Transmission dosimetry with a liquid-filled electronic portal imaging device

International Nuclear Information System (INIS)

Boellaard, R.; Van Herk, M.; Mijnheer, B.J.

1995-01-01

The aim of transmission dosimetry is to correlate transmission dose values with patient dose values. A liquid-filled electronic portal imaging device (EPID) has been developed. After determination of the dose response relationship, i.e. the relation between pixel value and dose rate, for clinical situations it was found that the EPID is applicable for two-dimensional dosimetry with an accuracy of about 1%. The aim of this study was to investigate transmission dose distributions at different phantom-detector distances to predict exit dose distributions from transmission dose images. An extensive set of transmission dose measurements below homogeneous phantoms were performed with the EPID. The influence of several parameters such as field size, phantom thickness, phantom-detector distance and phantom-source distance on the transmission dose and its distribution were investigated. The two-dimensional transmission dose images were separated into two components: a primary dose and a scattered dose distribution. It was found that the scattered dose is maximal at a phantom thickness of about 10 cm. The scattered dose distribution below a homogeneous phantom has a Gaussian shape. The width of the Gaussian is small at small phantom-detector distances and increases for larger phantom-detector distances. The dependence of the scattered dose distribution on the field size at various phantom-detector distances has been used to estimate the dose distribution at the exit site of the phantom. More work is underway to determine the exit dose distributions for clinical situations, including the presence of inhomogeneities

Theoretical study of the transmission of low-energy (0-10 eV) electrons through thin-film organic molecular solids: benzene

International Nuclear Information System (INIS)

Goulet, T.; Jay-Gerin, J.-P.

1986-01-01

A theoretical study of the transmission of low-energy (0 to 10 eV) electrons incident from vacuum through thin-film organic molecular solids deposited on a cold metal substrate is presented and developed for the specific case of solid benzene. In essence, using a semiclassical description of electron transport in solids with an energy-independent scattering mean free path and assuming an isotropic electron scattering, the behavior of a penetrating electron in the film is simulated when a large number of scattering events are present. The good agreement between the calculated electron transmission spectra and those obtained experimentally indicates that our study provides a realistic description of the electron transport in the film, and accounts for the influence of the various electron-molecule scattering processes upon the energy dependence of the transmitted current. In particular, we show that the excitonic subionization energy losses are at the origin of the main structures of the observed electron transmission spectra. It is also shown that our study can successfully be used to estimate the probabilities of the various electron scattering processes which occur in the film, as well as the electron mean free path (l). For solid benzene, l is about 8 A in the considered electron energy range. (author)

Electron scattering from tetrahydrofuran

International Nuclear Information System (INIS)

Fuss, M C; Sanz, A G; García, G; Muñoz, A; Oller, J C; Blanco, F; Do, T P T; Brunger, M J; Almeida, D; Limão-Vieira, P

2012-01-01

Electron scattering from Tetrahydrofuran (C 4 H 8 O) was investigated over a wide range of energies. Following a mixed experimental and theoretical approach, total scattering, elastic scattering and ionization cross sections as well as electron energy loss distributions were obtained.

Electron diffraction patterns with thermal diffuse scattering maxima around Kikuchi lines

International Nuclear Information System (INIS)

Karakhanyan, R. K.; Karakhanyan, K. R.

2011-01-01

Transmission electron diffraction patterns of silicon with thermal diffuse maxima around Kikuchi lines, which are analogs of the maxima of thermal diffuse electron scattering around point reflections, have been recorded. Diffuse maxima are observed only around Kikuchi lines with indices that are forbidden for the silicon structure. The diffraction conditions for forming these maxima are discussed.

On the Progress of Scanning Transmission Electron Microscopy (STEM) Imaging in a Scanning Electron Microscope.

Science.gov (United States)

Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar

2018-04-01

Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.

Low energy electron scattering from fuels

International Nuclear Information System (INIS)

Lopes, M. Cristina A.; Silva, Daniel G.M.; Coelho, Rafael F.; Duque, Humberto V.; Santos, Rodrigo R. dos; Ribeiro, Thiago M.

2011-01-01

Full text. Accurate and precise values of absolute total cross section (TCS) represent important information in many scientific and technological applications. In our case, for example, we are motivated to provide such information for electron-fuel collision processes which are specifically relevant to modeling spark ignition in alcohol-fuelled internal combustion engines. Many electron scattering TCS measurements are presently available for a diverse range of atomic and molecular targets. However, lack of data for important bio-molecular targets still remains. Disagreements between the available TCS data for the alcohols have prompted several studies of electron scattering collision of slow electrons with these molecules which are currently important in applications as bio- fuels. This relevance, which has attracted much attention, has been one of the subjects of a recent collaboration between experimental and theoretical groups in the USA and Brazil. Recently this collaboration reported first measurements and calculations of differential cross sections for elastic low-energy (rotationally unresolved) electron scattering by several primary alcohols. In this work we address methanol and ethanol TCSs at low energy range and report additional studies of resonant structure in ethanol using the detection of metastable states produced by electron impact excitation with high energy resolution. We have recently constructed a TCS apparatus in our laboratory at Universidade Federal de Juiz de Fora, Brazil, based on the well-known linear transmission technique. The experimental setup is based on the measurement of the attenuation of a collimated electron beam through a gas cell containing the atoms or molecules to be studied at a given pressure. It consists essentially of an electron gun, a gas cell and an electron energy analyzer composed of an array of decelerating electrostatic lenses, a cylindrical dispersive 127o analyzer and a Faraday cup. To our knowledge, there exist

Low energy electron scattering from fuels

Energy Technology Data Exchange (ETDEWEB)

Lopes, M. Cristina A.; Silva, Daniel G.M.; Coelho, Rafael F.; Duque, Humberto V.; Santos, Rodrigo R. dos; Ribeiro, Thiago M. [Universidade Federal de Juiz de Fora (UFJF), MG (Brazil). Dept. de Fisica; Yates, Brent; Hong, Ling; Khakoo, Murtadha A. [California State University at Fullerton, CA (US). Physics Department; Bettega, Marcio H.F. [Universidade Federal do Parana (UFPR), Curitiba, PR (Brazil). Dept. de Fisica; Costa, Romarly F. da [Universidade Federal do ABC (UFABC), Santo Andre, SP (Brazil). Centro de Ciencias Naturais e Humanas; Lima, Marco A.P. [Laboratorio Nacional de Ciencia e Tecnologia do Bioetanol (CTBE/CNPEM), Campinas, SP (Brazil)

2011-07-01

Full text. Accurate and precise values of absolute total cross section (TCS) represent important information in many scientific and technological applications. In our case, for example, we are motivated to provide such information for electron-fuel collision processes which are specifically relevant to modeling spark ignition in alcohol-fuelled internal combustion engines. Many electron scattering TCS measurements are presently available for a diverse range of atomic and molecular targets. However, lack of data for important bio-molecular targets still remains. Disagreements between the available TCS data for the alcohols have prompted several studies of electron scattering collision of slow electrons with these molecules which are currently important in applications as bio- fuels. This relevance, which has attracted much attention, has been one of the subjects of a recent collaboration between experimental and theoretical groups in the USA and Brazil. Recently this collaboration reported first measurements and calculations of differential cross sections for elastic low-energy (rotationally unresolved) electron scattering by several primary alcohols. In this work we address methanol and ethanol TCSs at low energy range and report additional studies of resonant structure in ethanol using the detection of metastable states produced by electron impact excitation with high energy resolution. We have recently constructed a TCS apparatus in our laboratory at Universidade Federal de Juiz de Fora, Brazil, based on the well-known linear transmission technique. The experimental setup is based on the measurement of the attenuation of a collimated electron beam through a gas cell containing the atoms or molecules to be studied at a given pressure. It consists essentially of an electron gun, a gas cell and an electron energy analyzer composed of an array of decelerating electrostatic lenses, a cylindrical dispersive 127o analyzer and a Faraday cup. To our knowledge, there exist

Incoherent imaging using dynamically scattered coherent electrons

International Nuclear Information System (INIS)

Nellist, P.D.; Pennycook, S.J.

1999-01-01

We use a Bloch wave approach to show that, even for coherent dynamical scattering from a stationary lattice with no absorption, annular dark-field imaging in a scanning transmission electron microscope gives a direct incoherent structure image of the atomic-column positions of a zone-axis-aligned crystal. Although many Bloch waves may be excited by the probe, the detector provides a filtering effect so that the 1s-type bound states are found to dominate the image contrast for typical experimental conditions. We also find that the column intensity is related to the transverse kinetic energy of the 1s states, which gives atomic number, Z, contrast. The additional effects of phonon scattering are discussed, in particular the reasons why phonon scattering is not a prerequisite for transverse incoherence. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

Electron-electron scattering and mobilities in semiconductors and quantum wells

International Nuclear Information System (INIS)

Lyo, S.K.

1986-01-01

The effect of electron-electron scattering on the mobility in semiconductors and semiconductor quantum wells is examined. A general exact formula is derived for the mobility, when the electron-electron collision rate is much faster than other scattering rates such as those by ionized impurities and phonons. In this limit, the transport relaxation rate is independent of the carrier's energy and contributions to the inverse mobility from individual scattering mechanism add up. The mobility becomes significantly reduced from its value in the absence of electron-electron scattering. When the collision rates are not necessarily dominated by electron-electron scattering, the mobility is calculated by the Kohler-Sondheimer variational method in the presence of ionized-impurity scattering and acoustic-phonon scattering in a nondegenerate two-dimensional quantum well

High-intensity-laser-electron scattering

International Nuclear Information System (INIS)

Meyerhofer, D.D.

1997-01-01

In the field of an intense laser, photon-electron scattering becomes nonlinear when the oscillatory energy of the electron approaches its rest mass. The electron wave function is dressed by the field with a concomitant increase in the effective electron mass. When the photon energy in the electron rest frame is comparable to the electron rest mass, multiphoton Compton scattering occurs. When the photon energy is significantly lower than the electron rest mass, the electron acquires momentum from the photon field and emits harmonics. This paper reviews nonlinear photon-electron scattering processes and results from two recent experiments where they have been observed

Electron scattering for exotic nuclei

Indian Academy of Sciences (India)

2014-11-04

Nov 4, 2014 ... A brand-new electron scattering facility, the SCRIT Electron Scattering Facility, will soon start its operation at RIKEN RI Beam Factory, Japan. This is the world's first electron scattering facility dedicated to the structure studies of short-lived nuclei. The goal of this facility is to determine the charge density ...

On the theory of inelastic scattering of slow electrons by surface excitations: 1. Half-space formalism

International Nuclear Information System (INIS)

Nkoma, J.S.

1982-08-01

A quantum-mechanical theory for the inelastic scattering of slow electrons (ISSE) by surface excitations is developed within the half-space model. The process of transmission of incident electrons into the crystal is described by the homogeneous Schroedinger equation, while the scattering process inside the crystal is described by an inhomogeneous Schroedinger equation. The scattering cross-section for ISSE by surface excitations is derived and is found to be small since it is dependent on an inverse sum of wavevectors which is large. It is also dependent on the fluctuations in the scattering potential. (author)

Interaction of electrons with light metal hydrides in the transmission electron microscope.

Science.gov (United States)

Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei

2014-12-01

Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Reflective small angle electron scattering to characterize nanostructures on opaque substrates

Science.gov (United States)

Friedman, Lawrence H.; Wu, Wen-Li; Fu, Wei-En; Chien, Yunsan

2017-09-01

Feature sizes in integrated circuits (ICs) are often at the scale of 10 nm and are ever shrinking. ICs appearing in today's computers and hand held devices are perhaps the most prominent examples. These smaller feature sizes demand equivalent advances in fast and accurate dimensional metrology for both development and manufacturing. Techniques in use and continuing to be developed include X-ray based techniques, optical scattering, and of course the electron and scanning probe microscopy techniques. Each of these techniques has their advantages and limitations. Here, the use of small angle electron beam scattering measurements in a reflection mode (RSAES) to characterize the dimensions and the shape of nanostructures on flat and opaque substrates is demonstrated using both experimental and theoretical evidence. In RSAES, focused electrons are scattered at angles smaller than 1 ° with the assistance of electron optics typically used in transmission electron microscopy. A proof-of-concept experiment is combined with rigorous electron reflection simulations to demonstrate the efficiency and accuracy of RSAES as a method of non-destructive measurement of shapes of features less than 10 nm in size on flat and opaque substrates.

Future of Electron Scattering and Diffraction

Energy Technology Data Exchange (ETDEWEB)

Hall, Ernest [GE Global Research, Niskayuna, New York (United States); Stemmer, Susanne [Univ. of California, Santa Barbara, CA (United States); Zheng, Haimei [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Zhu, Yimei [Brookhaven National Lab. (BNL), Upton, NY (United States); Maracas, George [Dept. of Energy (DOE), Washington DC (United States). Office of Science

2014-02-25

spectroscopy with high spatial resolution without damaging their structure. The strong interaction of electrons with matter allows high-energy electron pulses to gather structural information before a sample is damaged. Electron ScatteringImaging, diffraction, and spectroscopy are the fundamental capabilities of electron-scattering instruments. The DOE BES-funded TEAM (Transmission Electron Aberration-corrected Microscope) project achieved unprecedented sub-atomic spatial resolution in imaging through aberration-corrected transmission electron microscopy. To further advance electron scattering techniques that directly enable groundbreaking science, instrumentation must advance beyond traditional two-dimensional imaging. Advances in temporal resolution, recording the full phase and energy spaces, and improved spatial resolution constitute a new frontier in electron microscopy, and will directly address the BES Grand Challenges, such as to “control the emergent properties that arise from the complex correlations of atomic and electronic constituents” and the “hidden states” “very far away from equilibrium”. Ultrafast methods, such as the pump-probe approach, enable pathways toward understanding, and ultimately controlling, the chemical dynamics of molecular systems and the evolution of complexity in mesoscale and nanoscale systems. Central to understanding how to synthesize and exploit functional materials is having the ability to apply external stimuli (such as heat, light, a reactive flux, and an electrical bias) and to observe the resulting dynamic process in situ and in operando, and under the appropriate environment (e.g., not limited to UHV conditions). To enable revolutionary advances in electron scattering and science, the participants of the workshop recommended three major new instrumental developments: A. Atomic-Resolution Multi-Dimensional Transmission Electron Microscope: This instrument would provide quantitative information over the entire real space

On the theory of inelastic scattering of slow electrons by surface excitations: 2. Thin film formalism

International Nuclear Information System (INIS)

Nkoma, J.S.

1982-08-01

A quantum-mechanical theory for the inelastic scattering of slow electrons (ISSE) by surface excitations in a thin film is developed. The scattered wave function inside the thin film is obtained by solving the inhomogeneous Schroedinger equation, and it is found to contain terms which show that the back scattered intensity is smaller than the forward scattered intensity. A scattering cross-section for forward scattering is derived and is found to be dependent on transmission factors, wavevectors and fluctuations of the scattering potential. (author)

Ultrafast electron-optical phonon scattering and quasiparticle lifetime in CVD-grown graphene.

Science.gov (United States)

Shang, Jingzhi; Yu, Ting; Lin, Jianyi; Gurzadyan, Gagik G

2011-04-26

Ultrafast quasiparticle dynamics in graphene grown by chemical vapor deposition (CVD) has been studied by UV pump/white-light probe spectroscopy. Transient differential transmission spectra of monolayer graphene are observed in the visible probe range (400-650 nm). Kinetics of the quasiparticle (i.e., low-energy single-particle excitation with renormalized energy due to electron-electron Coulomb, electron-optical phonon (e-op), and optical phonon-acoustic phonon (op-ap) interactions) was monitored with 50 fs resolution. Extending the probe range to near-infrared, we find the evolution of quasiparticle relaxation channels from monoexponential e-op scattering to double exponential decay due to e-op and op-ap scattering. Moreover, quasiparticle lifetimes of mono- and randomly stacked graphene films are obtained for the probe photon energies continuously from 1.9 to 2.3 eV. Dependence of quasiparticle decay rate on the probe energy is linear for 10-layer stacked graphene films. This is due to the dominant e-op intervalley scattering and the linear density of states in the probed electronic band. A dimensionless coupling constant W is derived, which characterizes the scattering strength of quasiparticles by lattice points in graphene.

Characterization of duplex stainless steels by TEM [transmission electron microscopy], SANS [small-angle neutron scattering], and APFIM [atom-probe field ion microscopy] techniques

International Nuclear Information System (INIS)

Chung, H.M.; Chopra, O.K.

1987-06-01

Results are presented of complementary characterization of aged duplex stainless steels by advanced metallographic techniques, including transmission and high-voltage electron microscopies; small-angle neutron scattering; and atom-probe field ion microscopy. On the basis of the characterization, the mechanisms of aging embrittlement have been shown to be associated with the precipitation of Ni- and Si-rich G phase and Cr-rich α' in the ferrite, and M 23 C 6 carbides on the austenite-ferrite phase boundaries. 19 refs., 19 figs., 1 tab

Transmission Electron Microscopy and Diffractometry of Materials

CERN Document Server

Fultz, Brent

2013-01-01

This book explains concepts of transmission electron microscopy (TEM) and x-ray diffractometry (XRD) that are important for the characterization of materials. The fourth edition adds important new techniques of TEM such as electron tomography, nanobeam diffraction, and geometric phase analysis. A new chapter on neutron scattering completes the trio of x-ray, electron and neutron diffraction. All chapters were updated and revised for clarity. The book explains the fundamentals of how waves and wavefunctions interact with atoms in solids, and the similarities and differences of using x-rays, electrons, or neutrons for diffraction measurements. Diffraction effects of crystalline order, defects, and disorder in materials are explained in detail. Both practical and theoretical issues are covered. The book can be used in an introductory-level or advanced-level course, since sections are identified by difficulty. Each chapter includes a set of problems to illustrate principles, and the extensive Appendix includes la...

Energy-weighted dynamical scattering simulations of electron diffraction modalities in the scanning electron microscope.

Science.gov (United States)

Pascal, Elena; Singh, Saransh; Callahan, Patrick G; Hourahine, Ben; Trager-Cowan, Carol; Graef, Marc De

2018-04-01

Transmission Kikuchi diffraction (TKD) has been gaining momentum as a high resolution alternative to electron back-scattered diffraction (EBSD), adding to the existing electron diffraction modalities in the scanning electron microscope (SEM). The image simulation of any of these measurement techniques requires an energy dependent diffraction model for which, in turn, knowledge of electron energies and diffraction distances distributions is required. We identify the sample-detector geometry and the effect of inelastic events on the diffracting electron beam as the important factors to be considered when predicting these distributions. However, tractable models taking into account inelastic scattering explicitly are lacking. In this study, we expand the Monte Carlo (MC) energy-weighting dynamical simulations models used for EBSD [1] and ECP [2] to the TKD case. We show that the foil thickness in TKD can be used as a means of energy filtering and compare band sharpness in the different modalities. The current model is shown to correctly predict TKD patterns and, through the dictionary indexing approach, to produce higher quality indexed TKD maps than conventional Hough transform approach, especially close to grain boundaries. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Bremsstrahlung in electron-positronium scattering

International Nuclear Information System (INIS)

Amusia, M.Ya.; Korol, A.V.; Solovyov, A.V.

1986-01-01

The spectrum of radiation formed in the fast nonrelativistic electron scattering on positronium is calculated. It is shown that all the radiation proceeds via virtual positronium deformations during the collision. An essential difference of bremsstrahlung spectra in electron on positronium and electron on hydrogen scattering is demonstrated. (orig.)

Diffusive scattering of electrons by electron holes around injection fronts

Science.gov (United States)

Vasko, I. Y.; Agapitov, O. V.; Mozer, F. S.; Artemyev, A. V.; Krasnoselskikh, V. V.; Bonnell, J. W.

2017-03-01

Van Allen Probes have detected nonlinear electrostatic spikes around injection fronts in the outer radiation belt. These spikes include electron holes (EH), double layers, and more complicated solitary waves. We show that EHs can efficiently scatter electrons due to their substantial transverse electric fields. Although the electron scattering driven by EHs is diffusive, it cannot be evaluated via the standard quasi-linear theory. We derive analytical formulas describing local electron scattering by a single EH and verify them via test particle simulations. We show that the most efficiently scattered are gyroresonant electrons (crossing EH on a time scale comparable to the local electron gyroperiod). We compute bounce-averaged diffusion coefficients and demonstrate their dependence on the EH spatial distribution (latitudinal extent and spatial filling factor) and individual EH parameters (amplitude of electrostatic potential, velocity, and spatial scales). We show that EHs can drive pitch angle scattering of ≲5 keV electrons at rates 10-2-10-4 s-1 and, hence, can contribute to electron losses and conjugated diffuse aurora brightenings. The momentum and pitch angle scattering rates can be comparable, so that EHs can also provide efficient electron heating. The scattering rates driven by EHs at L shells L ˜ 5-8 are comparable to those due to chorus waves and may exceed those due to electron cyclotron harmonics.

Electron scattering on molecular hydrogen

International Nuclear Information System (INIS)

Wingerden, B. van.

1980-01-01

The author considers scattering phenomena which occur when a beam of electrons interacts with a molecular hydrogen gas of low density. Depending on the energy loss of the scattered electrons one can distinguish elastic scattering, excitation and (auto)ionization of the H 2 -molecule. The latter processes may also lead to dissociation. These processes are investigated in four experiments in increasing detail. (Auth.)

Transmission electron microscopy and Raman characterization of copper (I) oxide microspheres composed of nanoparticles

International Nuclear Information System (INIS)

Wang Wenzhong; Tu Ya; Wang Lijuan; Liang Yujie; Shi Honglong

2013-01-01

Highlights: ► Raman spectroscopy of copper (I) oxide microspheres were investigated. ► Infrared active mode is greatly activated in Raman scattering spectrum. ► Infrared active mode shows up in Raman spectrum of copper (I) oxide microspheres. ► The defects existed in spheres could be responsible for the observed Raman property. - Abstract: The high-resolution transmission electron microscope and Raman spectroscopy were used to investigate the microstructures and Raman scattering property of copper (I) oxide microspheres composed of nanoparticles. High-resolution transmission electron microscope images indicate that the copper (I) oxide microspheres are composed of nanoparticles with random growth direction, indicating that there are many defects in microspheres. The Raman spectrum shows that infrared active mode, which must be odd parity and is Raman forbidden for bulk crystal due to its inversion symmetry, is activated and shows up in Raman scattering spectrum. On the basis of investigations of the microstructure features of copper (I) oxide microspheres, we attribute the appearance of IR active mode in Raman scattering spectrum to the breakdown of the symmetry of the lattice due to the presence of defects in the prepared copper (I) oxide microspheres as observed in HRTEM images.

Electron scattering for exotic nuclei

International Nuclear Information System (INIS)

Suda, T.

2013-01-01

An electron scattering facility is under construction in RIKEN RI Beam Factory, Japan, which is dedicated to the structure studies of short-lived nuclei. This is the world's first and currently only facility of its type. The construction is nearly completed, and the first electron scattering experiment off short-lived nuclei will be carried out in the beginning of next year. The charge density distributions of short-lived nuclei will be precisely determined by elastic electron scattering for the first time. Physics pursued at this facility including future perspectives are explained

Electron scattering by molecular oxygen

International Nuclear Information System (INIS)

Duddy, P.E.

1999-03-01

Collisions of electrons with molecules is one of the fundamental processes which occur both in atomic and molecular physics and also in chemistry. These collisions are vital in determining the energy balance and transport properties of electrons in gases and plasmas at low temperatures. There are many important applications for the basic understanding of these collision processes. For example, the study of planetary atmospheres and the interstellar medium involves electron collisions with both molecules and molecular ions. In particular, two of the major cooling mechanisms of electrons in the Earth's ionosphere are (i) the fine structure changing transitions of oxygen atoms by electron impact and (ii) the resonant electron-impact vibrational excitation of N 2 . Other applications include magnetohydrodynamic power generation and laser physics. A molecule, by definition, will contain more than one nucleus and consequently the effect of nuclear motion in the molecule leads to many extra processes in electron scattering by molecules which cannot occur in electron-atom scattering. As for atoms, both elastic and inelastic scattering occur, but in the case of inelastic electron scattering by molecules, the target molecule is excited to a different state by the process. The excitation may be one, or some combination, of rotational, vibrational and electronic transitions. Other reactions which may occur include dissociation of the molecule into its constituent atoms or ionisation. Another difficulty arises when considering the interactions between the electron and the molecule, This interaction, which considerably complicates the calculation, is non-spherical and various methods have been developed over the years to represent this interaction. This thesis considers electron scattering by molecular oxygen in the low energy range i.e. 0-15eV. These collisions are of considerable interest in atmospheric physics and chemistry where the electron impact excitation of O 2 has

High-resolution imaging in the scanning transmission electron microscope

International Nuclear Information System (INIS)

Pennycook, S.J.; Jesson, D.E.

1992-03-01

The high-resolution imaging of crystalline materials in the scanning transmission electron microscopy (STEM) is reviewed with particular emphasis on the conditions under which an incoherent image can be obtained. It is shown that a high-angle annular detector can be used to break the coherence of the imaging process, in the transverse plane through the geometry of the detector, or in three dimensions if multiphonon diffuse scattering is detected. In the latter case, each atom can be treated as a highly independent source of high-angle scattering. The most effective fast electron states are therefore tightly bound s-type Bloch states. Furthermore, they add constructively for each incident angle in the coherent STEM probe, so that s states are responsible for practically the entire image contrast. Dynamical effects are largely removed, and almost perfect incoherent imaging is achieved. s states are relatively insensitive to neighboring strings, so that incoherent imaging is maintained for superlattice and interfaces, and supercell calculations are unnecessary. With an optimum probe profile, the incoherent image represents a direct image of the crystal projection, with compositional sensitivity built in through the strong dependence of the scattering cross sections on atomic number Z

Total electron scattering cross sections for methanol and ethanol at intermediate energies

International Nuclear Information System (INIS)

Silva, D G M; Tejo, T; Lopes, M C A; Muse, J; Romero, D; Khakoo, M A

2010-01-01

Absolute total cross section (TCS) measurements of electron scattering from gaseous methanol and ethanol molecules are reported for impact energies from 60 to 500 eV, using the linear transmission method. The attenuation of intensity of a collimated electron beam through the target volume is used to determine the absolute TCS for a given impact energy, using the Beer-Lambert law to first approximation. Besides these experimental measurements, we have also determined TCS using the additivity rule.

[Inelastic electron scattering from surfaces

International Nuclear Information System (INIS)

1993-01-01

This program uses ab-initio and multiple scattering to study surface dynamical processes; high-resolution electron-energy loss spectroscopy is used in particular. Off-specular excitation cross sections are much larger if electron energies are in the LEED range (50--300 eV). The analyses have been extended to surfaces of ordered alloys. Phonon eigenvectors and eigenfrequencies were used as inputs to electron-energy-loss multiple scattering cross section calculations. Work on low-energy electron and positron holography is mentioned

Calculation of electron-helium scattering

International Nuclear Information System (INIS)

Fursa, D.V.; Bray, I.

1994-11-01

We present the Convergent Close-Coupling (CCC) theory for the calculation of electron-helium scattering. We demonstrate its applicability at a range of projectile energies of 1.5 to 500 eV to scattering from the ground state to n ≤3 states. Excellent agreement with experiment is obtained with the available differential, integrated, ionization, and total cross sections, as well as with the electron-impact coherence parameters up to and including the 3 3 D state excitation. Comparison with other theories demonstrates that the CCC theory is the only general reliable method for the calculation of electron helium scattering. (authors). 66 refs., 2 tabs., 24 figs

Electron Scattering From Atoms, Molecules, Nuclei, and Bulk Matter

CERN Document Server

Whelan, Colm T

2005-01-01

Topics that are covered include electron scattering in the scanning TEM; basic theory of inelastic electron imaging; study of confined atoms by electron excitation; helium bubbles created in extreme pressure with application to nuclear safety; lithium ion implantation; electron and positron scattering from clusters; electron scattering from physi- and chemi-absorbed molecules on surfaces; coincidence studies; electron scattering from biological molecules; electron spectroscopy as a tool for environmental science; electron scattering in the presence of intense fields; electron scattering from astrophysical molecules; electon interatctions an detection of x-ray radiation.

Electron scattering on metal clusters and fullerenes

International Nuclear Information System (INIS)

Solov'yov, A.V.

2001-01-01

This paper gives a survey of physical phenomena manifesting themselves in electron scattering on atomic clusters. The main emphasis is made on electron scattering on fullerenes and metal clusters, however some results are applicable to other types of clusters as well. This work is addressed to theoretical aspects of electron-cluster scattering, however some experimental results are also discussed. It is demonstrated that the electron diffraction plays important role in the formation of both elastic and inelastic electron scattering cross sections. It is elucidated the essential role of the multipole surface and volume plasmon excitations in the formation of electron energy loss spectra on clusters (differential and total, above and below ionization potential) as well as the total inelastic scattering cross sections. Particular attention is paid to the elucidation of the role of the polarization interaction in low energy electron-cluster collisions. This problem is considered for electron attachment to metallic clusters and the plasmon enhanced photon emission. Finally, mechanisms of electron excitation widths formation and relaxation of electron excitations in metal clusters and fullerenes are discussed. (authors)

Role of electron-electron scattering on spin transport in single layer graphene

Directory of Open Access Journals (Sweden)

Bahniman Ghosh

2014-01-01

Full Text Available In this work, the effect of electron-electron scattering on spin transport in single layer graphene is studied using semi-classical Monte Carlo simulation. The D’yakonov-P’erel mechanism is considered for spin relaxation. It is found that electron-electron scattering causes spin relaxation length to decrease by 35% at 300 K. The reason for this decrease in spin relaxation length is that the ensemble spin is modified upon an e-e collision and also e-e scattering rate is greater than phonon scattering rate at room temperature, which causes change in spin relaxation profile due to electron-electron scattering.

The effect of scattering on single photon transmission of optical angular momentum

International Nuclear Information System (INIS)

Andrews, D L

2011-01-01

Schemes for the communication and registration of optical angular momentum depend on the fidelity of transmission between optical system components. It is known that electron spin can be faithfully relayed between exciton states in quantum dots; it has also been shown by several theoretical and experimental studies that the use of beams conveying orbital angular momentum can significantly extend the density and efficiency of such information transfer. However, it remains unclear to what extent the operation of such a concept at the single photon level is practicable—especially where this involves optical propagation through a material system, in which forward scattering events can intervene. The possibility of transmitting and decoding angular momentum over nanoscale distances itself raises other important issues associated with near-field interrogation. This paper provides a framework to address these and related issues. A quantum electrodynamical representation is constructed and used to pursue the consequences of individual photons, from a Laguerre–Gaussian beam, undergoing single and multiple scattering events in the course of propagation. In this context, issues concerning orbital angular momentum conservation, and its possible compromise, are tackled by identifying the relevant components of the electromagnetic scattering and coupling tensors, using an irreducible Cartesian basis. The physical interpretation broadly supports the fidelity of quantum information transmission, but it also identifies potential limitations of principle

The effect of scattering on single photon transmission of optical angular momentum

Science.gov (United States)

Andrews, D. L.

2011-06-01

Schemes for the communication and registration of optical angular momentum depend on the fidelity of transmission between optical system components. It is known that electron spin can be faithfully relayed between exciton states in quantum dots; it has also been shown by several theoretical and experimental studies that the use of beams conveying orbital angular momentum can significantly extend the density and efficiency of such information transfer. However, it remains unclear to what extent the operation of such a concept at the single photon level is practicable—especially where this involves optical propagation through a material system, in which forward scattering events can intervene. The possibility of transmitting and decoding angular momentum over nanoscale distances itself raises other important issues associated with near-field interrogation. This paper provides a framework to address these and related issues. A quantum electrodynamical representation is constructed and used to pursue the consequences of individual photons, from a Laguerre-Gaussian beam, undergoing single and multiple scattering events in the course of propagation. In this context, issues concerning orbital angular momentum conservation, and its possible compromise, are tackled by identifying the relevant components of the electromagnetic scattering and coupling tensors, using an irreducible Cartesian basis. The physical interpretation broadly supports the fidelity of quantum information transmission, but it also identifies potential limitations of principle.

Validations of calibration-free measurements of electron temperature using double-pass Thomson scattering diagnostics from theoretical and experimental aspects

Energy Technology Data Exchange (ETDEWEB)

Tojo, H., E-mail: tojo.hiroshi@qst.go.jp; Hiratsuka, J.; Yatsuka, E.; Hatae, T.; Itami, K. [National Institutes for Quantum and Radiological Science and Technology, 801-1 Mukoyama, Naka 311-0193 (Japan); Yamada, I.; Yasuhara, R.; Funaba, H.; Hayashi, H. [National Institute for Fusion Science, 322-6 Oroshi-cho, Toki 509-5292 (Japan); Ejiri, A.; Togashi, H.; Takase, Y. [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa 277-8561 (Japan)

2016-09-15

This paper evaluates the accuracy of electron temperature measurements and relative transmissivities of double-pass Thomson scattering diagnostics. The electron temperature (T{sub e}) is obtained from the ratio of signals from a double-pass scattering system, then relative transmissivities are calculated from the measured T{sub e} and intensity of the signals. How accurate the values are depends on the electron temperature (T{sub e}) and scattering angle (θ), and therefore the accuracy of the values was evaluated experimentally using the Large Helical Device (LHD) and the Tokyo spherical tokamak-2 (TST-2). Analyzing the data from the TST-2 indicates that a high T{sub e} and a large scattering angle (θ) yield accurate values. Indeed, the errors for scattering angle θ = 135° are approximately half of those for θ = 115°. The method of determining the T{sub e} in a wide T{sub e} range spanning over two orders of magnitude (0.01–1.5 keV) was validated using the experimental results of the LHD and TST-2. A simple method to provide relative transmissivities, which include inputs from collection optics, vacuum window, optical fibers, and polychromators, is also presented. The relative errors were less than approximately 10%. Numerical simulations also indicate that the T{sub e} measurements are valid under harsh radiation conditions. This method to obtain T{sub e} can be considered for the design of Thomson scattering systems where there is high-performance plasma that generates harsh radiation environments.

Continuum multiple-scattering approach to electron-molecule scattering and molecular photoionization

International Nuclear Information System (INIS)

Dehmer, J.L.; Dill, D.

1979-01-01

The multiple-scattering approach to the electronic continuum of molecules is described. The continuum multiple-scattering model (CMSM) was developed as a survey tool and, as such was required to satisfy two requirements. First, it had to have a very broad scope, which means (i) molecules of arbitrary geometry and complexity containing any atom in the periodic system, (ii) continuum electron energies from 0-1000 eV, and (iii) capability to treat a large range of processes involving both photoionization and electron scattering. Second, the structure of the theory was required to lend itself to transparent, physical interpretation of major spectral features such as shape resonances. A comprehensive theoretical framework for the continuum multiple scattering method is presented, as well as its applications to electron-molecule scattering and molecular photoionization. Highlights of recent applications in these two areas are reviewed. The major impact of the resulting studies over the last few years has been to establish the importance of shape resonances in electron collisions and photoionization of practically all (non-hydride) molecules

Principle of energy-filtering transmission electron microscopy and its applications

International Nuclear Information System (INIS)

Kurata, Hiroki

1997-01-01

Energy-filtering transmission electron microscopy (EFTEM) is widely used to make images and diffraction patterns more quantitative by removing the inelastic background, and to perform elemental and chemical mapping at high spatial resolution. The principal factors restricting the spatial resolution in elemental maps are discussed. The relativistic effect on inelastic scattering cross-section, which becomes significant for high-voltage EFTEM analysis, is also discussed in relation to the detection efficiency of core-loss signals. (author)

Ab initio transmission electron microscopy image simulations of coherent Ag-MgO interfaces

International Nuclear Information System (INIS)

Mogck, S.; Kooi, B.J.; Hosson, J.Th.M. de; Finnis, M.W.

2004-01-01

Density-functional theory calculations, within the plane-wave-ultrasoft pseudopotential framework, were performed in the projection for MgO and for the coherent (111) Ag-MgO polar interface. First-principles calculations were incorporated in high-resolution transmission electron microscopy (HRTEM) simulations by converting the charge density into electron scattering factors to examine the influence of charge transfer, charge redistribution at the interface, and ionicity on the dynamical electron scattering and on calculated HRTEM images. It is concluded that the ionicity of oxides and the charge redistribution at interfaces play a significant role in HRTEM image simulations. In particular, the calculations show that at oxygen-terminated (111) Ag-MgO interfaces the first oxygen layer at the interface is much brighter than that in calculations with neutral atoms, in agreement with experimental observations

Photons emission processes in electron scattering

International Nuclear Information System (INIS)

Soto Vargas, C.W.

1996-01-01

The investigations involving the scattering sections arising in virtual an real photon emission processes of electron and positron scattering by an atomic nucleus, have the need for thorough and complete calculations of the virtual photon spectrum and then introduce the distorted wave formulation, which is mathematically involved an numerically elaborated, but accessible to its use in experimental electron scattering facilities. (author) [es

Compton profiles by inelastic ion-electron scattering

International Nuclear Information System (INIS)

Boeckl, H.; Bell, F.

1983-01-01

It is shown that Compton profiles (CP) can be measured by inelastic ion-electron scattering. Within the impulse approximation the binary-encounter peak (BEP) reflects the CP of the target atom whereas the electron-loss peak (ELP) is given by projectile CP's. Evaluation of experimental data reveals that inelastic ion-electron scattering might be a promising method to supply inelastic electron or photon scattering for the determination of target CP's. The measurement of projectile CP's is unique to ion scattering since one gains knowledge about wave-function effects because of the high excitation degree of fast heavy-ion projectiles

Retrieval of the projected potential by inversion from the scattering matrix in electron-crystal scattering

International Nuclear Information System (INIS)

Allen, L.J.; Spargo, A.E.C.; Leeb, H.

1998-01-01

The retrieval of a unique crystal potential from the scattering matrix S in high energy transmission electron diffraction is discussed. It is shown that, in general, data taken at a single orientation are not sufficient to determine all the elements of S. Additional measurements with tilted incident beam are required for the determination of the whole S-matrix. An algorithm for the extraction of the crystal potential from the S-matrix measured at a single energy and thickness is presented. The limiting case of thin crystals is discussed. Several examples with simulated data are considered

Electron scattering by trapped fermionic atoms

International Nuclear Information System (INIS)

Wang Haijun; Jhe, Wonho

2002-01-01

Considering the Fermi gases of alkali-metal atoms that are trapped in a harmonic potential, we study theoretically the elastic and inelastic scattering of the electrons by the trapped Fermi atoms and present the corresponding differential cross sections. We also obtain the stopping power for the cases that the electronic state as well as the center-of-mass state are excited both separately and simultaneously. It is shown that the elastic scattering process is no longer coherent in contrast to the electron scattering by the atomic Bose-Einstein condensate (BEC). For the inelastic scattering process, on the other hand, the differential cross section is found to be proportional to the 2/3 power of the number of the trapped atoms. In particular, the trapped fermionic atoms display the effect of ''Fermi surface,'' that is, only the energy levels near the Fermi energy have dominant contributions to the scattering process. Moreover, it is found that the stopping power scales as the 7/6 power of the atomic number. These results are fundamentally different from those of the electron scattering by the atomic BEC, mainly due to the different statistics obeyed by the trapped atomic systems

Scatter and transmission doses from several pediatric X-ray examinations in a nursery

International Nuclear Information System (INIS)

Burrage, John W.; Rampant, Peter L.; Beeson, Brendan P.

2003-01-01

While several studies have investigated the dose from scattered radiation from X-ray procedures in a pediatric nursery, they examined scatter from chest procedures only, or the types of examination were not specified. The aim of this study was to collect scatter and transmission data from several types of X-ray examinations. Using a ''newborn'' anthropomorphic phantom and an ion chamber, a series of scatter and transmission dose measurements were performed using typical exposure factors for chest, chest and abdomen, skull, skeletal long bone and spine procedures. The phantom was inside a crib for all exposures. The maximum scatter dose measured at 1 m from the field center was about 0.05 μGy per exposure for lateral skulls. Transmission doses for lateral exams were around 0.1 μGy per exposure at 1 m from the isocenter. The study demonstrated that scatter dose to other patients in a neonatal unit is not significant, assuming the distance between adjacent cribs is in the order of 1 m. Transmission doses are also low provided the beam is fully intercepted by the cassette. For an average workload the dose received by imaging technologists would be small. (orig.)

Electron scattering by Ne, Ar and Kr at intermediate and high energies, 0.5-10 keV

Energy Technology Data Exchange (ETDEWEB)

Garcia, G.; Roteta, M.; Manero, F. [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas (CIEMAT), Departamento de Fusion y Particulas Elementales, Madrid (Spain); Blanco, F. [Universidad Complutense de Madrid, Facultad de Fisica, Departamento de Fisica Atomica Molecular y Nuclear, Madrid (Spain); Williart, A. [Universidad Nacional de Educacion a Distancia, Facultad de Ciencias, Departamento de Fisica de los Materiales, Madrid (Spain)

1999-04-28

Semi-empirical total cross sections for electron scattering of noble gases (Ne, Ar and Kr) in the energy range 0.5-10 keV have been obtained by combining transmission-beam measurements for impact energies up to 6 keV with an asymptotic behaviour at higher energies according to the Born-Bethe approximation. The influence of the forward electron scattering on the experimental system has been evaluated by means of a Monte Carlo electron transport simulation. Theoretical values have also been obtained by applying the Born approximation in the case of inelastic processes and by means of an atomic scattering potential for the elastic part. The results of these calculations show an excellent agreement with the semi-empirical values in the above-mentioned energy range. (author)

Parity violating asymmetries in polarized electron scattering

International Nuclear Information System (INIS)

Derman, E.; Marciano, W.J.

1979-01-01

We discuss parity violating asymmetries between the scattering of right and left-handed electrons on a variety of targets. Implications for gauge theories from recent SLAC results on deep-inelastic electron-deuterium and electron-proton scattering are examined. A derivation of the asymmetry for electron-electron scattering is given, its advantages are pointed out, and the feasibility of such a measurement is discussed. Other proposed or contemplated asymmetry experiments are reviewed and the necessity of including the Collins-Wilczek-Zee hadronic axial isoscalar current contribution in asymmetry predictions is noted

Schwinger–Keldysh canonical formalism for electronic Raman scattering

Energy Technology Data Exchange (ETDEWEB)

Su, Yuehua, E-mail: suyh@ytu.edu.cn

2016-03-01

Inelastic low-energy Raman and high-energy X-ray scatterings have made great progress in instrumentation to investigate the strong electronic correlations in matter. However, theoretical study of the relevant scattering spectrum is still a challenge. In this paper, we present a Schwinger–Keldysh canonical perturbation formalism for the electronic Raman scattering, where all the resonant, non-resonant and mixed responses are considered uniformly. We show how to use this formalism to evaluate the cross section of the electronic Raman scattering off an one-band superconductor. All the two-photon scattering processes from electrons, the non-resonant charge density response, the elastic Rayleigh scattering, the fluorescence, the intrinsic energy-shift Raman scattering and the mixed response, are included. In the mean-field superconducting state, Cooper pairs contribute only to the non-resonant response. All the other responses are dominated by the single-particle excitations and are strongly suppressed due to the opening of the superconducting gap. Our formalism for the electronic Raman scattering can be easily extended to study the high-energy resonant inelastic X-ray scattering.

Electron scattering from 36Ar and 40Ar

International Nuclear Information System (INIS)

Finn, J.M.

1975-01-01

The argon isotopes, 36 Ar and 40 Ar, have been investigated using electron scattering at the high-resolution Linac facilities of the National Bureau of Standards. Both elastic scattering and scattering to low-lying states have been observed. A high-pressure, low-volume gas target cell was designed and developed for this experiment. The cell features a transmission geometry and has resolution comparable to solid targets. Spectra were obtained at incident beam energies ranging from 65 to 115 MeV at scattering angles of 92.5 0 and 110 0 . Values obtained for the rms charge radii are 3.327 +- 0.015 and 3.393 +- 0.015 fm for 36 Ar and 40 Ar respectively. A sensitive measurement was made of the difference in the two radii yielding a value of Δ r = 0.079 +- 0.006 fm. The inelastic levels observed are the 1.97 (2 + ) and 4.18 MeV (3 - ) levels in 36 Ar, and the 1.46 (2 + ), 2.52 (2 + ), 3.21 (2 + ), and 3.68 MeV (3 - ) levels in 40 Ar. A Tassie model analysis was made of the inelastic transitions in the DWBA approximation and transition strengths of these levels were extracted

RAMAN LIGHT SCATTERING IN PSEUDOSPIN-ELECTRON MODEL AT STRONG PSEUDOSPIN-ELECTRON INTERACTION

Directory of Open Access Journals (Sweden)

T.S.Mysakovych

2004-01-01

Full Text Available Anharmonic phonon contributions to Raman scattering in locally anharmonic crystal systems in the framework of the pseudospin-electron model with tunneling splitting of levels are investigated. The case of strong pseudospin-electron coupling is considered. Pseudospin and electron contributions to scattering are taken into account. Frequency dependences of Raman scattering intensity for different values of model parameters and for different polarization of scattering and incident light are investigated.

Variational methods in electron-atom scattering theory

CERN Document Server

Nesbet, Robert K

1980-01-01

The investigation of scattering phenomena is a major theme of modern physics. A scattered particle provides a dynamical probe of the target system. The practical problem of interest here is the scattering of a low­ energy electron by an N-electron atom. It has been difficult in this area of study to achieve theoretical results that are even qualitatively correct, yet quantitative accuracy is often needed as an adjunct to experiment. The present book describes a quantitative theoretical method, or class of methods, that has been applied effectively to this problem. Quantum mechanical theory relevant to the scattering of an electron by an N-electron atom, which may gain or lose energy in the process, is summarized in Chapter 1. The variational theory itself is presented in Chapter 2, both as currently used and in forms that may facilitate future applications. The theory of multichannel resonance and threshold effects, which provide a rich structure to observed electron-atom scattering data, is presented in Cha...

Electron scattering from pyrimidine

International Nuclear Information System (INIS)

Colmenares, Rafael; Fuss, Martina C; García, Gustavo; Oller, Juan C; Muñoz, Antonio; Blanco, Francisco; Almeida, Diogo; Limão-Vieira, Paulo

2014-01-01

Electron scattering from pyrimidine (C 4 H 4 N 2 ) was investigated over a wide range of energies. Following different experimental and theoretical approaches, total, elastic and ionization cross sections as well as electron energy loss distributions were obtained.

Scattered radiation from applicators in clinical electron beams

International Nuclear Information System (INIS)

Battum, L J van; Zee, W van der; Huizenga, H

2003-01-01

In radiotherapy with high-energy (4-25 MeV) electron beams, scattered radiation from the electron applicator influences the dose distribution in the patient. In most currently available treatment planning systems for radiotherapy this component is not explicitly included and handled only by a slight change of the intensity of the primary beam. The scattered radiation from an applicator changes with the field size and distance from the applicator. The amount of scattered radiation is dependent on the applicator design and on the formation of the electron beam in the treatment head. Electron applicators currently applied in most treatment machines are essentially a set of diaphragms, but still do produce scattered radiation. This paper investigates the present level of scattered dose from electron applicators, and as such provides an extensive set of measured data. The data provided could for instance serve as example input data or benchmark data for advanced treatment planning algorithms which employ a parametrized initial phase space to characterize the clinical electron beam. Central axis depth dose curves of the electron beams have been measured with and without applicators in place, for various applicator sizes and energies, for a Siemens Primus, a Varian 2300 C/D and an Elekta SLi accelerator. Scattered radiation generated by the applicator has been found by subtraction of the central axis depth dose curves, obtained with and without applicator. Scattered radiation from Siemens, Varian and Elekta electron applicators is still significant and cannot be neglected in advanced treatment planning. Scattered radiation at the surface of a water phantom can be as high as 12%. Scattered radiation decreases almost linearly with depth. Scattered radiation from Varian applicators shows clear dependence on beam energy. The Elekta applicators produce less scattered radiation than those of Varian and Siemens, but feature a higher effective angular variance. The scattered

Experimental and Simulative Investigation of Laser Transmission Welding under Consideration of Scattering

Science.gov (United States)

Devrient, M.; Da, X.; Frick, T.; Schmidt, M.

Laser transmission welding is a well known joining technology for thermoplastics. Because of the needs of lightweight, cost effective and green production thermoplastics are usually filled with glass fibers. These lead to higher absorption and more scattering within the upper joining partner with a negative influence on the welding process. Here an experimental method for the characterization of the scattering behavior of semi crystalline thermoplastics filled with short glass fibers and a finite element model of the welding process capable to consider scattering as well as an analytical model are introduced. The experimental data is used for the numerical and analytical investigation of laser transmission welding under consideration of scattering. The scattering effects of several thermoplastics onto the calculated temperature fields as well as weld seam geometries are quantified.

Magnetic electron scattering

International Nuclear Information System (INIS)

Peterson, G.A.

1989-01-01

We briefly review some of the motivations, early results, and techniques of magnetic elastic and inelastic electron-nucleus scattering. We then discuss recent results, especially those acquired at high momentum transfers. 50 refs., 19 figs

Electron scattering studies by means of various nuclear models

International Nuclear Information System (INIS)

Essaniyazov, Sh.; Juraev, Sh.; Ismatov, E.I.

2006-01-01

Full text: Let us consider a general case of various interaction processes of electrons with nuclei. The study of the scattering o electrons of nuclei is the source of information on the structure of nuclei. At collision of fast electrons with nuclei, both elastic and inelastic scattering can be observed. Elastic scattering gives information on the sizes of nuclei, whereas the electrons inelastic scattering processes give important information on the dynamical properties of nuclei. In the first case, the characteristics of excited states, energy levels, their widths and others, and in the second case, momentum distribution of nucleons and other particles in nuclei are studied. Let us denote the momentum and the energy of the incident electron before and after the scattering as k and ε, and k' and ε', respectively. The angle between the vectors k and k' is denoted as θ. The scattering process is characterized by three parameters: k, k' and θ. However, it is convenient to introduce three other parameters instead of the indicated above. They are: energy ω ε - ε' and momentum q = k - k', transferred by electron at scattering, and the scattering angle θ. It is worth of mentioning the two reasons why the study of electron scattering is very effective tool to study the nuclear structure. First of all, the character of electron interaction with nucleus is a well-known electromagnetic interaction of electron with current and charge in nucleus. Secondly, this interaction is relatively weak (e 2 /ℎc) 2 = ω 2 is possible (since the photon mass is zero). In case of electrons, at fixed energy transfer ω various momentum transfer are possible. Therefore, at electron scattering study one can establish the dependence of the matrix elements of q, which are the Fourier-representations of the charge and current densities. Thus, it is possible to determine directly the spatial distribution of charge and current in nucleus. The inelastic scattering is accompanied by

Electroweak physics and electron scattering

International Nuclear Information System (INIS)

Henley, E.M.; Hwang, W.Y.P.

1988-01-01

The electroweak theory is developed and applied to electron scattering from nucleons and light nuclei. It is shown that these scatterings can be used to test the standard theory and probe structure effects. 33 refs., 5 figs

Magnetic effects in the paraxial regime of elastic electron scattering

Science.gov (United States)

Edström, Alexander; Lubk, Axel; Rusz, Ján

2016-11-01

Motivated by a recent claim [Phys. Rev. Lett. 116, 127203 (2016), 10.1103/PhysRevLett.116.127203] that electron vortex beams can be used to image magnetism at the nanoscale in elastic scattering experiments, using transmission electron microscopy, a comprehensive computational study is performed to study magnetic effects in the paraxial regime of elastic electron scattering in magnetic solids. Magnetic interactions from electron vortex beams, spin polarized electron beams, and beams with phase aberrations are considered, as they pass through ferromagnetic FePt or antiferromagnetic LaMnAsO. The magnetic signals are obtained by comparing the intensity over a disk in the diffraction plane for beams with opposite angular momentum or aberrations. The strongest magnetic signals are obtained from vortex beams with large orbital angular momentum, where relative magnetic signals above 10-3 are indicated for 10 ℏ orbital angular momentum, meaning that relative signals of one percent could be expected with the even larger orbital angular momenta, which have been produced in experimental setups. All results indicate that beams with low acceleration voltage and small convergence angles yield stronger magnetic signals, which is unfortunately problematic for the possibility of high spatial resolution imaging. Nevertheless, under atomic resolution conditions, relative magnetic signals in the order of 10-4 are demonstrated, corresponding to an increase with one order of magnitude compared to previous work.

Electron-atom scattering

International Nuclear Information System (INIS)

McCarthy, I.E.

1991-07-01

The coupled-channels-optical method has been implemented using two different approximations to the optical potential. The half-on-shell optical potential involves drastic approximations for numerical feasibility but still gives a good semiquantitative description of the effect of uncoupled channels on electron scattering from hydrogen, helium and sodium. The distorted-wave optical potential makes no approximations other than the weak coupling approximation for uncoupled channels. In applications to hydrogen and sodium it shows promise of describing scattering phenomena excellently at all energies. 27 refs., 5 figs

Inelastic scattering of fast electrons by crystals

International Nuclear Information System (INIS)

Allen, L.J.; Josefsson, T.W.

1995-01-01

Generalized fundamental equations for electron diffraction in crystals, which include the effect of inelastic scattering described by a nonlocal interaction, are derived. An expression is obtained for the cross section for any specific type of inelastic scattering (e.g. inner-shell ionization, Rutherford backscattering). This result takes into account all other (background) inelastic scattering in the crystal leading to absorption from the dynamical Bragg-reflected beams, in practice mainly due to thermal diffuse scattering. There is a contribution to the cross section from all absorbed electrons, which form a diffuse background, as well as from the dynamical electrons. The approximations involved, assuming that the interactions leading to inelastic scattering can be described by a local potential are discussed, together with the corresponding expression for the cross section. It is demonstrated by means of an example for K-shell electron energy loss spectroscopy that nonlocal effects can be significant. 47 refs., 4 figs

Electron-electron scattering in linear transport in two-dimensional systems

DEFF Research Database (Denmark)

Hu, Ben Yu-Kuang; Flensberg, Karsten

1996-01-01

We describe a method for numerically incorporating electron-electron scattering in quantum wells for small deviations of the distribution function from equilibrium, within the framework of the Boltzmann equation. For a given temperature T and density n, a symmetric matrix needs to be evaluated only...... once, and henceforth it can be used to describe electron-electron scattering in any Boltzmann equation linear-response calculation for that particular T and n. Using this method, we calculate the distribution function and mobility for electrons in a quantum well, including full finite...

Scattering of high energy electrons on deuteron

International Nuclear Information System (INIS)

Grossetete, B.

1964-12-01

The aim of this work is to obtain information on the neutron form factor from the study of the scattering of electrons on deuterium. The first part is dedicated to the theoretical study of the elastic and inelastic scattering. We introduce different form factors: Sachs form factor, the Pauli and Dirac form factors, they appear in the analytic expression of the scattering cross-section. We show how the deuteron form factors can be deduced from neutron's and proton's form factors. In the case of the inelastic scattering we show how the cross section can be broken into components associated to partial waves and we obtain different formulas for the inelastic cross-section based on the Breit formula or the Durand formalism. The second part is dedicated to the experiment setting of electron scattering on deuterium. The elastic scattering experiment has been made on solid or liquid CD 2 targets while inelastic scattering has been studied on a liquid target. We have used an electron beam produced by the Orsay linear accelerator and the scattered electrons have been analysed by a magnetic spectrometer and a Cerenkov detector. The results give a very low value (slightly positive)for the charge form factor of the neutron and a magnetic form factor for the neutron slightly below that of the proton [fr

Singularities of the transmission coefficient and anomalous scattering by a dielectric slab

Science.gov (United States)

Shestopalov, Yury

2018-03-01

We prove the existence and describe the distribution on the complex plane of the singularities, resonant states (RSs), of the transmission coefficient in the problem of the plane wave scattering by a parallel-plate dielectric slab in free space. It is shown that the transmission coefficient has isolated poles all with nonzero imaginary parts that form countable sets in the complex plane of the refraction index or permittivity of the slab with the only accumulation point at infinity. The transmission coefficient never vanishes and anomalous scattering, when its modulus exceeds unity, occurs at arbitrarily small loss of the dielectric filling the layer. These results are extended to the cases of scattering by arbitrary multi-layer parallel-plane media. Connections are established between RSs, spectral singularities, eigenvalues of the associated Sturm-Liouville problems on the line, and zeros of the corresponding Jost function.

Electron scattering off palladium isotopes

International Nuclear Information System (INIS)

Laan, J.B. van der.

1986-01-01

The low-lying states of the even Pd isotopes are characterized by vibrator-like properties. In this thesis the results of an electron scattering experiment on the Pd isotopes, designed to study the description of such nuclei in the Anharmonic Vibrator Model (AVM) and the Interacting Boson Approximation (IBA), are presented and discussed. Data have been taken at the high-resolution electron scattering facility of NIKHEF-K and covered a momentum-transfer range of 0.4 to 2.5 fm -1 . (Auth.)

Terahertz Plasma Waves in Two Dimensional Quantum Electron Gas with Electron Scattering

International Nuclear Information System (INIS)

Zhang Liping

2015-01-01

We investigate the Terahertz (THz) plasma waves in a two-dimensional (2D) electron gas in a nanometer field effect transistor (FET) with quantum effects, the electron scattering, the thermal motion of electrons and electron exchange-correlation. We find that, while the electron scattering, the wave number along y direction and the electron exchange-correlation suppress the radiation power, but the thermal motion of electrons and the quantum effects can amplify the radiation power. The radiation frequency decreases with electron exchange-correlation contributions, but increases with quantum effects, the wave number along y direction and thermal motion of electrons. It is worth mentioning that the electron scattering has scarce influence on the radiation frequency. These properties could be of great help to the realization of practical THz plasma oscillations in nanometer FET. (paper)

Protein aggregation studied by forward light scattering and light transmission analysis

Science.gov (United States)

Penzkofer, A.; Shirdel, J.; Zirak, P.; Breitkreuz, H.; Wolf, E.

2007-12-01

The aggregation of the circadian blue-light photo-receptor cryptochrome from Drosophila melanogaster (dCry) is studied by transmission and forward light scattering measurement in the protein transparent wavelength region. The light scattering in forward direction is caused by Rayleigh scattering which is proportional to the degree of aggregation. The light transmission through the samples in the transparent region is reduced by Mie light scattering in all directions. It depends on the degree of aggregation and the monomer volume fill factor of the aggregates (less total scattering with decreasing monomer volume fill factor of protein globule) allowing a distinction between tightly packed protein aggregation (monomer volume fill factor 1) and loosely packed protein aggregation (monomer volume fill factor less than 1). An increase in aggregation with temperature, concentration, and blue-light exposure is observed. At a temperature of 4 °C and a protein concentration of less than 0.135 mM no dCry aggregation was observed, while at 24 °C and 0.327 mM gelation occurred (loosely packed aggregates occupying the whole solution volume).

Effective exchange potentials for electronically inelastic scattering

International Nuclear Information System (INIS)

Schwenke, D.W.; Staszewska, G.; Truhlar, D.G.

1983-01-01

We propose new methods for solving the electron scattering close coupling equations employing equivalent local exchange potentials in place of the continuum-multiconfiguration-Hartree--Fock-type exchange kernels. The local exchange potentials are Hermitian. They have the correct symmetry for any symmetries of excited electronic states included in the close coupling expansion, and they have the same limit at very high energy as previously employed exchange potentials. Comparison of numerical calculations employing the new exchange potentials with the results obtained with the standard nonlocal exchange kernels shows that the new exchange potentials are more accurate than the local exchange approximations previously available for electronically inelastic scattering. We anticipate that the new approximations will be most useful for intermediate-energy electronically inelastic electron--molecule scattering

Stimulated Raman scattering and hot-electron production

International Nuclear Information System (INIS)

Drake, R.P.; Turner, R.E.; Lasinski, B.F.; Estabrook, K.G.; Campbell, E.M.; Wang, C.L.; Phillion, D.W.; Williams, E.A.; Kruer, W.L.

1985-01-01

High-intensity laser light can excite parametric instabilities that scatter or absorb it. One instability that can arise when laser light penetrates a plasma is sub-quarter-critical stimulated Raman (SQSR) scattering. It occurs below the quarter-critical density of the incident light and involves the decay of the incident light wave into a scattered light wave and electron plasma wave. The scattered-light wavelength ranges from 1 to 2 times that of the incident light, depending on the plasma density and temperature. This article reports studies of SQSR scattering and hot-electron production in plasmas produced by irradiating thick gold targets with up to 4 kJ of 0.53-μm light in 1-ns (FWHM) pulses. These studies have important implications for laser fusion. Hot electrons attributed to the SQSR instability can increase the difficulty of achieving high-gain implosions by penetrating and preheating the fusion fuel

Electron scattering in dense atomic and molecular gases: An empirical correlation of polarizability and electron scattering length

International Nuclear Information System (INIS)

Rupnik, K.; Asaf, U.; McGlynn, S.P.

1990-01-01

A linear correlation exists between the electron scattering length, as measured by a pressure shift method, and the polarizabilities for He, Ne, Ar, Kr, and Xe gases. The correlative algorithm has excellent predictive capability for the electron scattering lengths of mixtures of rare gases, simple molecular gases such as H 2 and N 2 and even complex molecular entities such as methane, CH 4

Probing mesoscopic crystals with electrons: One-step simultaneous inelastic and elastic scattering theory

Science.gov (United States)

Nazarov, Vladimir U.; Silkin, Vyacheslav M.; Krasovskii, Eugene E.

2017-12-01

Inelastic scattering of the medium-energy (˜10 -100 eV) electrons underlies the method of the high-resolution electron energy-loss spectroscopy (HREELS), which has been successfully used for decades to characterize pure and adsorbate-covered surfaces of solids. With the emergence of graphene and other quasi-two-dimensional (Q2D) crystals, HREELS could be expected to become the major experimental tool to study this class of materials. We, however, identify a critical flaw in the theoretical picture of the HREELS of Q2D crystals in the context of the inelastic scattering only ("energy-loss functions" formalism), in contrast to its justifiable use for bulk solids and surfaces. The shortcoming is the neglect of the elastic scattering, which we show is inseparable from the inelastic one, and which, affecting the spectra dramatically, must be taken into account for the meaningful interpretation of the experiment. With this motivation, using the time-dependent density functional theory for excitations, we build a theory of the simultaneous inelastic and elastic electron scattering at Q2D crystals. We apply this theory to HREELS of graphene, revealing an effect of the strongly coupled excitation of the π +σ plasmon and elastic diffraction resonances. Our results open a path to the theoretically interpretable study of the excitation processes in crystalline mesoscopic materials by means of HREELS, with its supreme resolution on the meV energy scale, which is far beyond the capacity of the now overwhelmingly used EELS in transmission electron microscopy.

Total cross sections for electron scattering by He

International Nuclear Information System (INIS)

De Heer, F.J.; Jansen, R.H.J.

1977-01-01

A set of total cross sections for scattering of electrons by He has been evaluated over the energy range of zero to 3000 eV by means of the analysis of experiments and theories on total cross sections for elastic scattering, ionisation and excitation, and on differential cross sections for elastic and inelastic scattering. Between 0 and 19.8 eV, where no inelastic processes occur, the total cross sections for scattering are equal to those for elastic scattering. Above 19.8 eV total cross sections for scattering of electrons have been evaluated by adding those for ionisation, excitation and elastic scattering. The total cross sections thus obtained are probably accurate to about 5% over a large part of the energy range. They appear to be in very good agreement with the recent experimental results of Blaauw et al. (J. Phys. B.; 10:L299 (1977)). The present results have already proved useful for application in the dispersion relation for forward scattering in electron-helium collisions. (author)

Angular momentum effects in electron scattering from atoms

International Nuclear Information System (INIS)

Williams, J F; Cvejanovie, D; Samarin, S; Pravica, L; Napier, S; Sergeant, A

2007-01-01

This paper concerns angular momentum-dependent phenomena in excited gas-phase atoms using incident photons or electrons in scattering experiments. A brief overview indicates the main capabilities of experimental techniques and the information which can be deduced about atomic structure and dynamics from conservation of momenta with measurement of polarization and detection of the number of emerging electrons, photons and ions. Maximum information may be obtained when the incident particles and the targets are state-selected both before and after scattering. The fundamental scattering amplitudes and their relative phases, and consequently derived quantities such as the parameters describing the electron charge cloud of the atomic target, have enabled significant advances of understanding of collision mechanisms. The angular momentum-dependent scattering probabilities change when, for example, the spin-orbit interaction for the target electrons becomes large compared with the Coulomb electron-electron interactions and also when electron exchange and the relative orientation of the electron spins change. Several examples are discussed to indicate significant principles and recent advances. Major contributions to this field from the technology associated with electron spin production and detection time, as well as time-coincidence detection, are discussed. New results from the authors' laboratory are presented

Electron states and electron Raman scattering in semiconductor double cylindrical quantum well wire

International Nuclear Information System (INIS)

Munguía-Rodríguez, M; Riera, R; Betancourt-Riera, Ri; Betancourt-Riera, Re; Nieto Jalil, J M

2016-01-01

The differential cross section for an electron Raman scattering process in a semiconductor GaAs/AlGaAs double quantum well wire is calculated, and expressions for the electronic states are presented. The system is modeled by considering T = 0 K and also with a single parabolic conduction band, which is split into a subband system due to the confinement. The gain and differential cross-section for an electron Raman scattering process are obtained. In addition, the emission spectra for several scattering configurations are discussed, and interpretations of the singularities found in the spectra are given. The electron Raman scattering studied here can be used to provide direct information about the efficiency of the lasers. (paper)

Atom electron scattering

International Nuclear Information System (INIS)

Santoso, B.

1976-01-01

Green Lippmann-Schwinger functions operator representations, derivation of perturbation method using Green function and atom electron scattering, are discussed. It is concluded that by using complex coordinate places where resonances occur, can be accurately identified. The resonance can be processed further for practical purposes, for example for the separation of atom. (RUW)

Transmission electron microscopy a textbook for materials science

CERN Document Server

Williams, David B

1996-01-01

Electron microscopy has revolutionized our understanding the extraordinary intellectual demands required of the mi­ of materials by completing the processing-structure-prop­ croscopist in order to do the job properly: crystallography, erties links down to atomistic levels. It now is even possible diffraction, image contrast, inelastic scattering events, and to tailor the microstructure (and meso structure ) of materials spectroscopy. Remember, these used to be fields in them­ to achieve specific sets of properties; the extraordinary abili­ selves. Today, one has to understand the fundamentals ties of modem transmission electron microscopy-TEM­ of all of these areas before one can hope to tackle signifi­ instruments to provide almost all of the structural, phase, cant problems in materials science. TEM is a technique of and crystallographic data allow us to accomplish this feat. characterizing materials down to the atomic limits. It must Therefore, it is obvious that any curriculum in modem mate­ be use...

Dynamic properties of electrons in solids by neutron scattering

International Nuclear Information System (INIS)

Lovesey, S.W.

1980-12-01

Illustrative cases of the use of neutron scattering in the study of the electronic properties of materials discussed here include scattering by localised electrons, narrow band materials and electron plasmas. (U.K.)

Density-dependent electron scattering in photoexcited GaAs

DEFF Research Database (Denmark)

Mics, Zoltán; D'’Angio, Andrea; Jensen, Søren A.

2013-01-01

—In a series of systematic optical pump - terahertz probe experiments we study the density-dependent electron scattering rate in photoexcited GaAs in a large range of carrier densities. The electron scattering time decreases by as much as a factor of 4, from 320 to 60 fs, as the electron density...

The effect of electron scattering from disordered grain boundaries on the resistivity of metallic nanostructures

International Nuclear Information System (INIS)

Arenas, Claudio; Henriquez, Ricardo; Moraga, Luis; Muñoz, Enrique; Munoz, Raul C.

2015-01-01

Highlights: • Quantum theory of the resistivity arising from electron-grain boundary scattering in nanometric metallic structures. • The resistivity is controlled by the collective properties of the grain assembly, by the allowed Kronig-Penney (KP) bands and by the electron transmission probability across successive grains. • When the grain diameter d is larger than the electron mean free path l, the increase in resistivity arises mainly from a decrease of the number of states at the Fermi surface that are allowed KP bands. • When the grain diameter d is smaller than the electron mean free path l, the increase in resistivity arises primarily from Anderson localization caused by electron transmission across successive grains. - Abstract: We calculate the electrical resistivity of a metallic specimen, under the combined effects of electron scattering by impurities, grain boundaries, and rough surfaces limiting the film, using a quantum theory based upon the Kubo formalism. Grain boundaries are represented by a one-dimensional periodic array of Dirac delta functions separated by a distance “d” giving rise to a Kronig–Penney (KP) potential. We use the Green's function built from the wave functions that are solutions of this KP potential; disorder is included by incorporating into the theory the probability that an electron is transmitted through several successive grain boundaries. We apply this new theory to analyze the resistivity of samples S1, S2, S7 and S8 measured between 4 and 300 K reported in Appl. Surf. Science273, 315 (2013). Although both the classical and the quantum theories predict a resistivity that agrees with experimental data to within a few percent or better, the phenomena giving rise to the increase of resistivity over the bulk are remarkably different. Classically, each grain boundary contributes to the electrical resistance by reflecting a certain fraction of the incoming electrons. In the quantum description, there are states

The effect of electron scattering from disordered grain boundaries on the resistivity of metallic nanostructures

Energy Technology Data Exchange (ETDEWEB)

Arenas, Claudio [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Blanco Encalada 2008, Casilla 487-3, Santiago 8370449 (Chile); Synopsys Inc., Avenida Vitacura 5250, Oficina 708, Vitacura, Santiago (Chile); Henriquez, Ricardo [Departamento de Física, Universidad Técnica Federico Santa María, Av. España 1680, Casilla 110-V, Valparaíso (Chile); Moraga, Luis [Universidad Central de Chile, Toesca 1783, Santiago (Chile); Muñoz, Enrique [Facultad de Física, Pontificia Universidad Católica de Chile, Casilla 306, Santiago 7820436 (Chile); Munoz, Raul C., E-mail: ramunoz@ing.uchile.cl [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Blanco Encalada 2008, Casilla 487-3, Santiago 8370449 (Chile)

2015-02-28

Highlights: • Quantum theory of the resistivity arising from electron-grain boundary scattering in nanometric metallic structures. • The resistivity is controlled by the collective properties of the grain assembly, by the allowed Kronig-Penney (KP) bands and by the electron transmission probability across successive grains. • When the grain diameter d is larger than the electron mean free path l, the increase in resistivity arises mainly from a decrease of the number of states at the Fermi surface that are allowed KP bands. • When the grain diameter d is smaller than the electron mean free path l, the increase in resistivity arises primarily from Anderson localization caused by electron transmission across successive grains. - Abstract: We calculate the electrical resistivity of a metallic specimen, under the combined effects of electron scattering by impurities, grain boundaries, and rough surfaces limiting the film, using a quantum theory based upon the Kubo formalism. Grain boundaries are represented by a one-dimensional periodic array of Dirac delta functions separated by a distance “d” giving rise to a Kronig–Penney (KP) potential. We use the Green's function built from the wave functions that are solutions of this KP potential; disorder is included by incorporating into the theory the probability that an electron is transmitted through several successive grain boundaries. We apply this new theory to analyze the resistivity of samples S1, S2, S7 and S8 measured between 4 and 300 K reported in Appl. Surf. Science273, 315 (2013). Although both the classical and the quantum theories predict a resistivity that agrees with experimental data to within a few percent or better, the phenomena giving rise to the increase of resistivity over the bulk are remarkably different. Classically, each grain boundary contributes to the electrical resistance by reflecting a certain fraction of the incoming electrons. In the quantum description, there are states

Parity violation in deep inelastic electron scattering

International Nuclear Information System (INIS)

Taylor, R.E.

1979-11-01

Neutral currents in electron scattering and the Weinberg-Salam model are reviewed. This generally accepted model is consistent with experimental results from neutrino interactions; an appropriate deep inelastic electron scattering experiment would measure couplings that don't involve neutrinos to see if they are also correctly described by the theory. The SLAC-Yale experiment measures a difference in the e-d inelastic cross section for right- and left-handed electrons. The polarized source, beam monitors, scattering experiment, checks of helicity dependence, and results are described. It is concluded that the data obtained are in agreement with the Weinberg-Salam model, and that the best value of sin 2 theta/sub W/ for these data is in excellent agreement with the average values of that parameter deduced from neutrino experiments. Future experiments with polarized electrons are discussed. 12 figures, 2 tables

Electron Raman scattering in asymmetrical multiple quantum wells

International Nuclear Information System (INIS)

Betancourt-Riera, R; Rosas, R; Marin-Enriquez, I; Riera, R; Marin, J L

2005-01-01

Optical properties of asymmetrical multiple quantum wells for the construction of quantum cascade lasers are calculated, and expressions for the electronic states of asymmetrical multiple quantum wells are presented. The gain and differential cross-section for an electron Raman scattering process are obtained. Also, the emission spectra for several scattering configurations are discussed, and the corresponding selection rules for the processes involved are studied; an interpretation of the singularities found in the spectra is given. The electron Raman scattering studied here can be used to provide direct information about the efficiency of the lasers

Electron scattering from sodium at intermediate energies

International Nuclear Information System (INIS)

Mitroy, J.; McCarthy, I.E.

1986-10-01

A comprehensive comparison is made between theoretical calculations and experimental data for intermediate energy (≥ 10 eV) electron scattering from sodium vapour. The theoretical predictions of coupled-channels calculations (including one, two or four channels) do not agree with experimental values of the differential cross sections for elastic scattering or the resonant 3s to 3p excitation. Increasingly-more-sophisticated calculations, incorporating electron correlations in the target states, and also including core-excited states in the close-coupling expansion, are done at a few selected energies in an attempt to isolate the cause of the discrepancies between theory and experiment. It is found that these more-sophisticated calculations give essentially the same results as the two- and four-channel calculations using Hartree-Fock wavefunctions. Comparison of the sodium high-energy elastic differential cross sections with those of neon suggests that the sodium differential cross section experiments may suffer from systematic errors. There is also disagreement, at the higher energies, between theoretical values for the scattering parameters and those that are derived from laser-excited superelastic scattering and electron photon coincidence experiments. When allowance is made for the finite acceptance angle of the electron spectrometers used in the experiments by convoluting the theory with a function representing the distribution of electrons entering the electron spectrometer it is found that the magnitudes of the differences between theory and experiment are reduced

Electron scattering off nuclei

International Nuclear Information System (INIS)

Gattone, A.O.

1989-01-01

Two recently developed aspects related to the scattering of electrons off nuclei are presented. On the one hand, a model is introduced which emphasizes the relativistic aspects of the problem in the impulse approximation, by demanding strict maintenance of the algebra of the Poincare group. On the other hand, the second model aims at a more sophisticated description of the nuclear response in the case of collective excitations. Basically, it utilizes the RPA formalism with a new development which enables a more careful treatment of the states in the continuum as is the case for the giant resonances. Applications of both models to the description of elastic scattering, inelastic scattering to discrete levels, giant resonances and the quasi-elastic region are discussed. (Author) [es

Inclusive and exclusive deep-inelastic electron scattering

International Nuclear Information System (INIS)

Morgenstern, J.

1985-11-01

In this talk, I will present some deep inelastic electron scattering experiments done recently at Saclay with the purpose of studying high momentum components in the nucleus, many body effects as correlations, exchange currents, and the electron-nucleon interaction inside the nuclear medium. For that purpose we have performed (e,e') and (ee'p) experiments. When we detect only the scattered electron, we get some average properties less sensitive to final state interaction; in ee'p measurements we are more specific

Significance of matrix diagonalization in modelling inelastic electron scattering

Energy Technology Data Exchange (ETDEWEB)

Lee, Z. [University of Ulm, Ulm 89081 (Germany); Hambach, R. [University of Ulm, Ulm 89081 (Germany); University of Jena, Jena 07743 (Germany); Kaiser, U.; Rose, H. [University of Ulm, Ulm 89081 (Germany)

2017-04-15

Electron scattering is always applied as one of the routines to investigate nanostructures. Nowadays the development of hardware offers more and more prospect for this technique. For example imaging nanostructures with inelastic scattered electrons may allow to produce component-sensitive images with atomic resolution. Modelling inelastic electron scattering is therefore essential for interpreting these images. The main obstacle to study inelastic scattering problem is its complexity. During inelastic scattering, incident electrons entangle with objects, and the description of this process involves a multidimensional array. Since the simulation usually involves fourdimensional Fourier transforms, the computation is highly inefficient. In this work we have offered one solution to handle the multidimensional problem. By transforming a high dimensional array into twodimensional array, we are able to perform matrix diagonalization and approximate the original multidimensional array with its twodimensional eigenvectors. Our procedure reduces the complicated multidimensional problem to a twodimensional problem. In addition, it minimizes the number of twodimensional problems. This method is very useful for studying multiple inelastic scattering. - Highlights: • 4D problems are involved in modelling inelastic electron scattering. • By means of matrix diagonalization, the 4D problems can be simplified as 2D problems. • The number of 2D problems is minimized by using this approach.

Electron scattering and reactions from exotic nuclei

International Nuclear Information System (INIS)

Karataglidis, S.

2017-01-01

The SCRIT and FAIR/ELISe experiments are the first to attempt to measure directly electron scattering form factors from nuclei far from stability. This will give direct information for the (one-body) charge densities of those systems, about which there is little information available. The SCRIT experiment will be taking data for medium-mass exotic nuclei, while the electron-ion collider at ELISe, when constructed, will be able to measure form factors for a wide range of exotic nuclei, as available from the radioactive ion beams produced by the FAIR experiment. Other facilities are now being proposed, which will also consider electron scattering from exotic nuclei at higher energies, to study short-range correlations in exclusive reactions. This review will consider all available information concerning the current status (largely theoretical) of electron scattering from exotic nuclei and, where possible, complement such information with equivalent information concerning the neutron densities of those exotic systems, as obtained from intermediate energy proton scattering. The issue of long- and short-range correlations will be discussed, and whether extending such studies to the exotic sector will elicit new information. (orig.)

Electron scattering and reactions from exotic nuclei

Energy Technology Data Exchange (ETDEWEB)

Karataglidis, S. [University of Johannesburg, Department of Physics, Auckland Park (South Africa); University of Melbourne, School of Physics, Victoria (Australia)

2017-04-15

The SCRIT and FAIR/ELISe experiments are the first to attempt to measure directly electron scattering form factors from nuclei far from stability. This will give direct information for the (one-body) charge densities of those systems, about which there is little information available. The SCRIT experiment will be taking data for medium-mass exotic nuclei, while the electron-ion collider at ELISe, when constructed, will be able to measure form factors for a wide range of exotic nuclei, as available from the radioactive ion beams produced by the FAIR experiment. Other facilities are now being proposed, which will also consider electron scattering from exotic nuclei at higher energies, to study short-range correlations in exclusive reactions. This review will consider all available information concerning the current status (largely theoretical) of electron scattering from exotic nuclei and, where possible, complement such information with equivalent information concerning the neutron densities of those exotic systems, as obtained from intermediate energy proton scattering. The issue of long- and short-range correlations will be discussed, and whether extending such studies to the exotic sector will elicit new information. (orig.)

Numerical computations of interior transmission eigenvalues for scattering objects with cavities

International Nuclear Information System (INIS)

Peters, Stefan; Kleefeld, Andreas

2016-01-01

In this article we extend the inside-outside duality for acoustic transmission eigenvalue problems by allowing scattering objects that may contain cavities. In this context we provide the functional analytical framework necessary to transfer the techniques that have been used in Kirsch and Lechleiter (2013 Inverse Problems, 29 104011) to derive the inside-outside duality. Additionally, extensive numerical results are presented to show that we are able to successfully detect interior transmission eigenvalues with the inside-outside duality approach for a variety of obstacles with and without cavities in three dimensions. In this context, we also discuss the advantages and disadvantages of the inside-outside duality approach from a numerical point of view. Furthermore we derive the integral equations necessary to extend the algorithm in Kleefeld (2013 Inverse Problems, 29 104012) to compute highly accurate interior transmission eigenvalues for scattering objects with cavities, which we will then use as reference values to examine the accuracy of the inside-outside duality algorithm. (paper)

Advantages of a monochromated transmission electron microscope for solid state physics

International Nuclear Information System (INIS)

Grogger, W.; Kothleitner, G.; Hofer, F.

2006-01-01

Full text: The characterization of nanostructured devices and functional materials at a nanometer scale is paramount for the understanding of their physical and chemical properties. Transmission electron microscopy (TEM) plays a central role, especially in terms of structural and chemical analysis on a nearly atomic scale. In particular, electron energy-loss spectrometry (EELS) can obtain information not only about the chemical composition of a thin sample, but also about chemical bonding and electronic structure (ionization edge fine structures) and optical properties (through valence loss EELS). Recent instrumental advances like monochromators for the electron gun in the TEM have made it possible to reduce the energy resolution to 0.15 eV at an acceleration voltage of 200 kV. Another strong point of the method lies in the combination with a fine electron probe (0.2 nm) which allows to record EELS spectra with high energy resolution and spatial resolution in the range of 1 nm. The improved energy resolution opens new possibilities for studying detailed electronic structure and bonding effects in solids such as transmission metal oxides. The experimental results will be compared with x-ray absorption spectroscopy and band structure calculations. A better energy-resolution is particularly important for measurements in the low loss region of the EELS spectrum which provides the information about the band gap and the dielectric function. We will highlight the potential of the method for studying metallic nanoparticles and semiconducting devices. Additionally, the influence of the intrinsic effects like core-hole and excited lifetime broadening and delocalization of the inelastically scattered electrons will be discussed. (author)

Observations of localised dielectric excitations, secondary events and ionisation damage by scanning transmission electron microscopy

International Nuclear Information System (INIS)

Howie, A.

1988-01-01

In the scanning transmission electron microscope (STEM) a high intensity /approximately/0.5nm diameter, probe of 100 keV electrons is formed. This can be positioned to collect energy loss spectra from surfaces, interfaces, small spheres or other particles at controlled values of impact parameter or can be scanned across the object (usually a thin film) to produce high resolution images formed from a variety of signals - small angle or large angle (Z contrast) elastic scattering, inelastic scattering (both valence and core losses), secondary electron emission and x-ray or optical photon emission. The high spatial resolution achievable in a variety of simple structures raises many unsolved theoretical problems concerning the generation, propagation and decay of excitations in inhomogeneous media. These range from quite well posed problems in the mathematical physics of dielectric excitation to problems of plasmon propagation and rather more exotic and less well understood problems of radiation damage. 15 refs., 4 figs

Electron Raman scattering in quantum well wires

International Nuclear Information System (INIS)

Zhao Xiangfu; Liu Cuihong

2007-01-01

Electron Raman scattering (ERS) is investigated in a semiconductor quantum well wire (QWW) of cylindrical geometry for T=0K and neglecting phonon-assisted transitions. The differential cross-section (DCS) involved in this process is calculated as a function of a scattering frequency and the cylindrical radius. Electron states are confined within a QWW. Single parabolic conduction and valence bands are assumed. The selection rules are studied. Singularities in the spectra are interpreted for various cylindrical radii. ERS discussed here can provide direct information about the electron band structure of the system

A Monte Carlo study of the energy spectra and transmission characteristics of scattered radiation from x-ray computed tomography.

Science.gov (United States)

Platten, David John

2014-06-01

Existing data used to calculate the barrier transmission of scattered radiation from computed tomography (CT) are based on primary beam CT energy spectra. This study uses the EGSnrc Monte Carlo system and Epp user code to determine the energy spectra of CT scatter from four different primary CT beams passing through an ICRP 110 male reference phantom. Each scatter spectrum was used as a broad-beam x-ray source in transmission simulations through seventeen thicknesses of lead (0.00-3.50 mm). A fit of transmission data to lead thickness was performed to obtain α, β and γ parameters for each spectrum. The mean energy of the scatter spectra were up to 12.3 keV lower than that of the primary spectrum. For 120 kVp scatter beams the transmission through lead was at least 50% less than predicted by existing data for thicknesses of 1.5 mm and greater; at least 30% less transmission was seen for 140 kVp scatter beams. This work has shown that the mean energy and half-value layer of CT scatter spectra are lower than those of the corresponding primary beam. The transmission of CT scatter radiation through lead is lower than that calculated with currently available data. Using the data from this work will result in less lead shielding being required for CT scanner installations.

Inelastic scattering of quasifree electrons on O7+ projectiles

International Nuclear Information System (INIS)

Toth, G.; Grabbe, S.; Richard, P.; Bhalla, C.P.

1996-01-01

Absolute doubly differential cross sections (DDCS close-quote s) for the resonant inelastic scattering of quasifree target electrons on H-like projectiles have been measured. Electron spectra for 20.25-MeV O 7+ projectiles on an H 2 target were measured. The spectra contain a resonant contribution from the 3l3l ' doubly excited states of O 6+ , which decay predominantly to the 2l states of the O 7+ via autoionization, and a nonresonant contribution from the direct excitation of the projectiles to the O 7+ (2l) state by the quasifree target electrons. Close-coupling R-matrix calculations for the inelastic scattering of free electrons on O 7+ ions were performed. The relation between the electron-ion inelastic scattering calculation and the electron DDCS close-quote s for the ion-atom collision was established by using the inelastic scattering model (ISM). We found excellent agreement between the theoretical and measured resonant peak positions and relative peak heights. The calculated absolute double differential cross sections for the resonance processes are also in good agreement with the measured data. The implication is that collisions of highly charged ions on hydrogen can be used to obtain high-resolution, angle- resolved differential inelastic electron-scattering cross section. copyright 1996 The American Physical Society

Study of the nanostructure of Gum Metal using energy-filtered transmission electron microscopy

International Nuclear Information System (INIS)

Yano, T.; Murakami, Y.; Shindo, D.; Kuramoto, S.

2009-01-01

The nanostructure of Gum Metal, which has many anomalous mechanical properties, was investigated using transmission electron microscopy with energy filtering. A precise analysis of the weak diffuse electron scattering that was observed in the electron diffraction patterns of the Gum Metal specimen revealed that Gum Metal contains a substantial amount of the nanometer-sized ω phase. The morphology of the ω phase appeared to have a correlation with the faulting in the {2 1 1} planes, which are one of the characteristic lattice imperfections of the Gum Metal specimen. It is likely that the nanometer-sized ω phase may be a type of obstacle related to the restriction of the dislocation movement, which has been a significant problem in research on Gum Metal

Interfacial phonon scattering and transmission loss in >1 μm thick silicon-on-insulator thin films

Science.gov (United States)

Jiang, Puqing; Lindsay, Lucas; Huang, Xi; Koh, Yee Kan

2018-05-01

Scattering of phonons at boundaries of a crystal (grains, surfaces, or solid/solid interfaces) is characterized by the phonon wavelength, the angle of incidence, and the interface roughness, as historically evaluated using a specularity parameter p formulated by Ziman [Electrons and Phonons (Clarendon Press, Oxford, 1960)]. This parameter was initially defined to determine the probability of a phonon specularly reflecting or diffusely scattering from the rough surface of a material. The validity of Ziman's theory as extended to solid/solid interfaces has not been previously validated. To better understand the interfacial scattering of phonons and to test the validity of Ziman's theory, we precisely measured the in-plane thermal conductivity of a series of Si films in silicon-on-insulator (SOI) wafers by time-domain thermoreflectance (TDTR) for a Si film thickness range of 1-10 μm and a temperature range of 100-300 K. The Si /SiO2 interface roughness was determined to be 0.11 ±0.04 nm using transmission electron microscopy (TEM). Furthermore, we compared our in-plane thermal conductivity measurements to theoretical calculations that combine first-principles phonon transport with Ziman's theory. Calculations using Ziman's specularity parameter significantly overestimate values from the TDTR measurements. We attribute this discrepancy to phonon transmission through the solid/solid interface into the substrate, which is not accounted for by Ziman's theory for surfaces. The phonons that are specularly transmitted into an amorphous layer will be sufficiently randomized by the time they come back to the crystalline Si layer, the effect of which is practically equivalent to a diffuse reflection at the interface. We derive a simple expression for the specularity parameter at solid/amorphous interfaces and achieve good agreement between calculations and measurement values.

Electron scattering by hydrogen atoms

International Nuclear Information System (INIS)

Fujii, D.H.

1981-02-01

A variational method to calculate the differential cross section of the electron-hydrogen atom scattering process is presented. The second Born approximation is calculated, through a variational calculation using the energy and electronic charge simultaneously as parameters, in order to calculate the differential cross section which is written in a fractional form according to the Schwinger variational principle. Effects due to the electron change are included in the calculations. (L.C.) [pt

Theory of Raman scattering in coupled electron-phonon systems

Science.gov (United States)

Itai, K.

1992-01-01

The Raman spectrum is calculated for a coupled conduction-electron-phonon system in the zero-momentum-transfer limit. The Raman scattering is due to electron-hole excitations and phonons as well. The phonons of those branches that contribute to the electron self-energy and the correction of the electron-phonon vertex are assumed to have flat energy dispersion (the Einstein phonons). The effect of electron-impurity scattering is also incorporated. Both the electron-phonon interaction and the electron-impurity interaction cause the fluctuation of the electron distribution between different parts of the Fermi surface, which results in overdamped zero-sound modes of various symmetries. The scattering cross section is obtained by solving the Bethe-Salpeter equation. The spectrum shows a lower threshold at the smallest Einstein phonon energy when only the electron-phonon interaction is taken into consideration. When impurities are also taken into consideration, the threshold disappears.

Alignment creation by elastic electron scattering. A quantum treatment

International Nuclear Information System (INIS)

Csanak, G.; Kilcrease, D.P.; Fursa, D.V.; Bray, I.

2004-01-01

Alignment creation by elastic heavy particle scattering has been studied by many authors. A formula for the alignment creation cross section by elastic scattering is obtained by quantum-mechanical methods. The formula obtained differs from the analogous formula relevant for inelastic electron scattering. In the case of a J=1 to J=1 transition according to the inelastic formula, the alignment created is proportional to the quantity σ (1) - σ (0) where σ (M) is the excitation cross section of the M magnetic sublevel and thus σ (1) = (σ 1-1 + σ 10 + σ 11 )/3 and σ (0) = (σ 0-1 +σ 00 + σ 01 )/3 where σ MM' refers to the cross section of the electron impact induced M' to M transition. In the elastic scattering alignment creation formula obtained in the case of a J=1 to J=1 elastic scattering, the alignment created is proportional to the quantity q(1) - q(0) where q(1) σ (1) - σ 11 /3 and q(0) = σ 00 /3. Thus in obtaining q(M), the elastic scattering cross section by the M magnetic sublevel, σ MM' , is subtracted. This derivation considered only direct scattering, i.e. the incident electron was considered distinguishable from the target electrons. (Y.Kazumata)

Electron scattering off short-lived radioactive nuclei

International Nuclear Information System (INIS)

Wang, S.; Emoto, T.; Furukawa, Y.

2009-01-01

We have established a novel method which make electron scattering off short-lived radioactive nuclei come into being. This novel method was named SCRIT (Self-Confining RI ion Target). It was based on the well known "ion trapping" phenomenon in electron storage rings. Stable nucleus, 133 Cs, was used as target nucleus in the R&D experiment. The luminosity of interaction between stored electrons and Cs ions was about 1.02(0.06) × 10 26 cm -2 s -1 at beam current around 80 mA. The angular distribution of elastically scattered electrons from trapped Cs ions was measured. And an online luminosity monitor was used to monitor the change of luminosity during the experiment. (author)

Polarized electron-muon neutrino scattering to electron and neutrino in noncommutative space

Directory of Open Access Journals (Sweden)

MM Ettefaghi

2011-06-01

Full Text Available For neutrino scattering from polarized electron, the weak interaction term in the cross section is significantly suppressed by the polarized term. The magnetic moment term does not receive any correction from the electron polarization. Hence, the study of the magnetic moment of neutrinos through scattering from the polarized electron leads to a stronger bound on the neutrino magnetic moment compared with the unpolarized case. On the other hand, neutrinos which are electrically neutral can couple directly with photons in Noncommutative (NC QED. In this paper, we calculate the NC QED corrections on this scattering are calculated. The phase difference between the NC term and the polarized weak interaction term is π/2. Therefore, the NC term does not destroy the above suppression.

Electron scattering resonances and dissociative attachment in polyatomic molecules

International Nuclear Information System (INIS)

Olthoff, J.K.

1985-01-01

A relatively new technique, electron transmission spectroscopic, is now being used to investigate the unoccupied valence molecular orbitals of many chemical compounds. Electron-transmission spectroscopy measures the energy of negative ion states that arise from electron capture into unoccupied molecular orbitals. Additional information about the unoccupied orbitals may be obtained if the negative ion decays by way of dissociation. Determination of the identity, kinetic energy, and production rates of stable ion fragments supplies information about the shape and position of the potential energy curves which describe the electronic states of the molecule and the anion. Used together, photoelectron, electron transmission, and dissociation data can produce a complete picture of a molecule's valence electronic structure. For this work, a time-of-flight mass spectrometer was attached to an electron transmission spectrometer to observe negative ion fragments due to dissociative attachment. The mass spectrometer measures the identify and kinetic energy of stable negative ions as a function of incident electron energy. Electron transmission spectra and ion production data were acquired for many compounds in four chemical categories

2D scattering of unpolarized beams of electrons by charged nanomagnets

Energy Technology Data Exchange (ETDEWEB)

Senbeta, Teshome, E-mail: teshearada@yahoo.com [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia); Mal' nev, V.N., E-mail: vnmalnev@aau.edu.et [Department of Physics, Addis Ababa University, P.O. Box 1176, Addis Ababa (Ethiopia)

2012-07-15

2D spin-dependent scattering of slow unpolarized beams of electrons by charged nanomagnets is analyzed in the Born approximation. The obtained scattering lengths are larger than those from the neutral nanomagnets approximately by one order. It is shown that for particular parameters of the system it is possible to polarize completely the scattered electrons in a narrow range of scattering angles. The most suitable system for realization of these effects is 2D Si electron gas with immersed nanomagnets. - Highlights: Black-Right-Pointing-Pointer We study 2D spin dependent electron scattering by charged nanomagnets. Black-Right-Pointing-Pointer The applicability of the Born approximation to the problem is discussed. Black-Right-Pointing-Pointer Unpolarized incident beams used to obtain completely polarized scattered electrons. Black-Right-Pointing-Pointer The study shows peculiarities of 2D spin dependent scattering enhanced by Coulomb potential. Black-Right-Pointing-Pointer The result obtained can be used as one method of controlling spin currents.

Optical-potential model for electron-atom scattering

International Nuclear Information System (INIS)

Callaway, J.; Oza, D.H.

1985-01-01

It is proposed that the addition of a matrix optical potential to a close-coupling calculation should lead to improved results in studies of electron-atom scattering. This procedure is described with use of a pseudostate expansion to evaluate the optical potential. The integro-differential equations are solved by a linear-algebraic method. As a test case, applications are made to electron-hydrogen scattering, and the results are compared with those obtained by other calculational procedures, and with experiment

Detailed Monte Carlo simulation of electron elastic scattering

International Nuclear Information System (INIS)

Chakarova, R.

1994-04-01

A detailed Monte Carlo model is described which simulates the transport of electrons penetrating a medium without energy loss. The trajectory of each electron is constructed as a series of successive interaction events - elastic or inelastic scattering. Differential elastic scattering cross sections, elastic and inelastic mean free paths are used to describe the interaction process. It is presumed that the cross sections data are available and the Monte Carlo algorithm does not include their evaluation. Electrons suffering successive elastic collisions are followed until they escape from the medium or (if the absorption is negligible) their path length exceeds a certain value. The inelastic events are thus treated as absorption. The medium geometry is a layered infinite slab. The electron source could be an incident electron beam or electrons created inside the material. The objective is to obtain the angular distribution, the path length and depth distribution and the collision number distribution of electrons emitted through the surface of the medium. The model is applied successfully to electrons with energy between 0.4 and 20 keV reflected from semi-infinite homogeneous materials with different scattering properties. 16 refs, 9 figs

Electron mobility variance in the presence of an electric field: Electron-phonon field-induced tunnel scattering

International Nuclear Information System (INIS)

Melkonyan, S.V.

2012-01-01

The problem of electron mobility variance is discussed. It is established that in equilibrium semiconductors the mobility variance is infinite. It is revealed that the cause of the mobility variance infinity is the threshold of phonon emission. The electron-phonon interaction theory in the presence of an electric field is developed. A new mechanism of electron scattering, called electron-phonon field-induced tunnel (FIT) scattering, is observed. The effect of the electron-phonon FIT scattering is explained in terms of penetration of the electron wave function into the semiconductor band gap in the presence of an electric field. New and more general expressions for the electron-non-polar optical phonon scattering probability and relaxation time are obtained. The results show that FIT transitions have principle meaning for the mobility fluctuation theory: mobility variance becomes finite.

Nonelastic electron scattering in mercury telluride

CERN Document Server

Malik, O P

2002-01-01

By exact solution of the Boltzmann equation, the nonequilibrium charge carrier distribution function is obtained. In the temperature range 4.2 - 300 K, main electron scattering mechanisms are considered by taking into account the nonelastic electron interaction with optical vibrations of the crystal lattice.

Study of early laser-induced plasma dynamics: Transient electron density gradients via Thomson scattering and Stark Broadening, and the implications on laser-induced breakdown spectroscopy measurements

International Nuclear Information System (INIS)

Diwakar, P.K.; Hahn, D.W.

2008-01-01

To further develop laser-induced breakdown spectroscopy (LIBS) as an analytical technique, it is necessary to better understand the fundamental processes and mechanisms taking place during the plasma evolution. This paper addresses the very early plasma dynamics (first 100 ns) using direct plasma imaging, light scattering, and transmission measurements from a synchronized 532-nm probe laser pulse. During the first 50 ns following breakdown, significant Thomson scattering was observed while the probe laser interacted with the laser-induced plasma. The Thomson scattering was observed to peak 15-25 ns following plasma initiation and then decay rapidly, thereby revealing the highly transient nature of the free electron density and plasma equilibrium immediately following breakdown. Such an intense free electron density gradient is suggestive of a non-equilibrium, free electron wave generated by the initial breakdown and growth processes. Additional probe beam transmission measurements and electron density measurements via Stark broadening of the 500.1-nm nitrogen ion line corroborate the Thomson scattering observations. In concert, the data support the finding of a highly transient plasma that deviates from local thermodynamic equilibrium (LTE) conditions during the first tens of nanoseconds of plasma lifetime. The implications of this early plasma transient behavior are discussed in the context of plasma-analyte interactions and the role on LIBS measurements

A surprise in the first Born approximation for electron scattering

International Nuclear Information System (INIS)

Treacy, M.M.J.; Van Dyck, D.

2012-01-01

A standard textbook derivation for the scattering of electrons by a weak potential under the first Born approximation suggests that the far-field scattered wave should be in phase with the incident wave. However, it is well known that waves scattered from a weak phase object should be phase-shifted by π/2 relative to the incident wave. A disturbing consequence of this missing phase is that, according to the Optical Theorem, the total scattering cross section would be zero in the first Born approximation. We resolve this mystery pedagogically by showing that the first Born approximation fails to conserve electrons even to first order. Modifying the derivation to conserve electrons introduces the correct phase without changing the scattering amplitude. We also show that the far-field expansion for the scattered waves used in many texts is inappropriate for computing an exit wave from a sample, and that the near-field expansion also give the appropriately phase-shifted result. -- Highlights: ► The first Born approximation is usually invoked as the theoretical physical basis for kinematical electron scattering theory. ► Although it predicts the correct scattering amplitude, it predicts the wrong phase; the scattered wave is missing a prefactor of i. ► We show that this arises because the standard textbook version of the first Born approximation does not conserve electrons. ► We show how this can be fixed.

Electron scattering in graphene by defects in underlying h-BN layer: First-principles transport calculations

Science.gov (United States)

Kaneko, Tomoaki; Ohno, Takahisa

2018-03-01

We investigate the electronic structure and the transport properties of graphene adsorbed onto h-BN with carbon impurities or atomic vacancies using density functional theory and the non-equilibrium Green's function method. We find that the transport properties are degraded due to carrier doping and scattering off of localized defect states in h-BN. When graphene is doped by introducing defects in h-BN, the transmission spectra become asymmetric owing to the reduction of the electronic density of states, which contributes significantly to the degradation of graphene transport properties as compared with the effect of defect levels.

Mikheyev-Smirnov-Wolfenstein effect in electron-neutrino scattering experiments

International Nuclear Information System (INIS)

Bahcall, J.N.; Gelb, J.M.; Rosen, S.P.

1987-01-01

We calculate the influence of resonant neutrino scattering [the Mikheyev-Smirnov-Wolfenstein (MSW) effect] in the Sun and in the Earth on measurable quantities in solar-neutrino--electron scattering experiments. The MSW effect reduces the expected rate for 8 B-neutrino--electron scattering by a factor that ranges from --0.8 to --0.2 if resonant scattering is the correct explanation for the discrepancy between observation and calculation in the /sup 37/Cl experiment. The Earth can produce a significant diurnal effect for certain values of the neutrino mixing angle and mass difference

Electronic isotope shifts, muonic atoms, and electron scattering

International Nuclear Information System (INIS)

Shera, E.B.

1982-01-01

The roles of electronic isotope shift, muonic atom, and electron scattering experiments in studying the nuclear charge distribution are discussed in terms of the potentials of each probe. Barium isotope shift data are presented as an example of a combined muonic-optical analysis and the results are compared with droplet and IBA model predictions. A survey of muonic and (e,e) results is presented with emphasis on shell-structure related features

Diffraction and absorption of inelastically scattered electrons for K-shell ionization

International Nuclear Information System (INIS)

Josefsson, T.W.; Allen, L.J.

1995-01-01

An expression for the nonlocal inelastic scattering cross section for fast electrons in a crystalline environment, which explicitly includes diffraction as well as absorption for the inelastically scattered electrons, is used to carry out realistic calculations of K-shell electron energy loss spectroscopy (EELS) and energy dispersive x-ray (EDX) analysis cross sections. The calculations demonstrate quantitatively why, in EDX spectroscopy, integration over the dynamical states of the inelastically scattered electron averages in such a way that an effective plane wave representation of the scattered electrons is a good approximation. This is only the case for large enough acceptance angles of the detector in an EELS experiment. For EELS with smaller detector apertures, explicit integration over the dynamical final states is necessary and inclusion of absorption for the scattered electrons is important, particularly for thicker crystals. 50 refs., 7 figs

Transition densities with electron scattering

International Nuclear Information System (INIS)

Heisenberg, J.

1985-01-01

This paper reviews the ground state and transition charge densities in nuclei via electron scattering. Using electrons as a spectroscopic tool in nuclear physics, these transition densities can be determined with high precision, also in the nuclear interior. These densities generally ask for a microscopic interpretation in terms of contributions from individual nucleons. The results for single particle transitions confirm the picture of particle-phonon coupling. (Auth.)

Electron scattering for exotic nuclei

Indian Academy of Sciences (India)

2014-11-04

Nov 4, 2014 ... Research Center for Electron-Photon Science, Tohoku University, 1-2-1 ... nuclei precisely determined by elastic scattering [1]. .... In order to fulfill these requirements, a window-frame shaped dipole magnet with a gap.

Theory of atom displacements induced by fast electron elastic scattering in solids

International Nuclear Information System (INIS)

Cruz, C. M.; Pinera, I.; Abreu, Y.; Leyva, A.

2006-01-01

Present contribution deals with the theoretical description of the conditions favoring the occurrence of single fast electron elastic scattering in solids, leading to the displacement of atoms from their crystalline sites. Firstly, the Moliere-Bethe-Goudsmit-Saunderson theory of Multiple Electron Scattering is applied, determining the limiting angle θ l over which the single electron elastic scattering prevails over the multiple one, leading to the evaluation of the total macroscopic cross-section for single electron elastic scattering on the basis of the Mott-Rutherford differential cross-section. On the basis of single electron elastic scattering by atoms in the solid matrix, it was determined the relative number of Atom Displacements produced by the Gamma Radiation as a primary act, as well as the energy and linear momentum of the ejected atoms. The statistical distributions of single electron elastic scattering and of those inducing Atom Displacements at different electron initial energies in comparison with the others electron inelastic scattering channels are discussed, where the statistical sampling methods on the basis of the rejection one where applied simulating different practical situations. (Full text)

Transmission-grid requirements with scattered and fluctuating renewable electricity-sources

DEFF Research Database (Denmark)

Østergaard, Poul Alberg

2003-01-01

The article analysis the requirements of the transmission grids in a year 2020 situation with power balancing (matching production and consumption)as it is now on the few large power plants, and a year 2020 situation with geographically-scattered power balancing using e.g. CHP plants, heat pumps...

Compton scattering and electron-atom scattering in an elliptically polarized laser field of relativistic radiation power

International Nuclear Information System (INIS)

Panek, P.; Kaminski, J.Z.; Ehlotzky, F.

2003-01-01

Presently available laser sources can yield powers for which the ponderomotive energy of an electron U p can be equal to or even larger than the rest energy mc 2 of an electron. Therefore it has become of interest to consider fundamental radiation-induced or assisted processes in such powerful laser fields. In the present work we consider laser-induced Compton scattering and laser-assisted electron atom scattering in such fields, assuming that the laser beam has arbitrary elliptic polarization. We investigate in detail the angular and polarisation dependence of the differential cross-sections of the two laser-induced or laser-assisted nonlinear processes as a function of the order N of absorbed or emitted laser photons ω. The present work is a generalization of our previous analysis of Compton scattering and electron-atom scattering in a linearly polarized laser field. (authors)

Transmission electron microscope studies of extraterrestrial materials

Science.gov (United States)

Keller, Lindsay P.

1995-01-01

Transmission Electron Microscopy, X-Ray spectrometry and electron-energy-loss spectroscopy are used to analyse carbon in interplanetary dust particles. Optical micrographs are shown depicting cross sections of the dust particles embedded in sulphur. Selected-area electron diffraction patterns are shown. Transmission Electron Microscope specimens of lunar soil were prepared using two methods: ion-milling and ultramicrotomy. A combination of high resolution TEM imaging and electron diffraction is used to characterize the opaque assemblages. The opaque assemblages analyzed in this study are dominated by ilmenite with lesser rutile and spinel exsolutions, and traces of Fe metal.

Study of Compton broadening due to electron-photon scattering

Directory of Open Access Journals (Sweden)

Srinivasa Rao M.

2010-01-01

Full Text Available We have investigated the effects of Compton broadening due to electron-photon scattering in hot stellar atmospheres. A purely electron-photon scattering media is assumed to have plane parallel geometry with an input radia­tion field localized on one side of the slab. The method is based on the discrete space theory of radiative transfer for the intensity of emitted radiation. The solution is developed to study the importance of scattering of radiation by free electrons in high temperature stellar atmospheres which produces a brodening and shift in spectral lines because of the Compton effect and the Doppler effect arising from mass and thermal motions of scattering electrons. It is noticed that the Comptonized spectrum depends on three parameters: the optical depth of the medium, the temperature of the thermal electrons and the viewing angle. We also showed that the Compton effect produces red shift and asymmetry in the line. These two effects increase as the optical depth increases. It is also noticed that the emergent specific intensities become completely asymmetric for higher optical depths.

Study of Compton Broadening Due to Electron-Photon Scattering

Directory of Open Access Journals (Sweden)

Srinivasa Rao, M.

2010-06-01

Full Text Available We have investigated the effects of Compton broadening due to electron-photon scattering in hot stellar atmospheres. A purely electron-photon scattering media is assumed to have plane parallel geometry with an input radiation field localized on one side of the slab. The method is based on the discrete space theory of radiative transfer for the intensity of emitted radiation.The solution is developed to study the importance of scattering of radiation by free electrons in high temperature stellar atmospheres which produces a brodening and shift in spectral lines because of the Compton effect and the Doppler effect arising from mass and thermal motions of scattering electrons.It is noticed that the Comptonized spectrum depends on three parameters: the optical depth of the medium, the temperature of the thermal electrons and the viewing angle.We also showed that the Compton effect produces red shift and asymmetry in the line. These two effects increase as the optical depth increases. It is also noticed that the emergent specific intensities become completely asymmetric for higher optical depths.

Inelastic electron and light scattering from the elementary electronic excitations in quantum wells: Zero magnetic field

Directory of Open Access Journals (Sweden)

Manvir S. Kushwaha

2012-09-01

Full Text Available The most fundamental approach to an understanding of electronic, optical, and transport phenomena which the condensed matter physics (of conventional as well as nonconventional systems offers is generally founded on two experiments: the inelastic electron scattering and the inelastic light scattering. This work embarks on providing a systematic framework for the theory of inelastic electron scattering and of inelastic light scattering from the electronic excitations in GaAs/Ga1−xAlxAs quantum wells. To this end, we start with the Kubo's correlation function to derive the generalized nonlocal, dynamic dielectric function, and the inverse dielectric function within the framework of Bohm-Pines’ random-phase approximation. This is followed by a thorough development of the theory of inelastic electron scattering and of inelastic light scattering. The methodological part is then subjected to the analytical diagnoses which allow us to sense the subtlety of the analytical results and the importance of their applications. The general analytical results, which know no bounds regarding, e.g., the subband occupancy, are then specified so as to make them applicable to practicality. After trying and testing the eigenfunctions, we compute the density of states, the Fermi energy, the full excitation spectrum made up of intrasubband and intersubband – single-particle and collective (plasmon – excitations, the loss functions for all the principal geometries envisioned for the inelastic electron scattering, and the Raman intensity, which provides a measure of the real transitions induced by the (laser probe, for the inelastic light scattering. It is found that the dominant contribution to both the loss peaks and the Raman peaks comes from the collective (plasmon excitations. As to the single-particle peaks, the analysis indicates a long-lasting lack of quantitative comparison between theory and experiments. It is inferred that the inelastic electron

Parity violating electron scattering

International Nuclear Information System (INIS)

McKeown, R.D.

1990-01-01

Previous measurements of parity violation in electron scattering are reviewed with particular emphasis on experimental techniques. Significant progress in the attainment of higher precision is evident in these efforts. These pioneering experiments provide a basis for consideration of a future program of such measurements. In this paper some future plans and possibilities in this field are discussed

Pygmy resonances probed with electron scattering

International Nuclear Information System (INIS)

Bertulani, C.A.

2007-01-01

Pygmy resonances in light nuclei excited in electron scattering are discussed. These collective modes will be explored in future electron-ion colliders such as ELISe/FAIR (spokesperson: Haik Simon - GSI). Response functions for direct breakup are explored with few-body and hydrodynamical models, including the dependence upon final state interactions

Pair distribution functions of amorphous organic thin films from synchrotron X-ray scattering in transmission mode

Directory of Open Access Journals (Sweden)

Chenyang Shi

2017-09-01

Full Text Available Using high-brilliance high-energy synchrotron X-ray radiation, for the first time the total scattering of a thin organic glass film deposited on a strongly scattering inorganic substrate has been measured in transmission mode. The organic thin film was composed of the weakly scattering pharmaceutical substance indomethacin in the amorphous state. The film was 130 µm thick atop a borosilicate glass substrate of equal thickness. The atomic pair distribution function derived from the thin-film measurement is in excellent agreement with that from bulk measurements. This ability to measure the total scattering of amorphous organic thin films in transmission will enable accurate in situ structural studies for a wide range of materials.

Scattering of polarized low-energy electrons by ferromagnetic metals

International Nuclear Information System (INIS)

Helman, J.S.

1981-01-01

A source of spin polarized electrons with remarkable characteristics based on negative electron affinity (NEA) GaAs has recently been developed. It constitutes a unique tool to investigate spin dependent interactions in electron scattering processes. The characteristics and working principles of the source are briefly described. Some theoretical aspects of the scattering of polarized low-energy electrons by ferromagnetic metals are discussed. Finally, the results of the first polarized low-energy electron diffraction experiment using the NEA GaAs source are reviewed; they give information about the surface magnetization of ferromagnetic Ni (110). (Author) [pt

Energy spectrum of Compton scattering of laser photons on relativistic electrons

International Nuclear Information System (INIS)

Ando, Hiroaki; Yoneda, Yasuharu

1976-01-01

The high energy photons in gamma-ray region are obtainable by the Compton scattering of laser photons on relativistic electrons. But the motion of the electrons in the storage ring is not necessarily uniform. In the study of the uneven effect, the energy distribution of scattered photons is derived from the assumed momentum distribution of incident electrons. It is generally impossible to derive the momentum distribution of incident electrons from the energy spectrum of scattered photons. The additional conditions which make this possible in a special case are considered. A calculational method is examined for deriving the energy spectrum of scattered photons from the assumed momentum distribution of incident electrons. (Mori, K.)

Study of the electrons elastic scattering by atoms through pseudopotentials

International Nuclear Information System (INIS)

Bettega, M.H.F.

1990-01-01

Pseudopotentials allow an extraordinary simplification in the calculation of the electronic structure of atoms, molecules and crystals. Though they have been used extensively for electronic structure calculations, little is known of their applicability to scattering. A study of the pseudopotentials of Bachelet, Hamann and Schuter in the electron scattering by atoms was made, calculating phase-shifts and cross sections for angular momenta 1=0,1 and 2 and energy up to 5 R y. The results for the pseudopotential were compared all-electron calculations. The agreement is very good in a broad energy band. A simplification of the calculation of scattering by complex molecules where an all-electron calculation is impossible is aimed. (author)

Nuclear matter and electron scattering

Energy Technology Data Exchange (ETDEWEB)

Sick, I [Dept. fuer Physik und Astronomie, Univ. Basel (Switzerland)

1998-06-01

We show that inclusive electron scattering at large momentum transfer allows a measurement of short-range properties of nuclear matter. This provides a very valuable constraint in selecting the calculations appropriate for predicting nuclear matter properties at the densities of astrophysical interest. (orig.)

Micellar aggregates of saponins from Chenopodium quinoa: characterization by dynamic light scattering and transmission electron microscopy.

Science.gov (United States)

Verza, S G; de Resende, P E; Kaiser, S; Quirici, L; Teixeira, H F; Gosmann, G; Ferreira, F; Ortega, G G

2012-04-01

Entire seeds of Chenopodium quinoa Willd are a rich protein source and are also well-known for their high saponin content. Due to their amphiphily quinoa saponins are able to form intricate micellar aggregates in aqueous media. In this paper we study the aggregates formed by self-association of these compounds from two quinoa saponin fractions (FQ70 and FQ90) as well as several distinctive nanostructures obtained after their complexation with different ratios of cholesterol (CHOL) and phosphatidylcholine (PC). The FQ70 and FQ90 fractions were obtained by reversed-phase preparative chromatography. The structural features of their resulting aggregates were determined by Dynamic Light Scattering (DLS) and Transmission Electron Microscopy (TEM). Novel nanosized spherical vesicles formed by self-association with mean diameter about 100-200 nm were observed in FQ70 aqueous solutions whereas worm-like micelles an approximate width of 20 nm were detected in FQ90 aqueous solutions. Under experimental conditions similar to those reported for the preparation of Quillaja saponaria ISCOM matrices, tubular and ring-like micelles arose from FQ70:CHOL:PC and FQ90:CHOL:PC formulations, respectively. However, under these conditions no cage-like ISCOM matrices were observed. The saponin composition of FQ70 and FQ90 seems to determine the nanosized structures viewed by TEM. Phytolaccagenic acid, predominant in FQ70 and FQ90 fractions, is accountable for the formation of the nanosized vesicles and tubular structures observed by TEM in the aqueous solutions of both samples. Conversely, ring-like micelles observed in FQ90:CHOL:PC complexes can be attributed to the presence of less polar saponins present in FQ90, in particular those derived from oleanolic acid.

Electron Scattering on deuterium

International Nuclear Information System (INIS)

Platchkov, S.

1987-01-01

Selected electron scattering experiments on the deuteron system are discussed. The main advantages of the electromagnetic probe are recalled. The deuteron A(q 2 ) structure function is analyzed and found to be very sensitive to the neutron electric form factor. Electrodisintegration of the deuteron near threshold is presented as evidence for the importance of meson exchange currents in nuclei [fr

Bio-inspired, subwavelength surface structures to control reflectivity, transmission, and scattering in the infrared

Science.gov (United States)

Lora Gonzalez, Federico

Controlling the reflection of visible and infrared (IR) light at interfaces is extremely important to increase the power efficiency and performance of optics, electro-optical and (thermo)photovoltaic systems. The eye of the moth has evolved subwavelength protuberances that increase light transmission into the eye tissue and prevent reflection. The subwavelength protuberances effectively grade the refractive index from that of air (n=1) to that of the tissue (n=1.4), making the interface gradual, suppressing reflection. In theory, the moth-eye (ME) structures can be implemented with any material platform to achieve an antireflectance effect by scaling the pitch and size of protuberances for the wavelength range of interest. In this work, a bio-inspired, scalable and substrate-independent surface modification protocol was developed to realize broadband antireflective structures based on the moth-eye principle. Quasi-ordered ME arrays were fabricated in IR relevant materials using a colloidal lithography method to achieve highly efficient, omni-directional transmission of mid and far infrared (IR) radiation. The effect of structure height and aspect ratio on transmittance and scattering is explored, with discussion on experimental techniques and effective medium theory (EMT). The highest aspect ratio structures (AR = 9.4) achieved peak single-side transmittance of 98%, with >85% transmission for lambda = 7--30 microns. A detailed photon balance constructed by transmission, forward scattering, specular reflection and diffuse reflection measurements to quantify optical losses due to near-field effects will be discussed. In addition, angle-dependent transmission measurements showed that moth-eye structures provide superior antireflective properties compared to unstructured interfaces over a wide angular range (0--60° incidence). Finally, subwavelength ME structures are incorporated on a Si substrate to enhance the absorption of near infrared (NIR) light in PtSi films to

3He electron scattering sum rules

International Nuclear Information System (INIS)

Kim, Y.E.; Tornow, V.

1982-01-01

Electron scattering sum rules for 3 He are derived with a realistic ground-state wave function. The theoretical results are compared with the experimentally measured integrated cross sections. (author)

Path integral approach to electron scattering in classical electromagnetic potential

International Nuclear Information System (INIS)

Xu Chuang; Feng Feng; Li Ying-Jun

2016-01-01

As is known to all, the electron scattering in classical electromagnetic potential is one of the most widespread applications of quantum theory. Nevertheless, many discussions about electron scattering are based upon single-particle Schrodinger equation or Dirac equation in quantum mechanics rather than the method of quantum field theory. In this paper, by using the path integral approach of quantum field theory, we perturbatively evaluate the scattering amplitude up to the second order for the electron scattering by the classical electromagnetic potential. The results we derive are convenient to apply to all sorts of potential forms. Furthermore, by means of the obtained results, we give explicit calculations for the one-dimensional electric potential. (paper)

Recent progress in electron scattering from atoms and molecules

Energy Technology Data Exchange (ETDEWEB)

Brunger, M. J. [Centre for Antimatter-Matter Studies, CAPS, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia and Institute of Mathematical Sciences, University of Malaya, Kuala Lumpur (Malaysia); Buckman, S. J. [Institute of Mathematical Sciences, University of Malaya, Kuala Lumpur, Malaysia and Centre for Antimatter-Matter Studies, AMPL, Australian National University, Canberra, ACT 0200 (Australia); Sullivan, J. P.; Palihawadana, P. [Centre for Antimatter-Matter Studies, AMPL, Australian National University, Canberra, ACT 0200 (Australia); Jones, D. B. [School of Chemical and Physical Sciences, Flinders University, GPO Box 2100, Adelaide, SA 5001 (Australia); Chiari, L.; Pettifer, Z. [Centre for Antimatter-Matter Studies, CAPS, Flinders University, GPO Box 2100, Adelaide, SA 5001 (Australia); Silva, G. B. da [Centre for Antimatter-Matter Studies, CAPS, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia and Universidade Federal de Mato Grosso, Barra do Garças, Mato Grosso (Brazil); Lopes, M. C. A. [Centre for Antimatter-Matter Studies, CAPS, Flinders University, GPO Box 2100, Adelaide, SA 5001, Australia and Departamento de Fisica, Universidade Federal de Juiz de Fora, Juiz de Fora, MG (Brazil); Duque, H. V. [Departamento de Fisica, Universidade Federal de Juiz de Fora, Juiz de Fora, MG (Brazil); Masin, Z.; Gorfinkiel, J. D. [Department of Physical Sciences, The Open University, Walton Hall, Milton Keynes, MK7 6AA (United Kingdom); Garcia, G. [Instituto de Fisica Fundamental, CSIC, Madrid E-28006 (Spain); Hoshino, M.; Tanaka, H. [Department of Physics, Sophia University, Tokyo, 102-8554 (Japan); Limão-Vieira, P. [Laboratório de Colisões Atómicas e Moleculares, CEFITEC, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)

2014-03-05

We present and discuss recent results, both experimental and theoretical (where possible), for electron impact excitation of the 3s[3/2 ]{sub 1} and 3s′[1/2 ]{sub 1} electronic states in neon, elastic electron scattering from the structurally similar molecules benzene, pyrazine, and 1,4-dioxane and excitation of the electronic states of the important bio-molecule analogue α-tetrahydrofurfuryl alcohol. While comparison between theoretical and experimental results suggests that benchmarked cross sections for electron scattering from atoms is feasible in the near-term, significant further theoretical development for electron-molecule collisions, particularly in respect to discrete excitation processes, is still required.

Analytical fits to Fink's electron scattering amplitudes, 1

International Nuclear Information System (INIS)

Hayashi, Shigeo

1984-01-01

Numerical data of the direct and spin-flip amplitudes for elastic electron scattering, calculated previously by Fink and co-workers, were expressed in the form Σc 1 exp(-c 2 x+ic 3 +ic 4 ), where x=1-cos theta,theta being a scattering angle. The adjustable c-parameters were determined by the use of a simplex method. Results are reported for carbon at incident electron energies of 25-1000eV. (author)

Design of a transmission electron positron microscope

International Nuclear Information System (INIS)

Doyama, Masao; Inoue, M.; Kogure, Y.; Hayashi, Y.; Yoshii, T.; Kurihara, T.; Tsuno, K.

2003-01-01

This paper reports the plans and design of positron-electron microscopes being built at KEK (High Energy Accelerator Research Organization), Tsukuba, Japan. A used electron microscope is altered. The kinetic energies of positrons produced by accelerators or by nuclear decays are not a unique value but show a spread over in a wide range. Positron beam is guided to a transmission electron microscope (JEM100SX). Positrons are moderated by a tungsten foil, are accelerated and are focused on a nickel sheet. The monochromatic focused beam is injected into an electron microscope. The focusing and aberration of positrons are the same as electrons in a magnetic system which are used in commercial electron microscopes. Imaging plates are used to record positron images for the transmission electron microscope. (author)

Indirect processes in electron-ion scattering

International Nuclear Information System (INIS)

Bottcher, C.; Griffin, D.C.; Pindzola, M.S.; Phaneuf, R.A.

1983-10-01

A summary is given of an informal workshop held at Oak Ridge National Laboratory on June 22-23, 1983, in which the current status of theoretical calculations of indirect processes in electron-ion scattering was reviewed. Processes of particular interest in astrophysical and fusion plasmas were emphasized. Topics discussed include atomic structure effects, electron-impact ionization, and dielectronic recombination

Indirect processes in electron-ion scattering

Energy Technology Data Exchange (ETDEWEB)

Bottcher, C.; Griffin, D.C.; Pindzola, M.S.; Phaneuf, R.A.

1983-10-01

A summary is given of an informal workshop held at Oak Ridge National Laboratory on June 22-23, 1983, in which the current status of theoretical calculations of indirect processes in electron-ion scattering was reviewed. Processes of particular interest in astrophysical and fusion plasmas were emphasized. Topics discussed include atomic structure effects, electron-impact ionization, and dielectronic recombination.

Deep inelastic electron and muon scattering

International Nuclear Information System (INIS)

Taylor, R.E.

1975-07-01

From the review of deep inelastic electron and muon scattering it is concluded that the puzzle of deep inelastic scattering versus annihilation was replaced with the challenge of the new particles, that the evidence for the simplest quark-algebra models of deep inelastic processes is weaker than a year ago. Definite evidence of scale breaking was found but the specific form of that scale breaking is difficult to extract from the data. 59 references

Electron scattering cross sections pertinent to electron microscopy

International Nuclear Information System (INIS)

Inokuti, M.

1978-01-01

Some elements of the physics that determine cross sections are discussed, and various sources of data are indicated that should be useful for analytical microscopy. Atoms, molecules, and to some extent, solids are considered. Inelastic and elastic scattering of electrons and some solid-state effects are treated. 30 references

Electron distortion effects in quasi-eleastic electron scattering

International Nuclear Information System (INIS)

Jin, Yanhe.

1991-03-01

This report discusses the following topics: dirac single particle shell model; dirac free states in Coulomb and optical potentials; deep inelastic electron scattering; plane wave born approximation and Rosenbluth separation; analysis of the 40 Ca(e,e') experimental data; and analysis of the exclusive (e,e'p) experimental data

Linear temperature behavior of thermopower and strong electron-electron scattering in thick F-doped SnO2 films

Science.gov (United States)

Lang, Wen-Jing; Li, Zhi-Qing

2014-07-01

Both the semi-classical and quantum transport properties of F-doped SnO2 thick films (˜1 μm) were investigated experimentally. We found that the resistivity caused by the thermal phonons obeys Bloch-Grüneisen law from ˜90 to 300 K, while only the diffusive thermopower, which varies linearly with temperature from 300 down to 10 K, can be observed. The phonon-drag thermopower is completely suppressed due to the long electron-phonon relaxation time in the compound. These observations, together with the fact that the carrier concentration has negligible temperature dependence, indicate that the conduction electrons in F-doped SnO2 films possess free-electron-like characteristics. At low temperatures, the electron-electron scattering dominates over the electron-phonon scattering and governs the inelastic scattering process. The theoretical predications of scattering rates of large- and small-energy-transfer electron-electron scattering processes, which are negligibly weak in three-dimensional disordered conventional conductors, are quantitatively tested in this lower carrier concentration and free-electron-like highly degenerate semiconductor.

Linear temperature behavior of thermopower and strong electron-electron scattering in thick F-doped SnO2 films

International Nuclear Information System (INIS)

Lang, Wen-Jing; Li, Zhi-Qing

2014-01-01

Both the semi-classical and quantum transport properties of F-doped SnO 2 thick films (∼1 μm) were investigated experimentally. We found that the resistivity caused by the thermal phonons obeys Bloch-Grüneisen law from ∼90 to 300 K, while only the diffusive thermopower, which varies linearly with temperature from 300 down to 10 K, can be observed. The phonon-drag thermopower is completely suppressed due to the long electron-phonon relaxation time in the compound. These observations, together with the fact that the carrier concentration has negligible temperature dependence, indicate that the conduction electrons in F-doped SnO 2 films possess free-electron-like characteristics. At low temperatures, the electron-electron scattering dominates over the electron-phonon scattering and governs the inelastic scattering process. The theoretical predications of scattering rates of large- and small-energy-transfer electron-electron scattering processes, which are negligibly weak in three-dimensional disordered conventional conductors, are quantitatively tested in this lower carrier concentration and free-electron-like highly degenerate semiconductor.

Some remarks on electron scattering in a laser field

International Nuclear Information System (INIS)

Ehlotzky, F.

1988-01-01

Potential scattering of electrons in a quantized radiation field is reconsidered. Some remarks are made on the validity of the Kroll-Watson scattering formula and on the close connection of this formula with the classical transition rate of scattering in a radiation field. (17 refs.)

Ab initio calculation of scattering length and cross sections at very low energies for electron-helium scattering

International Nuclear Information System (INIS)

Saha, H.P.

1993-01-01

The multiconfiguration Hartree-Fock method for continuum wave functions has been used to calculate the scattering length and phase shifts over extremely low energies ranging from 0 to 1 eV very accurately for electron-helium scattering. The scattering length is calculated very accurately with wave functions computed exactly at zero energy, resulting in an upper bound of 1.1784. The electron correlation and polarization of the target by the scattering electron, which are very important in these calculations, have been taken into account in an accurate ab initio manner through the configuration-interaction procedure by optimizing both bound and continuum orbitals simultaneously at each kinetic energy of the scattered electron. Detailed results for scattering length, differential, total, and momentum-transfer cross sections obtained from the phase shifts are presented. The present scattering length is found to be in excellent agreement with the experimental result of Andrick and Bitsch [J. Phys. B 8, 402 (1975)] and the theoretical result of O'Malley, Burke, and Berrington [J. Phys. B 12, 953 (1979)]. There is excellent agreement between the present total cross sections and the corresponding experimental measurements of Buckman and Lohmann [J. Phys. B 19, 2547 (1986)]. The present momentum-transfer cross sections also show remarkable agreement with the experimental results of Crompton, Elford, and Robertson [Aust. J. Phys. 23, 667 (1970)

Electron scattering at surfaces and grain boundaries in thin Au films

International Nuclear Information System (INIS)

Henriquez, Ricardo; Flores, Marcos; Moraga, Luis; Kremer, German; González-Fuentes, Claudio; Munoz, Raul C.

2013-01-01

The electron scattering at surfaces and grain boundaries is investigated using polycrystalline Au films deposited onto mica substrates. We vary the three length scales associated with: (i) electron scattering in the bulk, that at temperature T is characterized by the electronic mean free path in the bulk ℓ 0 (T); (ii) electron-surface scattering, that is characterized by the film thickness t; (iii) electron-grain boundary scattering, that is characterized by the mean grain diameter D. We varied independently the film thickness from approximately 50 nm to about 100 nm, and the typical grain size making up the samples from 12 nm to 160 nm. We also varied the scale of length associated with electron scattering in the bulk by measuring the resistivity of each specimen at temperatures T, 4 K 0 (T) by approximately 2 orders of magnitude. Detailed measurements of the grain size distribution as well as surface roughness of each sample were performed with a Scanning Tunnelling Microscope (STM). We compare, for the first time, theoretical predictions with resistivity data employing the two theories available that incorporate the effect of both electron-surface as well as electron-grain boundary scattering acting simultaneously: the theory of A.F. Mayadas and M. Shatzkes, Phys. Rev. 1 1382 (1970) (MS), and that of G. Palasantzas, Phys. Rev. B 58 9685 (1998). We eliminate adjustable parameters from the resistivity data analysis, by using as input the grain size distribution as well as the surface roughness measured with the STM on each sample. The outcome is that both theories provide a fair representation of both the temperature as well as the thickness dependence of the resistivity data, but yet there are marked differences between the resistivity predicted by these theories. In the case of the MS theory, when the average grain diameter D is significantly smaller than ℓ 0 (300) = 37 nm, the electron mean free path in the bulk at 300 K, the effect of electron

The electron beam dynamics simulation in the laser-electron storage ring involving compton and intrabeam scattering

International Nuclear Information System (INIS)

Gladkikh, P.I.; Telegin, Yu.N.; Karnaukhov, I.M.

2002-01-01

The feasibility of the development of intense X-ray sources based on Compton scattering in laser-electron storage rings is discussed. The results of the electron beam dynamics simulation involving Compton and intrabeam scattering are presented

The electron beam dynamics simulation in the laser-electron storage ring involving compton and intrabeam scattering

CERN Document Server

Gladkikh, P I; Karnaukhov, I M

2002-01-01

The feasibility of the development of intense X-ray sources based on Compton scattering in laser-electron storage rings is discussed. The results of the electron beam dynamics simulation involving Compton and intrabeam scattering are presented.

Electron Raman scattering in a cylindrical quantum dot

International Nuclear Information System (INIS)

Zhong Qinghu; Yi Xuehua

2012-01-01

Electron Raman scattering (ERS) is investigated in a CdS cylindrical quantum dot (QD). The differential cross section is calculated as a function of the scattering frequency and the size of the QD. Single parabolic conduction and valence bands are assumed, and singularities in the spectrum are found and interpreted. The selection rules for the processes are also studied. The ERS studied here can be used to provide direct information about the electron band structure of these systems. (semiconductor physics)

Hybrid Theory of Electron-Hydrogenic Systems Elastic Scattering

Science.gov (United States)

Bhatia, A. K.

2007-01-01

Accurate electron-hydrogen and electron-hydrogenic cross sections are required to interpret fusion experiments, laboratory plasma physics and properties of the solar and astrophysical plasmas. We have developed a method in which the short-range and long-range correlations can be included at the same time in the scattering equations. The phase shifts have rigorous lower bounds and the scattering lengths have rigorous upper bounds. The phase shifts in the resonance region can be used to calculate very accurately the resonance parameters.

Electron-electron scattering in the Weinberg-Salam theory

International Nuclear Information System (INIS)

Hirashima, Hideharu

1988-01-01

The Weinberg theory is generally believed to have been established in recent years. At distances smaller than 10 -16 cm, the strength of weak interactions becomes almost equal to that of the electromagnetic interactions. The grand unified theories proposed so far are based on the idea that the coupling constants for the Abelian U(1) field, the non-Abelian SU(2) field and the non-Abelian SU(3) color field depend on momentum transfer, or distance. At distances smaller than 10 -29 cm, weak electromagnetic and strong interactions are assumed to become almost the same strength. The question here is whether nature has no new features in the vast range from 10 -16 cm (10 2 GeV) to 10 -29 cm (10 15 GeV) and whether the substructure of quark or lepton can be expected to be revealed at the next accelerator energy region. The Weinberger-Salam theory may lose its validity even in near future experiments. In any case, it must be overhauled from various aspects. From this point of view, by using the Weinberger-Salam theory, calculation of the differential cross section for elastic electron-electron scattering is re-examined to make clear the difference with the results of QED. In addition, as an example of experiments which could investigate the Weinberger-Salam theory more in detail, a short account is given of the elastic scattering of polarized electrons from a polarized electron target. (Nogami, K.)

Robust parameterization of elastic and absorptive electron atomic scattering factors

International Nuclear Information System (INIS)

Peng, L.M.; Ren, G.; Dudarev, S.L.; Whelan, M.J.

1996-01-01

A robust algorithm and computer program have been developed for the parameterization of elastic and absorptive electron atomic scattering factors. The algorithm is based on a combined modified simulated-annealing and least-squares method, and the computer program works well for fitting both elastic and absorptive atomic scattering factors with five Gaussians. As an application of this program, the elastic electron atomic scattering factors have been parameterized for all neutral atoms and for s up to 6 A -1 . Error analysis shows that the present results are considerably more accurate than the previous analytical fits in terms of the mean square value of the deviation between the numerical and fitted scattering factors. Parameterization for absorptive atomic scattering factors has been made for 17 important materials with the zinc blende structure over the temperature range 1 to 1000 K, where appropriate, and for temperature ranges for which accurate Debye-Waller factors are available. For other materials, the parameterization of the absorptive electron atomic scattering factors can be made using the program by supplying the atomic number of the element, the Debye-Waller factor and the acceleration voltage. For ions or when more accurate numerical results for neutral atoms are available, the program can read in the numerical values of the elastic scattering factors and return the parameters for both the elastic and absorptive scattering factors. The computer routines developed have been tested both on computer workstations and desktop PC computers, and will be made freely available via electronic mail or on floppy disk upon request. (orig.)

Small angle neutron scattering

International Nuclear Information System (INIS)

Bernardini, G.; Cherubini, G.; Fioravanti, A.; Olivi, A.

1976-09-01

A method for the analysis of the data derived from neutron small angle scattering measurements has been accomplished in the case of homogeneous particles, starting from the basic theory without making any assumption on the form of particle size distribution function. The experimental scattering curves are interpreted with the aid the computer by means of a proper routine. The parameters obtained are compared with the corresponding ones derived from observations at the transmission electron microscope

Quasielastic electron scattering from 40Ca

International Nuclear Information System (INIS)

Williamson, C.F.; Yates, T.C.; Schmitt, W.M.; Osborn, M.; Deady, M.; Zimmerman, P.D.; Blatchley, C.C.; Seth, K.K.; Sarmiento, M.; Parker, B.; Jin, Y.; Wright, L.E.; Onley, D.S.

1997-01-01

Differential cross sections for quasielastic electron scattering on 40 Ca have been measured at laboratory scattering angles of 45.5 degree, 90 degree, and 140 degree with bombarding energies ranging from 130 to 840 MeV. Transverse and longitudinal response functions have been extracted for momentum transfers from 300 to 500 MeV/c. Contrary to some previously reported results, the total observed longitudinal strength agrees with the relativistic Fermi gas prediction to within ±18%. copyright 1997 The American Physical Society

Electron-translation effects in heavy-ion scattering

International Nuclear Information System (INIS)

Heinz, U.; Greiner, W.; Mueller, B.

1981-01-01

The origin and importance of electron-translation effects within a molecular description of electronic excitations in heavy-ion collisions is investigated. First, a fully consistent quantum-mechanical description of the scattering process is developed; the electrons are described by relativistic molecular orbitals, while the nuclear motion is approximated nonrelativistically. Leaving the quantum-mechanical level by using the semiclassical approximation for the nuclear motion, a set of coupled differential equations for the occupation amplitudes of the molecular orbitals is derived. In these coupled-channel equations the spurious asymptotic dynamical couplings are corrected for by additional matrix elements stemming from the electron translation. Hence, a molecular description of electronic excitations in heavy-ion scattering has been achieved, which is free from the spurious asymptotic couplings of the conventional perturbated stationary-state approach. The importance of electron-translation effects for continuum electrons and positrons is investigated. To this end an algorithm for the description of continuum electrons is proposed, which for the first time should allow for the calculation of angular distributions for delta electrons. Finally, the practical consequences of electron-translation effects are studied by calculating the corrected coupling matrix elements for the Pb-Cm system and comparing the corresponding K-vacancy probabilities with conventional calculations. We critically discuss conventional methods for cutting off the coupling matrix elements in coupled-channel calculations

Density-dependent electron scattering in photoexcited GaAs in strongly diffusive regime

DEFF Research Database (Denmark)

Mics, Zoltán; D’Angio, Andrea; Jensen, Søren A.

2013-01-01

In a series of systematic optical pump–terahertz probe experiments, we study the density-dependent electron scattering rate in photoexcited GaAs in the regime of strong carrier diffusion. The terahertz frequency-resolved transient sheet conductivity spectra are perfectly described by the Drude...... model, directly yielding the electron scattering rates. A diffusion model is applied to determine the spatial extent of the photoexcited electron-hole gas at each moment after photoexcitation, yielding the time-dependent electron density, and hence the density-dependent electron scattering time. We find...

Multiple pole in the electron--hydrogen-atom scattering amplitude

International Nuclear Information System (INIS)

Amusia, M.Y.; Kuchiev, M.Y.

1982-01-01

It is demonstrated that the amplitude for electron--hydrogen-atom forward scattering has the third-order pole at the point E = -13.6 eV, E being the energy of the incident electron. The coefficients which characterize the pole are calculated exactly. The invalidity of the Born approximation is proved. The contribution of the pole singularity to the dispersion relation for the scattering amplitude is discussed

Quantitative atomic resolution mapping using high-angle annular dark field scanning transmission electron microscopy

International Nuclear Information System (INIS)

Van Aert, S.; Verbeeck, J.; Erni, R.; Bals, S.; Luysberg, M.; Dyck, D. Van; Tendeloo, G. Van

2009-01-01

A model-based method is proposed to relatively quantify the chemical composition of atomic columns using high angle annular dark field (HAADF) scanning transmission electron microscopy (STEM) images. The method is based on a quantification of the total intensity of the scattered electrons for the individual atomic columns using statistical parameter estimation theory. In order to apply this theory, a model is required describing the image contrast of the HAADF STEM images. Therefore, a simple, effective incoherent model has been assumed which takes the probe intensity profile into account. The scattered intensities can then be estimated by fitting this model to an experimental HAADF STEM image. These estimates are used as a performance measure to distinguish between different atomic column types and to identify the nature of unknown columns with good accuracy and precision using statistical hypothesis testing. The reliability of the method is supported by means of simulated HAADF STEM images as well as a combination of experimental images and electron energy-loss spectra. It is experimentally shown that statistically meaningful information on the composition of individual columns can be obtained even if the difference in averaged atomic number Z is only 3. Using this method, quantitative mapping at atomic resolution using HAADF STEM images only has become possible without the need of simultaneously recorded electron energy loss spectra.

Resonant inelastic scattering of quasifree electrons on ions

International Nuclear Information System (INIS)

Grabbe, S.

1994-01-01

Several studies of resonant-transfer excitation (RTE) have been reported in ion-atom collisions where the doubly excited autoionizing states are produced. Such a complex collision can be approximated as the scattering of quasifree electrons of the target from the projectile ion. Most of the investigations have been restricted to the deexcitation of the autoionizing states to the ground state by Auger electron emission. It has been shown that there is a strong interference between the elastic scattering amplitude and the resonance amplitude. The authors present here the cases where the corresponding interference is between the inelastic scattering and the resonance process. Recent work on 3 ell 3 ell ' resonances that decay predominantly to n=2 states will be presented for C 5+ -molecular hydrogen collisions

Electron-nucleon scattering experiments in the GeV range

International Nuclear Information System (INIS)

Glawe, U.B.

1980-01-01

In the framework of this thesis a computer code systems was developed which describes the inclusive electron scattering on bound nucleons in the impact approximation. It could be shown that the structure functions for the quasi-free scattering can be represented as an incoherent superposition of the structure functions of the free processes. The structure functions of the free processes were determined from experimental cross sections. From the comparison of the calculations with electron scattering experiments on the nuclei 6 Li, 9 Be, 12 C, 27 Al, and 28 Si in the kinematic range 0.0 2 2 and W [de

Orbiting transmission source for positron tomography

International Nuclear Information System (INIS)

Huesman, R.H.; Derenzo, S.E.; Cahoon, J.L.; Geyer, A.B.; Moses, W.W.; Uber, D.C.; Vuletich, T.; Budinger, T.F.

1988-01-01

Accidental suppression and effective data rates have been measured for the orbiting transmission source as implemented in the Donner 600-Crystal Positron Tomograph. A mechanical description of the orbiting source and a description of the electronics used to discard scattered and accidental events is included. Since accidental coincidences were the rate-limiting factor in transmission data acquisition, the new method allows us to acquire sufficient transmission data in a shorter time with a more active transmission source

Electron scattering at surfaces and grain boundaries in thin Au films

Energy Technology Data Exchange (ETDEWEB)

Henriquez, Ricardo [Departamento de Física, Universidad Técnica Federico Santa María, Av. España 1680, Casilla 110-V, Valparaíso (Chile); Flores, Marcos; Moraga, Luis [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Blanco Encalada 2008, Casilla 487-3, Santiago 8370449 (Chile); Kremer, German [Bachillerato, Universidad de Chile, Las Palmeras 3425, Santiago 7800024 (Chile); González-Fuentes, Claudio [Departamento de Física, Universidad Técnica Federico Santa María, Av. España 1680, Casilla 110-V, Valparaíso (Chile); Munoz, Raul C., E-mail: ramunoz@ing.uchile.cl [Departamento de Física, Facultad de Ciencias Físicas y Matemáticas, Universidad de Chile, Blanco Encalada 2008, Casilla 487-3, Santiago 8370449 (Chile)

2013-05-15

The electron scattering at surfaces and grain boundaries is investigated using polycrystalline Au films deposited onto mica substrates. We vary the three length scales associated with: (i) electron scattering in the bulk, that at temperature T is characterized by the electronic mean free path in the bulk ℓ{sub 0}(T); (ii) electron-surface scattering, that is characterized by the film thickness t; (iii) electron-grain boundary scattering, that is characterized by the mean grain diameter D. We varied independently the film thickness from approximately 50 nm to about 100 nm, and the typical grain size making up the samples from 12 nm to 160 nm. We also varied the scale of length associated with electron scattering in the bulk by measuring the resistivity of each specimen at temperatures T, 4 K < T < 300 K. Cooling the samples to 4 K increases ℓ{sub 0}(T) by approximately 2 orders of magnitude. Detailed measurements of the grain size distribution as well as surface roughness of each sample were performed with a Scanning Tunnelling Microscope (STM). We compare, for the first time, theoretical predictions with resistivity data employing the two theories available that incorporate the effect of both electron-surface as well as electron-grain boundary scattering acting simultaneously: the theory of A.F. Mayadas and M. Shatzkes, Phys. Rev. 1 1382 (1970) (MS), and that of G. Palasantzas, Phys. Rev. B 58 9685 (1998). We eliminate adjustable parameters from the resistivity data analysis, by using as input the grain size distribution as well as the surface roughness measured with the STM on each sample. The outcome is that both theories provide a fair representation of both the temperature as well as the thickness dependence of the resistivity data, but yet there are marked differences between the resistivity predicted by these theories. In the case of the MS theory, when the average grain diameter D is significantly smaller than ℓ{sub 0}(300) = 37 nm, the electron mean

Modification of diode characteristics by electron back-scatter from high-atomic-number anodes

International Nuclear Information System (INIS)

Mosher, D.; Cooperstein, G.; Rose, D.V.; Swanekamp, S.B.

1996-01-01

In high-power vacuum diodes with high-atomic-number anodes, back-scattered electrons alter the vacuum space charge and resulting electron and ion currents. Electron multiple back-scattering was studied through equilibrium solutions of the Poisson equation for 1-dimensional, bipolar diodes in order to predict their early-time behavior. Before ion turn-on, back-scattered electrons from high-Z anodes suppress the diode current by about 10%. After ion turn-on in the same diodes, electron back-scatter leads to substantial enhancements of both the electron and ion currents above the Child-Langmuir values. Current enhancements with ion flow from low-Z anodes are small. (author). 5 figs., 7 refs

Modification of diode characteristics by electron back-scatter from high-atomic-number anodes

Energy Technology Data Exchange (ETDEWEB)

Mosher, D; Cooperstein, G [Naval Research Laboratory, Washington, DC (United States); Rose, D V; Swanekamp, S B [JAYCOR, Vienna, VA (United States)

1997-12-31

In high-power vacuum diodes with high-atomic-number anodes, back-scattered electrons alter the vacuum space charge and resulting electron and ion currents. Electron multiple back-scattering was studied through equilibrium solutions of the Poisson equation for 1-dimensional, bipolar diodes in order to predict their early-time behavior. Before ion turn-on, back-scattered electrons from high-Z anodes suppress the diode current by about 10%. After ion turn-on in the same diodes, electron back-scatter leads to substantial enhancements of both the electron and ion currents above the Child-Langmuir values. Current enhancements with ion flow from low-Z anodes are small. (author). 5 figs., 7 refs.

Electron re-scattering from aligned linear molecules using the R-matrix method

International Nuclear Information System (INIS)

Harvey, A G; Tennyson, J

2009-01-01

Electron re-scattering in a strong laser field provides an important probe of molecular structure and processes. The laser field drives the ionization of the molecule, followed by acceleration and subsequent recollision of the electron with the parent molecular ion, the scattered electrons carry information about the nuclear geometry and electronic states of the molecular ion. It is advantageous in strong field experiments to work with aligned molecules, which introduces extra physics compared to the standard gas-phase, electron-molecule scattering problem. The formalism for scattering from oriented linear molecules is presented and applied to H 2 and CO 2 . Differential cross sections are presented for (re-)scattering by these systems concentrating on the most common, linear alignment. In H 2 these cross sections show significant angular structure which, particularly for a scattering angle of 90 deg., are predicted to vary significantly between re-collisions stimulated by an even or an odd number of photons. In CO 2 these cross sections are zero indicating the necessity of using non-parallel alignment with this molecule.

Runaway relativistic electron scattering on the plazma oscillations in tokamak

International Nuclear Information System (INIS)

Krasovitskij, V.B.; Razdorski, V.G.

1980-01-01

The dynamics of fast electrons in a tolamak plasma with the presence of the constant external electric field have been inveatigated. It is shown that the occurrence of the relativistic electrons ''tail'' of the distribution function is followed by an intensive plasma oscillation swinging under conditions of the anomalous Doppler effect and their large angle scattering in the momentum space. A part of scattered electrons is captured by tokamak inhomogeneous magnetic field and causes the occurrence of a new low frequency alfven instability under conditions of magnetic drift resonance followed by quasilinear diffusion of relativistic electrons along the small radius of the torus. The flux of runaway electrons scattered on plasma oscillations has been found. A nonlinear diffusion equation has been derived for the flux of captured electrons. The equation defines the carrying out of fast particles from the plasma filament center to its periphery depending on the external magnetic field and plasma parameters

Elastic scattering of low-energy electrons from ammonia

International Nuclear Information System (INIS)

Alle, D.T.; Gulley, R.J.; Buckman, S.J.; Brunger, M.J.

1992-01-01

We report absolute differential cross section measurements for vibrationally elastic electron scattering from NH 3 at incident energies from 2-30 eV. The present results, from a crossed electron-molecular beam apparatus, represent the first comprehensive experimental attempt to quantify the elastic electron-NH 3 scattering process. At each energy studied we have integrated our differential cross section data to generate total elastic and elastic momentum transfer cross sections and a critical comparison of both our differential and integral cross sections against previous experiment and theory is provided. We also report our observation of a strong Feshbach resonance in the elastic channel at an energy of 5.59 ± 0.05 eV. (Author)

Inelastic electron photon scattering at moderate four momentum transfers

International Nuclear Information System (INIS)

Berger, C.; Genzel, H.; Grigull, R.; Lackas, W.; Raupach, F.; Klovning, A.; Lillestoel, E.; Skard, J.A.; Ackermann, H.; Buerger, J.

1980-10-01

We present new high statistics data on hadron production in photon photon reactions. The data are analyzed in terms of an electron photon scattering formalism. The dependence of the total cross section on Q 2 , the four momentum transfer squared of the scattered electron, and on the mass W of the hadronic system is investigated. The data are compared to predictions from Vector Dominance and the quark model. (orig.)

Elastic scattering of low energy electrons by hydrogen molecule

International Nuclear Information System (INIS)

Freitas, L.C.G.; Mu-Tao, L.; Botelho, L.F.

1987-01-01

The coherent version of the Renormalized Multiple-Centre Potential Model (RMPM) has been extended to treat the elastic scattering of low energy electrons by H2 molecule. The intramolecular Multiple Scattering (MS) effect has also been included. The comparison against the experimental data shows that the inclusion of the MS improves significantly with experiment. The extension of the present method to study electron-polyatomic molecule interaction is also discussed. (author) [pt

Influence of scattering processes on electron quantum states in nanowires

Directory of Open Access Journals (Sweden)

Pozdnyakov Dmitry

2007-01-01

Full Text Available AbstractIn the framework of quantum perturbation theory the self-consistent method of calculation of electron scattering rates in nanowires with the one-dimensional electron gas in the quantum limit is worked out. The developed method allows both the collisional broadening and the quantum correlations between scattering events to be taken into account. It is an alternativeper seto the Fock approximation for the self-energy approach based on Green’s function formalism. However this approach is free of mathematical difficulties typical to the Fock approximation. Moreover, the developed method is simpler than the Fock approximation from the computational point of view. Using the approximation of stable one-particle quantum states it is proved that the electron scattering processes determine the dependence of electron energy versus its wave vector.

Electron scattering by native defects in III-V nitrides and their alloys

International Nuclear Information System (INIS)

Hsu, L.; Walukiewicz, W.

1996-03-01

We have calculated the electron mobilities in GaN and InN taking into consideration scattering by short range potentials, in addition to all standard scattering mechanisms. These potentials are produced by the native defects which are responsible for the high electron concentrations in nominally undoped nitrides. Comparison of the calculated mobilities with experimental data shows that scattering by short range potentials is the dominant mechanism limiting the electron mobilities in unintentionally doped nitrides with large electron concentrations. In the case of Al x Ga 1-x N alloys, the reduction in the electron concentration due to the upward shift of the conduction band relative to the native defect level can account for the experimentally measured mobilities. Resonant scattering is shown to be important when the defect and Fermi levels are close in energy

Electron and positron atomic elastic scattering cross sections

International Nuclear Information System (INIS)

Stepanek, Jiri

2003-01-01

A method was developed to calculate the total and differential elastic-scattering cross sections for incident electrons and positrons in the energy range from 0.01 eV to 1 MeV for atoms of Z=1-100. For electrons, hydrogen, helium, nitrogen, oxygen, krypton, and xenon, and for positrons, helium, neon, and argon atoms were considered for comparison with experimental data. First, the variationally optimized atomic static potentials were calculated for each atom by solving the Dirac equations for bound electron states. Second, the Dirac equations for a free electron or positron are solved for an atom using the previously calculated static potential accomplished (in the case of electrons) by 'adjusted' Hara's exchange potential for a free-state particle. Additional to the exchange effects, the charge cloud polarization effects are considered applying the correlation-polarization potential of O'Connell and Lane (with correction of Padial and Norcross) for incident electrons, and of Jain for incident positrons. The total, cutoff and differential elastic-scattering cross sections are calculated for incident electrons and positrons with the help of the relativistic partial wave analysis. The solid state effects for scattering in solids are described by means of a muffin-tin model, i.e. the potentials of neighboring atoms are superpositioned in such a way that the resulting potential and its derivative are zero in the middle distance between the atoms. The potential of isolated atom is calculated up to the radius at which the long-range polarization potential becomes a value of -10 -8

Transmission of electrons through Al2O3 nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.J.; Víkor, Gy.

2012-01-01

We investigate transmission of low-energy electrons (250 eV) through insulating AlO nanocapillaries (270 nm diameter and 15 μm length). Kinetic energy distribution of electrons transmitted through the nanocapillaries in the straightforward direction, time dependence of the transmission rate both...

Scattering of electrons in copper by a Frenkel pair defect

Energy Technology Data Exchange (ETDEWEB)

Lodder, A.; Rijsdijk, G.A.; Bukman, D.J.; Baratta, A.J.; Molenaar, J.

1988-06-01

The Korringa-Kohn-Rostoker (KKR) Green function extended-defect formalism, used to describe the scattering of Bloch electrons in a dilute alloy, is generalised to include an asymmetric defect centred on a lattice site. The revised theory is then used to investigate conduction electron scattering from Frenkel pairs in Cu. Such defects consist of two self-interstitial atoms centred on a vacant lattice site forming a dumb-bell oriented along the <100> axis. The generalised formalism allows one to calculate the cluster t matrix T for the Frenkel pair cluster including the surrounding displaced nearest neighbours. It was found that the interstitials at the vacant lattice site could still be treated within the muffin-tin potential as a central scatterer characterised by a t matrix which is non-diagonal in the angular momentum. Electron scattering rates and Dingle temperatures are calculated and discussed in view of preliminary experimental results.

Scattering of electrons in copper by a Frenkel pair defect

International Nuclear Information System (INIS)

Lodder, A.; Rijsdijk, G.A.; Bukman, D.J.; Baratta, A.J.; Molenaar, J.

1988-01-01

The Korringa-Kohn-Rostoker (KKR) Green function extended-defect formalism, used to describe the scattering of Bloch electrons in a dilute alloy, is generalised to include an asymmetric defect centred on a lattice site. The revised theory is then used to investigate conduction electron scattering from Frenkel pairs in Cu. Such defects consist of two self-interstitial atoms centred on a vacant lattice site forming a dumb-bell oriented along the axis. The generalised formalism allows one to calculate the cluster t matrix T for the Frenkel pair cluster including the surrounding displaced nearest neighbours. It was found that the interstitials at the vacant lattice site could still be treated within the muffin-tin potential as a central scatterer characterised by a t matrix which is non-diagonal in the angular momentum. Electron scattering rates and Dingle temperatures are calculated and discussed in view of preliminary experimental results. (author)

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Ming, W.Q.; Chen, J.H., E-mail: jhchen123@hnu.edu.cn

2013-11-15

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations.

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

International Nuclear Information System (INIS)

Ming, W.Q.; Chen, J.H.

2013-01-01

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations

Contribution of the Electron Scattering Process to the Broad Hα Wings

Directory of Open Access Journals (Sweden)

Sekeráš M.

2012-06-01

Full Text Available We modeled the extended wings of the OVI 1032, 1038 Å resonance lines and He II 1640 Å emission line in the spectra of Z And, AG Dra and V1016 Cyg by the electron scattering process. By this way we determined the electron temperature and the electron optical depth of the layer of electrons, through which the line photons are transferred in the direction of the observer. We derived an empirical relationship between the emission measure of the symbiotic nebula and the electron optical depth. This relationship allows us to distinguish the flux contribution in the broad Hα wings, which is due to the electron scattering and that produced by the Hα transition in the moving hydrogen plasma. For example, subtracting the electron scattering contribution from the Hα line profile leads to a reduction in the mass-loss rate by approximately 15 %.

Electron scattering from the ground state of mercury

International Nuclear Information System (INIS)

Fursa, D.; Bray, I.

2000-01-01

Full text: Close-coupling calculations have been performed for electron scattering from the ground state of mercury. We have used non-relativistic convergent close-coupling computer code with only minor modifications in order to account for the most prominent relativistic effects. These are the relativistic shift effect and singlet-triplet mixing. Very good agreement with measurements of differential cross sections for elastic scattering and excitation of 6s6p 1 P state at all energies is obtained. It is well recognised that a consistent approach to electron scattering from heavy atoms (like mercury, with nuclear charge Z=80) must be based on a fully relativistic Dirac equations based technique. While development of such technique is under progress in our group, the complexity of the problem ensures that results will not be available in the near future. On other hand, there is considerable interest in reliable theoretical results for electron scattering from heavy atoms from both applications and the need to interpret existing experimental data. This is particularly the case for mercury, which is the major component in fluorescent lighting devices and has been the subject of intense experimental study since nineteen thirties. Similarly to our approach for alkaline-earth atoms we use a model of two valence electrons above an inert Hartree-Fock core to describe the mercury atom. Note that this model does not account for any core excited states which are present in the mercury discrete spectrum. The major effect of missing core-excited states is substantial underestimation of the static dipole polarizability of the mercury ground state (34 a.u.) and consequent underestimation of the forward scattering elastic cross sections. We correct for this by adding in the scattering calculations a phenomenological polarization potential. In order to obtain correct ground state ionization energy for mercury one has to account for the relativistic shift effect. We model this

Vector analyzing power in elastic electron-proton scattering

International Nuclear Information System (INIS)

Diaconescu, L.; Ramsey-Musolf, M.J.

2004-01-01

We compute the vector analyzing power (VAP) for the elastic scattering of transversely polarized electrons from protons at low energies using an effective theory of electrons, protons, and photons. We study all contributions through second order in E/M, where E and M are the electron energy and nucleon mass, respectively. The leading-order VAP arises from the imaginary part of the interference of one- and two-photon exchange amplitudes. Subleading contributions are generated by the nucleon magnetic moment and charge radius as well as recoil corrections to the leading-order amplitude. Working to O(E/M) 2 , we obtain a prediction for A n that is free of unknown parameters and that agrees with the recent measurement of the VAP in backward angle ep scattering

Electron scattering from atoms in the presence of a laser field. III

International Nuclear Information System (INIS)

Mittleman, M.H.

1977-01-01

The development of the theory of the effect of a laser on electron-atom scattering is continued by the derivation of explicit relations between the observed electron-atom scattering cross sections in the presence of a laser and exact electron-atom scattering cross sections with no laser present. No approximation concerning the scattering interaction is made. The only approximations concerning the laser are that (1) the laser-atom interaction energy is small compared to atomic energies, (2) the Rabi frequency times the collision time is small, and (3) the laser intensity in appropriate units is small

Resonance estimates for single spin asymmetries in elastic electron-nucleon scattering

International Nuclear Information System (INIS)

Barbara Pasquini; Marc Vanderhaeghen

2004-01-01

We discuss the target and beam normal spin asymmetries in elastic electron-nucleon scattering which depend on the imaginary part of two-photon exchange processes between electron and nucleon. We express this imaginary part as a phase space integral over the doubly virtual Compton scattering tensor on the nucleon. We use unitarity to model the doubly virtual Compton scattering tensor in the resonance region in terms of γ* N → π N electroabsorption amplitudes. Taking those amplitudes from a phenomenological analysis of pion electroproduction observables, we present results for beam and target normal single spin asymmetries for elastic electron-nucleon scattering for beam energies below 1 GeV and in the 1-3 GeV region, where several experiments are performed or are in progress

Elastic scattering of electrons from singly ionized argon

International Nuclear Information System (INIS)

Griffin, D.C.; Pindzola, M.S.

1996-01-01

Recently, Greenwood et al. [Phys. Rev. Lett. 75, 1062 (1995)] reported measurements of large-angle elastic scattering of electrons from singly ionized argon at an energy of 3.3 eV. They compared their results for the differential cross section with cross sections determined using phase shifts obtained from two different scattering potentials and found large discrepancies between theory and experiment at large angles. They state that these differences may be due to the effects of polarization of the target, which are not included in their calculations, as well as inaccurate representations of electron exchange in the local scattering potentials that are employed to determine the phase shifts. In order to test these proposed explanations of the discrepancies, we have carried out calculations of elastic scattering from Ar + using the R-matrix method. We compare both a single-state calculation, which does not include polarization, and a 17-state calculation, in which the effects of dipole polarizability are included through the use of polarization pseudostates within the close-coupling expansion, to each other and with the measurements. We find some differences between the two calculations at intermediate scattering angles, but very close agreement at angles above 100 degree. Although the calculated cross sections agree with experiment between 120 degree and 135 degree, large discrepancies persist at angles above 135 degree. We conclude that the differences between the measurements and theory cannot be explained on the basis of an inaccurate representation of electron exchange or polarization of the target. copyright 1996 The American Physical Society

Quantitative transmission electron microscopy at atomic resolution

International Nuclear Information System (INIS)

Allen, L J; D'Alfonso, A J; Forbes, B D; Findlay, S D; LeBeau, J M; Stemmer, S

2012-01-01

In scanning transmission electron microscopy (STEM) it is possible to operate the microscope in bright-field mode under conditions which, by the quantum mechanical principle of reciprocity, are equivalent to those in conventional transmission electron microscopy (CTEM). The results of such an experiment will be presented which are in excellent quantitative agreement with theory for specimens up to 25 nm thick. This is at variance with the large contrast mismatch (typically between two and five) noted in equivalent CTEM experiments. The implications of this will be discussed.

Through-transmission laser welding of glass fibre composite: Experimental light scattering identification

Science.gov (United States)

Cosson, Benoit; Asséko, André Chateau Akué; Dauphin, Myriam

2018-05-01

The purpose of this paper is to develop a cost-effective, efficient and quick to implement experimental optical method in order to predict the optical properties (extinction coefficient) of semi-transparent polymer composites. The extinction coefficient takes into account the effects due to the absorption and the scattering phenomena in a semi-transparent component during the laser processes, i.e. TTLW (through-transmission laser welding). The present method used a laser as light source and a reflex camera equipped with a macro lens as a measurement device and is based on the light transmission measurement through different thickness samples. The interaction between the incident laser beam and the semi-transparent composite is exanimated. The results are presented for the case of a semi-transparent composite reinforced with the unidirectional glass fiber (UD). A numerical method, ray tracing, is used to validate the experimental results. The ray tracing method is appropriate to characterize the light-scattering phenomenon in semi-transparent materials.

Transmission electron microscopy of bone

NARCIS (Netherlands)

Everts, Vincent; Niehof, Anneke; Tigchelaar-Gutter, Wikky; Beertsen, Wouter

2012-01-01

This chapter describes procedures to process mineralized tissues obtained from different sources for transmission electron microscopy (TEM). Methods for fixation, resin embedding, staining of semi-thin sections and ultrathin sections are presented. In addition, attention will be paid to processing

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

Science.gov (United States)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Elemental mapping in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Allen, L J; D'Alfonso, A J; Lugg, N R; Findlay, S D; LeBeau, J M; Stemmer, S

2010-01-01

We discuss atomic resolution chemical mapping in scanning transmission electron microscopy (STEM) based on core-loss electron energy loss spectroscopy (EELS) and also on energy dispersive X-ray (EDX) imaging. Chemical mapping using EELS can yield counterintuitive results which, however, can be understood using first principles calculations. Experimental chemical maps based on EDX bear out the thesis that such maps are always likely to be directly interpretable. This can be explained in terms of the local nature of the effective optical potential for ionization under those imaging conditions. This is followed by an excursion into the complementary technique of elemental mapping using energy-filtered transmission electron microscopy (EFTEM) in a conventional transmission electron microscope. We will then consider the widely used technique of Z-contrast or high-angle annular dark field (HAADF) imaging, which is based on phonon excitation, where it has recently been shown that intensity variations can be placed on an absolute scale by normalizing the measured intensities to the incident beam. Results, showing excellent agreement between theory and experiment to within a few percent, are shown for Z-contrast imaging from a sample of PbWO 4 .

Transmission Electron Microscopy of Minerals and Rocks

Science.gov (United States)

McLaren, Alex C.

1991-04-01

Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.

Electron scattering and correlation structure of light nuclei

International Nuclear Information System (INIS)

Lodhi, M.A.K.

1976-01-01

It has been known for some time that the short-range correlations due to the repulsive part of the nuclear interaction is exhibited in the nuclear form factors as obtained from high energy electron scattering. In this work the harmonic oscillator basis functions are used. The nuclear form factors as obtained from elastic electron scattering are calculated, with Jastrow's technique by means of the cluster expansion of Iwamoto Yamada, in the Born approximation. The correlated wave function is given. The results for nuclear form factors calculated with the wave function are presented for some light nuclei. (Auth.)

Transmission electron microscopy of bulk specimens over 10 µm in thickness

Energy Technology Data Exchange (ETDEWEB)

Sadamatsu, Sunao, E-mail: sadamatsu@mech.kagoshima-u.ac.jp [Department of Mechanical Engineering, Kagoshima University, Korimoto, Kagoshima 890-0065 (Japan); Tanaka, Masaki; Higashida, Kenji [Department of Materials Science and Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Matsumura, Syo [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Ultramicroscopy Research Center, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan)

2016-03-15

We succeeded the observation of microstructures in bulk-sized specimens of over 10 µm in thickness by employing a technique that combines transmission electron microscopy (TEM) with energy-filtered imaging based on electron energy-loss spectroscopy (EELS). This method is unique in that it incorporates the inelastically scattered electrons into the imaging process. Using this technique, bright and sharp images of dislocations in crystalline silicon specimens as thick as 10 µm were obtained. A calibration curve to determine foil thickness of such a thick specimen was also derived. This method simply extends the observable thickness range in TEM. If combined with tilt series of observation over a significant range of angle, it will disclose three dimensional nanostructures in a µm-order block of a specimen, promoting our understanding of the controlling mechanisms behind various bulky material properties. - Highlights: • We developed a method which enables thick specimens to be observed using EF-TEM. • The effects of energy filter width and position on images were determined. • We suggested a method to determine the thickness of a thick film sample. • We achieved observation of microstructures in specimens with a thickness of 10 µm.

Neutrino oscillations and neutrino-electron scattering

International Nuclear Information System (INIS)

Kayser, B.; Rosen, S.P.

1980-10-01

Neutrino flavor oscillations can significantly alter the cross section for neutrino-electron scattering. As a result, such oscillations can affect the comparison between existing reactor data and theories of neutral-current processes. They may also lead to strikingly large effects in high-energy accelerator experiments

Electron scattering and transport in liquid argon

Energy Technology Data Exchange (ETDEWEB)

Boyle, G. J.; Cocks, D. G.; White, R. D. [College of Science, Technology and Engineering, James Cook University, Townsville 4810 (Australia); McEachran, R. P. [Research School of Physical Sciences and Engineering, Australian National University, Canberra ACT 0200 (Australia)

2015-04-21

The transport of excess electrons in liquid argon driven out of equilibrium by an applied electric field is revisited using a multi-term solution of Boltzmann’s equation together with ab initio liquid phase cross-sections calculated using the Dirac-Fock scattering equations. The calculation of liquid phase cross-sections extends previous treatments to consider multipole polarisabilities and a non-local treatment of exchange, while the accuracy of the electron-argon potential is validated through comparison of the calculated gas phase cross-sections with experiment. The results presented highlight the inadequacy of local treatments of exchange that are commonly used in liquid and cluster phase cross-section calculations. The multi-term Boltzmann equation framework accounting for coherent scattering enables the inclusion of the full anisotropy in the differential cross-section arising from the interaction and the structure factor, without an a priori assumption of quasi-isotropy in the velocity distribution function. The model, which contains no free parameters and accounts for both coherent scattering and liquid phase screening effects, was found to reproduce well the experimental drift velocities and characteristic energies.

Electron scattering and transport in liquid argon

International Nuclear Information System (INIS)

Boyle, G. J.; Cocks, D. G.; White, R. D.; McEachran, R. P.

2015-01-01

The transport of excess electrons in liquid argon driven out of equilibrium by an applied electric field is revisited using a multi-term solution of Boltzmann’s equation together with ab initio liquid phase cross-sections calculated using the Dirac-Fock scattering equations. The calculation of liquid phase cross-sections extends previous treatments to consider multipole polarisabilities and a non-local treatment of exchange, while the accuracy of the electron-argon potential is validated through comparison of the calculated gas phase cross-sections with experiment. The results presented highlight the inadequacy of local treatments of exchange that are commonly used in liquid and cluster phase cross-section calculations. The multi-term Boltzmann equation framework accounting for coherent scattering enables the inclusion of the full anisotropy in the differential cross-section arising from the interaction and the structure factor, without an a priori assumption of quasi-isotropy in the velocity distribution function. The model, which contains no free parameters and accounts for both coherent scattering and liquid phase screening effects, was found to reproduce well the experimental drift velocities and characteristic energies

A new theoretical model for scattering of electrons by molecules. 1

International Nuclear Information System (INIS)

Peixoto, E.M.A.; Mu-tao, L.; Nogueira, J.C.

1975-01-01

A new theoretical model for electron-molecule scattering is suggested. The e-H 2 scattering is studied and the superiority of the new model over the commonly used Independent Atom Model (IAM) is demonstrated. Comparing theoretical and experimental data for 40keV electrons scattered by H 2 utilizing the new model, its validity is proved, while Partial Wave and First Born calculations, employing the Independent Atom Model, strongly deviated from the experiment [pt

Scattering of ultrarelativistic electrons in ultrathin crystals

Energy Technology Data Exchange (ETDEWEB)

Shul' ga, N.F., E-mail: shulga@kipt.kharkov.ua [National Science Center “Kharkov Institute of Physics and Technology”, 1, Akademichna str., Kharkiv, 61108 (Ukraine); Karazin Kharkiv National University, 4, Svobody sq., Kharkiv, 61000 (Ukraine); Shulga, S.N. [National Science Center “Kharkov Institute of Physics and Technology”, 1, Akademichna str., Kharkiv, 61108 (Ukraine); Karazin Kharkiv National University, 4, Svobody sq., Kharkiv, 61000 (Ukraine)

2017-06-10

Quantum theory is proposed of high energy electrons scattering in ultrathin crystals. This theory is based upon a special representation of the scattering amplitude in the form of an integral over the surface surrounding the crystal, and on the spectral method of determination of the wave function. The comparison is performed of quantum and classical differential scattering cross-sections in the transitional range of crystal thicknesses, from those at which the channeling phenomenon is not developed up to those at which it is established. It is shown that in this thickness range the quantum scattering cross-section, unlike the classical one, contains sharp peaks corresponding to some specific scattering angles, that is connected with the diffraction of the incident plane wave onto the periodically distributed crystal atomic strings. It is shown that the value of the scattering cross-section in the peaks varies periodically with the change of the target thickness. We note that this must lead to a new interference effect in radiation that is connected with the rearrangement of incident wave packet in transitional area of crystal thicknesses.

Scattering of ultrarelativistic electrons in ultrathin crystals

Directory of Open Access Journals (Sweden)

N.F. Shul'ga

2017-06-01

Full Text Available Quantum theory is proposed of high energy electrons scattering in ultrathin crystals. This theory is based upon a special representation of the scattering amplitude in the form of an integral over the surface surrounding the crystal, and on the spectral method of determination of the wave function. The comparison is performed of quantum and classical differential scattering cross-sections in the transitional range of crystal thicknesses, from those at which the channeling phenomenon is not developed up to those at which it is established. It is shown that in this thickness range the quantum scattering cross-section, unlike the classical one, contains sharp peaks corresponding to some specific scattering angles, that is connected with the diffraction of the incident plane wave onto the periodically distributed crystal atomic strings. It is shown that the value of the scattering cross-section in the peaks varies periodically with the change of the target thickness. We note that this must lead to a new interference effect in radiation that is connected with the rearrangement of incident wave packet in transitional area of crystal thicknesses.

Scattering of electrons by alkali-halide molecules: LiBr and CsCl

International Nuclear Information System (INIS)

Vukovic, L.; Zuo, M.; Shen, G.F.; Stumpf, B.; Bederson, B.

1989-01-01

We have investigated small-angle electron scattering by highly polar molecules. Recoil experiments are performed at 5 and 20 eV for electrons scattered by LiBr and CsCl, within the shadow of the unscattered molecular beam. Low-angular-range scattering described by the Born approximation for rotating dipoles, combined with different theories for intermediate- and high-angle scattering, are compared with our results. Evaluated total scattering cross sections as well as momentum-transfer and viscosity cross sections are given. A general two-dimensional analysis of the recoil experiment is presented

Alloy scattering dependence of electron transport in AlGaN

International Nuclear Information System (INIS)

Yarar, Z.; Ozdemir, M.

2010-01-01

The electron transport and velocity characteristics in AlGaN are examined using an ensemble Monte Carlo simulation method. A three valley band structure model where nonparabolicity effects are considered in all valleys is used for Monte Carlo calculations. All of the major electron scattering interactions like acoustic and optical phonon, intervaley, ionized impurity and alloy disorder scatterings are included in the calculations. The velocity-applied electric field characteristics are analyzed as a function of Al molar fraction and temperature in the ranges of x=0.1 to x=0.5 and 77 K to 500 K, respectively. The velocity overshoot is clearly observed and the population of valleys seems well-matched with the occupancy of valleys in AlGaN. The results of electron steady state velocity-field curves are found that the alloy disorder scattering has important effects on the electron transport characteristics of AlGaN.

X-ray, neutron, and electron scattering. Report of a materials sciences workshop

International Nuclear Information System (INIS)

1977-08-01

The ERDA Workshop on X-ray, Neutron, and Electron Scattering to assess needs and establish priorities for energy-related basic research on materials. The general goals of the Workshop were: (1) to review various energy technologies where x-ray, neutron, and electron scattering techniques might make significant contributions, (2) to identify present and future materials problems in the energy technologies and translate these problems into requirements for basic research by x-ray, neutron, and electron scattering techniques, (3) to recommend research areas utilizing these three scattering techniques that should be supported by the DPR Materials Sciences Program, and (4) to assign priorities to these research areas

Scattered radiation from applicators in clinical electron beams.

NARCIS (Netherlands)

Battum, L.J. van; Zee, W. van der; Huizenga, H.

2003-01-01

In radiotherapy with high-energy (4-25 MeV) electron beams, scattered radiation from the electron applicator influences the dose distribution in the patient. In most currently available treatment planning systems for radiotherapy this component is not explicitly included and handled only by a slight

Small angle elastic scattering of electrons by noble gas atoms

International Nuclear Information System (INIS)

Wagenaar, R.W.

1984-01-01

In this thesis, measurements are carried out to obtain small angle elastic differential cross sections in order to check the validity of Kramers-Kronig dispersion relations for electrons scattered by noble gas atoms. First, total cross sections are obtained for argon, krypton and xenon. Next, a parallel plate electrostatic energy analyser for the simultaneous measurement of doubly differential cross section for small angle electron scattering is described. Also absolute differential cross sections are reported. Finally the forward dispersion relation for electron-helium collisions is dealt with. (Auth.)

Chiral recognition in electron scattering by S- and R-2-butanol

DEFF Research Database (Denmark)

Jones, Nykola C.; Hoffmann, Søren Vrønning; Field, David

2015-01-01

Experiments are described involving the low energy scattering of electrons from the two optical enantiomers S- and R- 2-butanol. Using a synchrotron radiation photoionization source on the ASTRID storage ring, scattering spectra are reported between a few meV and 140 meV at an electron energy...

Compton scattering of photons from electrons bound in light elements

International Nuclear Information System (INIS)

Bergstrom, P.M. Jr.

1994-01-01

A brief introduction to the topic of Compton scattering from bound electrons is presented. The fundamental nature of this process in understanding quantum phenomena is reviewed. Methods for accurate theoretical evaluation of the Compton scattering cross section are presented. Examples are presented for scattering of several keV photons from helium

Spin entanglement in elastic electron scattering from lithium atoms

Science.gov (United States)

Bartschat, K.; Santos, S. Fonseca dos

2017-04-01

In two recent papers [Blum and Lohmann, Phys. Rev. Lett. 116, 033201 (2016), 10.1103/PhysRevLett.116.033201; Lohmann et al., Phys. Rev. A 94, 032331 (2016), 10.1103/PhysRevA.94.032331], the possibility of continuously varying the degree of entanglement between an elastically scattered electron and the valence electron of an alkali-metal target was discussed. To estimate how well such a scheme may work in practice, we present results for elastic electron scattering from lithium in the energy regime of 1 -5 eV and the full range of scattering angles 0∘-180∘ . The most promising regime for Bell correlations in this particular collision system are energies between about 1.5 and 3.0 eV, in an angular range around 110∘±10∘ . In addition to the relative exchange asymmetry parameter, we present the differential cross section that is important when estimating the count rate and hence the feasibility of experiments using this system.

A multislice theory of electron inelastic scattering in a solid

International Nuclear Information System (INIS)

Wang, Z.L.

1989-01-01

A multislice theory is proposed to solve Yoshioka's coupling equations for elastic and inelastic scattered high-energy electrons in a solid. This method is capable, in principle, of including the non-periodic crystal structures and the electron multiple scattering among all the excited states in the calculations. It is proved that the proposed theory for calculating the energy-filtered inelastic images, based on the physical optics approach, is equivalent to the quantum-mechanical theory under some approximations. The basic theory of simulating the energy-filtered inelastic image of core-shell losses and thermal diffuse scattering is outlined. (orig.)

Difference in x-ray scattering between metallic and non-metallic liquids due to conduction electrons

International Nuclear Information System (INIS)

Chihara, Junzo

1987-01-01

X-ray scattered intensity from a liquid metal as an electron-ion mixture is described using the structure factors, which are exactly expressed in terms of the static and dynamic direct correlation functions. This intensity for a metal is shown to differ from the usual scattered intensity from a non-metal in two points: the atomic form factor and the incoherent (Compton) scattering factor. It is shown that the valence electron form factor, which constitutes the atomic form factor in a liquid metal, leads to a determination of the electron-electron and electron-ion structure factors by combining the ionic structure factor. It is also shown that a part of the electron structure factor, which appears as the incoherent x-ray scattering, is usually approximated as the electron structure factor of the jellium model in the case of a simple metal. As a by-product, the x-ray scattered intensity from a crystalline metal and the inelastic scattering from a liquid metal are given by taking account of the presence of conduction electrons. In this way, we clarify some confusion which appeared in the proposal by Egelstaff et al for extracting the electron-electron correlation function in a metal from x-ray and neutron scattering experiments. A procedure to extract the electron-electron and electron-ion structure factors in a liquid metal is proposed on the basis of formula for scattered intensity derived here. (author)

Energy and angular distribution of electrons after transmission of thick layers

International Nuclear Information System (INIS)

Kreyling, H.

1975-01-01

In this work, the behaviour of electrons going through material-layers is studied. For a layer-thickness where the theories of multiple-scattering are no longer valid, a Monte-Carlo-method is presented for the calculation of energy distributions as a function of scattering-angle. Plastic-scintillator-material (NE 102 A produced by Nuclear Enterprises Ltd.) was bombarded by electrons with energies between 0.5 and 2.0 MeV and the energy-distributions of the electrons, scatterd in the layer, were measured as a function of the scattering-angle. With the aid of the Monte-Carlo-method developed in this paper, energy distributions were calculated as a function of scattering-angle for the two absorber materials aluminium (single-element material) and NE 102 A (chemical compound of C, N, H, O). (orig./WL) [de

Three-dimensional imaging of individual point defects using selective detection angles in annular dark field scanning transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Johnson, Jared M.; Im, Soohyun; Windl, Wolfgang; Hwang, Jinwoo, E-mail: hwang.458@osu.edu

2017-01-15

We propose a new scanning transmission electron microscopy (STEM) technique that can realize the three-dimensional (3D) characterization of vacancies, lighter and heavier dopants with high precision. Using multislice STEM imaging and diffraction simulations of β-Ga{sub 2}O{sub 3} and SrTiO{sub 3}, we show that selecting a small range of low scattering angles can make the contrast of the defect-containing atomic columns substantially more depth-dependent. The origin of the depth-dependence is the de-channeling of electrons due to the existence of a point defect in the atomic column, which creates extra “ripples” at low scattering angles. The highest contrast of the point defect can be achieved when the de-channeling signal is captured using the 20–40 mrad detection angle range. The effect of sample thickness, crystal orientation, local strain, probe convergence angle, and experimental uncertainty to the depth-dependent contrast of the point defect will also be discussed. The proposed technique therefore opens new possibilities for highly precise 3D structural characterization of individual point defects in functional materials. - Highlights: • A new electron microscopy technique that can visualize 3D position of point defect is proposed. • The technique relies on the electron de-channeling signals at low scattering angles. • The technique enables precise determination of the depth of vacancies and lighter impurity atoms.

Transmission electron microscopy of amyloid fibrils.

Science.gov (United States)

Gras, Sally L; Waddington, Lynne J; Goldie, Kenneth N

2011-01-01

Transmission Electron Microscopy of negatively stained and cryo-prepared specimens allows amyloid fibrils to be visualised at high resolution in a dried or a hydrated state, and is an essential method for characterising the morphology of fibrils and pre-fibrillar species. We outline the key steps involved in the preparation and observation of samples using negative staining and cryo-electron preservation. We also discuss methods to measure fibril characteristics, such as fibril width, from electron micrographs.

Electron attenuation anisotropy at crystal surfaces from LEED

Czech Academy of Sciences Publication Activity Database

Romanyuk, Olexandr; Bartoš, Igor

2009-01-01

Roč. 603, č. 17 (2009), s. 2789-2792 ISSN 0039-6028 R&D Projects: GA ČR GA202/07/0601; GA AV ČR IAA100100628 Institutional research plan: CEZ:AV0Z10100521 Keywords : electron attenuation length, low energy electron diffraction, photoelectron diffraction, electron–solid scattering and transmission, copper * low energy electron diffraction * photoelectron diffraction * electron–solid scattering and transmission * copper Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.798, year: 2009 http://dx.doi.org/10.1016/j.susc.2009.07.024

Multislice theory of fast electron scattering incorporating atomic inner-shell ionization

International Nuclear Information System (INIS)

Dwyer, C.

2005-01-01

It is demonstrated how atomic inner-shell ionization can be incorporated into a multislice theory of fast electron scattering. The resulting theory therefore accounts for both inelastic scattering due to inner-shell ionization and dynamical elastic scattering. The theory uses a description of the ionization process based on the angular momentum representation for both the initial and final states of the atomic electron. For energy losses near threshold, only a small number of independent states of the ejected atomic electron need to be considered, reducing demands on computing time, and eliminating the need for tabulated inelastic scattering factors. The theory is used to investigate the influence of the collection aperture size on the spatial origin of the silicon K-shell EELS signal generated by a STEM probe. The validity of a so-called local approximation is also considered

Inversion of electron-water elastic scattering data

International Nuclear Information System (INIS)

Lun, A.; Chen, X.J.; Allen, L.J.; Amos, K.

1994-01-01

Fixed energy inverse scattering theory has been used to analyse the differential cross-sections for the elastic scattering of electrons from water molecules. Both semiclassical (WKB) and fully quantal inversion methods have been used with data taken in the energy range 100 to 1000 eV. Constrained to be real, the local inversion potentials are found to be energy dependent; a dependence that can be interpreted as the local equivalence of true nonlocality in the actual interaction. 14 refs., 4 tabs., 8 figs

A novel technique for determining luminosity in electron-scattering/positron-scattering experiments from multi-interaction events

Science.gov (United States)

Schmidt, A.; O'Connor, C.; Bernauer, J. C.; Milner, R.

2018-01-01

The OLYMPUS experiment measured the cross-section ratio of positron-proton elastic scattering relative to electron-proton elastic scattering to look for evidence of hard two-photon exchange. To make this measurement, the experiment alternated between electron beam and positron beam running modes, with the relative integrated luminosities of the two running modes providing the crucial normalization. For this reason, OLYMPUS had several redundant luminosity monitoring systems, including a pair of electromagnetic calorimeters positioned downstream from the target to detect symmetric Møller and Bhabha scattering from atomic electrons in the hydrogen gas target. Though this system was designed to monitor the rate of events with single Møller/Bhabha interactions, we found that a more accurate determination of relative luminosity could be made by additionally considering the rate of events with both a Møller/Bhabha interaction and a concurrent elastic ep interaction. This method was improved by small corrections for the variance of the current within bunches in the storage ring and for the probability of three interactions occurring within a bunch. After accounting for systematic effects, we estimate that the method is accurate in determining the relative luminosity to within 0.36%. This precise technique can be employed in future electron-proton and positron-proton scattering experiments to monitor relative luminosity between different running modes.

Modelling Thomson scattering for systems with non-equilibrium electron distributions

Directory of Open Access Journals (Sweden)

Chapman D.A.

2013-11-01

Full Text Available We investigate the effect of non-equilibrium electron distributions in the analysis of Thomson scattering for a range of conditions of interest to inertial confinement fusion experiments. Firstly, a generalised one-component model based on quantum statistical theory is given in the random phase approximation (RPA. The Chihara expression for electron-ion plasmas is then adapted to include the new non-equilibrium electron physics. The theoretical scattering spectra for both diffuse and dense plasmas in which non-equilibrium electron distributions are expected to arise are considered. We find that such distributions strongly influence the spectra and are hence an important consideration for accurately determining the plasma conditions.

An Efficient Method for Electron-Atom Scattering Using Ab-initio Calculations

Energy Technology Data Exchange (ETDEWEB)

Xu, Yuan; Yang, Yonggang; Xiao, Liantuan; Jia, Suotang [Shanxi University, Taiyuan (China)

2017-02-15

We present an efficient method based on ab-initio calculations to investigate electron-atom scatterings. Those calculations profit from methods implemented in standard quantum chemistry programs. The new approach is applied to electron-helium scattering. The results are compared with experimental and other theoretical references to demonstrate the efficiency of our method.

Identification and angle reconstruction of the scattered electron with the ZEUS calorimeter

International Nuclear Information System (INIS)

Doeker, T.

1992-10-01

For the analysis of deep-inelastic electron-proton events with the ZEUS detector, a key ingredient is the reliable and efficient identification of a scattered electron. To this end an essential mean is the information from the uranium-scintillator calorimeter. In this work an algorithm is presented which uses the segmentation properties of the ZEUS calorimeter to identify the scattered electron in neutral current events. For energy deposits in adjacent calorimeter cells the algorithm determines the probability that these deposits result from an electromagnetic shower. Furthermore several methods of measuring the scattering angle of the final state electron are compared. An angular resolution of about 3 mrad is obtained. (orig.) [de

The influence of structure depth on image blurring of micrometres-thick specimens in MeV transmission electron imaging.

Science.gov (United States)

Wang, Fang; Sun, Ying; Cao, Meng; Nishi, Ryuji

2016-04-01

This study investigates the influence of structure depth on image blurring of micrometres-thick films by experiment and simulation with a conventional transmission electron microscope (TEM). First, ultra-high-voltage electron microscope (ultra-HVEM) images of nanometer gold particles embedded in thick epoxy-resin films were acquired in the experiment and compared with simulated images. Then, variations of image blurring of gold particles at different depths were evaluated by calculating the particle diameter. The results showed that with a decrease in depth, image blurring increased. This depth-related property was more apparent for thicker specimens. Fortunately, larger particle depth involves less image blurring, even for a 10-μm-thick epoxy-resin film. The quality dependence on depth of a 3D reconstruction of particle structures in thick specimens was revealed by electron tomography. The evolution of image blurring with structure depth is determined mainly by multiple elastic scattering effects. Thick specimens of heavier materials produced more blurring due to a larger lateral spread of electrons after scattering from the structure. Nevertheless, increasing electron energy to 2MeV can reduce blurring and produce an acceptable image quality for thick specimens in the TEM. Copyright © 2016 Elsevier Ltd. All rights reserved.

Study of Cr52 and Ca40 nuclei by electron scattering

International Nuclear Information System (INIS)

Blum, Daniel

1966-01-01

As high energy electron scattering is a powerful mean to study nuclear structure, this research thesis first reports and comments results obtained while taking the Born approximation into account, and which are useful to interpret electron scattering experiments. The author describes how nucleus charge distribution parameters are obtained from these results of elastic scattering, and then addresses the case of inelastic scattering. Three nuclear models are presented. Then, after a brief presentation of the characteristics of the experimental installation, the author describes how raw results are processed to obtain cross sections, and discusses errors. The last parts address the study of chromium 52 and calcium 40 nuclei

Electron scattering from nucleons and deuterons at intermediate energies

International Nuclear Information System (INIS)

Burkert, V.

1985-04-01

Recent results from electron scattering of nucleons and deuterons are discussed. A tentative physics program for ELSA employing the polarized electron beams as well as the polarized nucleon and deuteron target facilities is outlined. (orig.)

Coupled-channel optical calculation of electron-atom scattering: elastic scattering from sodium at 20 to 150 eV

International Nuclear Information System (INIS)

Bray, Igor; Konovalov, D.A.; McCarthy, I.E.

1991-04-01

A coupled-channel optical method for electron-atom scattering is applied to elastic electron-sodium scattering at energies of 20, 22.1, 54.4, 100, and 150 eV. It is demonstrated that the effect of all the inelastic channels on elastic scattering may be well reproduced by the 'ab initio' calculated complex non-local polarization potential. Whilst the experiments generally agree at small angles and therefore agree on the total elastic cross section, there is considerable discrepancy at intermediate and backward angles. 9 refs., 2 tabs., 1 fig

Evaluation of scatter correction using a single isotope for simultaneous emission and transmission data

International Nuclear Information System (INIS)

Yang, J.; Kuikka, J.T.; Vanninen, E.; Laensimies, E.; Kauppinen, T.; Patomaeki, L.

1999-01-01

Photon scatter is one of the most important factors degrading the quantitative accuracy of SPECT images. Many scatter correction methods have been proposed. The single isotope method was proposed by us. Aim: We evaluate the scatter correction method of improving the quality of images by acquiring emission and transmission data simultaneously with single isotope scan. Method: To evaluate the proposed scatter correction method, a contrast and linearity phantom was studied. Four female patients with fibromyalgia (FM) syndrome and four with chronic back pain (BP) were imaged. Grey-to-cerebellum (G/C) and grey-to-white matter (G/W) ratios were determined by one skilled operator for 12 regions of interest (ROIs) in each subject. Results: The linearity of activity response was improved after the scatter correction (r=0.999). The y-intercept value of the regression line was 0.036 (p [de

Nucleons, mesons and quarks: the electron scattering approach

International Nuclear Information System (INIS)

Frois, B.

1985-05-01

A few examples of the research carried out by electron scattering in order to elucidate the relevant degrees of freedom for nuclear physics. Is considered first quasielastic scattering from 3 He which gives some insight into the properties of the nucleon in the nuclear medium. Then examples of meson exchange currents are presented. Finally, the present status of our understanding of shorter range effects is discussed

Forward elastic scattering of electrons by hydrogen atoms

Energy Technology Data Exchange (ETDEWEB)

Garibotti, C.R. (Instituto de Fisica Teorica, R. Pamplona 145, Sao Paulo (Brazil)); Massaro, P.A. (Bari Univ. (Italy). Ist. di Fisica)

1978-01-11

The available theoretical and experimental values for the elastic, inelastic and ionization cross-sections of electrons by hydrogen atoms are used to obtain the total cross-section. The optical theorem and a dispersion relation are used to calculate the forward e-H scattering amplitude for medium and high energies. Using this quantity the reliability of the Born expansion for elastic e-H scattering is tested.

Transmission Electron Microscope Measures Lattice Parameters

Science.gov (United States)

Pike, William T.

1996-01-01

Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

Electron Scattering from MERCURY-198 and Mercury -204.

Science.gov (United States)

Laksanaboonsong, Jarungsaeng

This experiment is the first electron scattering study on mercury isotopes. Electron scattering from ^{198}Hg and ^{204 }Hg has been performed at the NIKHEF-K Medium Energy Accelerator. Measured cross sections cover an effective momentum transfer range from 0.4 to 2.9 fm^ {-1}. Elastic cross sections were determined for scattering from both isotopes. Cross section for inelastic excitations in ^{198}Hg below 3 MeV were also determined. Measured cross sections were fit using DWBA phase shift codes to determine coefficients for Fourier-Bessel expansions of ground state and transition charge densities. Differences between the ground state charge densities of the two isotopes reveal the effect of the polarization of the proton core in response to the addition of neutrons. Spin and parity of several excited states of ^{198}Hg were determined. Extracted transition densities of these states show their predominantly collective nature. Charge densities for members of the ground state rotational band were compared with axially symmetric Hartree-Fock and geometrical model predictions.

Electron-helium scattering in Debye plasmas

International Nuclear Information System (INIS)

Zammit, Mark C.; Fursa, Dmitry V.; Bray, Igor; Janev, R. K.

2011-01-01

Electron-helium scattering in weakly coupled hot-dense (Debye) plasma has been investigated using the convergent close-coupling method. The Yukawa-type Debye-Hueckel potential has been used to describe plasma Coulomb screening effects. Benchmark results are presented for momentum transfer cross sections, excitation, ionization, and total cross sections for scattering from the ground and metastable states of helium. Calculations cover the entire energy range up to 1000 eV for the no screening case and various Debye lengths (5-100 a 0 ). We find that as the screening interaction increases, the excitation and total cross sections decrease, while the total ionization cross sections increase.

Electron-cyclotron wave scattering by edge density fluctuations in ITER

Science.gov (United States)

Tsironis, Christos; Peeters, Arthur G.; Isliker, Heinz; Strintzi, Dafni; Chatziantonaki, Ioanna; Vlahos, Loukas

2009-11-01

The effect of edge turbulence on the electron-cyclotron wave propagation in ITER is investigated with emphasis on wave scattering, beam broadening, and its influence on localized heating and current drive. A wave used for electron-cyclotron current drive (ECCD) must cross the edge of the plasma, where density fluctuations can be large enough to bring on wave scattering. The scattering angle due to the density fluctuations is small, but the beam propagates over a distance of several meters up to the resonance layer and even small angle scattering leads to a deviation of several centimeters at the deposition location. Since the localization of ECCD is crucial for the control of neoclassical tearing modes, this issue is of great importance to the ITER design. The wave scattering process is described on the basis of a Fokker-Planck equation, where the diffusion coefficient is calculated analytically as well as computed numerically using a ray tracing code.

Electron enhanced Raman scattering and its applications in solution chemistry

International Nuclear Information System (INIS)

Yui, Hiroharu

2007-01-01

The present review describes a new enhancement technique for Raman scattering in aqueous solutions. Raman scattering spectroscopy has an inherent ability to distinguish between molecules with great similarity and provides useful information on local physical and chemical environments at their functional groups' level. Since the Raman scattering signals from water molecules are quite weak, Raman spectroscopy has great advantage for detection or discrimination of a trace amount of analytes in aqueous environments. However, Raman scattering cross-sections are inherently small and it generally requires high power excitation and long acquisition times to obtain high-quality Raman spectra. These conditions create disadvantages for the analyses for living cells and real-time monitoring for environmental analyses. Here, I describe a new Raman enhancement technique, namely electron enhanced Raman scattering (EERS)', where artificially generated electrons additionally affect the polarizability of target molecular systems and enhance their inherent Raman cross-section. Principles of the EERS and its applications to aqueous solution are presented. (author)

Exact Time-Dependent Exchange-Correlation Potential in Electron Scattering Processes

Science.gov (United States)

Suzuki, Yasumitsu; Lacombe, Lionel; Watanabe, Kazuyuki; Maitra, Neepa T.

2017-12-01

We identify peak and valley structures in the exact exchange-correlation potential of time-dependent density functional theory that are crucial for time-resolved electron scattering in a model one-dimensional system. These structures are completely missed by adiabatic approximations that, consequently, significantly underestimate the scattering probability. A recently proposed nonadiabatic approximation is shown to correctly capture the approach of the electron to the target when the initial Kohn-Sham state is chosen judiciously, and it is more accurate than standard adiabatic functionals but ultimately fails to accurately capture reflection. These results may explain the underestimation of scattering probabilities in some recent studies on molecules and surfaces.

Measurement of recoil photon polarisation in the electron-proton elastic scattering

International Nuclear Information System (INIS)

Buon, Jean

1965-02-01

This research thesis reports and discusses an experiment which aimed at checking the validity of the Born approximation at the first order in the elastic scattering of high energy electrons on protons. In this experiment, the recoil proton polarisation is measured in an elastic scattering of electrons with energy of 950 MeV and scattering at about 90 degrees in the mass centre system. The author describes the experimental installation, its operation and data collection, reports the analysis of photos and polarisation calculations and errors [fr

Dynamics of Supported Metal Nanoparticles Observed in a CS Corrected Environmental Transmission Electron Microscope

DEFF Research Database (Denmark)

Hansen, Thomas Willum; Dunin-Borkowski, Rafal E.; Wagner, Jakob Birkedal

resulting in the formation of larger particles and a loss of catalytic performance. Several models of sintering in different systems have been put forward [1,2]. However, most investigations have been post mortem studies, revealing only the final state of the catalyst. Transmission electron microscopy (TEM....... The combined capabilities of ETEM and image CS correction provide unique possibilities to study this relationship. However, in order to fully quantify image contrast from such experiments, a deeper understanding of the scattering of fast electrons in the presence of gas molecules in the pole piece gap...... of the microscope is needed. As industrial catalysts are usually complex high surface area materials, they are often not suited for fundamental studies. For this purpose, model systems consisting of gold nanoparticles on sheets of low surface area boron nitride and graphite supports were produced. Sheets...

Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review

Directory of Open Access Journals (Sweden)

Shu Xia Tao

2016-12-01

Full Text Available Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided.

Generalized Hartree-Fock method for electron-atom scattering

International Nuclear Information System (INIS)

Rosenberg, L.

1997-01-01

In the widely used Hartree-Fock procedure for atomic structure calculations, trial functions in the form of linear combinations of Slater determinants are constructed and the Rayleigh-Ritz minimum principle is applied to determine the best in that class. A generalization of this approach, applicable to low-energy electron-atom scattering, is developed here. The method is based on a unique decomposition of the scattering wave function into open- and closed-channel components, so chosen that an approximation to the closed-channel component may be obtained by adopting it as a trial function in a minimum principle, whose rigor can be maintained even when the target wave functions are imprecisely known. Given a closed-channel trial function, the full scattering function may be determined from the solution of an effective one-body Schroedinger equation. Alternatively, in a generalized Hartree-Fock approach, the minimum principle leads to coupled integrodifferential equations to be satisfied by the basis functions appearing in a Slater-determinant representation of the closed-channel wave function; it also provides a procedure for optimizing the choice of nonlinear parameters in a variational determination of these basis functions. Inclusion of additional Slater determinants in the closed-channel trial function allows for systematic improvement of that function, as well as the calculated scattering parameters, with the possibility of spurious singularities avoided. Electron-electron correlations can be important in accounting for long-range forces and resonances. These correlation effects can be included explicitly by suitable choice of one component of the closed-channel wave function; the remaining component may then be determined by the generalized Hartree-Fock procedure. As a simple test, the method is applied to s-wave scattering of positrons by hydrogen. copyright 1997 The American Physical Society

Electron Dynamics by Inelastic X-Ray Scattering

CERN Document Server

Schülke, Winfried

2007-01-01

The book offers the first comprehensive review of experimental methods, theory, and successful applications of synchrotron radiation based inelastic X-ray scattering (IXS) spectroscopy, which enables the investigation of electron dynamics in condensed matter (correlated motion and excitation).

Spin entanglement in elastic electron scattering from quasi-one electron atoms

Science.gov (United States)

Fonseca Dos Santos, Samantha; Bartschat, Klaus

2017-04-01

We have extended our work on e-Li collisions to investigate low-energy elastic electron collisions with atomic hydrogen and other alkali targets (Na,K,Rb). These systems have been suggested for the possibility of continuously varying the degree of entanglement between the elastically scattered projectile and the valence electron. In order to estimate how well such a scheme may work in practice, we carried out overview calculations for energies between 0 and 10 eV and the full range of scattering angles 0° -180° . In addition to the relative exchange asymmetry parameter that characterizes the entanglement, we present the differential cross section in order to estimate whether the count rates in the most interesting energy-angle regimes are sufficient to make such experiments feasible in practice. Work supported by the NSF under PHY-1403245.

Electrons scattered inside small dust grains of various materials

International Nuclear Information System (INIS)

Richterova, Ivana; Beranek, Martin; Pavlu, Jiri; Nemecek, Zdenek; Safrankova, Jana

2010-01-01

The dust grain charge in an electron beam is given by a difference in numbers of electrons that fall onto the grain and those leaving it. Electrons with energies exceeding 1 keV can penetrate through submicron-sized dust grains. If the grain is small enough, a yield of these electrons reaches unity but they leave a part of their energy inside the grain and this energy excites secondary electrons. The paper presents a hybrid Monte Carlo code that simulates paths of the primary electrons inside a spherical grain and provides the yield of scattered electrons and their energy spectrum as a function of the grain size and material. This code is based on the Richterovaet al. [Phys. Rev. B 74, 235430 (2006)] model but it includes several corrections important for light materials like carbon or ice. The model was verified using experimental results obtained on large planar samples. For spherical samples, we have found that the yield of scattered electrons reaches unity for 50 nm Au grains illuminated by 5 keV electrons, whereas the same effect can be observed on ≅1000 nm carbon grains.

Evaluation of scatter correction using a single isotope for simultaneous emission and transmission data

Energy Technology Data Exchange (ETDEWEB)

Yang, J.; Kuikka, J.T.; Vanninen, E.; Laensimies, E. [Kuopio Univ. Hospital (Finland). Dept. of Clinical Physiology and Nuclear Medicine; Kauppinen, T.; Patomaeki, L. [Kuopio Univ. (Finland). Dept. of Applied Physics

1999-05-01

Photon scatter is one of the most important factors degrading the quantitative accuracy of SPECT images. Many scatter correction methods have been proposed. The single isotope method was proposed by us. Aim: We evaluate the scatter correction method of improving the quality of images by acquiring emission and transmission data simultaneously with single isotope scan. Method: To evaluate the proposed scatter correction method, a contrast and linearity phantom was studied. Four female patients with fibromyalgia (FM) syndrome and four with chronic back pain (BP) were imaged. Grey-to-cerebellum (G/C) and grey-to-white matter (G/W) ratios were determined by one skilled operator for 12 regions of interest (ROIs) in each subject. Results: The linearity of activity response was improved after the scatter correction (r=0.999). The y-intercept value of the regression line was 0.036 (p<0.0001) after scatter correction and the slope was 0.954. Pairwise correlation indicated the agreement between nonscatter corrected and scatter corrected images. Reconstructed slices before and after scatter correction demonstrate a good correlation in the quantitative accuracy of radionuclide concentration. G/C values have significant correlation coefficients between original and corrected data. Conclusion: The transaxial images of human brain studies show that the scatter correction using single isotope in simultaneous transmission and emission tomography provides a good scatter compensation. The contrasts were increased on all 12 ROIs. The scatter compensation enhanced details of physiological lesions. (orig.) [Deutsch] Die Photonenstreuung gehoert zu den wichtigsten Faktoren, die die quantitative Genauigkeit von SPECT-Bildern vermindern. Es wurde eine ganze Reihe von Methoden zur Streuungskorrektur vorgeschlagen. Von uns wurde die Einzelisotopen-Methode empfohlen. Ziel: Wir untersuchten die Streuungskorrektur-Methode zur Verbesserung der Bildqualitaet durch simultane Gewinnung von Emissions

Electron scattering in the interacting boson model

NARCIS (Netherlands)

Dieperink, AEL; Iachello, F; Rinat, A; Creswell, C

1978-01-01

It is suggested that the interacting boson model be used in the analysis of electron scattering data. Qualitative features of the expected behavior of the inelastic excitation of some 2 ÷ states inthe transitional Sm-Nd region are discussed

Elastic scattering of low-energy electrons with Sr atoms

International Nuclear Information System (INIS)

Yuan, J.; Zhang, Z.; Wan, H.

1990-01-01

Static-exchange, plus correlation-polarization-potential calculations are performed for elastic low-energy electron scattering from Sr atoms while paying attention to the low-lying shape resonances. The correlation potential is calculated both with and without a scaling factor. A 2 D-shape resonance is produced at 1.0 eV with a parameter-free, and at 1.25 eV with a scaled, correlation potential. No 2 P-shape resonances are predicted, but evidence to support the existence of a stable negative ion Sr - in the 5s 2 5p electron configuration is given from the viewpoint of electron scattering. The bound energy of the extra electron in the negative ion is estimated by transforming the phase shift of the corresponding partial wave into the polarization quantum-defect number and extrapolating the number from positive to negative energies

Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited)

Energy Technology Data Exchange (ETDEWEB)

Follett, R. K., E-mail: rfollett@lle.rochester.edu; Delettrez, J. A.; Edgell, D. H.; Henchen, R. J.; Katz, J.; Myatt, J. F.; Froula, D. H. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623 (United States)

2016-11-15

Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10{sup 21} cm{sup −3}, which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra to show the improvements in plasma characterization.

Spin dependence in superelastic electron scattering from Na(3P)

International Nuclear Information System (INIS)

McClelland, J.J.; Kelley, M.H.; Celotta, R.J.

1985-01-01

Measurements are presented of spin asymmetries for superelastic scattering of 10-eV spin polarized electrons from the excited Na(3P/sub 3/2/) state created by linearly polarized laser optical pumping. Asymmetries as large as 16% are observed in scattering from a state which is not spin-polarized. Results are shown both as a function of scattering angle with fixed laser polarization direction, and as a function of the laser polarization direction at a fixed scattering angle

Transmission environmental scanning electron microscope with scintillation gaseous detection device

International Nuclear Information System (INIS)

Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

2015-01-01

A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. - Highlights: • Novel scanning transmission electron microscopy (STEM) with an environmental scanning electron microscope (ESEM) called TESEM. • Use of the gaseous detection device (GDD) in scintillation mode that allows high resolution bright and dark field imaging in the TESEM. • Novel approach towards a unification of both vacuum and environmental conditions in both bulk/surface and transmission mode of electron microscopy

Electron scattering at interfaces in nano-scale vertical interconnects: A combined experimental and ab initio study

Science.gov (United States)

Lanzillo, Nicholas A.; Restrepo, Oscar D.; Bhosale, Prasad S.; Cruz-Silva, Eduardo; Yang, Chih-Chao; Youp Kim, Byoung; Spooner, Terry; Standaert, Theodorus; Child, Craig; Bonilla, Griselda; Murali, Kota V. R. M.

2018-04-01

We present a combined theoretical and experimental study on the electron transport characteristics across several representative interface structures found in back-end-of-line interconnect stacks for advanced semiconductor manufacturing: Cu/Ta(N)/Co/Cu and Cu/Ta(N)/Ru/Cu. In particular, we evaluate the impact of replacing a thin TaN barrier with Ta while considering both Co and Ru as wetting layers. Both theory and experiment indicate a pronounced reduction in vertical resistance when replacing TaN with Ta, regardless of whether a Co or Ru wetting layer is used. This indicates that a significant portion of the total vertical resistance is determined by electron scattering at the Cu/Ta(N) interface. The electronic structure of these nano-sized interconnects is analyzed in terms of the atom-resolved projected density of states and k-resolved transmission spectra at the Fermi level. This work further develops a fundamental understanding of electron transport and material characteristics in nano-sized interconnects.

Electron Raman scattering in semiconductor quantum wire in an external magnetic field

International Nuclear Information System (INIS)

Betancourt-Riera, Ri; Nieto Jalil, J M; Riera, R; Betancourt-Riera, Re; Rosas, R

2008-01-01

The differential cross-section for an electron Raman scattering process in a semiconductor quantum wire in the presence of an external magnetic field perpendicular to the plane of confinement is calculated. We assume a single parabolic conduction band. The emission spectra for different scattering configurations and the selection rules for the processes are studied. Singularities in the spectra are found and interpreted. The electron Raman scattering studied here can be used to provide direct information about the electron band and subband structure of these confinement systems. The magnetic field distribution is considered constant with value B 0 inside the wire and zero outside

Electron scattering and nuclear structure

International Nuclear Information System (INIS)

Frois, B.

1987-01-01

The search for the appropriate degrees of freedom to describe nuclei is the central focus of nuclear physics today. Therefore the authors explore in this review their current understanding of nuclear structure as defined by electromagnetic data. The precision of the electromagnetic probe allows us to define accurately the limits of present theoretical descriptions. The authors review here a broad range of subjects that have been addressed by recent experiments, from the study of meson exchange currents and single-particle distributions to collective excitations in heavy nuclei. However, they do not discuss elastic magnetic scattering, inelastic excitation of discrete states, or single-nucleon knockout reactions since these reactions were recently reviewed. The principal aim of this review is to offer a fresh perspective on nuclear structure, based on the new generation of electron scattering data presented here and in the above-mentioned articles

Electron scattering in the interacting boson model

International Nuclear Information System (INIS)

Dieperink, A.E.L.; Iachello, F.; Creswell, C.

1978-01-01

It is suggested that the interacting boson model be used in the analysis of electron scattering data. Qualitative features of the expected behavior of the inelastic excitation of some 2 + states in the transitional Sm-Nd region are discussed. (Auth.)

New developments in transmission electron microscopy for nanotechnology

International Nuclear Information System (INIS)

Wang, Z.L.

2003-01-01

High-resolution transmission electron microscopy (HRTEM) is one of the most powerful tools used for characterizing nanomaterials, and it is indispensable for nanotechnology. This paper reviews some of the most recent developments in electron microscopy techniques for characterizing nanomaterials. The review covers the following areas: in-situ microscopy for studying dynamic shape transformation of nanocrystals; in-situ nanoscale property measurements on the mechanical, electrical and field emission properties of nanotubes/nanowires; environmental microscopy for direct observation of surface reactions; aberration-free angstrom-resolution imaging of light elements (such as oxygen and lithium); high-angle annular-dark-field scanning transmission electron microscopy (STEM); imaging of atom clusters with atomic resolution chemical information; electron holography of magnetic materials; and high-spatial resolution electron energy-loss spectroscopy (EELS) for nanoscale electronic and chemical analysis. It is demonstrated that the picometer-scale science provided by HRTEM is the foundation of nanometer-scale technology. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

Electron scattering in graphene with adsorbed NaCl nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Drabińska, Aneta, E-mail: Aneta.Drabinska@fuw.edu.pl; Kaźmierczak, Piotr; Bożek, Rafał; Karpierz, Ewelina; Wysmołek, Andrzej; Kamińska, Maria [Faculty of Physics, University of Warsaw, Pasteura 5, 02-093 Warsaw (Poland); Wołoś, Agnieszka [Faculty of Physics, University of Warsaw, Pasteura 5, 02-093 Warsaw (Poland); Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warsaw (Poland); Pasternak, Iwona; Strupiński, Włodek [Institute of Electronic Materials Technology, Wólczyńska 133, 01-919 Warsaw (Poland); Krajewska, Aleksandra [Institute of Electronic Materials Technology, Wólczyńska 133, 01-919 Warsaw (Poland); Institute of Optoelectronics, Military University of Technology, Kaliskiego 2, 00-908 Warsaw (Poland)

2015-01-07

In this work, the results of contactless magnetoconductance and Raman spectroscopy measurements performed for a graphene sample after its immersion in NaCl solution were presented. The properties of the immersed sample were compared with those of a non-immersed reference sample. Atomic force microscopy and electron spin resonance experiments confirmed the deposition of NaCl nanoparticles on the graphene surface. A weak localization signal observed using contactless magnetoconductance showed the reduction of the coherence length after NaCl treatment of graphene. Temperature dependence of the coherence length indicated a change from ballistic to diffusive regime in electron transport after NaCl treatment. The main inelastic scattering process was of the electron-electron type but the major reason for the reduction of the coherence length at low temperatures was additional, temperature independent, inelastic scattering. We associate it with spin flip scattering, caused by NaCl nanoparticles present on the graphene surface. Raman spectroscopy showed an increase in the D and D′ bands intensities for graphene after its immersion in NaCl solution. An analysis of the D, D′, and G bands intensities proved that this additional scattering is related to the decoration of vacancies and grain boundaries with NaCl nanoparticles, as well as generation of new on-site defects as a result of the decoration of the graphene surface with NaCl nanoparticles. The observed energy shifts of 2D and G bands indicated that NaCl deposition on the graphene surface did not change carrier concentration, but reduced compressive biaxial strain in the graphene layer.

Electron scattering in graphene with adsorbed NaCl nanoparticles

International Nuclear Information System (INIS)

Drabińska, Aneta; Kaźmierczak, Piotr; Bożek, Rafał; Karpierz, Ewelina; Wysmołek, Andrzej; Kamińska, Maria; Wołoś, Agnieszka; Pasternak, Iwona; Strupiński, Włodek; Krajewska, Aleksandra

2015-01-01

In this work, the results of contactless magnetoconductance and Raman spectroscopy measurements performed for a graphene sample after its immersion in NaCl solution were presented. The properties of the immersed sample were compared with those of a non-immersed reference sample. Atomic force microscopy and electron spin resonance experiments confirmed the deposition of NaCl nanoparticles on the graphene surface. A weak localization signal observed using contactless magnetoconductance showed the reduction of the coherence length after NaCl treatment of graphene. Temperature dependence of the coherence length indicated a change from ballistic to diffusive regime in electron transport after NaCl treatment. The main inelastic scattering process was of the electron-electron type but the major reason for the reduction of the coherence length at low temperatures was additional, temperature independent, inelastic scattering. We associate it with spin flip scattering, caused by NaCl nanoparticles present on the graphene surface. Raman spectroscopy showed an increase in the D and D′ bands intensities for graphene after its immersion in NaCl solution. An analysis of the D, D′, and G bands intensities proved that this additional scattering is related to the decoration of vacancies and grain boundaries with NaCl nanoparticles, as well as generation of new on-site defects as a result of the decoration of the graphene surface with NaCl nanoparticles. The observed energy shifts of 2D and G bands indicated that NaCl deposition on the graphene surface did not change carrier concentration, but reduced compressive biaxial strain in the graphene layer

The dispersion relation for the forward elastic electron-atom scattering amplitude

International Nuclear Information System (INIS)

Amusia, M.Y.

1978-01-01

The analytical properties of forward elastic electron-atom scattering amplitude are discussed. It is noted that the occurrence of exchange between the incoming and atomic electrons leads to the appearance of a number of singularities on the negative real axis in the complex energy plane. The conclusion is drawn that the dispersion relation for the forward electron-atom scattering amplitude should also include an integration over the negative energy from - I to - infinity, where I is the ionization potential. (author)

Diffraction contrast as a sensitive indicator of femtosecond sub-nanoscale motion in ultrafast transmission electron microscopy

Science.gov (United States)

Cremons, Daniel R.; Schliep, Karl B.; Flannigan, David J.

2013-09-01

With ultrafast transmission electron microscopy (UTEM), access can be gained to the spatiotemporal scales required to directly visualize rapid, non-equilibrium structural dynamics of materials. This is achieved by operating a transmission electron microscope (TEM) in a stroboscopic pump-probe fashion by photoelectrically generating coherent, well-timed electron packets in the gun region of the TEM. These probe photoelectrons are accelerated down the TEM column where they travel through the specimen before reaching a standard, commercially-available CCD detector. A second laser pulse is used to excite (pump) the specimen in situ. Structural changes are visualized by varying the arrival time of the pump laser pulse relative to the probe electron packet at the specimen. Here, we discuss how ultrafast nanoscale motions of crystalline materials can be visualized and precisely quantified using diffraction contrast in UTEM. Because diffraction contrast sensitively depends upon both crystal lattice orientation as well as incoming electron wavevector, minor spatial/directional variations in either will produce dynamic and often complex patterns in real-space images. This is because sections of the crystalline material that satisfy the Laue conditions may be heterogeneously distributed such that electron scattering vectors vary over nanoscale regions. Thus, minor changes in either crystal grain orientation, as occurs during specimen tilting, warping, or anisotropic expansion, or in the electron wavevector result in dramatic changes in the observed diffraction contrast. In this way, dynamic contrast patterns observed in UTEM images can be used as sensitive indicators of ultrafast specimen motion. Further, these motions can be spatiotemporally mapped such that direction and amplitude can be determined.

Second Born approximation in elastic-electron scattering from nuclear static electro-magnetic multipoles

International Nuclear Information System (INIS)

Al-Khamiesi, I.M.; Kerimov, B.K.

1988-01-01

Second Born approximation corrections to electron scattering by nuclei with arbitrary spin are considered. Explicit integral expressions for the charge, magnetic dipole and interference differential cross sections are obtained. Magnetic and interference relative corrections are then investigated in the case of backward electron scattering using shell model form factors for nuclear targets 9 Be, 10 B, and 14 N. To understand exponential growth of these corrections with square of the electron energy K 0 2 , the case of electron scattering by 6 Li is considered using monopole model charge form factor with power-law asymptotics. 11 refs., 2 figs. (author)

The determination of electron momentum densities by inelastic scattering gamma-ray-electron coincidence measurements: The (γ,eγ)-experiment

International Nuclear Information System (INIS)

Rollason, A.J.; Bell, F.; Schneider, J.R.

1989-09-01

Measurements have been made of the recoiling electron in 320 keV gamma ray inelastic scattering collisions in thin aluminium targets. The angular correlation of these electrons detected in coincidence with the scattered photon is in agreement with the kinematic requirements of the Compton effect and is correctly predicted by Monte Carlo simulations based on the impulse approximation. Further simulations of ideal-geometry experiments indicate that information about the initial electron momenta is available from an examination of those electron-photon events originating in a surface layer of one electronic mean free path depth and that elastic scattering of the recoil electrons from greater depths produces a nearly flat background to this signal. The results clearly demonstrate the feasibility of the (γ,eγ) experiment for studying electron momentum densities with synchrotron radiation. (orig.) With 23 refs., 17 figs

Multiple scattering approach to the vibrational excitation of molecules by slow electrons

International Nuclear Information System (INIS)

Drukarev, G.

1976-01-01

Another approach to the problem of vibrational excitation of homonuclear two-atomic molecules by slow electrons possibly accompanied by rotational transitions is presented based on the picture of multiple scattering of an electron inside the molecule. The scattering of two fixed centers in the zero range potential model is considered. The results indicate that the multiple scattering determines the order of magnitude of the vibrational excitation cross sections in the energy region under consideration even if the zero range potential model is used. Also the connection between the multiple scattering approach and quasi-stationary molecular ion picture is established. 9 refs

Electron Raman scattering in semiconductor quantum well wire of cylindrical ring geometry

International Nuclear Information System (INIS)

Betancourt-Riera, Re.; Betancourt-Riera, Ri.; Nieto Jalil, J. M.; Riera, R.

2015-01-01

We study the electron states and the differential cross section for an electron Raman scattering process in a semiconductor quantum well wire of cylindrical ring geometry. The electron Raman scattering developed here can be used to provide direct information about the electron band structures of these confinement systems. We assume that the system grows in a GaAs/Al 0.35 Ga 0.65 As matrix. The system is modeled by considering T = 0 K and also a single parabolic conduction band, which is split into a sub-band system due to the confinement. The emission spectra are discussed for different scattering configurations, and the selection rules for the processes are also studied. Singularities in the spectra are found and interpreted. (paper)

Study of Coulomb effects using the comparison of positrons and electrons elastic scattering on nuclei

International Nuclear Information System (INIS)

Breton, Vincent

1990-01-01

We have studied Coulomb effects in the electron-nucleus interaction by measuring electron and positron elastic scattering. The Coulomb field of the nucleus acts differently on theses particles because of their opposite charges. The experiment took place at the Accelerateur Lineaire de Saclay, with 450 MeV electrons and positrons. We measured the emittance of the positron and electron beams. We compared electron and positron beams having the same energy, the same emittance and the same intensity. This way, we measured positron scattering cross sections with 2 % systematic error. By comparing positron and electron elastic scattering cross sections for momentum transfers between 1 and 2 fm -1 , on a Lead 208 target, we showed that the calculations of Coulomb effects in elastic scattering are in perfect agreement with experimental results. The comparison of positron and electron elastic scattering cross sections on Carbon showed that dispersive effects are smaller than 2 % outside the diffraction minima. These two results demonstrate in a definitive way that electron scattering allows to measure charge densities in the center of nuclei with an accuracy of the order of 1 %. (author) [fr

Recent single ARM electron scattering experiments at Saclay

International Nuclear Information System (INIS)

Frois, B.

1981-07-01

Some recent electron scattering experiments at intermediate energies performed at the Saclay linear accelerator (ALS) are presented. First the definitive results of the measurements of the size of valence orbits by magnetic elastic electron scattering are discussed and followed by an overview of the study of charge distributions in closed shell nuclei. These results are among the most stringent experimental tests of nuclear theory because they probe without ambiguity the shape of nuclei. Then, it is shown how the details of the transition densities of the first excited states of 152 Sm have been brought out by very high momentum transfer experiments. Finally, the results of the investigation of mesonic degrees of freedom in deuterium and helium-3 are presented

Structure functions in electron-nucleon deep inelastic scattering

Energy Technology Data Exchange (ETDEWEB)

Saleem, M.; Fazal-E-Aleem (University of the Punjab, Lahore (Pakistan). Dept. of Physics)

1982-06-26

The phenomenological expressions for the structure functions in electron-nucleon deep inelastic scattering are proposed and are shown to satisfy the experimental data as well as a number of sum rules.

Effects of the electron's anomaly in relativistic laser-assisted Mott scattering

International Nuclear Information System (INIS)

Ngoko Djiokap, J.M.; Tetchou Nganso, H.M.; Kwato Njock, M.G.

2006-02-01

We investigate the influence of the electron's anomalous magnetic moment on the process of relativistic Mott scattering in a powerful electromagnetic plane wave for which the ponderomotive energy is of the order of the magnitude of the electron's rest mass. For this purpose, we use the Coulomb-Dirac-Volkov and the Dirac-Volkov functions with the electron's anomaly to describe the initial and final states respectively. First-order Born differential cross sections of induced and inverse bremsstrahlung are obtained for linearly polarized laser light. Numerical calculations are carried out for various parameters values (i.e. scattering angle, the nucleus charge, photon energy, electrical field) and are compared with results obtained by Li et al. It is found that for parameters used in the present work, incorporating the anomaly of the electron in the initial and final states yields cross sections which are strongly modified whatever the scattering geometry, as compared to the outcome of the previous treatment. (author)

Spin-dependent scattering by a potential barrier on a nanotube

International Nuclear Information System (INIS)

Abranyos, Yonatan; Gumbs, Godfrey; Fekete, Paula

2010-01-01

The electron spin effects on the surface of a nanotube have been considered through the spin-orbit interaction (SOI), arising from the electron confinement on the surface of the nanotube. This is of the same nature as the Rashba-Bychkov SOI at a semiconductor heterojunction. We estimate the effect of disorder within a potential barrier on the transmission probability. Using a continuum model, we obtain analytic expressions for the spin-split energy bands for electrons on the surface of nanotubes in the presence of SOI. First we calculate analytically the amplitudes of scattering from a potential barrier located around the axis of the nanotube into spin-dependent states. The effect of disorder on the scattering process is included phenomenologically and induces a reduction in the transition probability. We analyze the relative role of SOI and disorder in the transmission probability which depends on the angular and linear momentum of the incoming particle, and its spin orientation. Finally we demonstrate that in the presence of disorder, perfect transmission may not be achieved for finite barrier heights.

Experimental study of intensive electron beam scattering in melting channel

International Nuclear Information System (INIS)

Balagura, V.S.; Kurilko, V.I.; Safronov, B.G.

1988-01-01

Multiple scattering of an intensive electron beam at 28 keV energy passing through a melting channel in iron targets is experimentally studied. The dependence of scattering on the melting current value is established. The material density in the channel on the basis of the binary collision method is evaluated. It is shown that these density values are of three orders less than the estimations made on the basis of the data on energy losses of electrons in the channel. 6 refs.; 4 figs

One-way optical transmission in silicon photonic crystal heterojunction with circular and square scatterers

Energy Technology Data Exchange (ETDEWEB)

Liu, Dan, E-mail: liudanhu725@126.com [School of Physics and Mechanical & Electrical Engineering, Hubei University of Education, Wuhan, 430205 (China); Hu, Sen [School of Physics and Mechanical & Electrical Engineering, Hubei University of Education, Wuhan, 430205 (China); Gao, Yihua [Wuhan National Laboratory for Optoelectronics (WNLO), School of Physics, Huazhong University of Science and Technology (HUST), Wuhan, 430074 (China)

2017-07-12

A 2D orthogonal square-lattice photonic crystal (PC) heterojunction consisting of circular and square air holes in silicon is presented. Band structures are calculated using the plane wave expansion method, and the transmission properties are investigated by the finite-different time-domain simulations. Thanks to the higher diffraction orders excited when the circular and square holes are interlaced along the interface, one-way transmission phenomena can exist within wide frequency regions. The higher order diffraction is further enhanced through two different interface optimization designs proposed by modifying the PC structure of the hetero-interface. An orthogonal PC heterojunction for wide-band and efficient one-way transmission is constructed, and the maximum transmissivity is up to 78%. - Highlights: • Photonic crystal heterojunction with circular and square scatterers is first studied. • One-way transmission efficiency is closely related to the hetero-interface. • Wide-band and efficient one-way transmission is realized.

Effect of the single-scattering phase function on light transmission through disordered media with large inhomogeneities

International Nuclear Information System (INIS)

Marinyuk, V V; Sheberstov, S V

2017-01-01

We calculate the total transmission coefficient (transmittance) of a disordered medium with large (compared to the light wavelength) inhomogeneities. To model highly forward scattering in the medium we take advantage of the Gegenbauer kernel phase function. In a subdiffusion thickness range, the transmittance is shown to be sensitive to the specific form of the single-scattering phase function. The effect reveals itself at grazing angles of incidence and originates from small-angle multiple scattering of light. Our results are in a good agreement with numerical solutions to the radiative transfer equation. (paper)

Compton scattering of 145 keV gamma rays by K-shell electrons of silver

Energy Technology Data Exchange (ETDEWEB)

Acharya, V B; Singh, B; Ghumman, B S [Punjabi Univ., Patiala (India). Dept. of Physics

1981-01-01

Differential cross-sections for the incoherent scattering of 145 keV photons from K-shell electrons of silver are measured at scattering angles ranging from 30/sup 0/ to 150/sup 0/ to investigate the effect of electron binding on the scattering process in the low energy region. Measurements are made employing two NaI (Tl) scintillation spectrometers and a slow-fast coincidence circuit of resolving time 30 ns. The experimental results are compared with the available theoretical data. The total K-shell scattering cross-section is also estimated and is about 45% of the free electron cross-section.

Suppressing Klein tunneling in graphene using a one-dimensional array of localized scatterers.

Science.gov (United States)

Walls, Jamie D; Hadad, Daniel

2015-02-13

Graphene's unique physical and chemical properties make it an attractive platform for use in micro- and nanoelectronic devices. However, electrostatically controlling the flow of electrons in graphene can be challenging as a result of Klein tunneling, where electrons normally incident to a one-dimensional potential barrier of height V are perfectly transmitted even as V → ∞. In this study, theoretical and numerical calculations predict that the transmission probability for an electron wave normally incident to a one-dimensional array of localized scatterers can be significantly less than unity when the electron wavelength is smaller than the spacing between scatterers. In effect, placing periodic openings throughout a potential barrier can, somewhat counterintuitively, decrease transmission in graphene. Our results suggest that electrostatic potentials with spatial variations on the order of the electron wavelength can suppress Klein tunneling and could find applications in developing graphene electronic devices.

Stimulated Brillouin scattering during electron gyro-harmonic heating at EISCAT

Directory of Open Access Journals (Sweden)

H. Y. Fu

2015-08-01

Full Text Available Observations of secondary radiation, stimulated electromagnetic emission (SEE, produced during ionospheric modification experiments using ground-based, high-power, high-frequency (HF radio waves are considered. The High Frequency Active Auroral Research Program (HAARP facility is capable of generating narrowband SEE in the form of stimulated Brillouin scatter (SBS and stimulated ion Bernstein scatter (SIBS in the SEE spectrum. Such narrowband SEE spectral lines have not been reported using the European Incoherent Scatter (EISCAT heater facility before. This work reports the first EISCAT results of narrowband SEE spectra and compares them to SEE previously observed at HAARP during electron gyro-harmonic heating. An analysis of experimental SEE data shows observations of emission lines within 100 Hz of the pump frequency, interpreted as SBS, during the 2012 July EISCAT campaign. Experimental results indicate that SBS strengthens as the pump frequency approaches the third electron gyro-harmonic. Also, for different heater antenna beam angles, the CUTLASS radar backscatter induced by HF radio pumping is suppressed near electron gyro-harmonics, whereas electron temperature enhancement weakens as measured by EISCAT/UHF radar. The main features of these new narrowband EISCAT observations are generally consistent with previous SBS measurements at HAARP.

The role of symmetry in the theory of inelastic high-energy electron scattering and its application to atomic-resolution core-loss imaging.

Science.gov (United States)

Dwyer, C

2015-04-01

The inelastic scattering of a high-energy electron in a solid constitutes a bipartite quantum system with an intrinsically large number of excitations, posing a considerable challenge for theorists. It is demonstrated how and why the utilization of symmetries, or approximate symmetries, can lead to significant improvements in both the description of the scattering physics and the efficiency of numerical computations. These ideas are explored thoroughly for the case of core-loss excitations, where it is shown that the coupled angular momentum basis leads to dramatic improvements over the bases employed in previous work. The resulting gains in efficiency are demonstrated explicitly for K-, L- and M-shell excitations, including such excitations in the context of atomic-resolution imaging in the scanning transmission electron microscope. The utilization of other symmetries is also discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Parity Violation in Forward Angle Elastic Electron-Proton Scattering

Energy Technology Data Exchange (ETDEWEB)

Miller, IV, Grady Wilson [Princeton Univ., NJ (United States)

2001-01-01

We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton at Jefferson Laboratory. The kinematic point (θ_lab = 12.3 deg. and (Q²) = 0.48 (GeV/c)²) is chosen to provide sensitivity to the strange electric form factor G^s_E. A 3.36 GeV beam of longitudinally polarized electrons was scattered from protons in a liquid hydrogen target. The scattered flux was detected by a pair of spectrometers which focussed the elastically-scattered electrons onto total-absorption detectors. The detector signals were integrated and digitized by a custom data acquisition system. A feedback system reduced systematic errors by controlling helicity-correlated beam intensity differences at the sub-ppm (part per million) level. The experimental result, A = 14.5 +/- 2.0 (stat) ± 1.1 (syst) ppm, is consistent with the electroweak Standard Model with no additional contributions from strange quarks. In particular, the measurement implies G^S_E + 0.39 G^s_M = 0.023 ± 0.040 ± 0.026 (ζGⁿ_E), where the last uncertainty is due to the estimated uncertainty in the neutron electric form factor Gⁿ_E . This result represents the first experimental constraint of the strange electric form factor.

Low-energy positron and electron scattering from nitrogen dioxide

International Nuclear Information System (INIS)

Chiari, Luca; Brunger, M J; Zecca, Antonio; García, Gustavo; Blanco, Francisco

2013-01-01

Total cross section (TCS) measurements for positron scattering from nitrogen dioxide (NO 2 ) are presented in the energy range 0.2–40 eV. The TCS, the elastic integral and differential cross sections, and the integral cross section accounting of all the inelastic processes (including positronium formation) have also been computed using the independent atom model with screening corrected additivity rule (IAM-SCAR) for incident energies from 1 to 1000 eV. A qualitative level of agreement is found between the present TCS experiment and theory at the common energies. As no previous measurements or calculations for positron–NO 2  scattering exist in the literature, we also computed the TCS for electron collisions with NO 2  employing the IAM-SCAR method. A comparison of those results to the present positron cross sections and the earlier electron-impact data and calculations is provided. To investigate the role that chemical substitution plays in positron scattering phenomena, we also compare the present positron–NO 2  data with the TCSs measured at the University of Trento for positron scattering from N 2 O and CO 2 . (paper)

Advances in imaging and electron physics the scanning transmission electron microscope

CERN Document Server

Hawkes, Peter W

2009-01-01

Advances in Imaging and Electron Physics merges two long-running serials--Advances in Electronics and Electron Physics and Advances in Optical and Electron Microscopy. This series features extended articles on the physics of electron devices (especially semiconductor devices), particle optics at high and low energies, microlithography, image science and digital image processing, electromagnetic wave propagation, electron microscopy, and the computing methods used in all these domains.  This particular volume presents several timely articles on the scanning transmission electron microscope. Updated with contributions from leading international scholars and industry experts Discusses hot topic areas and presents current and future research trends Provides an invaluable reference and guide for physicists, engineers and mathematicians.

Advances in positron and electron scattering*

Science.gov (United States)

Limão-Vieira, Paulo; García, Gustavo; Krishnakumar, E.; Petrović, Zoran; Sullivan, James; Tanuma, Hajime

2016-10-01

The topical issue on Advances in Positron and Electron Scattering" combines contributions from POSMOL 2015 together with others devoted to celebrate the unprecedented scientific careers of our loyal colleagues and trusted friends Steve Buckman (Australian National University, Australia) and Michael Allan (University of Fribourg, Switzerland) on the occasion of their retirements. POSMOL 2015, the XVIII International Workshop on Low-Energy Positron and Positronium Physics and the XIX International Symposium on Electron-Molecule Collisions and Swarms, was held at Universidade NOVA de Lisboa, Lisboa, Portugal, from 17-20 July 2015. The international workshop and symposium allowed to achieve a very privileged forum of sharing and developing our scientific expertise on current aspects of positron, positronium and antiproton interactions with electrons, atoms, molecules and solid surfaces, and related topics, as well as electron interactions with molecules in both gaseous and condensed phases. Particular topics include studies of electron interactions with biomolecules, electron induced surface chemistry and the study of plasma processes. Recent developments in the study of swarms are also fully addressed.

Tree-level equivalence between a Lorentz-violating extension of QED and its dual model in electron-electron scattering

Energy Technology Data Exchange (ETDEWEB)

Toniolo, Giuliano R.; Fargnoli, H.G.; Brito, L.C.T. [Universidade Federal de Lavras, Departamento de Fisica, Caixa Postal 3037, Lavras, Minas Gerais (Brazil); Scarpelli, A.P.B. [Setor Tecnico-Cientifico, Departamento de Policia Federal, Sao Paulo (Brazil)

2017-02-15

S-matrix amplitudes for the electron-electron scattering are calculated in order to verify the physical equivalence between two Lorentz-breaking dual models. We begin with an extended Quantum Electrodynamics which incorporates CPT-even Lorentz-violating kinetic and mass terms. Then, in a process of gauge embedding, its gauge-invariant dual model is obtained. The physical equivalence of the two models is established at tree level in the electron-electron scattering and the unpolarized cross section is calculated up to second order in the Lorentz-violating parameter. (orig.)

Tree-level equivalence between a Lorentz-violating extension of QED and its dual model in electron-electron scattering

International Nuclear Information System (INIS)

Toniolo, Giuliano R.; Fargnoli, H.G.; Brito, L.C.T.; Scarpelli, A.P.B.

2017-01-01

S-matrix amplitudes for the electron-electron scattering are calculated in order to verify the physical equivalence between two Lorentz-breaking dual models. We begin with an extended Quantum Electrodynamics which incorporates CPT-even Lorentz-violating kinetic and mass terms. Then, in a process of gauge embedding, its gauge-invariant dual model is obtained. The physical equivalence of the two models is established at tree level in the electron-electron scattering and the unpolarized cross section is calculated up to second order in the Lorentz-violating parameter. (orig.)

Resonance electronic Raman scattering in rare earth crystals

International Nuclear Information System (INIS)

Williams, G.M.

1988-01-01

The intensities of Raman scattering transitions between electronic energy levels of trivalent rare earth ions doped into transparent crystals were measured and compared to theory. A particle emphasis was placed on the examination of the effect of intermediate state resonances on the Raman scattering intensities. Two specific systems were studied: Ce 3+ (4f 1 ) in single crystals of LuPO 4 and Er 3+ (4f 11 ) in single crystals of ErPO 4 . 134 refs., 92 figs., 33 tabs

Low-energy electron transmission through high aspect ratio Al O nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.; Víkor, G.

2009-01-01

Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined with resp......Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined...

Isotope analysis in the transmission electron microscope.

Science.gov (United States)

Susi, Toma; Hofer, Christoph; Argentero, Giacomo; Leuthner, Gregor T; Pennycook, Timothy J; Mangler, Clemens; Meyer, Jannik C; Kotakoski, Jani

2016-10-10

The Ångström-sized probe of the scanning transmission electron microscope can visualize and collect spectra from single atoms. This can unambiguously resolve the chemical structure of materials, but not their isotopic composition. Here we differentiate between two isotopes of the same element by quantifying how likely the energetic imaging electrons are to eject atoms. First, we measure the displacement probability in graphene grown from either 12 C or 13 C and describe the process using a quantum mechanical model of lattice vibrations coupled with density functional theory simulations. We then test our spatial resolution in a mixed sample by ejecting individual atoms from nanoscale areas spanning an interface region that is far from atomically sharp, mapping the isotope concentration with a precision better than 20%. Although we use a scanning instrument, our method may be applicable to any atomic resolution transmission electron microscope and to other low-dimensional materials.

Optical model theory of elastic electron- and positron-atom scattering at intermediate energies

International Nuclear Information System (INIS)

Joachain, C.J.

1977-01-01

It is stated that the basic idea of the optical model theory is to enable analysis of the elastic scattering of a particle from a complex target by replacing the complicated interactions between the beam and the target by an optical potential, or pseudopotential, in which the incident particle moves. Once the optical potential is determined the original many-body elastic scattering problem reduces to a one-body situation. The resulting optical potential is, however, a very complicated operator, and the formal expressions obtained from first principles for the optical potential can only be evaluated approximately in a few simple cases, such as high energy elastic hadron-nucleus scattering, for the the optical potential can be expressed in terms of two-body hadron-nucleon amplitudes, and the non-relativistic elastic scattering of fast charged particles by atoms. The elastic scattering of an electron or positron by a neutral atom at intermediate energies is here considered. Exchange effects between the projectile and the atomic electrons are considered; also absorption and polarisation effects. Applications of the full-wave optical model have so far only been made to the elastic scattering of fast electrons and positrons by atomic H, He, Ne, and Ar. Agreements of the optical model results with absolute measurements of differential cross sections for electron scattering are very good, an agreement that improves as the energy increases, but deteriorates quickly as the incident energy becomes lower than 50 eV for atomic H or 100 eV for He. For more complex atoms the optical model calculations also appear very encouraging. With regard to positron-atom elastic scattering the optical model results for positron-He scattering differ markedly at small angles from the corresponding electron-He values. It would be interesting to have experimental angular distributions of positron-atom elastic scattering in order to check predictions of the optical model theory. (U.K.)

Observation of fluxes of electrons scattered by the atmosphere in the second Araks experiment

International Nuclear Information System (INIS)

Lyachov, S.B.; Managadze, G.G.

1980-01-01

This paper describes the results of the USHBA spectrometer measurements of the fluxes of atmospheric scattered electrons in the second Araks experiment. The experimental data are presented for heights from 100 to 140 km. The spectral distributions of the scattered electron fluxes are given and the altitude variation of their intensity is compared with the atmosphere models. The conclusion is made about the possible effect of rocket gassing on the electron scattering processes for definite angles of injection

Electron mobility of two-dimensional electron gas in InGaN heterostructures: Effects of alloy disorder and random dipole scatterings

Science.gov (United States)

Hoshino, Tomoki; Mori, Nobuya

2018-04-01

InGaN has a smaller electron effective mass and is expected to be used as a channel material for high-electron-mobility transistors. However, it is an alloy semiconductor with a random distribution of atoms, which introduces additional scattering mechanisms: alloy disorder and random dipole scatterings. In this work, we calculate the electron mobility in InGaN- and GaN-channel high-electron-mobility transistors (HEMTs) while taking into account acoustic deformation potential, polar optical phonon, alloy disorder, and random dipole scatterings. For InGaN-channel HEMTs, we find that not only alloy disorder but also random dipole scattering has a strong impact on the electron mobility and it significantly decreases as the In mole fraction of the channel increases. Our calculation also shows that the channel thickness w dependence of the mobility is rather weak when w > 1 nm for In0.1Ga0.9N-channel HEMTs.

Inversion of the total cross sections for electron-molecule and electron-atom scattering

International Nuclear Information System (INIS)

Lun, D.R.; Amos, K.; Allen, L.J.

1994-01-01

Inverse scattering theory has been applied to construct the interaction potentials from total cross sections as a function of energy for electrons scattered off of atoms and molecules. The underlying potentials are assumed to be real and energy independent and are evaluated using the Eikonal approximation and with real phase shifts determined from the total cross sections. The inversion potentials have been determined using either a high energy limit approximation or by using a fixed energy inversion method at select energies. These procedures have been used to analyse e - - CH 4 , e - - SiH 4 , e - -Kr and e - -Xe scattering data in particular. 14 refs., 1 tabs., 3 figs

Effect of EMIC Wave Normal Angle Distribution on Relativistic Electron Scattering

Science.gov (United States)

Gamayunov, K. V.; Khazanov, G. V.

2006-01-01

The flux level of outer-zone relativistic electrons (above 1 MeV) is extremely variable during geomagnetic storms, and controlled by a competition between acceleration and loss. Precipitation of these electrons due to resonant pitch-angle scattering by electromagnetic ion cyclotron (EMIC) waves is considered one of the major loss mechanisms. This mechanism was suggested in early theoretical studies more than three decades ago. However, direct experimental evidence of the wave role in relativistic electrons precipitation is difficult to obtain because of lack of concurrent measurements of precipitating electrons at low altitudes and the waves in a magnetically conjugate equatorial region. Recently, the data from balloon-borne X-ray instruments provided indirect but strong evidence on an efficiency of the EMIC wave induced loss for the outer-zone relativistic electrons. These observations stimulated theoretical studies that, particularly, demonstrated that EMIC wave induced pitch-angle diffusion of MeV electrons can operate in the strong diffusion limit and this mechanism can compete with relativistic electron depletion caused by the Dst effect during the initial and main phases of storm. Although an effectiveness of relativistic electron scattering by EMIC waves depends strongly on the wave spectral properties, the most favorable assumptions regarding wave characteristics has been made in all previous theoretical studies. Particularly, only quasi field-aligned EMIC waves have been considered as a driver for relativistic electron loss. At the same time, there is growing experimental and theoretical evidence that these waves can be highly oblique; EMIC wave energy can occupy not only the region of generation, i.e. the region of small wave normal angles, but also the entire wave normal angle region, and even only the region near 90 degrees. The latter can dramatically change he effectiveness of relativistic electron scattering by EMIC waves. In the present study, we

Nucleon in nuclei from quasi-elastic electron scattering

International Nuclear Information System (INIS)

Gerard, A.

1987-04-01

One challenging problem in modern nuclear physics is to understand how the internal structure of the nucleon interferes with the dynamics of nucleons in a nucleus. The purpose of this paper is to review the present status of data in quasi-elastic electron scattering, to connect them with recent theoretical developments and to outline some future directions of research not accessible to present electron facilities

Parity nonconservation in polarized electron scattering at high energies

International Nuclear Information System (INIS)

Prescott, C.Y.

1979-10-01

Recent observations of parity violation in inelastic scattering of electrons at high energy is discussed with reference to the process e(polarized) + D(unpolarized) → e + X. The kinetics of this process, the idealized case of scattering from free quark targets, experimental techniques and results, and relations to atomic physics of parity violation in bismuth and thallium atoms with a model independent analysis. 17 references

Transmission X-ray scattering as a probe for complex liquid-surface structures

Energy Technology Data Exchange (ETDEWEB)

Fukuto, Masafumi; Yang, Lin; Nykypanchuk, Dmytro; Kuzmenko, Ivan

2016-01-28

The need for functional materials calls for increasing complexity in self-assembly systems. As a result, the ability to probe both local structure and heterogeneities, such as phase-coexistence and domain morphologies, has become increasingly important to controlling self-assembly processes, including those at liquid surfaces. The traditional X-ray scattering methods for liquid surfaces, such as specular reflectivity and grazing-incidence diffraction, are not well suited to spatially resolving lateral heterogeneities due to large illuminated footprint. A possible alternative approach is to use scanning transmission X-ray scattering to simultaneously probe local intermolecular structures and heterogeneous domain morphologies on liquid surfaces. To test the feasibility of this approach, transmission small- and wide-angle X-ray scattering (TSAXS/TWAXS) studies of Langmuir films formed on water meniscus against a vertically immersed hydrophilic Si substrate were recently carried out. First-order diffraction rings were observed in TSAXS patterns from a monolayer of hexagonally packed gold nanoparticles and in TWAXS patterns from a monolayer of fluorinated fatty acids, both as a Langmuir monolayer on water meniscus and as a Langmuir–Blodgett monolayer on the substrate. The patterns taken at multiple spots have been analyzed to extract the shape of the meniscus surface and the ordered-monolayer coverage as a function of spot position. These results, together with continual improvement in the brightness and spot size of X-ray beams available at synchrotron facilities, support the possibility of using scanning-probe TSAXS/TWAXS to characterize heterogeneous structures at liquid surfaces.

Parity violation in polarized electron scattering

International Nuclear Information System (INIS)

Prescott, C.Y.

1980-10-01

The weak forces are responsible for the decay of radioactive nuclei, and it was in these decay processes where parity non-conservation was first observed. Beta decay occurs through emission of e + or e - particles, indicating that the weak force can carry charge of both signs, and it was natural to speculate on the existence of a neutral component of the weak force. Even though weak neutral forces had not been observed it was conjectured that a neutral component of weak decay could exist, and Zel'dovich in 1957 suggested that parity violating effects may be observable in electron scattering and in atomic spectra. More than twenty years have passed since the early conjectures, and a great deal has been learned. Progress in quantum field theory led to the development of the SU(2) x U(1) gauge theory of weak and electromagnetic interactions and provided a renormalizable theory with a minimum of additional assumptions. Gauge theories predicted the existence of a new force, the neutral current interaction. This new interaction was first seen in 1973 in the Gargamelle bubble chamber at CERN. Today the neutral currents are accepted as well established, and it is the details of the neutral current structure that occupy attention. In particular the role that electrons play cannot be tested readily in neutrino beams (recent neutrino-electron scattering experiments are, however, rapidly improving this situation) and therefore interest in electron-hadron neutral current effects has been high. Parity violation is a unique signature of weak currents, and measurements of its size are a particularly important and sensitive means for determining the neutral current structure

Dual scattering foil design for poly-energetic electron beams

International Nuclear Information System (INIS)

Kainz, K K; Antolak, J A; Almond, P R; Bloch, C D; Hogstrom, K R

2005-01-01

The laser wakefield acceleration (LWFA) mechanism can accelerate electrons to energies within the 6-20 MeV range desired for therapy application. However, the energy spectrum of LWFA-generated electrons is broad, on the order of tens of MeV. Using existing laser technology, the therapeutic beam might require a significant energy spread to achieve clinically acceptable dose rates. The purpose of this work was to test the assumption that a scattering foil system designed for a mono-energetic beam would be suitable for a poly-energetic beam with a significant energy spread. Dual scattering foil systems were designed for mono-energetic beams using an existing analytical formalism based on Gaussian multiple-Coulomb scattering theory. The design criterion was to create a flat beam that would be suitable for fields up to 25 x 25 cm 2 at 100 cm from the primary scattering foil. Radial planar fluence profiles for poly-energetic beams with energy spreads ranging from 0.5 MeV to 6.5 MeV were calculated using two methods: (a) analytically by summing beam profiles for a range of mono-energetic beams through the scattering foil system, and (b) by Monte Carlo using the EGS/BEAM code. The analytic calculations facilitated fine adjustments to the foil design, and the Monte Carlo calculations enabled us to verify the results of the analytic calculation and to determine the phase-space characteristics of the broadened beam. Results showed that the flatness of the scattered beam is fairly insensitive to the width of the input energy spectrum. Also, results showed that dose calculated by the analytical and Monte Carlo methods agreed very well in the central portion of the beam. Outside the useable field area, the differences between the analytical and Monte Carlo results were small but significant, possibly due to the small angle approximation. However, these did not affect the conclusion that a scattering foil system designed for a mono-energetic beam will be suitable for a poly

Electron scattering from gas phase cis-diamminedichloroplatinum(II): Quantum analysis of resonance dynamics

Science.gov (United States)

Carey, Ralph; Lucchese, Robert R.; Gianturco, F. A.

2013-05-01

We present scattering calculations of electron collisions with the platinum-containing compound cis-diamminedichloroplatinum (CDDP), commonly known as cisplatin, between 0.5 eV and 6 eV, and the corresponding isolated Pt atom from 0.1 eV to 10 eV. We find evidence of resonances in e--CDDP scattering, using an ab initio description of the target. We computed scattering matrix elements from equations incorporating exchange and polarization effects through the use of the static-exchange plus density functional correlation potential. Additionally, we made use of a purely local adiabatic model potential that allows Siegert eigenstates to be calculated, thereby allowing inspection of the possible resonant scattering wave functions. The total cross section for electron scattering from (5d10) 1S Pt displays a large magnitude, monotonic decay from the initial collision energies, with no apparent resonance scattering features in any scattering symmetry. By contrast, the e--CDDP scattering cross section shows a small feature near 3.8 eV, which results from a narrow, well localized resonance of b2 symmetry. These findings are then related to the possible electron-mediated mechanism of the action of CDDP on DNA replication as suggested by recent experiments.

Electron-atom scattering at intermediate energies

International Nuclear Information System (INIS)

Kingston, A.E.; Walters, H.R.J.

1982-01-01

The problems of intermediate energy scattering are approached from the low and high energy ends. At low intermediate energies difficulties associated with the use of pseudostates and correlation terms are discussed, special consideration being given to nonphysical pseudoresonances. Perturbation methods appropriate to high intermediate energies are described and attempts to extend these high energy approximations down to low intermediate energies are studied. It is shown how the importance of electron exchange effects develops with decreasing energy. The problem of assessing the 'effective completeness' of pseudostate sets at intermediate energies is mentioned and an instructive analysis of a 2p pseudostate approximation to elastic e - -H scattering is given. It is suggested that at low energies the Pauli Exclusion Principle can act to hide short range defects in pseudostate approximations. (author)

Low energy elastic electron scattering from polyatomic targets

International Nuclear Information System (INIS)

Khakoo, M A

2008-01-01

New differential cross-section measurements for elastic electron scattering from ethylene (C 2 H 4 ), three primary alcohols, methanol (CH 3 OH), ethanol (C 2 H 5 OH) and propanol (C 3 H 7 OH) are reported. The measurements are obtained using the relative flow method with a thin aperture as the collimating target gas source. The relative flow method is applied without the molecular diameters restriction imposed by the relative flow pressure condition on helium (the calibrating gas) and the unknown gases (the primary alcohols). The experimental data were taken at incident electron energies of 1eV, 2eV, 5eV, 10eV, 15eV, 20eV, 30eV, 50eV and 100eV, but only a brief survey of these results will be made here. The experimental results are compared to theoretical differential cross-sections are obtained by using the variational multi-channel Schwinger method. Initial comparisons between theory and experiment show that present theory is well-able to model low electron scattering from these polyatomic targets.

Analysis on electronic control unit of continuously variable transmission

Science.gov (United States)

Cao, Shuanggui

Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.

Effects of lattice fluctuations on electronic transmission in metal/conjugated-oligomer/metal structures

International Nuclear Information System (INIS)

Yu, Z.G.; Smith, D.L.; Saxena, A.; Bishop, A.R.

1997-01-01

The electronic transmission across metal/conjugated-oligomer/metal structures in the presence of lattice fluctuations is studied for short oligomer chains. The lattice fluctuations are approximated by static white noise disorder. Resonant transmission occurs when the energy of an incoming electron coincides with a discrete electronic level of the oligomer. The corresponding transmission peak diminishes in intensity with increasing disorder strength. Because of disorder there is an enhancement of the electronic transmission for energies that lie within the electronic gap of the oligomer. If fluctuations are sufficiently strong, a transmission peak within the gap is found at the midgap energy E=0 for degenerate conjugated oligomers (e.g., trans-polyacetylene) and E≠0 for AB-type degenerate oligomers. These results can be interpreted in terms of soliton-antisoliton states created by lattice fluctuations. copyright 1997 The American Physical Society

Electron scattering in large water clusters from photoelectron imaging with high harmonic radiation.

Science.gov (United States)

Gartmann, Thomas E; Hartweg, Sebastian; Ban, Loren; Chasovskikh, Egor; Yoder, Bruce L; Signorell, Ruth

2018-06-06

Low-energy electron scattering in water clusters (H2O)n with average cluster sizes of n < 700 is investigated by angle-resolved photoelectron spectroscopy using high harmonic radiation at photon energies of 14.0, 20.3, and 26.5 eV for ionization from the three outermost valence orbitals. The measurements probe the evolution of the photoelectron anisotropy parameter β as a function of cluster size. A remarkably steep decrease of β with increasing cluster size is observed, which for the largest clusters reaches liquid bulk values. Detailed electron scattering calculations reveal that neither gas nor condensed phase scattering can explain the cluster data. Qualitative agreement between experiment and simulations is obtained with scattering calculations that treat cluster scattering as an intermediate case between gas and condensed phase scattering.

Dispersive effects from a comparison of electron and positron scattering from

International Nuclear Information System (INIS)

Paul Gueye; M. Bernheim; J. F. Danel; Jean-Eric Ducret; L. Lakehal-Ayat; J. M. Le Goff; A. Magnon; C. March; J. Morgenstern; Jacques Marroncle; Pascal Vernin; A. Zghiche-Lakehal-Ayat; Vincent Breton; Salvatore Frullani; Franco Garibaldi; F. Ghio; Mauro Iodice; D. B. Isabelle; Zein-Eddine Meziani; E. Offermann; M. Traini

1998-01-01

Dispersive effects have been investigated by comparing elastic scattering of electrons and positrons from 12 C at the Saclay Linear Accelerator. The results demonstrate that dispersive effects at energies of 262 MeV and 450 MeV are less than 2% below the first diffraction minimum [0.95 eff (fm -1 ) eff = 1.84 fm -1 ), the deviation between the positron scattering cross section and the cross section derived from the electron results is -44% ± 30%

Electron-He+ P-wave elastic scattering and photoabsorption in two-electron systems

International Nuclear Information System (INIS)

Bhatia, A. K.

2006-01-01

In a previous paper [A. K. Bhatia, Phys. Rev. A 69, 032714 (2004)], electron-hydrogen P-wave scattering phase shifts were calculated using the optical potential approach based on the Feshbach projection operator formalism. This method is now extended to the singlet and triplet electron-He + P-wave scattering in the elastic region. Phase shifts are calculated using Hylleraas-type correlation functions with up to 220 terms. Results are rigorous lower bounds to the exact phase shifts, and they are compared to phase shifts obtained from the method of polarized orbitals and close-coupling calculations. The continuum functions calculated here are used to calculate photoabsorption cross sections. Photoionization cross sections of He and photodetachment cross sections of H - are calculated in the elastic region--i.e., leaving He + and H in their respective ground states--and compared with previous calculations. Radiative attachment rates are also calculated

Simulation of loss electron in vacuum magnetically insulated transmission lines

International Nuclear Information System (INIS)

Zhang Pengfei; Li Yongdong; Liu Chunliang; Wang Hongguang; Guo Fan; Yang Hailiang; Qiu Aici; Su Zhaofeng; Sun Jianfeng; Sun Jiang; Gao Yi

2011-01-01

In the beginning of magnetic insulated period, loss electron in coaxial vacuum magnetically insulated transmission line (MITL) strikes anode and the bremsstrahlung photons are generated in the mean time. Based on the self-limited flow model, velocity in direction of energy transport, energy spectrum and angular distribution of loss electron are simulated by PIC code, energy spectrum of bremsstrahlung photons as well calculated though Monte Carlo method. Computational results show that the velocity of loss electron is less than 2.998 x 108 m/s, the angular excursion of electron is not much in a board extent of energy spectrum. These results show an indirect diagnosis of vacuum insulted transmission line working status based on loss electron bremsstrahlung. (authors)

Scattering theory of ballistic-electron-emission microscopy at nonepitaxial interfaces

International Nuclear Information System (INIS)

Smith, D. L.; Kozhevnikov, M.; Lee, E. Y.; Narayanamurti, V.

2000-01-01

We present an interface scattering model to describe ballistic-electron-emission microscopy (BEEM) at nonepitaxial metal/semiconductor interfaces. The model starts with a Hamiltonian consisting of the sum of two terms: one term, H 0 , describes an ideal interface for which the interface parallel component of wave vector is a good quantum number, and the second term, δH, describes interfacial scattering centers. The eigenstates of H 0 consist of an incident and a reflected part in the metal and a transmitted part in the semiconductor. The three components of each eigenstate have the same interface parallel wave vector. Because tunneling preferentially weights forward-directed states, the interface parallel component of wave vector is small for the H 0 eigenstates that are initially populated with high probability in BEEM. δH scatters electrons between the eigenstates of H 0 . The scattering conserves energy, but not the interface parallel wave vector. In the final state of the scattering process, states with a large interface parallel wave vector can be occupied with reasonable probability. If scattering is weak, so that the parallel wave vector is nearly conserved, the calculated collector current into conduction-band valleys with zero parallel wave vector at the minimum, such as the Γ valley for GaAs(100), is much larger than the calculated collector current into conduction-band valleys with a large parallel wave vector at the minimum, such as the L valleys for GaAs(100). However, if scattering is strong, the injected electron flux distribution is redistributed and valleys with zero interface transverse wave vector at their energy minimum are not preferentially weighted. Instead, the weighting varies as the density of final states for the scattering process so that, for example, the calculated L-channel collector current is much larger than the calculated Γ-channel collector current for GaAs(100). Interfacial scattering reduces the overall magnitude of the

Path-integral approach to resonant electron-molecule scattering

International Nuclear Information System (INIS)

Winterstetter, M.; Domcke, W.

1993-01-01

A path-integral formulation of resonant electron-molecule scattering is developed within the framework of the projection-operator formalism of scattering theory. The formation and decay of resonances is treated in real time as a quantum-mechanical electronic-tunneling process, modified by the coupling of the electronic motion with the nuclear degrees of freedom. It is shown that the electronic continuum can be summed over in the path-integral formulation, resulting formally in the path integral for an effective two-state system with coupling to vibrations. The harmonic-oscillator approximation is adopted for the vibrational motion in the present work. Approximation methods are introduced which render the numerical evaluation of the sum over paths feasible for up to ∼10 3 elementary time slices. The theory is numerically realized for simple but nontrivial models representing the 2 Π g d-wave shape resonance in e - +N 2 collisions and the 2 Σ u + p-wave shape resonance in e - +H 2 collisions, respectively. The accuracy of the path-integral results is assessed by comparison with exact numerical reference data for these models. The essential virtue of the path-integral approach is the fact that the computational effort scales at most linearly with the number of vibrational degrees of freedom. The path-integral method is thus well suited to treat electron collisions with polyatomic molecules and molecular aggregates

Visualizing One-Dimensional Electronic States and their Scattering in Semi-conducting Nanowires

Science.gov (United States)

Beidenkopf, Haim; Reiner, Jonathan; Norris, Andrew; Nayak, Abhay Kumar; Avraham, Nurit; Shtrikman, Hadas

One-dimensional electronic systems constitute a fascinating playground for the emergence of exotic electronic effects and phases, within and beyond the Tomonaga-Luttinger liquid paradigm. More recently topological superconductivity and Majorana modes were added to that long list of phenomena. We report scanning tunneling microscopy and spectroscopy measurements conducted on pristine, epitaxialy grown InAs nanowires. We resolve the 1D electronic band structure manifested both via Van-Hove singularities in the local density-of-states, as well as by the quasi-particle interference patterns, induced by scattering from surface impurities. By studying the scattering of the one-dimensional electronic states off various scatterers, including crystallographic defects and the nanowire end, we identify new one-dimensional relaxation regimes and yet unexplored effects of interactions. Some of these may bear implications on the topological superconducting state and Majorana modes therein. The authors acknowledge support from the Israeli Science Foundation (ISF).

Independent dosimetric calculation with inclusion of head scatter and MLC transmission for IMRT

International Nuclear Information System (INIS)

Yang, Y.; Xing, L.; Li, J.G.; Palta, J.; Chen, Y.; Luxton, Gary; Boyer, A.

2003-01-01

Independent verification of the MU settings and dose calculation of IMRT treatment plans is an important step in the IMRT quality assurance (QA) procedure. At present, the verification is mainly based on experimental measurements, which are time consuming and labor intensive. Although a few simplified algorithms have recently been proposed for the independent dose (or MU) calculation, head scatter has not been precisely taken into account in all these investigations and the dose validation has mainly been limited to the central axis. In this work we developed an effective computer algorithm for IMRT MU and dose validation. The technique is superior to the currently available computer-based MU check systems in that (1) it takes full consideration of the head scatter and leaf transmission effects; and (2) it allows a precise dose calculation at an arbitrary spatial point instead of merely a point on the central axis. In the algorithm the dose at an arbitrary spatial point is expressed as a summation of the contributions of primary and scatter radiation from all beamlets. Each beamlet is modulated by a dynamic modulation factor (DMF), which is determined by the MLC leaf trajectories, the head scatter, the jaw positions, and the MLC leaf transmission. A three-source model was used to calculate the head scatter distribution for irregular segments shaped by MLC and the scatter dose contributions were computed using a modified Clarkson method. The system reads in MLC leaf sequence files (or RTP files) generated by the Corvus (NOMOS Corporation, Sewickley, PA) inverse planning system and then computes the doses at the desired points. The algorithm was applied to study the dose distributions of several testing intensity modulated fields and two multifield Corvus plans and the results were compared with Corvus plans and experimental measurements. The final dose calculations at most spatial points agreed with the experimental measurements to within 3% for both the specially

Measuring the Weak Charge of the Proton via Elastic Electron-Proton Scattering

Energy Technology Data Exchange (ETDEWEB)

Jones, Donald C. [Univ. of Virginia, Charlottesville, VA (United States)

2015-10-01

The Qweak experiment which ran in Hall C at Jefferson Lab in Newport News, VA, and completed data taking in May 2012, measured the weak charge of the proton Q^p_W via elastic electron-proton scattering. Longitudinally polarized electrons were scattered from an unpolarized liquid hydrogen target. The helicity of the electron beam was flipped at approximately 1 kHz between left and right spin states. The Standard Model predicts a small parity-violating asymmetry of scattering rates between right and left helicity states due to the weak interaction. An initial result using 4% of the data was published in October 2013 [1] with a measured parity-violating asymmetry of -279 ± 35(stat) ± 31 (syst) ppb. This asymmetry, along with other data from parity-violating electron scattering experiments, provided the world's first determination of the weak charge of the proton. The weak charge of the proton was found to be ^p_W = 0.064 ± 0.012, in good agreement with the Standard Model prediction of ^p_W(SM) = 0.0708 ± 0.0003[2].

Monte Carlo study of electron relaxation in graphene with spin polarized, degenerate electron gas in presence of electron-electron scattering

Science.gov (United States)

Borowik, Piotr; Thobel, Jean-Luc; Adamowicz, Leszek

2017-12-01

The Monte Carlo simulation method is applied to study the relaxation of excited electrons in monolayer graphene. The presence of spin polarized background electrons population, with density corresponding to highly degenerate conditions is assumed. Formulas of electron-electron scattering rates, which properly account for electrons presence in two energetically degenerate, inequivalent valleys in this material are presented. The electron relaxation process can be divided into two phases: thermalization and cooling, which can be clearly distinguished when examining the standard deviation of electron energy distribution. The influence of the exchange effect in interactions between electrons with parallel spins is shown to be important only in transient conditions, especially during the thermalization phase.

Electronic properties of Be and Al by Compton scattering technique

International Nuclear Information System (INIS)

Aguiar, J.C.; Di Rocco, H.O.

2011-01-01

In this work, electronic properties of beryllium and aluminum are examined by using Compton scattering technique. The method is based on the irradiation of samples using a beam narrow of mono- energetic photons of 59.54 keV product of radioactive decay of Am -241 . Scattered radiation is collected by a high resolution semiconductor detector positioned at an angle of 90°. The measured spectrum is commonly called Compton profile and contains useful information about the electronic structure of the material. The experimental results are compared with theoretical calculations such as density functional theory showing a good agreement. However, these results show some discrepancies with many libraries used in codes such as Monte Carlo simulation. Since these libraries are based on the values tabulated by Biggs, Mendelsohn and Mann 1975 thus overestimating the scattered radiation on the material. (authors) [es

Relativistic electron-atom scattering in an extremely powerful laser field: Relevance of spin effects

International Nuclear Information System (INIS)

Panek, P.; Kaminski, J.Z.; Ehlotzky, F.

2002-01-01

We reconsider the relativistic scattering of electrons by an atom, being approximated by a static potential, in an extremely powerful electromagnetic plane wave of frequency ω and linear polarization ε. Since to a first order of approximation spin effects can be neglected, we first describe the scattered electron by the Gordon solution of the Klein-Gordon equation. Then we investigate the same scattering process by including the spin effects, using for the electron the Volkov solution of the Dirac equation. For sufficiently energetic electrons, the first-order Born approximation can be employed to represent the corresponding scattering matrix element. We compare the results of the differential cross sections of induced and inverse bremsstrahlung, evaluated from both approximations, for various parameter values and angular configurations and we find that in most cases the spin effects are marginal, even at very high laser power. On the other hand, we recover the various asymmetries in the angular distributions of the scattered electrons and their respective energies due to the laser-induced drift motion of the electrons in the direction of propagation of the radiation field, thus confirming the findings of our previous work [Phys. Rev. A 59, 2105 (1999); Laser Physics 10, 163 (2000)

The mass angular scattering power method for determining the kinetic energies of clinical electron beams

International Nuclear Information System (INIS)

Blais, N.; Podgorsak, E.B.

1992-01-01

A method for determining the kinetic energy of clinical electron beams is described, based on the measurement in air of the spatial spread of a pencil electron beam which is produced from the broad clinical electron beam. As predicted by the Fermi-Eyges theory, the dose distribution measured in air on a plane, perpendicular to the incident direction of the initial pencil electron beam, is Gaussian. The square of its spatial spread is related to the mass angular scattering power which in turn is related to the kinetic energy of the electron beam. The measured spatial spread may thus be used to determine the mass angular scattering power, which is then used to determine the kinetic energy of the electron beam from the known relationship between mass angular scattering power and kinetic energy. Energies obtained with the mass angular scattering power method agree with those obtained with the electron range method. (author)

[Inelastic electron scattering from surfaces

International Nuclear Information System (INIS)

1993-01-01

This program is aimed at the quantitative study of surface dynamical processes (vibrational, magnetic excitations) in crystalline slabs, ultrathin-layered materials, and chemisorbed systems on substrates, and of the geometric structure connected to these dynamical excitations. High-resolution electron-energy loss spectroscopy (HREELS) is a powerful probe. Off-specular excitation cross sections are much larger if electron energies are in the LEED range (50-300 eV). The analyses has been used to study surfaces of ordered alloys (NiAl). Ab-initio surface lattice dynamical results were combined with phonon-loss cross sections to achieve a more accurate microscopic description. First-principles phonon eigenvectors and eigenfrequencies were used as inputs to electron-energy-loss multiple scattering cross-section calculations. The combined microscopic approach was used to analyze EELS data of Cu(0001) and Ag(001) at two points. Positron diffraction is discussed as a structural and imaging tool. The relation between geometric structure of a film and its local magnetic properties will be studied in the future, along with other things

Development of wave length-dispersive soft x-ray emission spectrometers for transmission electron microscopes - an introduction of valence electron spectroscopy for transmission electron microscopy

International Nuclear Information System (INIS)

Terauchi, Masami; Koike, Masato; Fukushima, Kurio; Kimura, Atsushi

2010-01-01

Two types of wavelength-dispersive soft X-ray spectrometers, a high-dispersion type and a conventional one, for transmission electron microscopes were constructed. Those spectrometers were used to study the electronic states of valence electrons (bonding electrons). Both spectrometers extended the acceptable energy regions to higher than 2000 eV. The best energy resolution of 0.08 eV was obtained for an Al L-emission spectrum by using the high-dispersion type spectrometer. By using the spectrometer, C K-emission of carbon allotropes, Cu L-emission of Cu 1-x Zn x alloys and Pt M-emission spectra were presented. The FWHM value of 12 eV was obtained for the Pt Mα-emission peak. The performance of the conventional one was also presented for ZnS and a section specimen of a multilayer device. W-M and Si-K emissions were clearly resolved. Soft X-ray emission spectroscopy based on transmission electron microscopy (TEM) has an advantage for obtaining spectra from a single crystalline specimen with a defined crystal setting. As an example of anisotropic soft X-ray emission, C K-emission spectra of single crystalline graphite with different crystal settings were presented. From the spectra, density of states of π- and σ-bondings were separately derived. These results demonstrated a method to analyse the electronic states of valence electrons of materials in the nanometre scale based on TEM. (author)

Electronic Biometric Transmission Specification. Version 1.2

Science.gov (United States)

2006-11-08

Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non

Optical modeling of plasma-deposited ZnO films: Electron scattering at different length scales

International Nuclear Information System (INIS)

Knoops, Harm C. M.; Loo, Bas W. H. van de; Smit, Sjoerd; Ponomarev, Mikhail V.; Weber, Jan-Willem; Sharma, Kashish; Kessels, Wilhelmus M. M.; Creatore, Mariadriana

2015-01-01

In this work, an optical modeling study on electron scattering mechanisms in plasma-deposited ZnO layers is presented. Because various applications of ZnO films pose a limit on the electron carrier density due to its effect on the film transmittance, higher electron mobility values are generally preferred instead. Hence, insights into the electron scattering contributions affecting the carrier mobility are required. In optical models, the Drude oscillator is adopted to represent the free-electron contribution and the obtained optical mobility can be then correlated with the macroscopic material properties. However, the influence of scattering phenomena on the optical mobility depends on the considered range of photon energy. For example, the grain-boundary scattering is generally not probed by means of optical measurements and the ionized-impurity scattering contribution decreases toward higher photon energies. To understand this frequency dependence and quantify contributions from different scattering phenomena to the mobility, several case studies were analyzed in this work by means of spectroscopic ellipsometry and Fourier transform infrared (IR) spectroscopy. The obtained electrical parameters were compared to the results inferred by Hall measurements. For intrinsic ZnO (i-ZnO), the in-grain mobility was obtained by fitting reflection data with a normal Drude model in the IR range. For Al-doped ZnO (Al:ZnO), besides a normal Drude fit in the IR range, an Extended Drude fit in the UV-vis range could be used to obtain the in-grain mobility. Scattering mechanisms for a thickness series of Al:ZnO films were discerned using the more intuitive parameter “scattering frequency” instead of the parameter “mobility”. The interaction distance concept was introduced to give a physical interpretation to the frequency dependence of the scattering frequency. This physical interpretation furthermore allows the prediction of which Drude models can be used in a specific

Transmission electron microscopy in micro-nanoelectronics

CERN Document Server

Claverie, Alain

2013-01-01

Today, the availability of bright and highly coherent electron sources and sensitive detectors has radically changed the type and quality of the information which can be obtained by transmission electron microscopy (TEM). TEMs are now present in large numbers not only in academia, but also in industrial research centers and fabs.This book presents in a simple and practical way the new quantitative techniques based on TEM which have recently been invented or developed to address most of the main challenging issues scientists and process engineers have to face to develop or optimize sem

Nanoporous metal film: An energy-dependent transmission device for electron waves

International Nuclear Information System (INIS)

Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.

2011-01-01

We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.

Diffuse Surface Scattering in the Plasmonic Resonances of Ultralow Electron Density Nanospheres.

Science.gov (United States)

Monreal, R Carmina; Antosiewicz, Tomasz J; Apell, S Peter

2015-05-21

Localized surface plasmon resonances (LSPRs) have recently been identified in extremely diluted electron systems obtained by doping semiconductor quantum dots. Here, we investigate the role that different surface effects, namely, electronic spill-out and diffuse surface scattering, play in the optical properties of these ultralow electron density nanosystems. Diffuse scattering originates from imperfections or roughness at a microscopic scale on the surface. Using an electromagnetic theory that describes this mechanism in conjunction with a dielectric function including the quantum size effect, we find that the LSPRs show an oscillatory behavior in both position and width for large particles and a strong blue shift in energy and an increased width for smaller radii, consistent with recent experimental results for photodoped ZnO nanocrystals. We thus show that the commonly ignored process of diffuse surface scattering is a more important mechanism affecting the plasmonic properties of ultralow electron density nanoparticles than the spill-out effect.

Elastic and inelastic electron and muon scattering

International Nuclear Information System (INIS)

Hand, L.N.

1977-01-01

The current status of experiments in the field of elastic and inelastic electron and muon scattering is discussed. The talk is divided into discussions of the single arm inclusive experiments at SLAC and Fermilab; the multiparticle inclusive experiments at SLAC, Fermilab und Cornell, and a description of selected results from exclusive channel measurements on electroproduced final states. (orig.) [de

Rosetta Mission: Electron Scattering Cross Sections—Data Needs and Coverage in BEAMDB Database

Directory of Open Access Journals (Sweden)

Bratislav P. Marinković

2017-11-01

Full Text Available The emission of [O I] lines in the coma of Comet 67P/Churyumov-Gerasimenko during the Rosetta mission have been explained by electron impact dissociation of water rather than the process of photodissociation. This is the direct evidence for the role of electron induced processing has been seen on such a body. Analysis of other emission features is handicapped by a lack of detailed knowledge of electron impact cross sections which highlights the need for a broad range of electron scattering data from the molecular systems detected on the comet. In this paper, we present an overview of the needs for electron scattering data relevant for the understanding of observations in coma, the tenuous atmosphere and on the surface of 67P/Churyumov-Gerasimenko during the Rosetta mission. The relevant observations for elucidating the role of electrons come from optical spectra, particle analysis using the ion and electron sensors and mass spectrometry measurements. To model these processes electron impact data should be collated and reviewed in an electron scattering database and an example is given in the BEAMD, which is a part of a larger consortium of Virtual Atomic and Molecular Data Centre—VAMDC.

Theory of bright-field scanning transmission electron microscopy for tomography

International Nuclear Information System (INIS)

Levine, Zachary H.

2005-01-01

Radiation transport theory is applied to electron microscopy of samples composed of one or more materials. The theory, originally due to Goudsmit and Saunderson, assumes only elastic scattering and an amorphous medium dominated by atomic interactions. For samples composed of a single material, the theory yields reasonable parameter-free agreement with experimental data taken from the literature for the multiple scattering of 300-keV electrons through aluminum foils up to 25 μm thick. For thin films, the theory gives a validity condition for Beer's law. For thick films, a variant of Moliere's theory [V. G. Moliere, Z. Naturforschg. 3a, 78 (1948)] of multiple scattering leads to a form for the bright-field signal for foils in the multiple-scattering regime. The signal varies as [t ln(e 1-2γ t/τ)] -1 where t is the path length of the beam, τ is the mean free path for elastic scattering, and γ is Euler's constant. The Goudsmit-Saunderson solution interpolates numerically between these two limits. For samples with multiple materials, elemental sensitivity is developed through the angular dependence of the scattering. From the elastic scattering cross sections of the first 92 elements, a singular-value decomposition of a vector space spanned by the elastic scattering cross sections minus a delta function shows that there is a dominant common mode, with composition-dependent corrections of about 2%. A mathematically correct reconstruction procedure beyond 2% accuracy requires the acquisition of the bright-field signal as a function of the scattering angle. Tomographic reconstructions are carried out for three singular vectors of a sample problem with four elements Cr, Cu, Zr, and Te. The three reconstructions are presented jointly as a color image; all four elements are clearly identifiable throughout the image

Precise measurement in elastic electron scattering: HAPPEX and E-158 experiments

International Nuclear Information System (INIS)

Vacheret, A.

2004-12-01

Parity Violation asymmetry measurements in elastic electron scattering are in one hand an interesting way of retrieving new informations about the sea quarks of the nucleon and in the other hand a powerful test of the Standard Model electroweak sector at low energy. This thesis describes the HAPPEX experiment at JLab and the E-158 experiment at SLAC (USA) which measure de parity violation asymmetries in elastic scattering of polarized electron on nuclei like Hydrogen or Helium and on atomic electrons. With the measurements on hadronic targets one can extract the strange quarks contribution to the charge and current density of the nucleon. With the electron-electron scattering one can test the standard model at the loop level and far from the Z pole by extracting sin 2 θ W . In this thesis we describe the formalism associated with the electroweak probe. We present in detail the experimental methods used to make such precise measurements of parity violation asymmetry. Then, we describe the experimental set-up of each experiment and in particular the electron detector and the feedback loop on the beam current for the HAPPEX experiment and the analysis of E-158 run III with a dedicated systematic study on the beam sub-pulse fluctuations. We present the preliminary results for each experiment with a comparison with the other existing results and the future experiments. (author)

Catalysts under Controlled Atmospheres in the Transmission Electron Microscope

DEFF Research Database (Denmark)

Hansen, Thomas Willum; Wagner, Jakob Birkedal

2014-01-01

of resolution. Using suitably clean gases, modified pumping schemes, and short pathways through dense gas regions, these issues are now circumvented. Here we provide an account of best practice using environmental transmission electron microscopy on catalytic systems illustrated using select examples from......Over time, there has been an increasing interest in observing catalysts in their operating environment at high spatial resolution and ultimately to determine the structure of a catalytically active surface. One tool with the potential to do exactly this in direct space is the transmission electron...

Nuclear scattering studies by the scattering of medium-energy electrons. Progress report, January 1, 1977--October 31, 1977

International Nuclear Information System (INIS)

Peterson, G.A.

1977-10-01

Tune-up experiments were carried out at the Bates Linear Accelerator of Middleton, Massachusetts, on the 180 0 electron scattering apparatus designed and constructed by the University of Massachusetts under contract E(11-1)-2545. This apparatus serves as adjunct equipment to the Bates dispersion-matching spectrometer. Form factors were measured for the low-lying states of 27 Al over the momentum transfer range from 0.7 to 2.6 fm -1 . A paper was published in the Physical Review on low-momentum transfer elastic electron scattering from 3 He. The 3 He rms radius was determined to be 1.89 +- 0.05 fm from measurements made at the National Bureau of Standards over the momentum transfer range-squared between 0.032 and 0.34 fm -2 . A Physical Review paper was published in November, 1977, on the results of elastic electron scattering from 25 Mg over the momentum transfer range from 0.19 to 2.56 fm -1 at both forward and backward angles. Values of all of the ground-state multipole moments of both Coulomb and magnetic character were obtained. A paper was submitted for publication on the electroexcitation of giant dipole and quadrupole resonances in 20 Ne. Electric dipole and quadrupole strength was found throughout the region from 12.5 through 25 MeV. About 65% and 100% of the energy-weighted dipole and quadrupole sum rules, respectively, were exhausted. A preliminary run was made on 42 Ca and 44 Ca at the National Bureau of Standards for an incident electron energy of 54.3 MeV and a 145 0 scattering angle in an attempt to observe f/sub 7 / 2 / to f/sub 5 / 2 / magnetic dipole transitions. A paper was composed on the 160 0 inelastic scattering of electrons from 58 Ni at momentum transfers near 2 fm -1 . Strong M8 transitions were observed which are characterized by predominantly one particle--one hole excitations characterized by the configuration

Real-time simulator for designing electron dual scattering foil systems.

Science.gov (United States)

Carver, Robert L; Hogstrom, Kenneth R; Price, Michael J; LeBlanc, Justin D; Pitcher, Garrett M

2014-11-08

The purpose of this work was to develop a user friendly, accurate, real-time com- puter simulator to facilitate the design of dual foil scattering systems for electron beams on radiotherapy accelerators. The simulator allows for a relatively quick, initial design that can be refined and verified with subsequent Monte Carlo (MC) calculations and measurements. The simulator also is a powerful educational tool. The simulator consists of an analytical algorithm for calculating electron fluence and X-ray dose and a graphical user interface (GUI) C++ program. The algorithm predicts electron fluence using Fermi-Eyges multiple Coulomb scattering theory with the reduced Gaussian formalism for scattering powers. The simulator also estimates central-axis and off-axis X-ray dose arising from the dual foil system. Once the geometry of the accelerator is specified, the simulator allows the user to continuously vary primary scattering foil material and thickness, secondary scat- tering foil material and Gaussian shape (thickness and sigma), and beam energy. The off-axis electron relative fluence or total dose profile and central-axis X-ray dose contamination are computed and displayed in real time. The simulator was validated by comparison of off-axis electron relative fluence and X-ray percent dose profiles with those calculated using EGSnrc MC. Over the energy range 7-20 MeV, using present foils on an Elekta radiotherapy accelerator, the simulator was able to reproduce MC profiles to within 2% out to 20 cm from the central axis. The central-axis X-ray percent dose predictions matched measured data to within 0.5%. The calculation time was approximately 100 ms using a single Intel 2.93 GHz processor, which allows for real-time variation of foil geometrical parameters using slider bars. This work demonstrates how the user-friendly GUI and real-time nature of the simulator make it an effective educational tool for gaining a better understanding of the effects that various system

A Monte Carlo investigation of contaminant electrons due to a novel in vivo transmission detector

International Nuclear Information System (INIS)

Asuni, G; Jensen, J M; McCurdy, B M C

2011-01-01

A novel transmission detector (IBA Dosimetry, Germany) developed as an IMRT quality assurance tool, intended for in vivo patient dose measurements, is studied here. The goal of this investigation is to use Monte Carlo techniques to characterize treatment beam parameters in the presence of the detector and to compare to those of a plastic block tray (a frequently used clinical device). Particular attention is paid to the impact of the detector on electron contamination model parameters of two commercial dose calculation algorithms. The linac head together with the COMPASS transmission detector (TRD) was modeled using BEAMnrc code. To understand the effect of the TRD on treatment beams, the contaminant electron fluence, energy spectra, and angular distributions at different SSDs were analyzed for open and non-open (i.e. TRD and block tray) fields. Contaminant electrons in the BEAMnrc simulations were separated according to where they were created. Calculation of surface dose and the evaluation of contributions from contaminant electrons were performed using the DOSXYZnrc user code. The effect of the TRD on contaminant electrons model parameters in Eclipse AAA and Pinnacle 3 dose calculation algorithms was investigated. Comparisons of the fluence of contaminant electrons produced in the non-open fields versus open field show that electrons created in the non-open fields increase at shorter SSD, but most of the electrons at shorter SSD are of low energy with large angular spread. These electrons are out-scattered or absorbed in air and contribute less to surface dose at larger SSD. Calculated surface doses with the block tray are higher than those with the TRD. Contribution of contaminant electrons to dose in the buildup region increases with increasing field size. The additional contribution of electrons to surface dose increases with field size for TRD and block tray. The introduction of the TRD results in a 12% and 15% increase in the Gaussian widths used in the

Thomson scattering from near-solid density plasmas using soft x-ray free electron lasers

Energy Technology Data Exchange (ETDEWEB)

Holl, A; Bornath, T; Cao, L; Doppner, T; Dusterer, S; Forster, E; Fortmann, C; Glenzer, S H; Gregori, G; Laarmann, T; Meiwes-Broer, K H; Przystawik, A; Radcliffe, P; Redmer, R; Reinholz, H; Ropke, G; Thiele, R; Tiggesbaumker, J; Toleikis, S; Truong, N X; Tschentscher, T; Uschmann, I; Zastrau, U

2006-11-21

We propose a collective Thomson scattering experiment at the VUV free electron laser facility at DESY (FLASH) which aims to diagnose warm dense matter at near-solid density. The plasma region of interest marks the transition from an ideal plasma to a correlated and degenerate many-particle system and is of current interest, e.g. in ICF experiments or laboratory astrophysics. Plasma diagnostic of such plasmas is a longstanding issue. The collective electron plasma mode (plasmon) is revealed in a pump-probe scattering experiment using the high-brilliant radiation to probe the plasma. The distinctive scattering features allow to infer basic plasma properties. For plasmas in thermal equilibrium the electron density and temperature is determined from scattering off the plasmon mode.

Absolute Negative Resistance Induced by Directional Electron-Electron Scattering in a Two-Dimensional Electron Gas

Science.gov (United States)

Kaya, Ismet I.; Eberl, Karl

2007-05-01

A three-terminal device formed by two electrostatic barriers crossing an asymmetrically patterned two-dimensional electron gas displays an unusual potential depression at the middle contact, yielding absolute negative resistance. The device displays momentum and current transfer ratios that far exceed unity. The observed reversal of the current or potential in the middle terminal can be interpreted as the analog of Bernoulli’s effect in a Fermi liquid. The results are explained by directional scattering of electrons in two dimensions.

Application of the method of continued fractions for electron scattering by linear molecules

International Nuclear Information System (INIS)

Lee, M.-T.; Iga, I.; Fujimoto, M.M.; Lara, O.; Brasilia Univ., DF

1995-01-01

The method of continued fractions (MCF) of Horacek and Sasakawa is adapted for the first time to study low-energy electron scattering by linear molecules. Particularly, we have calculated the reactance K-matrices for an electron scattered by hydrogen molecule and hydrogen molecular ion as well as by a polar LiH molecule in the static-exchange level. For all the applications studied herein. the calculated physical quantities converge rapidly, even for a strongly polar molecule such as LiH, to the correct values and in most cases the convergence is monotonic. Our study suggests that the MCF could be an efficient method for studying electron-molecule scattering and also photoionization of molecules. (Author)

Continuum orbital approximations in weak-coupling theories for inelastic electron scattering

International Nuclear Information System (INIS)

Peek, J.M.; Mann, J.B.

1977-01-01

Two approximations, motivated by heavy-particle scattering theory, are tested for weak-coupling electron-atom (ion) inelastic scattering theory. They consist of replacing the one-electron scattering orbitals by their Langer uniform approximations and the use of an average trajectory approximation which entirely avoids the necessity for generating continuum orbitals. Numerical tests for a dipole-allowed and a dipole-forbidden event, based on Coulomb-Born theory with exchange neglected, reveal the error trends. It is concluded that the uniform approximation gives a satisfactory prediction for traditional weak-coupling theories while the average approximation should be limited to collision energies exceeding at least twice the threshold energy. The accuracy for both approximations is higher for positive ions than for neutral targets. Partial-wave collision-strength data indicate that greater care should be exercised in using these approximations to predict quantities differential in the scattering angle. An application to the 2s 2 S-2p 2 P transition in Ne VIII is presented

Monte Carlo study of electron-plasmon scattering effects on hot electron transport in GaAs

International Nuclear Information System (INIS)

Popov, V.V.; Bagaeva, T.Yu.; Solodkaya, T.I.

1994-07-01

It is shown using Monte Carlo simulation that electron-plasmon scattering affects substantially the hot-electron energy distribution function and transport properties in bulk GaAs. However, this effect is found to be much less than that predicted in earlier paper of other authors. (author). 5 refs, 7 figs

Transmission Electron Microscopy Studies of Electron-Selective Titanium Oxide Contacts in Silicon Solar Cells

KAUST Repository

Ali, Haider; Yang, Xinbo; Weber, Klaus; Schoenfeld, Winston V.; Davis, Kristopher O.

2017-01-01

In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21

LA phonons scattering of surface electrons in Bi2Se3

International Nuclear Information System (INIS)

Huang, Lang-Tao; Zhu, Bang-Fen

2013-01-01

Within the Boltzmann equation formalism we evaluate the transport relaxation time of Dirac surface states (SSs) in the typical topological insulator(TI) Bi 2 Se 3 due to the phonon scattering. We find that although the back-scattering of the SSs in TIs is strictly forbidden, the in-plane scattering between SSs in 3-dimensional TIs is allowed, maximum around the right-angle scattering. Thus the topological property of the SSs only reduces the scattering rate to its one half approximately. Besides, the larger LA deformation potential and lower sound velocity of Bi 2 Se 3 enhance the scattering rate significantly. Compared with the Dirac electrons in graphene, we find the scattering rate of SSs in Bi 2 Se 3 are two orders of magnitudes larger, which agree with the recent transport experiments

Moeller scattering with unpolarized electrons for the development of a Moeller polarimeter at ELSA

International Nuclear Information System (INIS)

Hueffer, C.

1992-07-01

In future experiments with polarized electrons are planned at ELSA, so it is necessary to measure the polarisation of the extracted electron beam. One possibility is to use the method of Moeller-scattering. A suitable arrangement with two lucite Cerenkov-detectors has been investigated and Moeller-scattering with unpolarized electrons has been studied. A low noise-to-signal-ratio in the time spectra allowed to separate Moeller events from background. Therefore it was possible to observe the linear dependence of Moeller-scattering-events on the atomic number of the target foil and on the current of the extracted electron beam. With regard to planned experiments it was important to show that the separation of the Moeller-electrons from the primary beam by the use of one single dipole magnet has been succesful. (orig.) [de

Theoretical study of the electron-cluster elastic scattering

International Nuclear Information System (INIS)

Descourt, P.; Guet, C.; Farine, M.

1997-01-01

The properties of the clusters consisting of some tens to several hundreds of alkali atoms are generally quite well described in the jellium approximation. This approximation treats the cluster as a charged Fermi liquid of finite size. The optical response predicted by this approximation and taking into account the electron-electron correlations of the Hartree-Fock mean field agrees rather well with the experiment. The objective of this work was to obtain a quantal many-body formalism, within jellium approximation, applicable to elastic scattering of electrons from an alkali-metal-cluster. Influence of correlations on the phase shifts was also taken into account

Electron-phonon interaction and scattering in Si and Ge: Implications for phonon engineering

International Nuclear Information System (INIS)

Tandon, Nandan; Albrecht, J. D.; Ram-Mohan, L. R.

2015-01-01

We report ab-initio results for electron-phonon (e-ph) coupling and display the existence of a large variation in the coupling parameter as a function of electron and phonon dispersion. This variation is observed for all phonon modes in Si and Ge, and we show this for representative cases where the initial electron states are at the band gap edges. Using these e-ph matrix elements, which include all possible phonon modes and electron bands within a relevant energy range, we evaluate the imaginary part of the electron self-energy in order to obtain the associated scattering rates. The temperature dependence is seen through calculations of the scattering rates at 0 K and 300 K. The results provide a basis for understanding the impacts of phonon scattering vs. orientation and geometry in the design of devices, and in analysis of transport phenomena. This provides an additional tool for engineering the transfer of energy from carriers to the lattice

Efficient scattering of electrons below few keV by Time Domain Structures around injection fronts

Science.gov (United States)

Vasko, I.; Agapitov, O. V.; Mozer, F.; Artemyev, A.; Krasnoselskikh, V.

2016-12-01

Van Allen Probes observations show an abundance of non-linear large-amplitude electrostatic spikes around injection fronts in the outer radiation belt. These spikes referred to as Time Domain Structures (TDS) include electron holes, double layers and more complicated solitary waves. The electron scattering driven by TDS may not be evaluated via the standard quasi-linear theory, since TDS are in principle non-linear plasma modes. In this paper we analyze the scattering of electrons by three-dimensional TDS (with non-negligible perpendicular electric field) around injection fronts. We derive the analytical formulas describing the local scattering by single TDS and show that the most efficiently scattered electrons are those in the first cyclotron resonance (electrons crossing TDS on a time scale comparable with their gyroperiod). The analytical formulas are verified via the test-particle simulation. We compute the bounce-averaged diffusion coefficients and demonstrate their dependence on the TDS spatial distribution, individual TDS parameters and L shell. We show that TDS are able to provide the pitch-angle scattering of <5 keV electrons at rate 10-2-10-4 s-1 and, thus, can be responsible for driving loss of electrons out of injections fronts on a time scale from few minutes to few hours. TDS can be, thus, responsible for driving diffuse aurora precipitations conjugated to injection fronts. We show that the pitch-angle scattering rates driven by TDS are comparable with those due to chorus waves and exceed those due to electron cyclotron harmonics. For injections fronts with no significant wave activity in the frequency range corresponding to chorus waves, TDS can be even dominant mechanism for losses of below few keV electrons.

Invited Review Terahertz Transmission, Scattering, Reflection, and Absorption—the Interaction of THz Radiation with Soils

Science.gov (United States)

Lewis, R. A.

2017-07-01

Terahertz radiation has been proposed as a useful tool in the study of soils and related materials from such diverse perspectives as detection of non-metallic landmines to improving soil fertility by agricultural charcoals produced by pyrolysis of organic material. The main barrier to such applications is that soils are rather opaque at terahertz frequencies. In this article, the main findings to date on the interaction of terahertz radiation with soils are reviewed, organized around the four phenomena of terahertz: transmission, scattering, reflection, and absorption. Terahertz transmission through soils is generally low and decreases with frequency. Terahertz scattering is evident in many THz-soil interactions, as the wavelength of the radiation is of the order of the particle size. Terahertz reflection is important to communications as these develop from the GHz into the THz band. Terahertz absorption on diluted soil samples has been demonstrated to be effective in identifying soil constituents, such as aromatic compounds, and soil contaminants, such as pesticides.

Investigation of superthermal asymmetric electron distributions using electron cyclotron wave transmission in tokamaks

International Nuclear Information System (INIS)

Giruzzi, G.; Fidone, I.; Marcha, M.J.

1991-01-01

The asymmetric electron distribution generated during lower hybrid current drive has been computed using a 3-D Fokker-Planck code. The superthermal tail and the resulting current are generally a combination of two components streaming in opposite toroidal directions. An appropriate diagnostic method for experimental investigation of the two superthermal populations is wave transmission of two equivalent rays with equal and opposite values of the refractive index. These equivalent rays can be realized by launching the waves from symmetric positions with respect ot the equatorial plane at equal and opposite angles in the toroidal direction. Using an appropriate ray tracing code, the damping of the two rays is computed and it is shown that it results from electrons with opposite parallel velocities. The differential transmission is then a measure of the overall asymmetry of the electron momentum distribution. (author). 12 refs, 8 figs

Polarized Bhabha scattering and a precision measurement of the electron neutral current couplings

International Nuclear Information System (INIS)

Abe, K.; Abt, I.; Ahn, C.J.; Akagi, T.; Ash, W.W.; Aston, D.; Bacchetta, N.; Baird, K.G.; Baltay, C.; Band, H.R.; Barakat, M.B.; Baranko, G.; Bardon, O.; Barklow, T.; Bazarko, A.O.; Ben-David, R.; Benvenuti, A.C.; Bienz, T.; Bilei, G.M.; Bisello, D.; Blaylock, G.; Bogart, J.R.; Bolton, T.; Bower, G.R.; Brau, J.E.; Breidenbach, M.; Bugg, W.M.; Burke, D.; Burnett, T.H.; Burrows, P.N.; Busza, W.; Calcaterra, A.; Caldwell, D.O.; Calloway, D.; Camanzi, B.; Carpinelli, M.; Cassell, R.; Castaldi, R.; Castro, A.; Cavalli-Sforza, M.; Church, E.; Cohn, H.O.; Coller, J.A.; Cook, V.; Cotton, R.; Cowan, R.F.; Coyne, D.G.; D'Oliveira, A.; Damerell, C.J.S.; Dasu, S.; De Sangro, R.; De Simone, P.; Dell'Orso, R.; Dima, M.; Du, P.Y.C.; Dubois, R.; Eisenstein, B.I.; Elia, R.; Falciai, D.; Fan, C.; Fero, M.J.; Frey, R.; Furuno, K.; Gillman, T.; Gladding, G.; Gonzalez, S.; Hallewell, G.D.; Hart, E.L.; Hasegawa, Y.; Hedges, S.; Hertzbach, S.S.; Hildreth, M.D.; Huber, J.; Huffer, M.E.; Hughes, E.W.; Hwang, H.; Iwasaki, Y.; Jacques, P.; Jaros, J.; Johnson, A.S.; Johnson, J.R.; Johnson, R.A.; Junk, T.; Kajikawa, R.; Kalelkar, M.; Karliner, I.; Kawahara, H.; Kendall, H.W.; Kim, Y.; King, M.E.; King, R.; Kofler, R.R.; Krishna, N.M.; Kroeger, R.S.; Labs, J.F.; Langston, M.; Lath, A.; Lauber, J.A.; Leith, D.W.G.; Liu, X.; Loreti, M.; Lu, A.; Lynch, H.L.; Ma, J.; Mancinelli, G.; Manly, S.; Mantovani, G.; Markiewicz, T.W.; Maruyama, T.; Massetti, R.; Masuda, H.; Mazzucato, E.; McKemey, A.K.; Meadows, B.T.; Messner, R.; Mockett, P.M.; Moffeit, K.C.; Mours, B.; Mueller, G.; Muller, D.; Nagamine, T.; Nauenberg, U.; Neal, H.; Nussbaum, M.; Ohnishi, Y.; Osborne, L.S.; Panvini, R.S.; Park, H.; Pavel, T.J.; Peruzzi, I.; Pescara, L.; Piccolo, M.; Piemontese, L.; Pieroni, E.; Pitts, K.T.; Plano, R.J.; Prepost, R.; Prescott, C.Y.; Punkar, G.D.; Quigley, J.; Ratcliff, B.N.; Reeves, T.W.; Rensing, P.E.; Rochester, L.S.; Rothberg, J.E.; Rowson, P.C.; Russell, J.J.; Saxton, O.H.; Schalk, T.

1995-01-01

Bhabha scattering with polarized electrons at the Z 0 resonance has been measured with the SLD experiment at the SLAC Linear Collider. The first measurement of the left-right asymmetry in Bhabha scattering is presented, yielding the effective weak mixing angle of sinθ eff W =0.2245±0.0049±0.0010. The effective electron couplings to the Z 0 are extracted from a combined analysis of polarized Bhabha scattering and the left-right asymmetry previously published: υ e =-0.0414±0.0020 and a e =-0.4977±0.0045

Elastic electron scattering at large momentum transfer

International Nuclear Information System (INIS)

Arnold, R.G.

1979-05-01

A review is given of elastic electron scattering at large momentum transfer (Q 2 > 20 fm -2 ) from nuclei with A less than or equal to 4. Recent experimental results are reviewed and the current problems in interpretation of these results are pointed out. Some questions for future experiments are posed, and a preview of possible future measurements is presented. 28 references

Monte Carlo calculation of scattered radiation from applicators in low energy clinical electron beams

International Nuclear Information System (INIS)

Jabbari, N.; Hashemi-Malayeri, B.; Farajollahi, A. R.; Kazemnejad, A.

2007-01-01

In radiotherapy with electron beams, scattered radiation from an electron applicator influences the dose distribution in the patient. The contribution of this radiation to the patient dose is significant, even in modern accelerators. In most of radiotherapy treatment planning systems, this component is not explicitly included. In addition, the scattered radiation produced by applicators varies based on the applicator design as well as the field size and distance from the applicators. The aim of this study was to calculate the amount of scattered dose contribution from applicators. We also tried to provide an extensive set of calculated data that could be used as input or benchmark data for advanced treatment planning systems that use Monte Carlo algorithms for dose distribution calculations. Electron beams produced by a NEPTUN 10PC medical linac were modeled using the BEAMnrc system. Central axis depth dose curves of the electron beams were measured and calculated, with and without the applicators in place, for different field sizes and energies. The scattered radiation from the applicators was determined by subtracting the central axis depth dose curves obtained without the applicators from that with the applicator. The results of this study indicated that the scattered radiation from the electron applicators of the NEPTUN 10PC is significant and cannot be neglected in advanced treatment planning systems. Furthermore, our results showed that the scattered radiation depends on the field size and decreases almost linearly with depth. (author)

Review of two-photon exchange in electron scattering

Energy Technology Data Exchange (ETDEWEB)

J. Arrington, P. G. Blunden, W. Melnitchouk

2011-10-01

We review the role of two-photon exchange (TPE) in electron-hadron scattering, focusing in particular on hadronic frameworks suitable for describing the low and moderate Q^2 region relevant to most experimental studies. We discuss the effects of TPE on the extraction of nucleon form factors and their role in the resolution of the proton electric to magnetic form factor ratio puzzle. The implications of TPE on various other observables, including neutron form factors, electroproduction of resonances and pions, and nuclear form factors, are summarized. Measurements seeking to directly identify TPE effects, such as through the angular dependence of polarization measurements, nonlinear epsilon contributions to the cross sections, and via e+p to e-p cross section ratios, are also outlined. In the weak sector, we describe the role of TPE and gamma-Z interference in parity-violating electron scattering, and assess their impact on the extraction of the strange form factors of the nucleon and the weak charge of the proton.

Development of a Hydrogen Møller Polarimeter for Precision Parity-Violating Electron Scattering

Science.gov (United States)

Gray, Valerie M.

2013-10-01

Parity-violating electron scattering experiments allow for testing the Standard Model at low energy accelerators. Future parity-violating electron scattering experiments, like the P2 experiment at the Johannes Gutenberg University, Mainz, Germany, and the MOLLER and SoLID experiments at Jefferson Lab will measure observables predicted by the Standard Model to high precision. In order to make these measurements, we will need to determine the polarization of the electron beam to sub-percent precision. The present way of measuring the polarization, with Møller scattering in iron foils or using Compton laser backscattering, will not easily be able to reach this precision. The novel Hydrogen Møller Polarimeter presents a non-invasive way to measure the electron polarization by scattering the electron beam off of atomic hydrogen gas polarized in a 7 Tesla solenoidal magnetic trap. This apparatus is expected to be operational by 2016 in Mainz. Currently, simulations of the polarimeter are used to develop the detection system at College of William & Mary, while the hydrogen trap and superconducting solenoid magnet are being developed at the Johannes Gutenberg University, Mainz. I will discuss the progress of the design and development of this novel polarimeter system. This material is based upon work supported by the National Science Foundation under Grant No. PHY-1206053.

Development of a secondary electron energy analyzer for a transmission electron microscope.

Science.gov (United States)

Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke

2018-04-01

A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.

Total cross sections for slow-electron (1--20 eV) scattering in solid H2O

International Nuclear Information System (INIS)

Michaud, M.; Sanche, L.

1987-01-01

An analytical method is proposed to determine absolute total cross sections per scatterer and related mean free paths for low-energy electron scattering in disordered molecular solid films. The procedure is based on a two-stream multiple-scattering model of the thickness dependence of the film reflectivity for elastic electrons. The expected analytical behavior and accuracy are tested on a model sample whose scattering properties are generated by a Monte Carlo simulation from initially known parameters. The effects of multiple scattering inside the film and at its interfaces are taken into account and discussed. The thickness dependence of the elastic electron reflectivity of H 2 O film condensed at 14 K is reported between 1 and 20 eV incident energy with a spectrometer resolution of 10 MeV. The proposed method is applied to extract from these measurements the energy dependence of the total effective and total inelastic cross sections for electron scattering in amorphous ice

Inelastic plasmon and inter-band electron-scattering potentials for Si from dielectric matrix calculations

International Nuclear Information System (INIS)

Josefsson, T.W.; Smith, A.E.

1994-01-01

Inelastic scattering of electrons in a crystalline environment may be represented by a complex non-hermitian potential. Completed generalised expressions for this inelastic electron scattering potential matrix, including virtual inelastic scattering, are derived for outer-shell electron and plasmon excitations. The relationship between these expressions and the general anisotropic dielectric response matrix of the solid is discussed. These generalised expressions necessarily include the off-diagonal terms representing effects due to departure from translational invariance in the interaction. Results are presented for the diagonal back structure dependent inelastic and virtual inelastic scattering potentials for Si, from a calculation of the inverse dielectric matrix in the random phase approximation. Good agreement is found with experiment as a function of incident energies from 10 eV to 100 keV. Anisotropy effects and hence the interaction de localisation represented by the off-diagonal scattering potential terms, are found to be significant below 1 keV. 38 refs., 2 figs

Observation of second harmonics in laser-electron scattering using low energy electron beam

Energy Technology Data Exchange (ETDEWEB)

Iinuma, Masataka [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan)]. E-mail: iinuma@hiroshima-u.ac.jp; Matsukado, Koji [Venture Business Laboratory, Hiroshima University, 1-313 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8527 (Japan); Endo, Ichita [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Hashida, Masaki [Institute for chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Hayashi, Kenji [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Kohara, Akitsugu [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Matsumoto, Fumihiko [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Nakanishi, Yoshitaka [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Sakabe, Shuji [Institute for chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Shimizu, Seiji [Institute for chemical Research, Kyoto University, Gokasho, Uji, Kyoto 611-0011 (Japan); Tauchi, Toshiaki [High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Yamamoto, Ken [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan); Takahashi, Tohru [ADSM, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima 739-8530 (Japan)

2005-10-17

We observed photon generation in the second harmonic region in collisions of 10 keV free electrons and the intense laser beam with the peak intensity of 4.0x10{sup 15} W/cm{sup 2}. Observed photon yield was 3 orders of magnitude higher than expectation from the nonlinear Compton scattering. The observation indicates necessity of further investigation for the interaction between the intense laser field and the low energy electron beam.

Electron--molecule scattering in momentum space

International Nuclear Information System (INIS)

Ritchie, B.

1979-01-01

We examine the Fourier transform of the Schroedinger equation for electron--molecule scattering, treated as potential scattering from a multicenter distribution of charged fixed in space. When the angle theta between R,the internuclear vector of a diatomic target, and q, the momentum transfer, is held fixed during the collision, then the directions of incidence and scattering are fixed relative to R. The process is then described as having a dynamical dependence on the magnitude of q, q, from which the scattering angle is determined, and a parametric dependence on q's direction relative to R. This approximation is used routinely at high energies in the calculation of the Born amplitude. Fixed--nuclei coordinate--space studies suggest that this approximation can be extended to low energies, provided the amplitude is taken from the solution of the integral equation of momentum space rather than from its inhomogeneity, proportional to the Born amplitude. We constrain R to be in the same direction relative to q', a virtual momentum transfer belonging to the kernel, as it is to q.Calculations are performed for the e, H 2 scattering in the static approximation, and cross sections averaged over theta/sub R/ are shown to be in good agreement with cross sections calculated by use of coupled spherical and coupled spheroidal partial wave theories. The angular distribution in the static approximation is also calculated at an incident energy close to 7 eV, where exchange is relatively unimportant. This result is in reasonably good agreement with that of R matrix theory in the static--exchange approximation. The extension of the theory to treat exchange is formulated and discussed. Also its extension to treat more complicated molecular targets is discussed

Continuum and bound electronic wavefunctions for anisotropic multiple-scattering potentials

International Nuclear Information System (INIS)

Siegel, J.; Dill, D.; Dehmer, J.L.

1975-01-01

Standard multiple-scattering treatments of bound and continuum one-electron states are restricted to a monopole potential in each of the various spherical regions. We have extended the treatment within these regions to a general potential. The corresponding multiple-scattering equations should facilitate accurate treatment of effects of the build-up of charge due to bonding, of the dipole character of polar molecules, and of external fields

Electron scattering from the octupole band in 238U

International Nuclear Information System (INIS)

Hirsch, A.; Creswell, C.; Bertozzi, W.; Heisenberg, J.; Hynes, M.V.; Kowalski, S.; Miska, H.; Norum, B.; Rad, F.N.; Sargent, C.P.; Sasanuma, T.; Turchinetz, W.

1978-01-01

A simple model for nuclear surface vibrations in permanently deformed nuclei does well in reproducing electron scattering cross sections of rotational levels built on a K/sup π/= 0 - intrinsic octupole vibration in 238 U

Development of the Atomic-Resolution Environmental Transmission Electron Microscope

DEFF Research Database (Denmark)

Gai, Pratibha L.; Boyes, Edward D.; Yoshida, Kenta

2016-01-01

The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures is descr......The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures...... is used to study steels, graphene, nanowires, etc. In this chapter, the experimental setup of the microscope column and its peripherals are described....

Attenuation correction for the HRRT PET-scanner using transmission scatter correction and total variation regularization

DEFF Research Database (Denmark)

Keller, Sune H; Svarer, Claus; Sibomana, Merence

2013-01-01

scatter correction in the μ-map reconstruction and total variation filtering to the transmission processing. Results: Comparing MAP-TR and the new TXTV with gold standard CT-based attenuation correction, we found that TXTV has less bias as compared to MAP-TR. We also compared images acquired at the HRRT......In the standard software for the Siemens high-resolution research tomograph (HRRT) positron emission tomography (PET) scanner the most commonly used segmentation in the μ -map reconstruction for human brain scans is maximum a posteriori for transmission (MAP-TR). Bias in the lower cerebellum...

Linear versus non-linear structural information limit in high-resolution transmission electron microscopy

International Nuclear Information System (INIS)

Van Aert, S.; Chen, J.H.; Van Dyck, D.

2010-01-01

A widely used performance criterion in high-resolution transmission electron microscopy (HRTEM) is the information limit. It corresponds to the inverse of the maximum spatial object frequency that is linearly transmitted with sufficient intensity from the exit plane of the object to the image plane and is limited due to partial temporal coherence. In practice, the information limit is often measured from a diffractogram or from Young's fringes assuming a weak phase object scattering beyond the inverse of the information limit. However, for an aberration corrected electron microscope, with an information limit in the sub-angstrom range, weak phase objects are no longer applicable since they do not scatter sufficiently in this range. Therefore, one relies on more strongly scattering objects such as crystals of heavy atoms observed along a low index zone axis. In that case, dynamical scattering becomes important such that the non-linear and linear interaction may be equally important. The non-linear interaction may then set the experimental cut-off frequency observed in a diffractogram. The goal of this paper is to quantify both the linear and the non-linear information transfer in terms of closed form analytical expressions. Whereas the cut-off frequency set by the linear transfer can be directly related with the attainable resolution, information from the non-linear transfer can only be extracted using quantitative, model-based methods. In contrast to the historic definition of the information limit depending on microscope parameters only, the expressions derived in this paper explicitly incorporate their dependence on the structure parameters as well. In order to emphasize this dependence and to distinguish from the usual information limit, the expressions derived for the inverse cut-off frequencies will be referred to as the linear and non-linear structural information limit. The present findings confirm the well-known result that partial temporal coherence has

Temporary electron localization and scattering in disordered single strands of DNA

International Nuclear Information System (INIS)

Caron, Laurent; Sanche, Leon

2006-01-01

We present a theoretical study of the effect of structural and base sequence disorders on the transport properties of nonthermal electron scattering within and from single strands of DNA. The calculations are based on our recently developed formalism to treat multiple elastic scattering from simplified pseudomolecular DNA subunits. Structural disorder is shown to increase both the elastic scattering cross section and the attachment probability on the bases at low energy. Sequence disorder, however, has no significant effect

Study of single-electron excitations by electron microscopy

International Nuclear Information System (INIS)

Craven, A.J.; Gibson, J.M.; Howie, A.; Spalding, D.R.

1978-01-01

The inelastic scattering of fast electrons by the excitation of L-shell electrons at a stacking fault in silicon has been studied with a scanning transmission electron microscope. It was found that the bright-field stacking fault contrast is preserved in the filtered L-shell-loss signal at 100 eV. This result is discussed in terms of the delocalization of the excitation mechanism. It is concluded that localization effects will typically become significant only for energy transfers greater than 1 keV from a fast electron of energy 80 keV. (author)

Expansions for model-independent analyses of inelastic electron scattering

International Nuclear Information System (INIS)

Jackson, D.F.; Hilton, J.M.; Roberts, A.C.M.

1977-01-01

It is noted that the commonly-used Fourier-Bessel expansion for the transition density for inelastic electron scattering depends sensitively on an arbitrary parameter and is not realistic at large distances. Alternative expansions are suggested. (author)

Surface-enhanced Raman scattering active gold nanoparticle/nanohole arrays fabricated through electron beam lithography

Science.gov (United States)

Wu, Tsunghsueh; Lin, Yang-Wei

2018-03-01

Effective surface-enhanced Raman scattering (SERS)-active substrates from gold nanoparticle and gold nanohole arrays were successfully fabricated through electron beam lithography with precise computer-aided control of the unit size and intergap distance. Their SERS performance was evaluated using 4-mercaptobenzoic acid (4-MBA). These gold arrays yielded strong SERS signals under 785 nm laser excitation. The enhancement factors for 4-MBA molecules on the prepared gold nanoparticle and nanohole arrays maxed at 1.08 × 107 and 8.61 × 106, respectively. The observed increase in SERS enhancement was attributed to the localized surface plasmon resonance (LSPR) wavelength shifting toward the near-infrared regime when the gold nanohole diameter increased, in agreement with the theoretical prediction in this study. The contribution of LSPR to the Raman enhancement from nanohole arrays deposited on fluorine-doped tin oxide glass was elucidated by comparing SERS and transmission spectra. This simple fabrication procedure, which entails employing electron beam lithography and the controllability of the intergap distance, suggests highly promising uses of nanohole arrays as functional components in sensing and photonic devices.

Oxidation mechanism of nickel particles studied in an environmental transmission electron microscope

DEFF Research Database (Denmark)

Jeangros, Q.; Hansen, Thomas Willum; Wagner, Jakob Birkedal

2014-01-01

The oxidation of nickel particles was studied in situ in an environmental transmission electron microscope in 3.2 mbar of O2 between ambient temperature and 600°C. Several different transmission electron microscopy imaging techniques, electron diffraction and electron energy-loss spectroscopy were...... diffusion of Ni2+ along NiO grain boundaries, self-diffusion of Ni2+ ions and vacancies, growth of NiO grains and nucleation of voids at Ni/NiO interfaces. We also observed the formation of transverse cracks in a growing NiO film in situ in the electron microscope....

Cross sections for inelastic scattering of electrons by atoms: selected topics related to electron microscopy

International Nuclear Information System (INIS)

Inokuti, M.; Manson, S.T.

1982-01-01

We begin with a resume of the Bethe theory, which provides a general framework for discussing the inelastic scattering of fast electrons and leads to powerful criteria for judging the reliability of cross-section data. The central notion of the theory is the generalized oscillator strength as a function of both the energy transfer and the momentum transfer, and is the only non-trivial factor in the inelastic-scattering cross section. Although the Bethe theory was initially conceived for free atoms, its basic ideas apply to solids, with suitable generalizations; in this respect, the notion of the dielectric response function is the most fundamental. Topics selected for discussion include the generalized oscillator strengths for the K-shell and L-shell ionization for all atoms with Z less than or equal to 30, evaluated by use of the Hartree-Slater potential. As a function of the energy transfer, the generalized oscillator strength most often shows a non-monotonic structure near the K-shell and L-shell thresholds, which has been interpreted as manifestations of electron-wave propagation through atomic fields. For molecules and solids, there are additional structures due to the scattering of ejected electrons by the fields of other atoms

On the proton exchange contribution to electron-hydrogen atom elastic scattering

International Nuclear Information System (INIS)

Mignaco, J.A.; Tort, A.C.

1979-05-01

It is shown that the exchange contribution to the electron-proton potential Born term in elastic electron-hydrogen atom scattering arises as the non relativistic limit from the exchange of a proton between the two participant electrons - calculated from quantum electrodynamics including properly bound states (as solution of Bethe - Salpeter equation). (Author) [pt

Morphology, surface roughness, electron inelastic and quasi-elastic scattering in elastic peak electron spectroscopy of polymers

International Nuclear Information System (INIS)

Lesiak, B.; Kosinski, A.; Nowakowski, R.; Koever, L.; Toth, J.; Varga, D.; Cserny, I.; Sulyok, A.; Gergely, G.

2006-01-01

Complete text of publication follows. Elastic peak electron spectroscopy (EPES) deals with the interaction of electrons with atoms of a solid surface, studying the distribution of electrons backscattered elastically. The nearest vicinity of the elastic peak, (low kinetic energy region) reflects both, electron inelastic and quasi-elastic processes. The incident electrons produce surface excitations, inducing surface plasmons with the corresponding loss peaks separated by 1 - 20 eV energy from the elastic peak. Quasi-elastic losses result from the recoil of scattering atoms of different atomic number, Z. The respective energy shift and Doppler broadening of the elastic peak depend on Z, the primary electron energy, E, and the measurement geometry. Quantitative surface analytical application of EPES, such as determination of parameters describing electron transport, requires a comparison of experimental data with corresponding data derived from Monte Carlo (MC) simulation. Several problems occur in EPES studies of polymers. The intensity of elastic peak, considered in quantitative surface analysis, is influenced by both, the inelastic and quasi-elastic scattering processes (especially for hydrogen scattering atoms and primary electron energy above 1000 eV). An additional factor affecting the elastic peak intensity is the surface morphology and roughness. The present work compares the effect of these factors on the elastic peak intensity for selected polymers (polyethylene, polyaniline and polythiophenes). X-ray photoelectron spectroscopy (XPS) and helium pycnometry are applied for deriving the surface atomic composition and the bulk density, while scanning electron microscopy (SEM) and atomic force microscopy (AFM) for determining surface morphology and roughness. According to presented results, the influence of surface morphology and roughness is larger than those of surface excitations or recoil of hydrogen atoms. The component due to recoil of hydrogen atoms can be

Total cross sections for electron scattering with halocarbon molecules

Energy Technology Data Exchange (ETDEWEB)

Naghma, Rahla; Gupta, Dhanoj; Antony, Bobby, E-mail: bka.ism@gmail.com

2014-03-01

Highlights: • A quantum mechanical model to find elastic, inelastic and total CS by e{sup −} impact. • Spherical complex optical potential formalism is used to find total CS. • Result shows consistency and good agreement with previous data wherever available. • Maiden attempt to find CS for CH{sub 2}Br{sub 2}, CHBr{sub 3}, CBr{sub 4} and C{sub n}H{sub 2n+1}Cl (n = 2–4) molecules. • Interesting correlation observed between total CS and polarizability of the molecule. - Abstract: A theoretical study on electron collision with chlorinated methanes: CH{sub 2}Cl{sub 2} and CHCl{sub 3}, brominated methanes: CH{sub 2}Br{sub 2}, CHBr{sub 3} and CBr{sub 4} and some mono chloroalkanes: C{sub n}H{sub 2n+1}Cl (n = 2–4) molecules in gaseous ground state is undertaken to report elastic, inelastic and total cross sections in the 20–5000 eV energy range. The target molecule is represented as a sum of various scattering centres, which are assumed to scatter electrons independently. The spherical complex optical potential (SCOP) is formulated to represent the interaction dynamics between the electron and the constituent scattering centres. Using SCOP, the quantum mechanical scattering problem is solved through partial wave analysis. The results obtained for CH{sub 2}Cl{sub 2} and CHCl{sub 3} are compared with the available experimental and theoretical values. The elastic cross section for CBr{sub 4} shows satisfactory agreement with the previous available data. The cross sections for CH{sub 2}Br{sub 2}, CHBr{sub 3}, and C{sub n}H{sub 2n+1}Cl (n = 2–4) molecules presented in this work are reported for the first time.

Study of nuclei by electron scattering

International Nuclear Information System (INIS)

Torizuka, Yoshiharu; Saito, Teijiro; Ito, Kohei; Terasawa, Tatsuo; Hosoyama, Kenji.

1974-01-01

It is urgently required to clarify the physical meaning of the quasi-elastic scattering associated with the background, in order to develop rapidly the study of giant resonance. The experimental works performed in the present term aimed at the synthetic understanding of both giant resonance and quasi-elastic scattering, and presented the possibility of the separability of giant resonance from quasi-elastic scattering. The object of this experiment was to measure higher order multi-pole moment of 51 V by using relatively high energy electron beam. Targets of chemically pure 51 V had thickness of 68.2 or 100.5 mg/cm 2 . The measurement was made at the position where scattering angle was 155 0 . The state of M7 can be well explained by the model with (fsub(7/2)) 3 coordination. This may be because the nuclei with stretched configuration such as 51 V do not have any contribution of orbital motion, but have the contribution of eigen magnetic moment to the highest multiplicity. States of M3 and M5 are a little complicated. Since in the experimental equipment used, the contribution of charge distribution was so large, that it was difficult to make the precision measurement of M3 and M5. In 51 V, however, it can be considered that M3 and M5 decreased by the contribution of 2Psub(3/2) and 1fsub(5/2). On the other hand, there is no contribution from these energy states to M7. (Tai, I.)

Transmission characteristics of the kinematics of the laser-plasma shock wave in air in compton scattering

International Nuclear Information System (INIS)

Hao Dongshan; Xie Hongjun

2006-01-01

By comparing the kinematical equation of a shock wave in free air, the study of transmission characteristics of the laser plasma shock wave in Compton scattering is presented. The results show that the attenuation course of the kinematics of he laser plasma shock wave is related not only with the explosion fountainhead and the characteristics of the explosion course, total energy release, air elastic, but also with multi-photon nonlinear Compton scattering. Because of the scattering the initial radius of the shock wave increases, the attenuation course shortens, the energy metastasis efficiency rises. The results of the numerical analysis and the actual values of the shock waves in air by a way intense explosion are very tallying. (authors)

The Strength of Chaos: Accurate Simulation of Resonant Electron Scattering by Many-Electron Ions and Atoms in the Presence of Quantum Chaos

Science.gov (United States)

2017-01-20

AFRL-AFOSR-JP-TR-2017-0012 The Strength of Chaos : accurate simulation of resonant electron scattering by many-electron ions and atoms in the presence...of quantum chaos Igor Bray CURTIN UNIVERSITY OF TECHNOLOGY Final Report 01/20/2017 DISTRIBUTION A: Distribution approved for public release. AF...SUBTITLE The Strength of Chaos : accurate simulation of resonant electron scattering by many- electron ions and atoms in the presence of quantum chaos

One-dimensional theory and simulation of acceleration in relativistic electron beam Raman scattering

International Nuclear Information System (INIS)

Abe, T.

1986-01-01

Raman scattering by a parallel relativistic electron beam was examined analytically and by using the numerical simulation. Incident wave energy can be transferred not only to the scattered electromagnetic wave but also to the beam. That is, the beam can be accelerated by the Doppler-shifted plasma oscillation accompanied by the scattered wave. The energy conversion rates for them were obtained. They increase with the γ value of the electron beam. For the larger γ values of the beam, the energy of the incident wave is mainly transferred to the beam, while in smaller γ, the energy conversion rate to the scattered wave is about 0.2 times that to the beam. Even in smaller γ, the total energy conversion rate is about 0.1

Preliminary results on application of the multiple-scattering technique to electron--molecule scattering and molecular photoionization: the PI/sub g/ resonance in e-N2 scattering

International Nuclear Information System (INIS)

Dehmer, J.L.; Dill, D.

1974-01-01

A prototype calculation of the well-known 2.5-eV shape resonance in e-N 2 scattering was performed to test the usefulness of the multiple-scattering method for electronic continuum molecular wavefunctions. The results of this demanding test are very encouraging. (U.S.)

Double electron ionization in Compton scattering of high energy photons by helium atoms

International Nuclear Information System (INIS)

Amusia, M.Y.; Mikhailov, A.I.

1995-01-01

The cross section for double-electron ionization of two-electron atoms and ions in Compton scattering of high energy photons is calculated. It is demonstrated that its dependence on the incoming photon frequency is the same as that for single-electron ionization. The ratio of open-quotes double-to-singleclose quotes ionization in Compton scattering was found to be energy independent and almost identical with the corresponding value for photoionization. For the He atom it is 1.68%. This surprising result deserves experimental verification

Double electron ionization in Compton scattering of high energy photons by helium atoms

Energy Technology Data Exchange (ETDEWEB)

Amusia, M.Y.; Mikhailov, A.I. [St. Petersburg Nuclear Physics Institute, Gatchina (Russian Federation)

1995-08-01

The cross section for double-electron ionization of two-electron atoms and ions in Compton scattering of high energy photons is calculated. It is demonstrated that its dependence on the incoming photon frequency is the same as that for single-electron ionization. The ratio of {open_quotes}double-to-single{close_quotes} ionization in Compton scattering was found to be energy independent and almost identical with the corresponding value for photoionization. For the He atom it is 1.68%. This surprising result deserves experimental verification.

Pitch Angle Scattering of Energetic Electrons by Plasmaspheric Hiss Emissions

Science.gov (United States)

Tobita, M.; Omura, Y.; Summers, D.

2017-12-01

We study scattering of energetic electrons in pitch angles and kinetic energies through their resonance with plasmaspheric hiss emissions consisting of many coherent discrete whistler-mode wave packets with rising and falling frequencies [1,2,3]. Using test particle simulations, we evaluate the efficiency of scattering, which depends on the inhomogeneity ratio S of whistler mode wave-particle interaction [4]. The value of S is determined by the wave amplitude, frequency sweep rate, and the gradient of the background magnetic field. We first modulate those parameters and observe variations of pitch angles and kinetic energies of electrons with a single wave under various S values so as to obtain basic understanding. We then include many waves into the system to simulate plasmaspheric hiss emissions. As the wave packets propagate away from the magnetic equator, the nonlinear trapping potential at the resonance velocity is deformed, making a channel of gyrophase for untrapped electrons to cross the resonance velocity, and causing modulations in their pitch angles and kinetic energies. We find efficient scattering of pitch angles and kinetic energies because of coherent nonlinear wave-particle interaction, resulting in electron precipitations into the polar atmosphere. We compare the results with the bounce averaged pitch angle diffusion coefficient based on quasi-linear theory, and show that the nonlinear wave model with many coherent packets can cause scattering of resonant electrons much faster than the quasi-linear diffusion process. [1] Summers, D., Omura, Y., Nakamura, S., and C. A. Kletzing (2014), Fine structure of plasmaspheric hiss, J. Geophys. Res., 119, 9134-9149. [2] Omura, Y., Y. Miyashita, M. Yoshikawa, D. Summers, M. Hikishima, Y. Ebihara, and Y. Kubota (2015), Formation process of relativistic electron flux through interaction with chorus emissions in the Earth's inner magnetosphere, J. Geophys. Res. Space Physics, 120, 9545-9562. [3] Nakamura, S., Y

Characterization of a quadrant diamond transmission X-ray detector including a precise determination of the mean electron-hole pair creation energy.

Science.gov (United States)

Keister, Jeffrey W; Cibik, Levent; Schreiber, Swenja; Krumrey, Michael

2018-03-01

Precise monitoring of the incoming photon flux is crucial for many experiments using synchrotron radiation. For photon energies above a few keV, thin semiconductor photodiodes can be operated in transmission for this purpose. Diamond is a particularly attractive material as a result of its low absorption. The responsivity of a state-of-the art diamond quadrant transmission detector has been determined, with relative uncertainties below 1% by direct calibration against an electrical substitution radiometer. From these data and the measured transmittance, the thickness of the involved layers as well as the mean electron-hole pair creation energy were determined, the latter with an unprecedented relative uncertainty of 1%. The linearity and X-ray scattering properties of the device are also described.

Electron inelastic scattering by compound nuclei and giant multipole resonances

International Nuclear Information System (INIS)

Dzhavadov, A.V.; Mukhtarov, A.I.; Mirabutalybov, M.M.

1980-01-01

Multipole giant resonances in heavy nuclei have been investigated with the application of the Danos-Greiner dynamic collective theory to the Tassi model. The monopole giant resonance has been studied in 158 Gd, 166 Er, 184 W, 232 Th and 238 V nuclei at the incident electron energy E=200 MeV. Dependences of the form factor square of electron scattering by a 166 Er nucleus on the scattering angle obtained in the distorted-wave high-energy approximation (DWHEA) are presented. Giant dipole and quadrupole resonances in 60 Ni and 90 Zr nuclei have been studied. A comparison has been made of theoretical results obtained in the DWHEA for the dependence of the form factor square on the effective momentum transfer with the experimental data. The analysis of the obtained results led to the following conclusions. To draw a conclusion about the validity of one or another nuclear model and methods for calculating form factors, it is necessary to investigate, both theoretically and experimentally, electron scattering at great angles (THETA>=70 deg). To obtain a good agreement it is necessary to take account of the actual proton and neutron distributions in the ground state and their dynamic properties in an excited state [ru

Directly Observing Micelle Fusion and Growth in Solution by Liquid-Cell Transmission Electron Microscopy

Energy Technology Data Exchange (ETDEWEB)

Parent, Lucas R. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Bakalis, Evangelos [Dipartimento; Ramírez-Hernández, Abelardo [Materials; Institute; Kammeyer, Jacquelin K. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Park, Chiwoo [Department; de Pablo, Juan [Materials; Institute; Zerbetto, Francesco [Dipartimento; Patterson, Joseph P. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Laboratory; Gianneschi, Nathan C. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States

2017-11-16

Amphiphilic small molecules and polymers form commonplace nanoscale macromolecular compartments and bilayers, and as such are truly essential components in all cells and in many cellular processes. The nature of these architectures, including their formation, phase changes, and stimuli-response behaviors, is necessary for the most basic functions of life, and over the past half-century, these natural micellar structures have inspired a vast diversity of industrial products, from biomedicines to detergents, lubricants, and coatings. The importance of these materials and their ubiquity have made them the subject of intense investigation regarding their nanoscale dynamics with increasing interest in obtaining sufficient temporal and spatial resolution to directly observe nanoscale processes. However, the vast majority of experimental methods involve either bulk-averaging techniques including light, neutron, and X-ray scattering, or are static in nature including even the most advanced cryogenic transmission electron microscopy techniques. Here, we employ in situ liquid-cell transmission electron microscopy (LCTEM) to directly observe the evolution of individual amphiphilic block copolymer micellar nanoparticles in solution, in real time with nanometer spatial resolution. These observations, made on a proof-of-concept bioconjugate polymer amphiphile, revealed growth and evolution occurring by unimer addition processes and by particle-particle collision-and-fusion events. The experimental approach, combining direct LCTEM observation, quantitative analysis of LCTEM data, and correlated in silico simulations, provides a unique view of solvated soft matter nanoassemblies as they morph and evolve in time and space, enabling us to capture these phenomena in solution.

Application and development of the Schwinger multichannel scattering theory and the partial differential equation theory of electron-molecule scattering

Science.gov (United States)

Weatherford, Charles A.

1993-01-01

One version of the multichannel theory for electron-target scattering based on the Schwinger variational principle, the SMC method, requires the introduction of a projection parameter. The role of the projection parameter a is investigated and it is shown that the principal-value operator in the SMC equation is Hermitian regardless of the value of a as long as it is real and nonzero. In a basis that is properly orthonormalizable, the matrix representation of this operator is also Hermitian. The use of such basis is consistent with the Schwinger variational principle because the Lippmann-Schwinger equation automatically builds in the correct boundary conditions. Otherwise, an auxiliary condition needs to be introduced, and Takatsuka and McKoy's original value of a is one of the three possible ways to achieve Hermiticity. In all cases but one, a can be uncoupled from the Hermiticity condition and becomes a free parameter. An equation for a based on the variational stability of the scattering amplitude is derived; its solution has an interesting property that the scattering amplitude from a converged SMC calculation is independent of the choice of a even though the SMC operator itself is a-dependent. This property provides a sensitive test of the convergence of the calculation. For a static-exchange calculation, the convergence requirement only depends on the completeness of the one-electron basis, but for a general multichannel case, the a-invariance in the scattering amplitude requires both the one-electron basis and the N plus 1-electron basis to be complete. The role of a in the SMC equation and the convergence property are illustrated using two examples: e-CO elastic scattering in the static-exchange approximation, and a two-state treatment of the e-H2 Chi(sup 1)Sigma(sub g)(+) yields b(sup 3)Sigma(sub u)(+) excitation.

A simplified mathematical model for scattered transmission of X-rays in raw brown coal

International Nuclear Information System (INIS)

Braune, M.

1983-01-01

A simplified mathematical model is presented which renders it possible to calculate the ash content of lignite from scattered transmission of X radiation taking into account two grain classes, the bulk density, and the fill height. The fine grain is assigned to sand and the coarse one to lignite. The model provides a correlation between the fine grain content and the counting rate

A simple way to obtain backscattered electron images in a scanning transmission electron microscope.

Science.gov (United States)

Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki

2014-08-01

We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

NESKA, Electron and Positron Scattering from Point Nuclei

International Nuclear Information System (INIS)

Idoeta, R.; Legarda, F.

2002-01-01

1 - Description of program or function: The Mott's differential cross section for the scattering of electrons and positrons by point nuclei without screening is calculated for any energy, atomic number and angle of scattering. 2 - Method of solution: We have summed the conditionally convergent series appearing in Mott's cross section using two consecutive transformations: the one of Yennie, Ravenhall and Wilson and that of Euler till we have seven times six significant figures repeated in the ratio of the Mott cross section to the classical Rutherford cross section. 3 - Restrictions on the complexity of the problem: Those appearing in the use of Mott's cross section for unscreened point nuclei

Optical potential study of electron scattering by rubidium

Energy Technology Data Exchange (ETDEWEB)

Chin, J. H.; Ratnavelu, K. [University of Malaya, Kuala Lumpur (Malaysia); Zhou, Y. [Harbin Institute of Technology, Harbin (China)

2011-10-15

The coupled-channel optical method (CCOM) has been implemented in a study of electronrubidium scattering. This method includes the continuum effect in the calculation via an ab-initio optical potential. Eight atomic states (5s, 5p, 4d, 6s, 6p, 5d, 7s, 7p) were used together with the continuum optical potential in the 5s-5s, 5s-5p, and 5p-5p coupling. The elastic, inelastic and total cross sections for electron-rubidium scattering at low and intermediate energies, ranging from 10 eV to 100 eV, are reported. The results are compared with available experimental and theoretical data.

High resolution transmission imaging without lenses

International Nuclear Information System (INIS)

Rodenburg, J M; Hurst, A C; Maiden, A

2010-01-01

The whole history of transmission imaging has been dominated by the lens, whether used in visible-light optics, electron optics or X-ray optics. Lenses can be thought of as a very efficient method of processing a wave front scattered from an object into an image of that object. An alternative approach is to undertake this image-formation process using a computational technique. The crudest scattering experiment is to simply record the intensity of a diffraction pattern. Recent progress in so-called diffractive imaging has shown that it is possible to recover the phase of a scattered wavefield from its diffraction pattern alone, as long as the object (or the illumination on the object) is of finite extent. In this paper we present results from a very efficient phase retrieval method which can image infinitely large fields of view. It may have important applications in improving resolution in electron microscopy, or at least allowing low specification microscopes to achieve resolution comparable to state-of-the-art machines.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

MAGNETIC SPECTROMETER DESIGN FOR ELECTRON SCATTERING ABOVE 1 Bev

Energy Technology Data Exchange (ETDEWEB)

Schopper, H.

1963-06-15

Design considerations are discussed for magnetic spectrometer electron scattering investigations with the higher energy (above 1 Bev) electron sources which are being developed. The spectrometers are to be used to discriminate between elastic and inelastic processes. A momentum resolution of the order of one per cent is required for these experiments. Various spectrometers are compared according to their optical properties and the number of magnets they consist of. (R.E.U.)

Experimental and theoretical electron-scattering cross-section data for dichloromethane

Science.gov (United States)

Krupa, K.; Lange, E.; Blanco, F.; Barbosa, A. S.; Pastega, D. F.; Sanchez, S. d'A.; Bettega, M. H. F.; García, G.; Limão-Vieira, P.; Ferreira da Silva, F.

2018-04-01

We report on a combination of experimental and theoretical investigations into the elastic differential cross sections (DCSs) and integral cross sections for electron interactions with dichloromethane, C H2C l2 , in the incident electron energy over the 7.0-30 eV range. Elastic electron-scattering cross-section calculations have been performed within the framework of the Schwinger multichannel method implemented with pseudopotentials (SMCPP), and the independent-atom model with screening-corrected additivity rule including interference-effects correction (IAM-SCAR+I). The present elastic DCSs have been found to agree reasonably well with the results of IAM-SCAR+I calculations above 20 eV and also with the SMC calculations below 30 eV. Although some discrepancies were found for 7 eV, the agreement between the two theoretical methodologies is remarkable as the electron-impact energy increases. Calculated elastic DCSs are also reported up to 10000 eV for scattering angles from 0° to 180° together with total cross section within the IAM-SCAR+I framework.

Characterization of Li-rich layered oxides by using transmission electron microscope

Directory of Open Access Journals (Sweden)

Hu Zhao

2017-07-01

Full Text Available Lithium-rich layered oxides (LrLOs deliver extremely high specific capacities and are considered to be promising candidates for electric vehicle and smart grid applications. However, the application of LrLOs needs further understanding of the structural complexity and dynamic evolution of monoclinic and rhombohedral phases, in order to overcome the issues including voltage decay, poor rate capability, initial irreversible capacity loss and etc. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, have fueled rapid progress in the understanding of the mechanism of such issues. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, migration of transition metal, and the activation of oxygen of LrLOs are then explored in detail, with a particular focus on the mechanism of voltage decay. Keywords: Lithium-ion battery, Transmission electron microscope, Lithium-rich layered oxide, Cathode material

Fast electron and X-ray scattering as a tool to study target's structure

International Nuclear Information System (INIS)

Amusia, M.Ya.

2007-01-01

We concentrate on several relatively new aspects of the study of fast electron and X-ray scattering by atoms and atom-like objects, namely endohedral atoms and fullerenes. However, main attention is given to fast charge particle scattering. We show that the corresponding cross-sections, being expressed via so-called generalized oscillator strengths (GOS), give information on the electronic structure of the target and on the role of electron correlations in it. We consider what sort of information became available when analyzing the dependence of GOS upon their multipolarity, transferred momentum q and energy ω. To obtain theoretical results, we employ both the one-electron Hartree-Fock approximation and account for the multi-electron correlation in the target, using the random phase approximation with exchange. We demonstrate the role of non-dipole corrections in the small-angle fast-electron inelastic scattering. There dipole contribution dominates while non-dipole corrections can be considerably and controllably enhanced as compared to the case of low and medium energy photoionization. We show also that analyses of GOS for discrete level excitations permit to clarify their multipolarity. The results of calculations of Compton excitation and ionization cross-sections are presented. Attention is given to cooperative effects in inelastic fast electron-atom scattering that results in directed motion of the secondary electrons, a phenomenon that is similar to 'drag currents' in photoionization. We demonstrate how one should derive GOS for endohedral atoms, e.g. A-C 60 and what is the additional information that can be obtained from corresponding GOS. Most of discussions are illustrated by the results of concrete calculations

A modified linear algebraic approach to electron scattering using cubic splines