
Sample records for scar molecular markers

  1. Molecular mapping of the Pinus monticola Cr2 gene using AFLP and SCAR markers

    Directory of Open Access Journals (Sweden)

    A.K.M. Ekramoddoullah


    Full Text Available White pine blister rust (WPBR, caused by Cronartium ribicola, is a devastating disease in five-needle pines. Genetic resistance is an important component of integrated strategies to control WPBR. The major resistance gene Cr2, discovered by Kinloch etal.(1999, is also effective against British Columbia (BC isolates of WPBR (Hunt et al. 2004. Pyramiding Cr2 gene with other resistancegenes is being pursued as a strategy in BC white pine breeding. To facilitate this strategy, we have recently identified a few RAPD markerslinked to Cr2 at one side (Liu et al. 2006. The objective of the present study was to identify amplified fragment length polymorphism(AFLP markers linked to both sides of Cr2 for its more precise apping. Use of the AFLP technique combined with bulked segregant analysis (BSA and haploid segregation analysis allowed the identification of five AFLP markers. Of these five AFLP markers in the Cr2 linkage, markers EacccMccgat-365, EactgMcccac- 290, and EacagEacag-750 werelinked in coupling and EacagMcccag-160r and EacccMccgat-180r in repulsion. Following cloning and sequencing of the AFLP andRAPD markers, specific PCR primers were designed and used in the amplification of sequence characterized amplified region(SCAR markers at both sides of Cr2. EacccMccgat- 365 and RAPD marker U570-843 reported previously were converted into SCARmarkers. These two SCARs segregated in a 1:1 (presence:absence ratio and the scoring cosegregated with their respective AFLP orRAPD marker. The SCAR marker EacccMccgat- 365-scar was positioned at 3.1 Kosambi cM from one side of Cr2 and U570-843-scarlocalized at 1.4 Kosambi cM from other side. Both SCAR markers can be useful in breeding programs with marker-assisted selection procedureto screen for resistance. This study represents the first report of the development of PCR-based sequence-specific markers linkedto blister rust resistance in five-needle pines. These findings may

  2. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning. (United States)

    Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A


    The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

  3. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* # (United States)

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita


    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

  4. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities. (United States)

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita


    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

  5. Using a sequence characterized amplified region (SCAR) marker for ...

    African Journals Online (AJOL)



    Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.

  6. Applicability of SCAR markers to food genomics: olive oil traceability. (United States)

    Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson


    DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

  7. Sequence characterized amplified region (SCAR) markers-based ...

    African Journals Online (AJOL)

    ajl yemi


    Dec 19, 2011 ... reverse transcription polymerase chain reaction (RT-PCR), differential-display .... were synthesized by Sangon Biological Engineering Technology and. Services ..... to cold tolerance to scar markers in common carp. J. Dalian.

  8. SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana). (United States)

    Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T


    To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.

  9. Development of CACTA transposon derived SCAR markers and their use in population structure analysis in Zea mays. (United States)

    Roy, Neha Samir; Park, Kyong-Cheul; Lee, Sung-Il; Im, Min-Ji; Ramekar, Rahul Vasudeo; Kim, Nam-Soo


    Molecular marker technologies have proven to be an important breakthrough for genetic studies, construction of linkage maps and population genetics analysis. Transposable elements (TEs) constitute major fractions of repetitive sequences in plants and offer a wide range of possible areas to be explored as molecular markers. Sequence characterized amplified region (SCAR) marker development provides us with a simple and time saving alternative approach for marker development. We employed the CACTA-TD to develop SCARs and then integrated them into linkage map and used them for population structure and genetic diversity analysis of corn inbred population. A total of 108 dominant SCAR markers were designed out of which, 32 were successfully integrated in to the linkage map of maize RIL population and the remaining were added to a physical map for references to check the distribution throughout all chromosomes. Moreover, 76 polymorphic SCARs were used for diversity analysis of corn accessions being used in Korean corn breeding program. The overall average polymorphic information content (PIC) was 0.34, expected heterozygosity was 0.324 and Shannon's information index was 0.491 with a percentage of polymorphism of 98.67%. Further analysis by associating with desirable traits may also provide some accurate trait specific tagged SCAR markers. TE linked SCARs can provide an added level of polymorphism as well as improved discriminating ability and therefore can be useful in further breeding programs to develop high yielding germplasm.


    Arno, Anna I; Gauglitz, Gerd G; Barret, Juan P; Jeschke, Marc G


    Keloids and hypertrophic scars are prevalent disabling conditions with still suboptimal treatments. Basic science and molecular-based medicine research has contributed to unravel new bench-to-bedside scar therapies, and to dissect the complex signaling pathways involved. Peptides such as transforming growth factor beta (TGF-β) superfamily, with SMADs, Ski, SnoN, Fussels, endoglin, DS-Sily, Cav-1p, AZX100, thymosin-β4 and other related molecules may emerge as targets to prevent and treat keloids and hypertrophic scars. The aim of this review is to describe the basic complexity of these new molecular scar management strategies, and point out new fibrosis research lines. PMID:24438742

  11. RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae). (United States)

    Zhao, Ya-E; Wu, Li-Ping


    For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

  12. Identification of RAPD and SCAR markers associated with yield traits in the Indian tropical tasar silkworm Antheraea mylitta drury (United States)

    Dutta, Suhrid R.; Kar, Prasanta K.; Srivastava, Ashok K.; Sinha, Manoj K.; Shankar, Jai; Ghosh, Ananta K.


    The tropical tasar silkworm, Antheraea mylitta, is a semi-domesticated vanya silk-producing insect of high economic importance. To date, no molecular marker associated with cocoon and shell weights has been identified in this species. In this report, we identified a randomly amplified polymorphic DNA (RAPD) marker and examined its inheritance, and also developed a stable diagnostic sequence-characterized amplified region (SCAR) marker. Silkworms were divided into groups with high (HCSW) and low (LCSW) cocoon and shell weights, and the F2 progeny of a cross between these two groups were obtained. DNA from these silkworms was screened by PCR using 34 random primers and the resulting RAPD fragments were used for cluster analysis and discriminant function analysis (DFA). The clustering pattern in a UPGMA-based dendogram and DFA clearly distinguished the HCSW and LCSW groups. Multiple regression analysis identified five markers associated with cocoon and shell weights. The marker OPW16905 bp showed the most significant association with cocoon and shell weights, and its inheritance was confirmed in F2 progeny. Cloning and sequencing of this 905 bp fragment showed 88% identity between its 134 nucleotides and the Bmc-1/Yamato-like retroposon of A. mylitta. This marker was further converted into a diagnostic SCAR marker (SCOPW 16826 bp). The SCAR marker developed here may be useful in identifying the right parental stock of tasar silk-worms for high cocoon and shell weights in breeding programs designed to enhance the productivity of tasar silk. PMID:23271934

  13. Development of SRAP, SRAP-RGA, RAPD and SCAR markers linked with a Fusarium wilt resistance gene in eggplant. (United States)

    Mutlu, Nedim; Boyaci, Filiz Hatice; Göçmen, Münevver; Abak, Kazim


    Fusarium wilt (Fusarium oxysporum Schlecht. f. sp. melongenae) is a vascular disease of eggplant (Solanum melongena L.). The objectives of this work were (1) to confirm the monogenic inheritance of fusarium wilt resistance in eggplant, (2) to identify molecular markers linked to this resistance, and (3) to develop SCAR markers from most informative markers. We report the tagging of the gene for resistance to fusarium wilt (FOM) in eggplant using SRAP, RGA, SRAP-RGA and RAPD markers. Analysis of segregation data confirmed the monogenic inheritance of resistance. DNA from F(2) and BC(1) populations of eggplant segregating for fusarium wilt resistance was screened with 2,316 primer combinations to detect polymorphism. Three markers were linked within 2.6 cM of the gene. The codominant SRAP marker Me8/Em5 and dominant SRAP-RGA marker Em12/GLPL2 were tightly linked to each other and mapped 1.2 cM from the resistance gene, whereas RAPD marker H12 mapped 2.6 cM from the gene and on the same side as the other two markers. The SRAP marker was converted into two dominant SCAR markers that were confirmed to be linked to the resistance gene in the F(2,) BC(1) and F(2) of BC(3) generations of the same cross. These markers provide a starting point for mapping the eggplant FOM resistance gene in eggplant and for exploring the synteny between solanaceous crops for fusarium wilt resistance genes. The SCAR markers will be useful for identifying fusarium wilt-resistant genotypes in marker-assisted selection breeding programs using segregating progenies of the resistant eggplant progenitor used in this study.

  14. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis]. (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili


    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  15. Molecular markers in glioma. (United States)

    Ludwig, Kirsten; Kornblum, Harley I


    Gliomas are the most malignant and aggressive form of brain tumors, and account for the majority of brain cancer related deaths. Malignant gliomas, including glioblastoma are treated with radiation and temozolomide, with only a minor benefit in survival time. A number of advances have been made in understanding glioma biology, including the discovery of cancer stem cells, termed glioma stem cells (GSC). Some of these advances include the delineation of molecular heterogeneity both between tumors from different patients as well as within tumors from the same patient. Such research highlights the importance of identifying and validating molecular markers in glioma. This review, intended as a practical resource for both clinical and basic investigators, summarizes some of the more well-known molecular markers (MGMT, 1p/19q, IDH, EGFR, p53, PI3K, Rb, and RAF), discusses how they are identified, and what, if any, clinical relevance they may have, in addition to discussing some of the specific biology for these markers. Additionally, we discuss identification methods for studying putative GSC's (CD133, CD15, A2B5, nestin, ALDH1, proteasome activity, ABC transporters, and label-retention). While much research has been done on these markers, there is still a significant amount that we do not yet understand, which may account for some conflicting reports in the literature. Furthermore, it is unlikely that the investigator will be able to utilize one single marker to prospectively identify and isolate GSC from all, or possibly, any gliomas.

  16. Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus. (United States)

    Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su


    New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Gender Identification in Date Palm Using Molecular Markers. (United States)

    Awan, Faisal Saeed; Maryam; Jaskani, Muhammad J; Sadia, Bushra


    Breeding of date palm is complicated because of its long life cycle and heterozygous nature. Sexual propagation of date palm does not produce true-to-type plants. Sex of date palms cannot be identified until the first flowering stage. Molecular markers such as random amplified polymorphic DNA (RAPD), sequence-characterized amplified regions (SCAR), and simple sequence repeats (SSR) have successfully been used to identify the sex-linked loci in the plant genome and to isolate the corresponding genes. This chapter highlights the use of three molecular markers including RAPD, SCAR, and SSR to identify the gender of date palm seedlings.

  18. Stem cell markers (cytokeratin 17 and cytokeratin 19 in scarring and nonscarring alopecia

    Directory of Open Access Journals (Sweden)

    Dalia El Sakka


    Full Text Available Background: Alopecia is one of the most important hair follicle (HF disorders, which is divided into scarring (cicatricial and nonscarring (noncicatricial types. Objective: The aim of this study is to investigate the expression of stem cell (SC markers such as cytokeratin (CK 17 and CK19 in scarring and nonscarring alopecia. Materials and Methods: Thirty patients with scalp alopecia (15 with scarring alopecia and 15 without together with ten healthy volunteers were included in this study. Biopsies were taken from all participants and stained for CK17 and CK19 using immunohistochemistry. Results: There was a statistically significant difference between the nonscarring group and the control group with regard to CK17 expression in the outer layers of the HFs (P = 0.00 and CK19 staining of the inner layers of the HFs (P = 0.008. There was a statistically significant difference between the scarring and the control groups regarding CK17 expression in the outer (P = 0.00 and the inner layers (P = 0.00 of the HFs and CK19 expression in the inner layers of the HFs (P = 0.00. CK17 expression in the outer layers (P = 0.02 and the inner layers of the HFs (P = 0.00 together with CK19 expression in the inner layers of the HFs (P = 0.00 showed statistically significant differences between scarring and nonscarring alopecia groups. Conclusions: The presence of SC markers (CK17 and CK19 in the HFs was affected in both scarring and nonscarring alopecia, but the defect in scarring alopecia is more evident than that of nonscarring alopecia. The persistence of SC markers in some types of scarring alopecia could give a hope for the recovery of these lesions. Further studies are recommended to clarify the benefit from using HF SCs in the treatment of alopecia.

  19. Stem Cell Markers (Cytokeratin 17 and Cytokeratin 19) in Scarring and Nonscarring Alopecia (United States)

    El Sakka, Dalia; Gaber, Mohamed Abdel Wahed; Abdou, Asmaa Gaber; Wahed, Moshira Abdel; Saleh, Ahmed Abdel-Wahab; Shehata, Walla


    Background: Alopecia is one of the most important hair follicle (HF) disorders, which is divided into scarring (cicatricial) and nonscarring (noncicatricial) types. Objective: The aim of this study is to investigate the expression of stem cell (SC) markers such as cytokeratin (CK) 17 and CK19 in scarring and nonscarring alopecia. Materials and Methods: Thirty patients with scalp alopecia (15 with scarring alopecia and 15 without) together with ten healthy volunteers were included in this study. Biopsies were taken from all participants and stained for CK17 and CK19 using immunohistochemistry. Results: There was a statistically significant difference between the nonscarring group and the control group with regard to CK17 expression in the outer layers of the HFs (P = 0.00) and CK19 staining of the inner layers of the HFs (P = 0.008). There was a statistically significant difference between the scarring and the control groups regarding CK17 expression in the outer (P = 0.00) and the inner layers (P = 0.00) of the HFs and CK19 expression in the inner layers of the HFs (P = 0.00). CK17 expression in the outer layers (P = 0.02) and the inner layers of the HFs (P = 0.00) together with CK19 expression in the inner layers of the HFs (P = 0.00) showed statistically significant differences between scarring and nonscarring alopecia groups. Conclusions: The presence of SC markers (CK17 and CK19) in the HFs was affected in both scarring and nonscarring alopecia, but the defect in scarring alopecia is more evident than that of nonscarring alopecia. The persistence of SC markers in some types of scarring alopecia could give a hope for the recovery of these lesions. Further studies are recommended to clarify the benefit from using HF SCs in the treatment of alopecia. PMID:27761086

  20. Database of predicted SCAR markers in five fruit and three ...

    Indian Academy of Sciences (India)


    Mar 4, 2016 ... ular markers work on the principle of variations in sequences for any of the following ... were introduced to overcome the disadvantages of RAPD. It is easy to design ... on the home page of FViSCARdb (http://www.bioinfoindia.

  1. Molecular markers: a potential resource for ginger genetic diversity studies. (United States)

    Ismail, Nor Asiah; Rafii, M Y; Mahmud, T M M; Hanafi, M M; Miah, Gous


    Ginger is an economically important and valuable plant around the world. Ginger is used as a food, spice, condiment, medicine and ornament. There is available information on biochemical aspects of ginger, but few studies have been reported on its molecular aspects. The main objective of this review is to accumulate the available molecular marker information and its application in diverse ginger studies. This review article was prepared by combing material from published articles and our own research. Molecular markers allow the identification and characterization of plant genotypes through direct access to hereditary material. In crop species, molecular markers are applied in different aspects and are useful in breeding programs. In ginger, molecular markers are commonly used to identify genetic variation and classify the relatedness among varieties, accessions, and species. Consequently, it provides important input in determining resourceful management strategies for ginger improvement programs. Alternatively, a molecular marker could function as a harmonizing tool for documenting species. This review highlights the application of molecular markers (isozyme, RAPD, AFLP, SSR, ISSR and others such as RFLP, SCAR, NBS and SNP) in genetic diversity studies of ginger species. Some insights on the advantages of the markers are discussed. The detection of genetic variation among promising cultivars of ginger has significance for ginger improvement programs. This update of recent literature will help researchers and students select the appropriate molecular markers for ginger-related research.

  2. Analysis of genetic diversity of Brassica rapa var. chinensis using ISSR markers and development of SCAR marker specific for Fragrant Bok Choy, a product of geographic indication. (United States)

    Shen, X L; Zhang, Y M; Xue, J Y; Li, M M; Lin, Y B; Sun, X Q; Hang, Y Y


    Non-heading Chinese cabbage [Brassica rapa var. chinensis (Linnaeus) Kitamura] is a popular vegetable and is also used as a medicinal plant in traditional Chinese medicine. Fragrant Bok Choy is a unique accession of non-heading Chinese cabbage and a product of geographic indication certified by the Ministry of Agriculture of China, which is noted for its rich aromatic flavor. However, transitional and overlapping morphological traits can make it difficult to distinguish this accession from other non-heading Chinese cabbages. This study aimed to develop a molecular method for efficient identification of Fragrant Bok Choy. Genetic diversity analysis, based on inter-simple sequence repeat molecular markers, was conducted for 11 non-heading Chinese cabbage accessions grown in the Yangtze River Delta region. Genetic similarity coefficients between the 11 accessions ranged from 0.5455 to 0.8961, and the genetic distance ranged from 0.0755 to 0.4475. Cluster analysis divided the 11 accessions into two major groups. The primer ISSR-840 amplified a fragment specific for Fragrant Bok Choy. A pair of specific sequence-characterized amplified region (SCAR) primers based on this fragment amplified a target band in Fragrant Bok Choy individuals, but no band was detected in individuals of other accessions. In conclusion, this study has developed an efficient strategy for authentication of Fragrant Bok Choy. The SCAR marker described here will facilitate the conservation and utilization of this unique non-heading Chinese cabbage germplasm resource.

  3. Application of molecular markers in apple breeding

    Directory of Open Access Journals (Sweden)

    Marić Slađana


    Full Text Available Apple is economically the most important species of genus Malus Miller. In respect of production, trade and consumption, it ranks first among deciduous fruit and third on a global scale among all fruit species. Apple breeding is carried out on a large scale in several scientific institutes throughout the world. Due to this activity, apple is a fruit species with the highest number of described monogenic traits; 76 genes, encoding morphological traits, pest and disease resistance, as well as 69 genes encoding enzymes. The development of molecular markers (RFLPs, AFLPs, SCARs and SSRs has allowed the mapping of the apple genome and the development of several saturated genetic maps, to which genes controlling important traits are assigned. Markers flanking these genes not only play an important role in selecting parental combinations and seedlings with positive traits, but they are also particularly important in detecting recessive traits, such as seedless fruit. In addition they enable pre-selection for polygenic quantitative traits. In recent years, particular attention has been paid to biochemical and physiological processes involved in the pathway of important traits e.g., ripening and the storage capability of apple fruit.

  4. Molecular markers for thyroid cancer

    International Nuclear Information System (INIS)

    Marrero Rodriguez, Maria Teresa; Sinconegui Gomez, Belkys; Cruz Cruz, Anaisa


    The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more accessible and potentially usable from a methodological viewpoint for diagnosis of the thyroid nodule before surgery. The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more

  5. Application of molecular markers in breeding for bean common ...

    African Journals Online (AJOL)

    Sequence characterised amplified region (SCAR) markers, linked to four independent quantitative trait loci (QTL) in XAN 159 and GN #1 Nebr. sel. 27, are available for indirect selection of resistance to common bacterial blight in Phaseolus vulgaris. Existing SCAR-markers, SU91, BC420, BC409 and SAP6, were evaluated ...

  6. Molecular Markers for Food Traceability

    Directory of Open Access Journals (Sweden)

    Paula Martins-Lopes


    Full Text Available DNA analysis with molecular markers has opened a way to understand complex organism's genome. It is presently being widely applied across different fields, where food takes a preeminent position. Constant outbreaks of foodborne illnesses are increasing consumer's attention towards more detailed information related to what they are consuming. This overview reports on the areas where food traceability has been considered, and the problems that still remain to be bypassed in order to be widely applied. An outline of the most broadly used PCR-based methods for food traceability is described. Applications in the area of detection of genetically modified organisms, protected denomination of origin, allergenic and intolerance reactions are detailed in order to understand the dimension of the performed studies.

  7. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.


    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  8. RAPD-SCAR Markers for Genetically Improved NEW GIFT Nile Tilapia (Oreochromis niloticus niloticus L.) and Their Application in Strain Identification. (United States)

    Li, Si-Fa; Tang, Shou-Jie; Cai, Wan-Qi


    The NEW GIFT Nile tilapia (Oreochromis niloticus niloticus L.) is a nationally certificated new strain selected over 14 years and 9 generations from the base strain of GIFT Nile tilapia, introduced in 1994. This new variety has been extended in most of areas of China. The management of genetically improved strains, including the genetic markers for identification is needed urgently. RAPD analysis was conducted and their conversion to SCAR markers was developed. From NEW GIFT Nile tilapia, two strain-specific RAPD bands, S(304 )(624 bp ) and S(36 )(568 bp ) were identified. The strain-specific RAPD bands were gel-purified, cloned, and sequenced. Locus-specific primers were then designed to amplify the strain-specific bands. PCR amplification was conducted to test the variations in allele frequencies of two converted SCAR markers among the NEW GIFT Nile tilapia and its base strains, as well as 7 additional farmed strains worldwide. The frequency of SCAR marker I (553 bp) was 85.7% in NEW GIFT Nile tilapia, but 16.7% in the base strain. The frequency of SCAR marker II (558 bp) was 91.4% in NEW GIFT Nile tilapia, but 0% - 70% in the 7 other strains. In order to confirm the utility of these two markers, an examination was conducted for a wild population from Egypt, resulted the frequency of SCAR I and II was 10% and 70%, respectively, much lower than that of New GIFT strain. The increase in allele frequency of these two SCAR markers suggests that these markers might be genetically linked to the quantitative trait loci (QTL) underlining the performance traits by long term selection, and indicate the bright potential of SCAR marker technology for tracking generations during selection progress and for distinguishing among genetically improved strain and other strains.

  9. A molecular marker map for roses

    NARCIS (Netherlands)

    Debener, T.; Mattiesch, L.; Vosman, B.


    n addition to an existing core map for diploid roses which comprised 305 molecular markers 60 additional markers were mapped to extend the map. As a first application of the information contained in the map, the map position of a resistance gene from roses, Rdr1, was determined by identifying


    Directory of Open Access Journals (Sweden)

    I. S. Kunin


    Full Text Available The search of molecular markers of metastasing and prognosis in prostate cancer remains an urgent task. In this study, we investigated the relationship of gene expression heparanase-1 (HPSE1 and D-glucuronil C5-epimerase (GLCE with early disease relapse and metastasis of a 2,5−3 years after diagnosis. It was shown that the ratio of the expression levels of genes HPSE1/GLCE > 1 may serve as a prognostic relapse marker and trends of the tumour to metastasis. The data obtained suggest to use this option as a molecular marker for the diagnostics of metastatic process and the disease prognosis.

  11. Identification of degenerate nuclei and development of a SCAR marker for Flammulina velutipes.

    Directory of Open Access Journals (Sweden)

    Sun Young Kim

    Full Text Available Flammulina velutipes is one of the major edible mushrooms in the world. Recently, abnormalities that have a negative impact on crop production have been reported in this mushroom. These symptoms include slow vegetative growth, a compact mycelial mat, and few or even no fruiting bodies. The morphologies and fruiting capabilities of monokaryons of wild-type and degenerate strains that arose through arthrospore formation were investigated through test crossing. Only one monokaryotic group of the degenerate strains and its hybrid strains showed abnormal phenotypes. Because the monokaryotic arthrospore has the same nucleus as the parent strain, these results indicated that only one aberrant nucleus of the two nuclei in the degenerate strain was responsible for the degeneracy. A sequence-characterized amplified region marker that is linked to the degenerate monokaryon was identified based on a polymorphic sequence that was generated using random primers. Comparative analyses revealed the presence of a degenerate-specific genomic region in a telomere, which arose via the transfer of a genomic fragment harboring a putative helicase gene. Our findings have narrowed down the potential molecular targets responsible for this phenotype for future studies and have provided a marker for the detection of degenerate strains.

  12. Differentiating Authentic Adenophorae Radix from Its Adulterants in Commercially-Processed Samples Using Multiplexed ITS Sequence-Based SCAR Markers

    Directory of Open Access Journals (Sweden)

    Byeong Cheol Moon


    Full Text Available Determining the precise botanical origin of a traditional herbal medicine is important for basic quality control. In both the Chinese and Korean herbal pharmacopoeia, authentic Adenophorae Radix is defined as the roots of Adenophora stricta and Adenophora triphylla. However, the roots of Codonopsis lanceolata, Codonopsis pilosula, and Glehnia littoralis are frequently distributed as Adenophorae Radix in Korean herbal markets. Unfortunately, correctly identifying dried roots is difficult using conventional methods because the roots of those species are morphologically similar. Therefore, we developed DNA-based markers for the identification of authentic Adenophorae Radix and its common adulterants in commercially-processed samples. To develop a reliable method to discriminate between Adenophorae Radix and its adulterants, we sequenced the nuclear ribosomal DNA internal transcribed spacers (nrDNA-ITS and designed sequence-characterized amplified region (SCAR primers specific to the authentic and adulterant species. Using these primers, we developed SCAR markers for each species and established a multiplex-PCR method that can authenticate the four herbal medicines in a single PCR reaction. Furthermore, we confirmed that commercially-processed herbal medicines, which often have degraded DNA, could be assessed with our method. Therefore, our method is a reliable genetic tool to protect against adulteration and to standardize the quality of Adenophorae Radix.

  13. Trends in plant research using molecular markers. (United States)

    Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco


    A deep bibliometric analysis has been carried out, obtaining valuable parameters that facilitate the understanding around the research in plant using molecular markers. The evolution of the improvement in the field of agronomy is fundamental for its adaptation to the new exigencies that the current world context raises. In addition, within these improvements, this article focuses on those related to the biotechnology sector. More specifically, the use of DNA markers that allow the researcher to know the set of genes associated with a particular quantitative trait or QTL. The use of molecular markers is widely extended, including: restriction fragment length polymorphism, random-amplified polymorphic DNA, amplified fragment length polymorphism, microsatellites, and single-nucleotide polymorphisms. In addition to classical methodology, new approaches based on the next generation sequencing are proving to be fundamental. In this article, a historical review of the molecular markers traditionally used in plants, since its birth and how the new molecular tools facilitate the work of plant breeders is carried out. The evolution of the most studied cultures from the point of view of molecular markers is also reviewed and other parameters whose prior knowledge can facilitate the approach of researchers to this field of research are analyzed. The bibliometric analysis of molecular markers in plants shows that top five countries in this research are: US, China, India, France, and Germany, and from 2013, this research is led by China. On the other hand, the basic research using Arabidopsis is deeper in France and Germany, while other countries focused its efforts in their main crops as the US for wheat or maize, while China and India for wheat and rice.

  14. Preoperative Molecular Markers in Thyroid Nodules. (United States)

    Sahli, Zeyad T; Smith, Philip W; Umbricht, Christopher B; Zeiger, Martha A


    The need for distinguishing benign from malignant thyroid nodules has led to the pursuit of differentiating molecular markers. The most common molecular tests in clinical use are Afirma ® Gene Expression Classifier (GEC) and Thyroseq ® V2. Despite the rapidly developing field of molecular markers, several limitations exist. These challenges include the recent introduction of the histopathological diagnosis "Non-Invasive Follicular Thyroid neoplasm with Papillary-like nuclear features", the correlation of genetic mutations within both benign and malignant pathologic diagnoses, the lack of follow-up of molecular marker negative nodules, and the cost-effectiveness of molecular markers. In this manuscript, we review the current published literature surrounding the diagnostic value of Afirma ® GEC and Thyroseq ® V2. Among Afirma ® GEC studies, sensitivity (Se), specificity (Sp), positive predictive value (PPV), and negative predictive value (NPV) ranged from 75 to 100%, 5 to 53%, 13 to 100%, and 20 to 100%, respectively. Among Thyroseq ® V2 studies, Se, Sp, PPV, and NPV ranged from 40 to 100%, 56 to 93%, 13 to 90%, and 48 to 97%, respectively. We also discuss current challenges to Afirma ® GEC and Thyroseq ® V2 utility and clinical application, and preview the future directions of these rapidly developing technologies.

  15. Molecular marker analysis of 'Shatangju' and 'Wuzishatangju ...

    African Journals Online (AJOL)

    'Wuzishatangju'(Citrus reticulata Blanco) is an excellent cultivar derived from a bud sport of a seedy 'Shatangju' cultivar found in Guangdong Province in the 1980s. In this study, six molecular markers including random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), simple sequence repeat (SSR) ...

  16. Molecular markers unravel intraspecific and interspecific genetic ...

    Indian Academy of Sciences (India)

    [Kotwal S., Dhar M. K., Kour B., Raj K. and Kaul S. 2013 Molecular markers unravel intraspecific and interspecific genetic variability in ... of bowel problems including chronic constipation, amoebic ..... while to select parents from accessions, Pov80 and Pov79 ... nology (DBT), Govt. of India, for financial assistance in the form.

  17. Prognostic molecular markers in early breast cancer

    International Nuclear Information System (INIS)

    Esteva, Francisco J; Hortobagyi, Gabriel N


    A multitude of molecules involved in breast cancer biology have been studied as potential prognostic markers. In the present review we discuss the role of established molecular markers, as well as potential applications of emerging new technologies. Those molecules used routinely to make treatment decisions in patients with early-stage breast cancer include markers of proliferation (e.g. Ki-67), hormone receptors, and the human epidermal growth factor receptor 2. Tumor markers shown to have prognostic value but not used routinely include cyclin D 1 and cyclin E, urokinase-like plasminogen activator/plasminogen activator inhibitor, and cathepsin D. The level of evidence for other molecular markers is lower, in part because most studies were retrospective and not adequately powered, making their findings unsuitable for choosing treatments for individual patients. Gene microarrays have been successfuly used to classify breast cancers into subtypes with specific gene expression profiles and to evaluate prognosis. RT-PCR has also been used to evaluate expression of multiple genes in archival tissue. Proteomics technologies are in development

  18. NABIC marker database: A molecular markers information network of agricultural crops. (United States)

    Kim, Chang-Kug; Seol, Young-Joo; Lee, Dong-Jun; Jeong, In-Seon; Yoon, Ung-Han; Lee, Gang-Seob; Hahn, Jang-Ho; Park, Dong-Suk


    In 2013, National Agricultural Biotechnology Information Center (NABIC) reconstructs a molecular marker database for useful genetic resources. The web-based marker database consists of three major functional categories: map viewer, RSN marker and gene annotation. It provides 7250 marker locations, 3301 RSN marker property, 3280 molecular marker annotation information in agricultural plants. The individual molecular marker provides information such as marker name, expressed sequence tag number, gene definition and general marker information. This updated marker-based database provides useful information through a user-friendly web interface that assisted in tracing any new structures of the chromosomes and gene positional functions using specific molecular markers. The database is available for free at

  19. Mutant germplasm characterization using molecular markers. A manual

    International Nuclear Information System (INIS)


    and PCR based DNA markers such as Sequence Characterized Amplified Regions (SCARs) or Sequence Tagged Sites (STS). These techniques help in direct selection of many desired characters simultaneously using F2 and back-cross populations, near isogenic lines, doubled haploids and recombinant inbred lines. During the last decade the world of classical Mendelian genetics has entered a new age, namely that of genomics, which means the study of structure of genes and their function. A great deal of DNA sequence information is now available in particular from model species such as rice and Arabidopsis, but the functions of the derived genes are mostly unknown. Concentrated research efforts are therefore being made to fill this so-called 'phenotypic gap'. Induced mutations combined with molecular marker technology are playing an important role in this field, leading to a reinforced demand for mutagenized plant material in which certain characters have been changed due to knockout mutations of the responsible genes. Using molecular and genetic tools a mutated character can then be associated with a DNA sequence of previously unknown function. Recent reports on the homology of genes and the gene order between for instance the grass genomes (synteny) suggest that the knowledge acquired will also be useful for identification and isolation of genes from under-utilised crops

  20. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo


    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  1. Diversity of black Aspergilli isolated from raisins in Argentina: Polyphasic approach to species identification and development of SCAR markers for Aspergillus ibericus. (United States)

    Giaj Merlera, G; Muñoz, S; Coelho, I; Cavaglieri, L R; Torres, A M; Reynoso, M M


    Aspergillus section Nigri is a heterogeneous fungal group including some ochratoxin A producer species that usually contaminate raisins. The section contains the Series Carbonaria which includes the toxigenic species Aspergillus carbonarius and nontoxigenic Aspergillus ibericus that are phenotypically undistinguishable. The aim of this study was to examine the diversity of black aspergilli isolated from raisins and to develop a specific genetic marker to distinguish A. ibericus from A. carbonarius. The species most frequently found in raisins in this study were Aspergillus tubingensis (35.4%) and A. carbonarius (32.3%), followed by Aspergillus luchuensis (10.7%), Aspergillus japonicus (7.7%), Aspergillus niger (6.2%), Aspergillus welwitschiae (4.6%) and A. ibericus (3.1%). Based on inter-simple sequence repeat (ISSR) fingerprinting profiles of major Aspergillus section Nigri members, a sequence-characterized amplified region (SCAR) marker was identified. Primers were designed based on the conserved regions of the SCAR marker and were utilized in a PCR for simultaneous identification of A. carbonarius and A. ibericus. The detection level of the SCAR-PCR was found to be 0.01 ng of purified DNA. The present SCAR-PCR is rapid and less cumbersome than conventional identification techniques and could be a supplementary strategy and a reliable tool for high-throughput sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Fecal Molecular Markers for Colorectal Cancer Screening

    Directory of Open Access Journals (Sweden)

    Rani Kanthan


    Full Text Available Despite multiple screening techniques, including colonoscopy, flexible sigmoidoscopy, radiological imaging, and fecal occult blood testing, colorectal cancer remains a leading cause of death. As these techniques improve, their sensitivity to detect malignant lesions is increasing; however, detection of precursor lesions remains problematic and has generated a lack of general acceptance for their widespread usage. Early detection by an accurate, noninvasive, cost-effective, simple-to-use screening technique is central to decreasing the incidence and mortality of this disease. Recent advances in the development of molecular markers in faecal specimens are encouraging for its use as a screening tool. Genetic mutations and epigenetic alterations that result from the carcinogenetic process can be detected by coprocytobiology in the colonocytes exfoliated from the lesion into the fecal matter. These markers have shown promising sensitivity and specificity in the detection of both malignant and premalignant lesions and are gaining popularity as a noninvasive technique that is representative of the entire colon. In this paper, we summarize the genetic and epigenetic fecal molecular markers that have been identified as potential targets in the screening of colorectal cancer.

  3. Functional molecular markers for crop improvement. (United States)

    Kage, Udaykumar; Kumar, Arun; Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C


    A tremendous decline in cultivable land and resources and a huge increase in food demand calls for immediate attention to crop improvement. Though molecular plant breeding serves as a viable solution and is considered as "foundation for twenty-first century crop improvement", a major stumbling block for crop improvement is the availability of a limited functional gene pool for cereal crops. Advancement in the next generation sequencing (NGS) technologies integrated with tools like metabolomics, proteomics and association mapping studies have facilitated the identification of candidate genes, their allelic variants and opened new avenues to accelerate crop improvement through development and use of functional molecular markers (FMMs). The FMMs are developed from the sequence polymorphisms present within functional gene(s) which are associated with phenotypic trait variations. Since FMMs obviate the problems associated with random DNA markers, these are considered as "the holy grail" of plant breeders who employ targeted marker assisted selections (MAS) for crop improvement. This review article attempts to consider the current resources and novel methods such as metabolomics, proteomics and association studies for the identification of candidate genes and their validation through virus-induced gene silencing (VIGS) for the development of FMMs. A number of examples where the FMMs have been developed and used for the improvement of cereal crops for agronomic, food quality, disease resistance and abiotic stress tolerance traits have been considered.

  4. Development of cost-effective Hordeum chilense DNA markers: molecular aids for marker-assisted cereal breeding. (United States)

    Hernández, P; Dorado, G; Ramírez, M C; Laurie, D A; Snape, J W; Martín, A


    Hordeum chilense is a potential source of useful genes for wheat breeding. The use of this wild species to increase genetic variation in wheat will be greatly facilitated by marker-assisted introgression. In recent years, the search for the most suitable DNA marker system for tagging H. chilense genomic regions in a wheat background has lead to the development of RAPD and SCAR markers for this species. RAPDs represent an easy way of quickly generating suitable introgression markers, but their use is limited in heterogeneous wheat genetic backgrounds. SCARs are more specific assays, suitable for automatation or multiplexing. Direct sequencing of RAPD products is a cost-effective approach that reduces labour and costs for SCAR development. The use of SSR and STS primers originally developed for wheat and barley are additional sources of genetic markers. Practical applications of the different marker approaches for obtaining derived introgression products are described.

  5. Use of Moringa oleifera Flower Pod Extract as Natural Preservative and Development of SCAR Marker for Its DNA Based Identification. (United States)

    Gull, Iram; Javed, Attia; Aslam, Muhammad Shahbaz; Mushtaq, Roohi; Athar, Muhammad Amin


    The use of Moringa oleifera as natural food preservative has been evaluated in the present study. In addition, for quality assurance, the study has also been focused on the shelf life of product to authenticate the identification of plant by development of DNA based marker. Among the different extracts prepared from flower pods of Moringa oleifera, methanol and aqueous extract exhibited high antibacterial and antioxidant activity, respectively. The high phenolic contents (53.5 ± 0.169 mg GAE/g) and flavonoid contents (10.9 ± 0.094 mg QE/g) were also recorded in methanol and aqueous extract, respectively. Due to instability of bioactive compounds in aqueous extract, methanol extract is considered as potent natural preservative. The shelf life of methanol extract was observed for two months at 4°C under dark conditions. The developed SCAR primers (MOF217/317/MOR317) specifically amplified a fragment of 317 bp from DNA of Moringa oleifera samples collected from different regions of Punjab province of Pakistan. The methanol extract of Moringa oleifera flower pods has great potential to be used as natural preservative and nutraceutical in food industry.

  6. Molecular markers linked to apomixis in Panicum maximum Jacq.

    African Journals Online (AJOL)



    May 28, 2014 ... The objective of this work was to identify molecular markers linked to apomixis in ... Four RAPD markers linked to apomixis were identified and mapped in this .... Data analysis. The amplification of the potential markers was analyzed as binary, with 1 for presence and 0 for absence of the marker. The binary.

  7. Molecular marker systems for Oenothera genetics. (United States)

    Rauwolf, Uwe; Golczyk, Hieronim; Meurer, Jörg; Herrmann, Reinhold G; Greiner, Stephan


    The genus Oenothera has an outstanding scientific tradition. It has been a model for studying aspects of chromosome evolution and speciation, including the impact of plastid nuclear co-evolution. A large collection of strains analyzed during a century of experimental work and unique genetic possibilities allow the exchange of genetically definable plastids, individual or multiple chromosomes, and/or entire haploid genomes (Renner complexes) between species. However, molecular genetic approaches for the genus are largely lacking. In this study, we describe the development of efficient PCR-based marker systems for both the nuclear genome and the plastome. They allow distinguishing individual chromosomes, Renner complexes, plastomes, and subplastomes. We demonstrate their application by monitoring interspecific exchanges of genomes, chromosome pairs, and/or plastids during crossing programs, e.g., to produce plastome-genome incompatible hybrids. Using an appropriate partial permanent translocation heterozygous hybrid, linkage group 7 of the molecular map could be assigned to chromosome 9.8 of the classical Oenothera map. Finally, we provide the first direct molecular evidence that homologous recombination and free segregation of chromosomes in permanent translocation heterozygous strains is suppressed.

  8. Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn. (United States)

    Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng


    Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

  9. The role of Molecular Markers in Improvement of Fruit Crops

    Directory of Open Access Journals (Sweden)

    Zahoor Ahmad BHAT


    Full Text Available Markers have been used over the years for the classification of plants. Markers are any trait of an organism that can be identified with confidence and relative easy, and can be followed in a mapping population on another hand markers be defined as heritable entities associated with the economically important trait under the control of polygenes. Morphological markers can be detected with naked eye (naked eye polymorphism or as difference in physical or chemical properties of the macromolecules. In other words, there are two types of genetic markers viz. morphological markers or naked eye polymorphism and non-morphological markers or molecular markers. Morphological markers include traits such as plant height, disease response, photoperiod, sensitivity, shape or colour of flowers, fruits or seeds etc. Molecular markers include biochemical constituents. Morphological markers have many limitations for being used as markers particularly in fruit crops because of long generation time and large size of fruit trees besides being influenced by environment. Consequently, molecular markers could be appropriate choice to study and preserve the diversity in any germplasm. Molecular markers have diverse applications in fruit crop improvement, particularly in the areas of genetic diversity and varietal identification studies, gene tagging, disease diagnostics, pedigree analysis, hybrid detection, sex differentiation and marker assisted selection.

  10. Assessing Date Palm Genetic Diversity Using Different Molecular Markers. (United States)

    Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S


    Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

  11. An overview of molecular marker methods for plants | Semagn ...

    African Journals Online (AJOL)

    The development and use of molecular markers for the detection and exploitation of DNA polymorphism is one of the most significant developments in the field of molecular genetics. The presence of various types of molecular markers, and differences in their principles, methodologies, and applications require careful ...

  12. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize. (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y


    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  13. Biological (molecular and cellular) markers of toxicity

    International Nuclear Information System (INIS)

    Shugart, L.R.; D'Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.


    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO 6 -ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O 6 -ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP

  14. Development of a thematic collection of Musa spp accessions using SCAR markers for preventive breeding against Fusarium oxysporum f. sp cubense tropical race 4. (United States)

    Silva, P R O; de Jesus, O N; Bragança, C A D; Haddad, F; Amorim, E P; Ferreira, C F


    Bananas are one of the most consumed fruits worldwide, but are affected by many pests and diseases. One of the most devastating diseases is Fusarium wilt, caused by Fusarium oxysporum f. sp cubense (Foc). Recently, Fusarium tropical race 4 (Foc TR4) has been causing irreparable damage, especially in Asia and Africa where it has devastated entire plantations, including areas with Cavendish, which is known to be resistant to Foc race 1. Although this race is not yet present in Brazil, results obtained by Embrapa in partnership with the University of Wageningen, The Netherlands, indicate that 100% of the cultivars used by Brazilian growers are susceptible to Foc TR 4. In our study, 276 banana accessions were screened with sequence characterized amplified region (SCAR) markers that have been linked to the resistance of Foc TR 4. Two SCAR primers were tested and the results revealed that SCAR ScaU1001 was efficient at discriminating accessions with possible resistance in 36.6% of the evaluated accessions. This is the first attempt to develop a thematic collection of possible Foc TR 4 resistant banana accessions in Brazil, which could be tested in Asian or African countries to validate marker-assisted selection (MAS), and for use in the preventive breeding of the crop to safeguard our banana plantations against Foc TR 4. We believe that this is an important step towards the prevention of this devastating disease, especially considering that our banana plantations are at risk.

  15. Marcadores moleculares na predição do sexo em plantas de mamoeiro Molecular markers for sex identification in papaya

    Directory of Open Access Journals (Sweden)

    Eder Jorge de Oliveira


    Full Text Available O objetivo deste trabalho foi validar marcadores moleculares, previamente identificados como ligados ao sexo do mamoeiro, para utilização na seleção indireta em genótipos comerciais. Foram analisadas duas variedades do grupo Solo e dois híbridos do grupo Formosa, com utilização de 20 plantas por genótipo, quatro marcadores do tipo SCAR (Sequence Characterized Amplified Region e um RAPD (Random Amplified Polymorphic DNA. O RAPD BC210 permitiu a identificação de todas as plantas femininas e hermafroditas, o que revela grande potencial para ser usado na seleção assistida em alguns dos genótipos mais cultivados no Brasil. Os marcadores do tipo SCAR não permitiram a identificação correta do sexo dos genótipos, pois detectou-se a presença de falso-positivos e falso-negativos nas análises.The objective of this work was the validation of previous discovered sex related molecular markers of papaya, aiming at the indirect selection of Brazilian commercial genotypes. Two varieties of the Solo group and two hybrids of the Formosa group (20 plants for genotype, four SCAR (Sequence Characterized Amplified Region and one RAPD (Random Amplified Polymorphic DNA markers were used. All hermaphrodite and female plants were correctly predicted by RAPD BC210, showing its high potential for marker assisted selection in important commercial genotypes used in Brazil. The SCAR markers did not show the true sex identification of these genotypes, revealing the presence of false positives and negatives in the analyses.

  16. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations. (United States)

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan


    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  17. Advance of molecular marker application in the tobacco research ...

    African Journals Online (AJOL)

    Tobacco (Nicotiana spp.) is one of the most important commercial crops in the world. During the last two decades, molecular markers have entered the scene of genetic improvement in different fields of agricultural research. The principles and characteristics of several molecular markers such as RFLP, RAPD, AFLP, ...

  18. Variable expression of molecular markers in juvenile nasopharyngeal angiofibroma. (United States)

    Mishra, A; Pandey, A; Mishra, S C


    Molecular categorisation may explain the wide variation in the clinical characteristics of juvenile nasopharyngeal angiofibroma. Variations in molecular markers in juvenile nasopharyngeal angiofibroma in an Indian population were investigated and compared with global reports. Variable molecular marker expression was demonstrated at the regional and global levels. A wide variation in molecular characteristics is evident. Molecular data have been reported for only 11 countries, indicating a clear geographical bias. Only 58 markers have been studied, and most are yet to be validated. Research into the molecular epidemiology of juvenile nasopharyngeal angiofibroma is still in its infancy. Although the molecular variation is not well understood, data obtained so far have prompted important research questions. Hence, multicentre collaborative molecular studies are needed to establish the aetiopathogenesis and establish molecular surrogates for clinical characteristics.

  19. Molecular markers of neuropsychological functioning and Alzheimer's disease. (United States)

    Edwards, Melissa; Balldin, Valerie Hobson; Hall, James; O'Bryant, Sid


    The current project sought to examine molecular markers of neuropsychological functioning among elders with and without Alzheimer's disease (AD) and determine the predictive ability of combined molecular markers and select neuropsychological tests in detecting disease presence. Data were analyzed from 300 participants (n = 150, AD and n = 150, controls) enrolled in the Texas Alzheimer's Research and Care Consortium. Linear regression models were created to examine the link between the top five molecular markers from our AD blood profile and neuropsychological test scores. Logistical regressions were used to predict AD presence using serum biomarkers in combination with select neuropsychological measures. Using the neuropsychological test with the least amount of variance overlap with the molecular markers, the combined neuropsychological test and molecular markers was highly accurate in detecting AD presence. This work provides the foundation for the generation of a point-of-care device that can be used to screen for AD.

  20. Molecular markers for use in plant molecular breeding and germplasm evaluation

    International Nuclear Information System (INIS)

    Edwards, J.D.; McCouch, S.R.


    A number of molecular marker technologies exist, each with different advantages and disadvantages. When available, genome sequence allows for the development of greater numbers and higher quality molecular markers. When genome sequence is limited in the organism of interest, related species may serve as sources of molecular markers. Some molecular marker technologies combine the discovery and assay of DNA sequence variations, and therefore can be used in species without the need for prior sequence information and up-front investment in marker development. As a prerequisite for marker-assisted selection (MAS), there must be a known association between genetic markers and genes affecting the phenotype to be modified. Comparative databases can facilitate the transfer of knowledge of genetic marker-phenotype association across species so that discoveries in one species may be applied to many others. Further genomics research and reductions in the costs associated with molecular markers will continue to provide new opportunities to employ MAS. (author)

  1. Acne Scars (United States)

    ... or scrubbing scarred areas can further reduce skin elasticity and heighten the appearance of the scar. Pick ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  2. Molecular Pathology: Predictive, Prognostic, and Diagnostic Markers in Uterine Tumors. (United States)

    Ritterhouse, Lauren L; Howitt, Brooke E


    This article focuses on the diagnostic, prognostic, and predictive molecular biomarkers in uterine malignancies, in the context of morphologic diagnoses. The histologic classification of endometrial carcinomas is reviewed first, followed by the description and molecular classification of endometrial epithelial malignancies in the context of histologic classification. Taken together, the molecular and histologic classifications help clinicians to approach troublesome areas encountered in clinical practice and evaluate the utility of molecular alterations in the diagnosis and subclassification of endometrial carcinomas. Putative prognostic markers are reviewed. The use of molecular alterations and surrogate immunohistochemistry as prognostic and predictive markers is also discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. The role of molecular markers and marker assisted selection in breeding for organic agriculture

    DEFF Research Database (Denmark)

    Lammerts van Bueren, E.T.; Backes, G.; de Vriend, H.


    markers is not self-evident and is often debated. Organic and low-input farming conditions require breeding for robust and flexible varieties, which may be hampered by too much focus on the molecular level. Pros and contras for application of molecular markers in breeding for organic agriculture...... was the topic of a recent European plant breeding workshop. The participants evaluated strengths, weaknesses, opportunities, and threats of the use of molecular markers and we formalized their inputs into breeder’s perspectives and perspectives seen from the organic sector’s standpoint. Clear strengths were...

  4. Molecular markers for predicting end-products quality of wheat ...

    African Journals Online (AJOL)

    Molecular markers for predicting end-products quality of wheat (Triticum aestivum L.) ... African Journal of Biotechnology. Journal Home · ABOUT ... Four new Saudi wheat lines (KSU 102, KSU 103, KSU 105 and KSU 106) and two. American ...

  5. Molecular markers: Implications for cytopathology and specimen collection. (United States)

    VanderLaan, Paul A


    Cytologic specimens obtained through minimally invasive biopsy techniques are increasingly being used as principle diagnostic specimens for tumors arising in multiple sites. The number and scope of ancillary tests performed on these specimens have grown substantially over the past decade, including many molecular markers that not only can aid in formulating accurate and specific diagnoses but also can provide prognostic or therapeutic information to help direct clinical decisions. Thus, the cytopathologist needs to ensure that adequate material is collected and appropriately processed for the study of relevant molecular markers, many of which are specific to tumor site. This brief review covers considerations for effective cytologic specimen collection and processing to ensure diagnostic and testing success. In addition, a general overview is provided of molecular markers pertinent to tumors from a variety of sites. The recognition of these established and emerging molecular markers by cytopathologists is an important step toward realizing the promise of personalized medicine. © 2015 American Cancer Society.

  6. Molecular marker screening of peanut ( Arachis hypogaea L ...

    African Journals Online (AJOL)

    Molecular marker screening of peanut (Arachis hypogaea L.) germplasm for Meloidogyne arenaria resistance. V Carpentieri-Pipolo, M Gallo-Meagher, DW Dickson, DW Gorbet, M de Lurdes Mendes, SG Hulse de Souza ...

  7. Molecular markers for genetic diversity and phylogeny research of ...

    African Journals Online (AJOL)

    Brazilian sheep descended from several breeds brought to the New World by Portuguese and Spanish colonists, and they have evolved and adapted to local climatic variations and acquired tolerance or resistance to many diseases. Molecular markers are widely used in analyzing genetic variability, and markers such as ...

  8. [Prognostic and predictive molecular markers for urologic cancers]. (United States)

    Hartmann, A; Schlomm, T; Bertz, S; Heinzelmann, J; Hölters, S; Simon, R; Stoehr, R; Junker, K


    Molecular prognostic factors and genetic alterations as predictive markers for cancer-specific targeted therapies are used today in the clinic for many malignancies. In recent years, many molecular markers for urogenital cancers have also been identified. However, these markers are not clinically used yet. In prostate cancer, novel next-generation sequencing methods revealed a detailed picture of the molecular changes. There is growing evidence that a combination of classical histopathological and validated molecular markers could lead to a more precise estimation of prognosis, thus, resulting in an increasing number of patients with active surveillance as a possible treatment option. In patients with urothelial carcinoma, histopathological factors but also the proliferation of the tumor, mutations in oncogenes leading to an increasing proliferation rate and changes in genes responsible for invasion and metastasis are important. In addition, gene expression profiles which could distinguish aggressive tumors with high risk of metastasis from nonmetastasizing tumors have been recently identified. In the future, this could potentially allow better selection of patients needing systemic perioperative treatment. In renal cell carcinoma, many molecular markers that are associated with metastasis and survival have been identified. Some of these markers were also validated as independent prognostic markers. Selection of patients with primarily organ-confined tumors and increased risk of metastasis for adjuvant systemic therapy could be clinically relevant in the future.

  9. Prospects of molecular markers in Fusarium species diversity

    DEFF Research Database (Denmark)

    Nayaka, S. Chandra; Wulff, Ednar Gadelha; Udayashankar, A.C.


    focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well...... for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole......-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates...

  10. Molecular marker genes for ectomycorrhizal symbiosis (United States)

    Shiv Hiremath; Carolyn McQuattie; Gopi Podila; Jenise. Bauman


    Mycorrhizal symbiosis is a mutually beneficial association very commonly found among most vascular plants. Formation of mycorrhiza happens only between compatible partners and predicting this is often accomplished through a trial and error process. We investigated the possibility of using expression of symbiosis specific genes as markers to predict the formation of...

  11. Promise and pitfalls of molecular markers of thyroid nodules (United States)

    Jadhav, S.; Lila, Anurag; Bandgar, Tushar; Shah, Nalini


    Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG) and fine needle aspiration biopsy (FNAB). The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients. PMID:23565369

  12. Promise and pitfalls of molecular markers of thyroid nodules

    Directory of Open Access Journals (Sweden)

    S Jadhav


    Full Text Available Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG and fine needle aspiration biopsy (FNAB. The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients.

  13. Application of molecular markers to find out classificatory ...

    African Journals Online (AJOL)

    The present communication is aimed to find out determinants of molecular marker based classification of rice (Oryza sativa L) germplasm using the available data from an experiment conducted for development of molecular fingerprints of diverse varieties of Basmati and non Basmati rice adapted to irrigated and aerobic ...

  14. Development of dominant sequence characterized amplified region (SCAR marker linked with plume moth (Exelastis atomosa Walsingham 1886 resistance in pigeon-pea

    Directory of Open Access Journals (Sweden)

    Ramya R Mishra


    Full Text Available The mode of gene action governing resistance to plume moth (Exelastis atomosa Walsingham 1886 derived from pigeon-pea (Cajanus scarabaeoides (L. Thouars accession ICPW-94 has been determined and the resistance alleles have been designated as PPM1. The progenies of F2 population and F3 families derived from an interspecific cross C. cajan (L. Huth ('ICP-26' x C. scarabaeoides (accession ICPW-94 revealed monogenic gene action for resistance to plume moth, and the dominant control by single locus or cluster of tightly linked alleles. Bulked segregant analysis (BSA of 116 F2 progenies by using 143 parental polymorphic RAPD primers could identify a fragment OPA09(910 associated with plume moth resistance in coupling phase of linkage. Further single plant analysis of the 116 F2 mapping population revealed OPA09(910 was linked to PPMi locus conferring host resistance to plume moth with recombination fraction (rf value of 0.125 (12.7 cM of Kosambi function. The resistance specific fragment OPA09(910 was cloned, sequenced and converted into a sequence characterized amplified region (SCAR marker, SCOPA09(942, which was also closely associated (10.3 cM with the locus PPMl with rf value 0.102. BLAST analysis with pigeon-pea genome sequence also confirmed its occurrence in CcLG02 (Scafseq.LG_V5.0fa and contig 01597 (AFSP01.fsa1. This SCAR marker showed reasonable screening efficiency in the F2, F3, and BC1F1 lines, thus it can be used as genetic handle in marker-assisted introgression of the genomic fragment conferring plume moth resistance and screening of breeding lines in pigeon-pea.

  15. Cancer molecular markers: A guide to cancer detection and management. (United States)

    Nair, Meera; Sandhu, Sardul Singh; Sharma, Anil Kumar


    Cancer is generally caused by the molecular alterations which lead to specific mutations. Advances in molecular biology have provided an impetus to the study of cancers with valuable prognostic and predictive significance. Over the hindsight various attempts have been undertaken by scientists worldwide, in the management of cancer; where, we have witnessed a number of molecular markers which allow the early detection of cancers and lead to a decrease in its mortality rate. Recent advances in oncology have led to the discovery of cancer markers that has allowed early detection and targeted therapy of tumors. In this context, current review provides a detail outlook on various molecular markers for diagnosis, prognosis and management of therapeutic response in cancer patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Oligodendroglioma: pathology, molecular mechanisms and markers

    NARCIS (Netherlands)

    Wesseling, P.; Bent, M. van den; Perry, A.


    For nearly a century, the diagnosis and grading of oligodendrogliomas and oligoastrocytomas has been based on histopathology alone. Roughly 20 years ago, the first glioma-associated molecular signature was found with complete chromosome 1p and 19q codeletion being particularly common in

  17. Molecular markers in bladder cancer: Novel research frontiers. (United States)

    Sanguedolce, Francesca; Cormio, Antonella; Bufo, Pantaleo; Carrieri, Giuseppe; Cormio, Luigi


    Bladder cancer (BC) is a heterogeneous disease encompassing distinct biologic features that lead to extremely different clinical behaviors. In the last 20 years, great efforts have been made to predict disease outcome and response to treatment by developing risk assessment calculators based on multiple standard clinical-pathological factors, as well as by testing several molecular markers. Unfortunately, risk assessment calculators alone fail to accurately assess a single patient's prognosis and response to different treatment options. Several molecular markers easily assessable by routine immunohistochemical techniques hold promise for becoming widely available and cost-effective tools for a more reliable risk assessment, but none have yet entered routine clinical practice. Current research is therefore moving towards (i) identifying novel molecular markers; (ii) testing old and new markers in homogeneous patients' populations receiving homogeneous treatments; (iii) generating a multimarker panel that could be easily, and thus routinely, used in clinical practice; (iv) developing novel risk assessment tools, possibly combining standard clinical-pathological factors with molecular markers. This review analyses the emerging body of literature concerning novel biomarkers, ranging from genetic changes to altered expression of a huge variety of molecules, potentially involved in BC outcome and response to treatment. Findings suggest that some of these indicators, such as serum circulating tumor cells and tissue mitochondrial DNA, seem to be easily assessable and provide reliable information. Other markers, such as the phosphoinositide-3-kinase (PI3K)/AKT (serine-threonine kinase)/mTOR (mammalian target of rapamycin) pathway and epigenetic changes in DNA methylation seem to not only have prognostic/predictive value but also, most importantly, represent valuable therapeutic targets. Finally, there is increasing evidence that the development of novel risk assessment tools

  18. Development and use of molecular markers: past and present. (United States)

    Grover, Atul; Sharma, P C


    Molecular markers, due to their stability, cost-effectiveness and ease of use provide an immensely popular tool for a variety of applications including genome mapping, gene tagging, genetic diversity diversity, phylogenetic analysis and forensic investigations. In the last three decades, a number of molecular marker techniques have been developed and exploited worldwide in different systems. However, only a handful of these techniques, namely RFLPs, RAPDs, AFLPs, ISSRs, SSRs and SNPs have received global acceptance. A recent revolution in DNA sequencing techniques has taken the discovery and application of molecular markers to high-throughput and ultrahigh-throughput levels. Although, the choice of marker will obviously depend on the targeted use, microsatellites, SNPs and genotyping by sequencing (GBS) largely fulfill most of the user requirements. Further, modern transcriptomic and functional markers will lead the ventures onto high-density genetic map construction, identification of QTLs, breeding and conservation strategies in times to come in combination with other high throughput techniques. This review presents an overview of different marker technologies and their variants with a comparative account of their characteristic features and applications.

  19. Application of molecular markers in wheat breeding: Reality or delusion?

    Directory of Open Access Journals (Sweden)

    Kobiljski Borislav


    Full Text Available Conventional plant breeding use morphological and phenotypic markers for the identification of important agronomic traits. Plant breeders and scientists continuously seek to develop new techniques, which can be used for faster and more accurate introgression of desirable traits into plants. Over the last several years there has been significant increase in the application of molecular markers in the breeding programmes of different species. So far, detected level of polymorphism and informatitivnes of different molecular marker methods applied in MAS (Marker Assisted Selection studies (RFLP, AFLP, etc. were insufficient either to validate their further use or there were very expensive and of huge healthy risk. Fortunately for wheat (and other crops breeders, the new class of molecular markers - microsatellites have prove recently to be most powerful for MAS. But, due to lack of the knowledge, experience, valid informations and even tradition and habits, many breeders have either negative or repulsive attitude towards implementation of MAS in breeding programes. In this paper the relevant facts regarding implementation of MAS in breeding are discussed in general, and for wheat breeding in particular, in order to summarize merits and limitations in application of microsatellites in MAS selection. .

  20. Molecular markers shared by diverse apomictic Pennisetum species. (United States)

    Lubbers, E L; Arthur, L; Hanna, W W; Ozias-Akins, P


    Two molecular markers, a RAPD (randomly amplified polymorphic DNA) and a RFLP/STS (restriction fragment length polymorphism/sequence-tagged site), previously were found associated with apomictic reproductive behavior in a backcross population produced to transfer apomixis from Pennisetum squamulatum to pearl millet. The occurrence of these molecular markers in a range of 29 accessions of Pennisetum comprising 11 apomictic and 8 sexual species was investigated. Both markers were specific for apomictic species in Pennisetum. The RFLP/STS marker, UGT 197, was found to be associated with all taxa that displayed apomictic reproductive behavior except those in section Brevivalvula. Neither UGT197 nor the cloned RAPD fragment OPC-04600 hybridized with any sexually reproducing representatives of the genus. The cloned C04600 was associated with 3 of the 11 apomictic species, P. ciliare, P. massaicum, and P. squamulatum. UGT197 was more consistently associated with apomictic reproductive behavior than OPC04600 or cloned C04600, thus it could be inferred that UGT197 is more closely linked to the gene(s) for apomixis than the cloned C04600. The successful use of these probes to survey other Pennisetum species indicates that apomixis is a trait that can be followed across species by using molecular means. This technique of surveying species within a genus will be useful in determining the relative importance of newly isolated markers and may facilitate the identification of the apomixis gene(s).

  1. Molecular markers linked to apomixis in Panicum maximum Jacq ...

    African Journals Online (AJOL)

    Panicum maximum Jacq. is an important forage grass of African origin largely used in the tropics. The genetic breeding of this species is based on the hybridization of sexual and apomictic genotypes and selection of apomictic F1 hybrids. The objective of this work was to identify molecular markers linked to apomixis in P.

  2. Clinical Relevance of Prognostic and Predictive Molecular Markers in Gliomas. (United States)

    Siegal, Tali


    Sorting and grading of glial tumors by the WHO classification provide clinicians with guidance as to the predicted course of the disease and choice of treatment. Nonetheless, histologically identical tumors may have very different outcome and response to treatment. Molecular markers that carry both diagnostic and prognostic information add useful tools to traditional classification by redefining tumor subtypes within each WHO category. Therefore, molecular markers have become an integral part of tumor assessment in modern neuro-oncology and biomarker status now guides clinical decisions in some subtypes of gliomas. The routine assessment of IDH status improves histological diagnostic accuracy by differentiating diffuse glioma from reactive gliosis. It carries a favorable prognostic implication for all glial tumors and it is predictive for chemotherapeutic response in anaplastic oligodendrogliomas with codeletion of 1p/19q chromosomes. Glial tumors that contain chromosomal codeletion of 1p/19q are defined as tumors of oligodendroglial lineage and have favorable prognosis. MGMT promoter methylation is a favorable prognostic marker in astrocytic high-grade gliomas and it is predictive for chemotherapeutic response in anaplastic gliomas with wild-type IDH1/2 and in glioblastoma of the elderly. The clinical implication of other molecular markers of gliomas like mutations of EGFR and ATRX genes and BRAF fusion or point mutation is highlighted. The potential of molecular biomarker-based classification to guide future therapeutic approach is discussed and accentuated.

  3. Molecular markers for drought tolerance in bread wheat

    African Journals Online (AJOL)



    May 22, 2013 ... Molecular markers for drought tolerance in bread wheat. Tharwat El Ameen. Department of Genetics, South Valley University, Qena, 83523, Egypt. Accepted 3 May, 2013. Random amplified polymorphic DNA (RAPD) primers associated with drought tolerance was used in this study to characterize drought ...

  4. Prevalence of the molecular marker of chloroquine resistance ( pfcrt ...

    African Journals Online (AJOL)

    In line with the World Health Organization (WHO) guideline on chloroquine (CQ) resistance, CQ was withdrawn as the first-line antimalarial drug in Nigeria in 2005 as a result of ... We monitored the resistance pattern 5 years after withdrawal of CQ, using the pfcrt K76T mutation as a molecular marker for CQ resistance.

  5. Molecular marker screening of tomato, ( solanum lycopersicum L ...

    African Journals Online (AJOL)

    Tomato is one of the crops in which genetic resistance has specially been effective against root-knot nematodes. In this study, molecular screening was done on some tomato germplasm to detect markers for the gene that confers resistance (Mi) with specific primer (Mi23/F//Mi23/R). The cultivars; VFNT, FLA 505-BL 1172, ...

  6. Molecular markers in the epidemiology and diagnosis of coccidioidomycosis. (United States)

    Duarte-Escalante, Esperanza; Frías-De-León, María Guadalupe; Zúñiga, Gerardo; Martínez-Herrera, Erick; Acosta-Altamirano, Gustavo; Reyes-Montes, María Del Rocío


    The prevalence of coccidioidomycosis in endemic areas has been observed to increase daily. To understand the causes of the spread of the disease and design strategies for fungal detection in clinical and environmental samples, scientists have resorted to molecular tools that allow fungal detection in a natural environment, reliable identification in clinical cases and the study of biological characteristics, such as reproductive and genetic structure, demographic history and diversification. We conducted a review of the most important molecular markers in the epidemiology of Coccidioides spp. and the diagnosis of coccidioidomycosis. A literature search was performed for scientific publications concerning the application of molecular tools for the epidemiology and diagnosis of coccidioidomycosis. The use of molecular markers in the epidemiological study and diagnosis of coccidioidomycosis has allowed for the typing of Coccidioides spp. isolates, improved understanding of their mode of reproduction, genetic variation and speciation and resulted in the development specific, rapid and sensitive strategies for detecting the fungus in environmental and clinical samples. Molecular markers have revealed genetic variability in Coccidioides spp. This finding influences changes in the epidemiology of coccidioidomycosis, such as the emergence of more virulent or antifungal resistant genotypes. Furthermore, the molecular markers currently used to identify Coccidioides immitis and Coccidioides posadasii are specific and sensitive. However, they must be validated to determine their application in diagnosis. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  7. Molecular pathology in adult gliomas: diagnostic, prognostic, and predictive markers.

    LENUS (Irish Health Repository)

    Jansen, Michael


    Over the past 10 years, there has been an increasing use of molecular markers in the assessment and management of adult malignant gliomas. Some molecular signatures are used diagnostically to help pathologists classify tumours, whereas others are used to estimate prognosis for patients. Most crucial, however, are those markers that are used to predict response to certain therapies, thereby directing clinicians to a particular treatment while avoiding other potentially deleterious therapies. Recently, large-scale genome-wide surveys have been used to identify new biomarkers that have been rapidly developed as diagnostic and prognostic tools. Given these developments, the pace of discovery of new molecular assays will quicken to facilitate personalised medicine in the setting of malignant glioma.

  8. Molecular markers associated with aluminium tolerance in Sorghum bicolor. (United States)

    Too, Emily Jepkosgei; Onkware, Augustino Osoro; Were, Beatrice Ang'iyo; Gudu, Samuel; Carlsson, Anders; Geleta, Mulatu


    Sorghum ( Sorghum bicolor , L. Moench) production in many agro-ecologies is constrained by a variety of stresses, including high levels of aluminium (Al) commonly found in acid soils. Therefore, for such soils, growing Al tolerant cultivars is imperative for high productivity. In this study, molecular markers associated with Al tolerance were identified using a mapping population developed by crossing two contrasting genotypes for this trait. Four SSR ( Xtxp34 , Sb5_236 , Sb6_34 , and Sb6_342 ), one STS ( CTG29_3b ) and three ISSR ( 811_1400 , 835_200 and 884_200 ) markers produced alleles that showed significant association with Al tolerance. CTG29_3b, 811_1400 , Xtxp34 and Sb5_ 236 are located on chromosome 3 with the first two markers located close to Alt SB , a locus that underlie the Al tolerance gene ( SbMATE ) implying that their association with Al tolerance is due to their linkage to this gene. Although CTG29_3b and 811_ 1400 are located closer to Alt SB , Xtxp34 and Sb5_236 explained higher phenotypic variance of Al tolerance indices. Markers 835_200 , 884_200 , Sb6_34 and Sb6_342 are located on different chromosomes, which implies the presence of several genes involved in Al tolerance in addition to S bMATE in sorghum. These molecular markers have a high potential for use in breeding for Al tolerance in sorghum.

  9. Reviewing and Updating the Major Molecular Markers for Stem Cells (United States)

    Calloni, Raquel; Cordero, Elvira Alicia Aparicio; Henriques, João Antonio Pêgas


    Stem cells (SC) are able to self-renew and to differentiate into many types of committed cells, making SCs interesting for cellular therapy. However, the pool of SCs in vivo and in vitro consists of a mix of cells at several stages of differentiation, making it difficult to obtain a homogeneous population of SCs for research. Therefore, it is important to isolate and characterize unambiguous molecular markers that can be applied to SCs. Here, we review classical and new candidate molecular markers that have been established to show a molecular profile for human embryonic stem cells (hESCs), mesenchymal stem cells (MSCs), and hematopoietic stem cells (HSCs). The commonly cited markers for embryonic ESCs are Nanog, Oct-4, Sox-2, Rex-1, Dnmt3b, Lin-28, Tdgf1, FoxD3, Tert, Utf-1, Gal, Cx43, Gdf3, Gtcm1, Terf1, Terf2, Lefty A, and Lefty B. MSCs are primarily identified by the expression of CD13, CD29, CD44, CD49e, CD54, CD71, CD73, CD90, CD105, CD106, CD166, and HLA-ABC and lack CD14, CD31, CD34, CD45, CD62E, CD62L, CD62P, and HLA-DR expression. HSCs are mainly isolated based on the expression of CD34, but the combination of this marker with CD133 and CD90, together with a lack of CD38 and other lineage markers, provides the most homogeneous pool of SCs. Here, we present new and alternative markers for SCs, along with microRNA profiles, for these cells. PMID:23336433

  10. Molecular markers in well-differentiated thyroid cancer. (United States)

    D'Cruz, Anil K; Vaish, Richa; Vaidya, Abhishek; Nixon, Iain J; Williams, Michelle D; Vander Poorten, Vincent; López, Fernando; Angelos, Peter; Shaha, Ashok R; Khafif, Avi; Skalova, Alena; Rinaldo, Alessandra; Hunt, Jennifer L; Ferlito, Alfio


    Thyroid nodules are of common occurrence in the general population. About a fourth of these nodules are indeterminate on aspiration cytology placing many a patient at risk of unwanted surgery. The purpose of this review is to discuss various molecular markers described to date and place their role in proper perspective. This review covers the fundamental role of the signaling pathways and genetic changes involved in thyroid carcinogenesis. The current literature on the prognostic significance of these markers is also described. PubMed was used to search relevant articles. The key terms "thyroid nodules", "thyroid cancer papillary", "carcinoma papillary follicular", "carcinoma papillary", "adenocarcinoma follicular" were searched in MeSH, and "molecular markers", "molecular testing", mutation, BRAF, RAS, RET/PTC, PAX 8, miRNA, NIFTP in title and abstract fields. Multiple combinations were done and a group of experts in the subject from the International Head and Neck Scientific Group extracted the relevant articles and formulated the review. There has been considerable progress in the understanding of thyroid carcinogenesis and the emergence of numerous molecular markers in the recent years with potential to be used in the diagnostic algorithm of these nodules. However, their precise role in routine clinical practice continues to be a contentious issue. Majority of the studies in this context are retrospective and impact of these mutations is not independent of other prognostic factors making the interpretation difficult. The prevalence of these mutations in thyroid nodule is high and it is a continuously evolving field. Clinicians should stay informed as recommendation on the use of these markers is expected to evolve.

  11. Implication of Gastric Cancer Molecular Genetic Markers in Surgical Practice. (United States)

    Nemtsova, Marina V; Strelnikov, Vladimir V; Tanas, Alexander S; Bykov, Igor I; Zaletaev, Dmitry V; Rudenko, Viktoria V; Glukhov, Alexander I; Kchorobrich, Tatiana V; Li, Yi; Tarasov, Vadim V; Barreto, George E; Aliev, Gjumrakch


    We have investigated aberrant methylation of genes CDH1, RASSF1A, MLH1, N33, DAPK, expression of genes hTERT, MMP7, MMP9, BIRC5 (survivin), PTGS2, and activity of telomerase of 106 gastric tumor samples obtained intra-operatively and 53 gastric tumor samples from the same group of patients obtained endoscopically before surgery. Biopsy specimens obtained from 50 patients with chronic calculous cholecystitis were used as a control group. Together with tissue samples obtained from different sites remote to tumors, a total of 727 samples have been studied. The selected parameters comprise a system of molecular markers that can be used in both diagnostics of gastric cancer and in dynamic monitoring of patients after surgery. Special attention was paid to the use of molecular markers for the diagnostics of malignant process in the material obtained endoscopically since the efficacy of morphological diagnostics in biopsies is compromised by intratumoral heterogeneity, which may prevent reliable identification of tumor cells in the sampling. Our data indicated that certain molecular genetic events provided more sensitive yet specific markers of the tumor. We demonstrated that molecular profiles detected in preoperative biopsies were confirmed by the material obtained intra-operatively. The use of endoscopic material facilitates gastric tumors pre-operative diagnostics, improving early detection of gastric cancer and potential effective treatment strategies.

  12. Gliomatosis cerebri: Prognosis based on current molecular markers. (United States)

    Maharaj, Monish M; Phan, Kevin; Xu, Joshua; Fairhall, Jacob; Reddy, Rajesh; Rao, Prashanth J V


    This study aims to review the literature and identify key molecular markers affecting the prognosis of Gliomatosis cerebri (2) to evaluate the level of evidence and identify outstanding markers requiring further study. A literature search was conducted across 5 major databases using the key terms: "Molecular markers" AND "Gliomatosis cerebri" OR "diffuse astrocytoma." Critical appraisal and data presentation was performed inline with the PRISMA guidelines. Following search strategy implementation, 11 studies were included in the final review process. Our data demonstrates significant prognostic value associated with IDH1 132H mutation and variable evidence surrounding the role of INA expression, MGMT promoter methylation and other factors. However, there are significant limitations in the level of evidence obtained. As the genetic basis for the pathogenesis of Gliomatosis cerebri continues to widen, there is little data on markers aside from IDH1 mutation available. IDH1 132H mutation has been demonstrated to have significant effect on survival, particularly in patients with Gliomatosis cerebri type 2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Promise and pitfalls of molecular markers of thyroid nodules


    Jadhav, S.; Lila, Anurag; Bandgar, Tushar; Shah, Nalini


    Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG) and fine needle aspiration biopsy (FNAB). The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly ...

  14. Determination of molecular markers associated with anthesis-silking interval in maize

    International Nuclear Information System (INIS)

    Simpson, J.


    Maize lines contrasting in anthesis-silking, interval (ASI), a trait strongly linked to drought tolerance, have been analyzed under different water stress conditions in the field and with molecular markers. Correlation of marker and field data has revealed molecular markers strongly associated with flowering and yield traits. (author)

  15. Molecular markers for urothelial bladder cancer prognosis: toward implementation in clinical practice. (United States)

    van Rhijn, Bas W G; Catto, James W; Goebell, Peter J; Knüchel, Ruth; Shariat, Shahrokh F; van der Poel, Henk G; Sanchez-Carbayo, Marta; Thalmann, George N; Schmitz-Dräger, Bernd J; Kiemeney, Lambertus A


    To summarize the current status of clinicopathological and molecular markers for the prediction of recurrence or progression or both in non-muscle-invasive and survival in muscle-invasive urothelial bladder cancer, to address the reproducibility of pathology and molecular markers, and to provide directions toward implementation of molecular markers in future clinical decision making. Immunohistochemistry, gene signatures, and FGFR3-based molecular grading were used as molecular examples focussing on prognostics and issues related to robustness of pathological and molecular assays. The role of molecular markers to predict recurrence is limited, as clinical variables are currently more important. The prediction of progression and survival using molecular markers holds considerable promise. Despite a plethora of prognostic (clinical and molecular) marker studies, reproducibility of pathology and molecular assays has been understudied, and lack of reproducibility is probably the main reason that individual prediction of disease outcome is currently not reliable. Molecular markers are promising to predict progression and survival, but not recurrence. However, none of these are used in the daily clinical routine because of reproducibility issues. Future studies should focus on reproducibility of marker assessment and consistency of study results by incorporating scoring systems to reduce heterogeneity of reporting. This may ultimately lead to incorporation of molecular markers in clinical practice. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.


    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  17. Molecular Pathogenesis and Diagnostic, Prognostic and Predictive Molecular Markers in Sarcoma. (United States)

    Mariño-Enríquez, Adrián; Bovée, Judith V M G


    Sarcomas are infrequent mesenchymal neoplasms characterized by notable morphological and molecular heterogeneity. Molecular studies in sarcoma provide refinements to morphologic classification, and contribute diagnostic information (frequently), prognostic stratification (rarely) and predict therapeutic response (occasionally). Herein, we summarize the major molecular mechanisms underlying sarcoma pathogenesis and present clinically useful diagnostic, prognostic and predictive molecular markers for sarcoma. Five major molecular alterations are discussed, illustrated with representative sarcoma types, including 1. the presence of chimeric transcription factors, in vascular tumors; 2. abnormal kinase signaling, in gastrointestinal stromal tumor; 3. epigenetic deregulation, in chondrosarcoma, chondroblastoma, and other tumors; 4. deregulated cell survival and proliferation, due to focal copy number alterations, in dedifferentiated liposarcoma; 5. extreme genomic instability, in conventional osteosarcoma as a representative example of sarcomas with highly complex karyotype. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Genetic studies and a search for molecular markers that are linked ...

    African Journals Online (AJOL)


    Instead, linkage analysis resulted in the construction of a molecular marker linkage map consisting of 45 ..... This limits the application of this marker type, particularly in ... primer design when one uses RAPDs. .... Concepts of Genetics. Fourth.

  19. Molecular markers for tracking the origin and worldwide distribution of invasive strains of Puccinia striiformis

    DEFF Research Database (Denmark)

    Walter, Stephanie; Ali, Sajid; Kemen, Eric


    .g., the spreading of two aggressive and high temperature adapted strains to three continents since 2000. The combination of sequence-characterized amplified region (SCAR) markers, which were developed from two specific AFLP fragments, differentiated the two invasive strains, PstS1 and PstS2 from all other P....... striiformis strains investigated at a worldwide level. The application of the SCAR markers on 566 isolates showed that PstS1 was present in East Africa in the early 1980s and then detected in the Americas in 2000 and in Australia in 2002. PstS2 which evolved from PstS1 became widespread in the Middle East...... as the most plausible origin of the two invasive strains. The SCAR markers developed in the present study provide a rapid, inexpensive, and efficient tool to track the distribution of P. striiformis invasive strains, PstS1 and PstS2....

  20. Characterization of Gladiolus Germplasm Using Morphological, Physiological, and Molecular Markers. (United States)

    Singh, Niraj; Pal, Ashish K; Roy, R K; Tewari, S K; Tamta, Sushma; Rana, T S


    Estimation of variability and genetic relationships among breeding materials is one of the important strategies in crop improvement programs. Morphological (plant height, spike length, a number of florets/spike), physiological (chlorophyll content, chlorophyll fluorescence, and rapid light curve parameters) and Directed amplification of minisatellite DNA (DAMD) markers were used to investigate the relationships among 50 Gladiolus cultivars. Cluster analysis based on morphological data, physiological characteristics, molecular markers, and cumulative data discriminated all cultivars into seven, five, seven, and six clusters in the unweighted pair-group method using arithmetic mean (UPGMA) dendrogram, respectively. The results of the principal coordinate analysis (PCoA) also supported UPGMA clustering. Variations among the Gladiolus cultivars at phenotypic level could be due to the changes in physiology, environmental conditions, and genetic variability. DAMD analysis using 10 primers produced 120 polymorphic bands with 80% polymorphism showing polymorphic information content (PIC = 0.28), Marker index (MI = 3.37), Nei's gene diversity (h = 0.267), and Shannon's information index (I = 0.407). Plant height showed a positive significant correlation with Spike length and Number of florets/spike (r = 0.729, p < 0.001 and r = 0.448, p = 0.001 respectively). Whereas, Spike length showed positive significant correlation with Number of florets/spike (r = 0.688, p < 0.001) and Chlorophyll content showed positive significant correlation with Electron transport rate (r = 0.863, p < 0.001). Based on significant morphological variations, high physiological performance, high genetic variability, and genetic distances between cultivars, we have been able to identify diverse cultivars of Gladiolus that could be the potential source as breeding material for further genetic improvement in this ornamental crop.

  1. Advances in Carcinogenic Metal Toxicity and Potential Molecular Markers

    Directory of Open Access Journals (Sweden)

    Preeyaporn Koedrith


    Full Text Available Metal compounds such as arsenic, cadmium, chromium, cobalt, lead, mercury, and nickel are classified as carcinogens affecting human health through occupational and environmental exposure. However, the underlying mechanisms involved in tumor formation are not well clarified. Interference of metal homeostasis may result in oxidative stress which represents an imbalance between production of free radicals and the system’s ability to readily detoxify reactive intermediates. This event consequently causes DNA damage, lipid peroxidation, protein modification, and possibly symptomatic effects for various diseases including cancer. This review discusses predominant modes of action and numerous molecular markers. Attention is paid to metal-induced generation of free radicals, the phenomenon of oxidative stress, damage to DNA, lipid, and proteins, responsive signal transduction pathways with major roles in cell growth and development, and roles of antioxidant enzymatic and DNA repair systems. Interaction of non-enzymatic antioxidants (carotenoids, flavonoids, glutathione, selenium, vitamin C, vitamin E, and others with cellular oxidative stress markers (catalase, glutathione peroxidase, and superoxide dismutase as well as certain regulatory factors, including AP-1, NF-κB, Ref-1, and p53 is also reviewed. Dysregulation of protective pathways, including cellular antioxidant network against free radicals as well as DNA repair deficiency is related to oncogenic stimulation. These observations provide evidence that emerging oxidative stress-responsive regulatory factors and DNA repair proteins are putative predictive factors for tumor initiation and progression.

  2. Greek PDO saffron authentication studies using species specific molecular markers. (United States)

    Bosmali, I; Ordoudi, S A; Tsimidou, M Z; Madesis, P


    Saffron, the spice produced from the red stigmas of the flower of Crocus sativus L. is a frequent target of fraud and mislabeling practices that cannot be fully traced using the ISO 3632 trade standard specifications and test methods. A molecular approach is proposed herein as a promising branding strategy for the authentication of highly esteemed saffron brands such as the Greek Protected Designation of Origin (PDO) "Krokos Kozanis". Specific ISSR (inter-simple sequence repeat) markers were used to assess for the first time, the within species variability of several populations of C. sativus L. from the cultivation area of "Krokos Kozanis" as well as the potential differences with the band pattern produced by other Crocus species. Then, species-specific markers were developed taking advantage of an advanced molecular technique such as the HRM analysis coupled with universal DNA barcoding regions (trnL) (Bar-HRM) and applied to saffron admixtures with some of the most common plant adulterants (Calendula officinalis, Carthamus tinctorius, Gardenia jasminoides, Zea mays and Curcuma longa). The sensitivity of the procedure was tested for turmeric as a case study whereas HPLC-fluorescence determination of secondary metabolites was also employed for comparison. The overall results indicated that the Bar-HRM approach is quite effective in terms of specificity and sensitivity. Its effectiveness regarding the detection of turmeric was comparable to that of a conventional HPLC method (0.5% vs 1.0%, w/w). Yet, the proposed DNA-based method is much faster, cost-effective and can be used even by non-geneticists, in any laboratory having access to an HRM-capable real-time PCR instrumentation. It can be, thus, regarded as a strong analytical tool in saffron authentication studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. New models and molecular markers in evaluation of developmental toxicity

    International Nuclear Information System (INIS)

    Huuskonen, Hannele


    Mammalian and non-mammalian embryos and embryonic stem cells may be used as models in mechanistic studies and in testing embryotoxicity of compounds. In addition to conventional culture methods, genetic modifications and use of molecular markers offer significant advantages in mechanistic studies as well as in developing new test methods for embryotoxicity. Zebrafish model has been used for a long time and at present several applications are available. It is an easy vertebral non-mammalian model, whose genome is largely known and several genetic modifications are easily constructed to study gene expression or knocked down genes. Fluorescent marker proteins can be used also in zebrafish to indicate gene activation in transgenic models. Chemical genetics approach has been developed using zebrafish model. This is a new approach to screen small molecules that regulate signaling pathways. Embryonic stem cells have been used in mechanistic studies and mouse embryonic stem cell test has been validated to study embryotoxicity in vitro. This method has been improved using quantitative measurements of molecular endpoints by real-time RT-PCR or fluorescent activated cell sorting methods (FACS). Methods facilitating differentiation to several different cell types are available. We have studied preimplantation mouse embryos as a possible model for in vitro testing. In this method, superovulated and in vivo fertilized preimplantation embryos were collected at morula stage and cultured up to blastocysts. The mouse preimplantation culture test was improved by quantitative gene expression measurement using two-step real-time RT-PCR methods. New endpoints improve the tests of in vitro embryotoxicity because subjective assessments are replaced by objective measurements. In addition, automation is possible and less time is needed for analysis. Thus, high throughput screening will come possible to test large numbers of compounds

  4. Isolation of two new retrotransposon sequences and development of molecular and cytological markers for Dasypyrum villosum (L.). (United States)

    Zhang, Jie; Jiang, Yun; Xuan, Pu; Guo, Yuanlin; Deng, Guangbing; Yu, Maoqun; Long, Hai


    Dasypyrum villosum is a valuable genetic resource for wheat improvement. With the aim to efficiently monitor the D. villosum chromatin introduced into common wheat, two novel retrotransposon sequences were isolated by RAPD, and were successfully converted to D. villosum-specific SCAR markers. In addition, we constructed a chromosomal karyotype of D. villosum. Our results revealed that different accessions of D. villosum showed slightly different signal patterns, indicating that distribution of repeats did not diverge significantly among D. villosum accessions. The two SCAR markers and FISH karyotype of D. villosum could be used for efficient and precise identification of D. villosum chromatin in wheat breeding.

  5. Application of molecular markers for variety protection of ryegrass (Lolium perenne L.)

    DEFF Research Database (Denmark)

    Jensen, Louise Bach; Deneken, Gerhard; Roulund, N


    registration systems. Although DUS testing currently employs mostly visually observable characteristics that are expressions of the phenotype of a variety, there is much interest in the use of molecular markers. The overall objective of this project is to examine the potential use of molecular markers...... with 140 alleles gives the same level of information. Furthermore, number of genotypes per variety can be reduced to 20 compared to the original dataset containing 60 genotypes when using all 18 SSR markers but not when using only six SSR markers. Significant association was found between the molecular...... on the morphological characterization from the DUS trial. 18 SSR markers were selected based on their genome distribution, reproducibility, level of information and ease of scoring. It was found, that for variety discrimination, reducing the number of SSR markers from 18 SSR markers with 262 alleles to six SSR markers...

  6. Proteomic identification of gender molecular markers in Bothrops jararaca venom. (United States)

    Zelanis, André; Menezes, Milene C; Kitano, Eduardo S; Liberato, Tarcísio; Tashima, Alexandre K; Pinto, Antonio F M; Sherman, Nicholas E; Ho, Paulo L; Fox, Jay W; Serrano, Solange M T


    Variation in the snake venom proteome is a well-documented phenomenon; however, sex-based variation in the venom proteome/peptidome is poorly understood. Bothrops jararaca shows significant sexual size dimorphism and here we report a comparative proteomic/peptidomic analysis of venoms from male and female specimens and correlate it with the evaluation of important venom features. We demonstrate that adult male and female venoms have distinct profiles of proteolytic activity upon fibrinogen and gelatin. These differences were clearly reflected in their different profiles of SDS-PAGE, two-dimensional electrophoresis and glycosylated proteins. Identification of differential protein bands and spots between male or female venoms revealed gender-specific molecular markers. However, the proteome comparison by in-solution trypsin digestion and label-free quantification analysis showed that the overall profiles of male and female venoms are similar at the polypeptide chain level but show striking variation regarding their attached carbohydrate moieties. The analysis of the peptidomes of male and female venoms revealed different contents of peptides, while the bradykinin potentiating peptides (BPPs) showed rather similar profiles. Furthermore we confirmed the ubiquitous presence of four BPPs that lack the C-terminal Q-I-P-P sequence only in the female venom as gender molecular markers. As a result of these studies we demonstrate that the sexual size dimorphism is associated with differences in the venom proteome/peptidome in B. jararaca species. Moreover, gender-based variations contributed by different glycosylation levels in toxins impact venom complexity. Bothrops jararaca is primarily a nocturnal and generalist snake species, however, it exhibits a notable ontogenetic shift in diet and in venom proteome upon neonate to adult transition. As is common in the Bothrops genus, B. jararaca shows significant sexual dimorphism in snout-vent length and weight, with females being

  7. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  8. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica


    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  9. Genetic diversity analysis of common beans based on molecular markers. (United States)

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl


    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  10. Use of molecular markers in plant breeding = [Het gebruik van moleculaire merkers in de plantenveredeling

    NARCIS (Netherlands)

    Berloo, van R.


    Molecular markers provide plant breeding with an important and valuable new source of information. Linkage between molecular markers can be translated to genetic linkage maps, which have become an important tool in plant and animal genetics. Linkage between (quantitative) trait-data and

  11. Isotopic and molecular fractionation in combustion; three routes to molecular marker validation, including direct molecular 'dating' (GC/AMS) (United States)

    Currie, L. A.; Klouda, G. A.; Benner, B. A.; Garrity, K.; Eglinton, T. I.

    The identification of unique isotopic, elemental, and molecular markers for sources of combustion aerosol has growing practical importance because of the potential effects of fine particle aerosol on health, visibility and global climate. It is urgent, therefore, that substantial efforts be directed toward the validation of assumptions involving the use of such tracers for source apportionment. We describe here three independent routes toward carbonaceous aerosol molecular marker identification and validation: (1) tracer regression and multivariate statistical techniques applied to field measurements of mixed source, carbonaceous aerosols; (2) a new development in aerosol 14C metrology: direct, pure compound accelerator mass spectrometry (AMS) by off-line GC/AMS ('molecular dating'); and (3) direct observation of isotopic and molecular source emissions during controlled laboratory combustion of specific fuels. Findings from the combined studies include: independent support for benzo( ghi)perylene as a motor vehicle tracer from the first (statistical) and second (direct 'dating') studies; a new indication, from the third (controlled combustion) study, of a relation between 13C isotopic fractionation and PAH molecular fractionation, also linked with fuel and stage of combustion; and quantitative data showing the influence of both fuel type and combustion conditions on the yields of such species as elemental carbon and PAH, reinforcing the importance of exercising caution when applying presumed conservative elemental or organic tracers to fossil or biomass burning field data as in the first study.

  12. Applications of molecular markers in the discrimination of Panax species and Korean ginseng cultivars (Panax ginseng

    Directory of Open Access Journals (Sweden)

    Ick Hyun Jo


    Full Text Available The development of molecular markers is one of the most useful methods for molecular breeding and marker-based molecular associated selections. Even though there is less information on the reference genome, molecular markers are indispensable tools for determination of genetic variation and identification of species with high levels of accuracy and reproducibility. The demand for molecular approaches for marker-based breeding and genetic discriminations in Panax species has greatly increased in recent times and has been successfully applied for various purposes. However, owing to the existence of diverse molecular techniques and differences in their principles and applications, there should be careful consideration while selecting appropriate marker types. In this review, we outline the recent status of different molecular marker applications in ginseng research and industrial fields. In addition, we discuss the basic principles, requirements, and advantages and disadvantages of the most widely used molecular markers, including restriction fragment length polymorphism, random amplified polymorphic DNA, sequence tag sites, simple sequence repeats, and single nucleotide polymorphisms.

  13. Applications of molecular markers in the discrimination of Panax species and Korean ginseng cultivars (Panax ginseng). (United States)

    Jo, Ick Hyun; Kim, Young Chang; Kim, Dong Hwi; Kim, Kee Hong; Hyun, Tae Kyung; Ryu, Hojin; Bang, Kyong Hwan


    The development of molecular markers is one of the most useful methods for molecular breeding and marker-based molecular associated selections. Even though there is less information on the reference genome, molecular markers are indispensable tools for determination of genetic variation and identification of species with high levels of accuracy and reproducibility. The demand for molecular approaches for marker-based breeding and genetic discriminations in Panax species has greatly increased in recent times and has been successfully applied for various purposes. However, owing to the existence of diverse molecular techniques and differences in their principles and applications, there should be careful consideration while selecting appropriate marker types. In this review, we outline the recent status of different molecular marker applications in ginseng research and industrial fields. In addition, we discuss the basic principles, requirements, and advantages and disadvantages of the most widely used molecular markers, including restriction fragment length polymorphism, random amplified polymorphic DNA, sequence tag sites, simple sequence repeats, and single nucleotide polymorphisms.

  14. An evaluation of a diagnostic test to identify the sex of farmed rainbow trout, using sex-specific molecular markers Evaluación de un test diagnóstico para identificar el sexo en truchas arcoíris por medio de marcadores moleculares específicos

    Directory of Open Access Journals (Sweden)

    María E López


    Full Text Available In trout farming males exhibits lower growth rate and precocious sexual maturation in contrast to females. Since these traits are detrimental for intensive production, all females populations are most appreciated by fish farmers. Molecular markers sex-specific have been developed for rainbow trout that can be useful to diagnose the phenotypic sex of individuals. We evaluated the use of two SCAR markers (OmyP9 & Omy163, which show polymorphisms between males and females in rainbow trout as a diagnostic test for sexing farmed trout. Adult trout (n = 131 were genotyped to assess the association of the SCAR markers with phenotypic sex. To evaluate the correct performance of the SCAR marker in sex diagnosis, each marker and both were analyzed to estimate its specificity (the proportion of males that are correctly identified, sensitivity (the proportion of females that are correctly identified and predictive value (the probability of the correct positive or negative female identification. Significant associations with phenotypic sex of both SCAR markers with sex were found. The sensitivity and predictive (positive and negative indexes show higher values when both SCAR markers were considered (95.7, 77.4 and 94.4%, respectively. For joined SCAR markers a likelihood ratio (LR+ of 3.43 was obtained indicating its utility to establish a diagnostic test for sexing trout by use of marker-based analysis.En el cultivo de truchas los individuos del sexo masculino presentan menor tasa de crecimiento y maduración sexual precoz, características que no presentan las hembras. Debido a estos rasgos indeseables para el cultivo intensivo, el uso de poblaciones todo hembra es una práctica habitual en el cultivo de truchas. Para trucha arcoíris se han desarrollado marcadores moleculares sexo específico que pueden utilizarse en el diagnóstico temprano del sexo, en condiciones de cultivo. Se evaluó la aplicación de dos marcadores SCAR (OmyP9 y Omy163, que muestran

  15. Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers. (United States)

    Abbas, Ghulam; Hameed, Amjad; Rizwan, Muhammad; Ahsan, Muhammad; Asghar, Muhammad J; Iqbal, Nayyer


    Molecular confirmation of interspecific recombinants is essential to overcome the issues like self-pollination, environmental influence, and inadequacy of morphological characteristics during interspecific hybridization. The present study was conducted for genetic confirmation of mungbean (female) and mashbean (male) interspecific crosses using molecular markers. Initially, polymorphic random amplified polymorphic DNA (RAPD), universal rice primers (URP), and simple sequence repeats (SSR) markers differentiating parent genotypes were identified. Recombination in hybrids was confirmed using these polymorphic DNA markers. The NM 2006 × Mash 88 was most successful interspecific cross. Most of true recombinants confirmed by molecular markers were from this cross combination. SSR markers were efficient in detecting genetic variability and recombination with reference to specific chromosomes and particular loci. SSR (RIS) and RAPD identified variability dispersed throughout the genome. In conclusion, DNA based marker assisted selection (MAS) efficiently confirmed the interspecific recombinants. The results provided evidence that MAS can enhance the authenticity of selection in mungbean improvement program.

  16. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers. (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E


    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.


    Directory of Open Access Journals (Sweden)

    I. Hrytsyniak


    Full Text Available Purpose. The application of molecular genetic markers has been widely used in modern experimental fish-farming in recent years. This methodology is currently presented by a differentiated approach with individual mechanisms and clearly defined possibilities. Numerous publications in the scientific literature that are dedicated to molecular genetic markers for the most part offer purely practical data. Thus, the synthesis and analysis of existing information on the general principles of action and the limits of the main methods of using molecular genetic markers is an actual problem. In particular, such a description will make it possible to plan more effectively the experiment and to obtain the desired results with high reliability. Findings. The main types of variable parts of DNA that can be used as molecular genetic markers in determining the level of stock hybridization, conducting genetic inventory of population and solving other problems in modern fish-farming are described in this paper. Also, the article provides an overview of principal modern methods that can be used to identify molecular genetic markers. Originality. This work is a generalization of modern ideas about the mechanisms of experiments with molecular genetic markers in fish-farming. Information is provided in the form of consistent presentation of the principles and purpose of each method, as well as significant advances during their practical application. Practical value. The proposed review of classic and modern literature data on molecular genetic markers can be used for planning, modernization and correction of research activity in modern fish-farming.

  18. Uso prático de marcadores moleculares para seleção assistida no melhoramento de uvas de mesa apirênicas Practical use of molecular markers for seedlessness assisted selection in grapevine breeding

    Directory of Open Access Journals (Sweden)

    Luís Fernando Revers


    Full Text Available A hipótese mais bem aceita atualmente para explicar a genética complexa da estenoespermocarpia, observada na videira, indica que a expressão deste fenótipo é controlada por três genes recessivos, independentemente herdados e controlados por um gene regulador dominante (sdI. Em estudo anterior, Lahogue et al. (1998 identificaram um marcador RAPD (Random Amplified Polymorphic DNA ligado ao gene sdI e utilizaram-no para desenvolver um SCAR (Sequence Characterized Amplified Region co-dominante denominado SCC8, que pode distinguir, em uma progênie, indivíduos com semente como também selecionar indivíduos apirênicos. Neste trabalho, são apresentados resultados da avaliação do potencial de aplicação do marcador molecular SCAR SCC8 para seleção assistida do caráter da apirenia no melhoramento de uvas de mesa sem sementes. A utilização deste marcador na seleção assistida para apirenia em uvas de mesa mostrou-se viável, e as conseqüências da sua utilização no programa de melhoramento da Embrapa Uva e Vinho são discutidas.The inheritance of seedlessness in grapevine is based on a complex genetic system, where the expression of three independently inherited recessive genes is controlled by a dominant regulator gene (sdI. In a previous study, Lahogue et al. (1998 identified a random amplified polymorphic DNA marker, tightly linked to the sdI gene and developed a codominant SCAR (Sequence Characterized Amplified Region marker named SCC8, that allows the distinction of seeded and seedless plants in a segregating progeny. The aim of the present work was to evaluate the usefullness of the SCAR marker SCC8 for assisted selection of the seedlessness character in grape breeding. According to our results, the use of the SCC8 marker is economically viable and the consequences of its use in the grapevine breeding program at Embrapa Uva e Vinho are discussed.

  19. Criteria for selection and application of molecular markers for clinical studies of osteoarthritis. (United States)

    Otterness, I G; Swindell, A C


    To develop criteria for the selection and application of molecular markers for the study of osteoarthritis (OA). Statistical criteria for marker selection for OA are developed. After studying more than 20 different molecular markers for monitoring OA, procedures for choosing markers for clinical studies have been developed. For a particular study, the process starts with the markers showing 'face-validity' for monitoring OA. They are next required to successfully distinguish OA patients from controls. This necessitates definition of the distribution of marker values in OA patients and controls. So far, they have been consistently log-normal. The difference (Delta) in marker values between OA and controls defines the opportunity for marker improvement. The between-visit standard deviation (S) in patients puts limits on the detection of marker changes. The two variables can be combined to estimate the practicality of a marker using a modified power analysis. The number of patients (N*) required to observe a 50% improvement with an alpha level of P=0.05 and with 80% certainty is estimated as 50(S/Delta)(2). N*, S and Delta should be used to characterize and compare markers. Marker efficiency can be refined by regressing on secondary variables, such as age, sex, BMI, severity, etc. Finally, the use of two or more markers may be required to improve marker prediction of clinical outcome. Correlated markers can be used to reinforce conclusions by essentially adding replicative data. Independent, complementary markers can be used to develop associations with clinical parameters, and perhaps diagnose and monitor disease status, activities that so far have not been possible with single markers.

  20. Molecular analysis of childhood primitive neuroectodermal tumors defines markers associated with poor outcome

    DEFF Research Database (Denmark)

    Scheurlen, W G; Schwabe, G C; Joos, S


    PURPOSE: The diagnostic and prognostic significance of well-defined molecular markers was investigated in childhood primitive neuroectodermal tumors (PNET). MATERIALS AND METHODS: Using microsatellite analysis, Southern blot analysis, and fluorescence in situ hybridization (FISH), 30 primary tumors......: In our study, amplification of c-myc was a poor-prognosis marker in PNET. LOH of chromosome 17p was associated with metastatic disease. Molecular analysis of primary tumors using these markers may be useful for stratification of children with PNET in future prospective studies. The other aberrations...... investigated were not of significant prognostic value, but may provide an entry point for future large-scale molecular studies....

  1. Advance of molecular marker application in the tobacco research

    African Journals Online (AJOL)



    Dec 29, 2008 ... nature, codominant inheritance, easy access, easy and ... available DNA marker types employed in tobacco research, the second .... and organization of mitochondrial and chloroplast genomes ... maternal genome of tobacco.

  2. Molecular Markers of Metastasis in Ductal Mammary Carcinoma

    National Research Council Canada - National Science Library

    Achary, Patnala


    ...% of those patients, however, the disease spreads, and they are at risk of death. Our goal is to develop DNA markers that could be reliably used to identify the ductal mammary carcinomas that are prone to develop metastasis...

  3. Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN (United States)

    Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger


    Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

  4. Identification of molecular markers associated with fruit traits in olive and assessment of olive core collection with AFLP markers and fruit traits. (United States)

    Ipek, M; Seker, M; Ipek, A; Gul, M K


    The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization.

  5. Post-burn scars and scar contractures

    Directory of Open Access Journals (Sweden)

    Goel Arun


    Full Text Available The mortality and morbidity from burns have diminished tremendously over the last six to seven decades. However, these do not truly reflect whether the victim could go back to society as a useful person or not and lead a normal life because of the inevitable post-burn scars, contractures and other deformities which collectively have aesthetic and functional considerations. This article gives an overview of the post-burn scars and scar contractures, especially their prevention, minimisation and principles of management.


    Organic molecular markers were measured in airborne particulate matter (PM10) from the City of Philadelphia North Broad Street air quality monitoring site to identify the seasonal abundances of key tracer compounds together with their dominant sources. Daily PM10...

  7. Molecular marker analysis of heading date Hd1 locus in Egyptian ...

    African Journals Online (AJOL)

    Nine molecular markers derived from the heading date QTL Hd1 DNA sequence for cultivated rice were used to study the heading date allelic diversity of the cultivated Egyptian rice varieties. The results showed that among the nine simple sequence repeats (SSR) and sequence tagged-sites (STS) markers used, one SSR ...

  8. Suitability and use of two molecular markers to track race-specific ...

    African Journals Online (AJOL)

    Molecular markers linked to resistance to different races of S. gesneriodes have been identified. It was desirable to demonstrate the applicability and efficiency for use in ... The two marker data set were significantly correlated with the phenotypic data (r=0.95). Based on the tight linkage with the resistant locus, 61RM2 was ...

  9. Molecular biology of breast cancer metastasis Molecular expression of vascular markers by aggressive breast cancer cells

    International Nuclear Information System (INIS)

    Hendrix, Mary JC; Seftor, Elisabeth A; Kirschmann, Dawn A; Seftor, Richard EB


    During embryogenesis, the formation of primary vascular networks occurs via the processes of vasculogenesis and angiogenesis. In uveal melanoma, vasculogenic mimicry describes the 'embryonic-like' ability of aggressive, but not nonaggressive, tumor cells to form networks surrounding spheroids of tumor cells in three-dimensional culture; these recapitulate the patterned networks seen in patients' aggressive tumors and correlates with poor prognosis. The molecular profile of these aggressive tumor cells suggests that they have a deregulated genotype, capable of expressing vascular phenotypes. Similarly, the embryonic-like phenotype expressed by the aggressive human breast cancer cells is associated with their ability to express a variety of vascular markers. These studies may offer new insights for consideration in breast cancer diagnosis and therapeutic intervention strategies

  10. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants (United States)

    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki


    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase ( This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  11. Recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Zieger, Karsten; Ørntoft, Torben Falck


    individually contributed to the management of the disease. However, the development of high-throughput techniques for simultaneous assessment of a large number of markers has allowed classification of tumors into clinically relevant molecular subgroups beyond those possible by pathological classification. Here......Bladder cancer is the fifth most common neoplasm in industrialized countries. Due to frequent recurrences of the superficial form of this disease, bladder cancer ranks as one of the most common cancers. Despite the description of a large number of tumor markers for bladder cancers, none have......, we review the recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers....

  12. Molecular Characterization of Cultivated Pawpaw (Asimina triloba) Using RAPD Markers (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak


    Thirty-four extant pawpaw [Asimina triloba (L.) Dunal] cultivars and advanced selections representing a large portion of the gene pool of cultivated pawpaws were investigated using 71 randomly amplified polymorphic DNA (RAPD) markers to establish genetic identities and evaluate genetic relatedness. All 34 cultivated pawpaws were uniquely...

  13. Identifying molecular markers associated with stigma characteristics in rice (United States)

    Stigma characteristics play essential roles in hybrid seed production of rice and marker-assisted breeding plays essential role because they are quantitatively inherited with single-flowered perfect spikelet. Ninety four accessions originated from 47 countries were selected from the USDA rice core c...

  14. Molecular markers in the surgical margin of oral carcinomas

    DEFF Research Database (Denmark)

    Bilde, A.; Buchwald, C. von; Dabelsteen, E.


    epithelium in the surgical resection margin may explain the local recurrence rate. The purpose of this study is to investigate the presence of senescence markers, which may represent early malignant changes in the margin that in routine pathological evaluations are classified as histologically normal...

  15. Molecular marker analysis to differentiate a clonal selection of ...

    African Journals Online (AJOL)

    Lalit Kumar


    Apr 3, 2013 ... Microsatellite and amplified fragment length polymorphism (AFLP) markers were used to differentiate. Manjari Naveen, a clonal selection of Centennial Seedless variety of grape. Twenty one (21) microsatellite primers could not detect variation between parent variety and its clone. AFLP analysis.

  16. Molecular markers for granulovacuolar degeneration are present in rimmed vacuoles.

    Directory of Open Access Journals (Sweden)

    Masahiro Nakamori

    Full Text Available BACKGROUND: Rimmed vacuoles (RVs are round-oval cytoplasmic inclusions, detected in muscle cells of patients with myopathies, such as inclusion body myositis (IBM and distal myopathy with RVs (DMRV. Granulovacuolar degeneration (GVD bodies are spherical vacuoles containing argentophilic and hematoxyphilic granules, and are one of the pathological hallmarks commonly found in hippocampal pyramidal neurons of patients with aging-related neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease. These diseases are common in the elderly and share some pathological features. Therefore, we hypothesized that mechanisms of vacuolar formation in RVs and GVD bodies are common despite their role in two differing pathologies. We explored the components of RVs by immunohistochemistry, using antibodies for GVD markers. METHODS: Subjects included one AD case, eight cases of sporadic IBM, and three cases of DMRV. We compared immunoreactivity and staining patterns for GVD markers. These markers included: (1 tau-modifying proteins (caspase 3, cyclin-dependent kinase 5 [CDK5], casein kinase 1δ [CK1δ], and c-jun N-terminal kinase [JNK], (2 lipid raft-associated materials (annexin 2, leucine-rich repeat kinase 2 [LRRK2], and flotillin-1, and (3 other markers (charged multi-vesicular body protein 2B [CHMP2B] and phosphorylated transactive response DNA binding protein-43 [pTDP43] in both GVD bodies and RVs. Furthermore, we performed double staining of each GVD marker with pTDP43 to verify the co-localization. RESULTS: GVD markers, including lipid raft-associated proteins and tau kinases, were detected in RVs. CHMP2B, pTDP43, caspase 3, LRRK2, annexin 2 and flotillin-1 were detected on the rim and were diffusely distributed in the cytoplasm of RV-positive fibers. CDK5, CK1δ and JNK were detected only on the rim. In double staining experiments, all GVD markers colocalized with pTDP43 in RVs. CONCLUSIONS: These results suggest that RVs of muscle

  17. Temperature effects on multiphase reactions of organic molecular markers: A modeling study (United States)

    Pratap, Vikram; Chen, Ying; Yao, Guangming; Nakao, Shunsuke


    Various molecular markers are used in source apportionment studies. In early studies, molecular markers were assumed to be inert. However, recent studies suggest that molecular markers can decay rapidly through multiphase reactions, which makes interpretation of marker measurements challenging. This study presents a simplified model to account for the effects of temperature and relative humidity on the lifetime of molecular markers through a shift in gas-particle partitioning as well as a change in viscosity of the condensed phase. As a model case, this study examines the stability of levoglucosan, a key marker species of biomass burning, over a wide temperature range relevant to summertime and wintertime. Despite the importance of wood combustion for space heating in winter, the lifetime of levoglucosan in wintertime is not well understood. The model predicts that in low-temperature conditions, levoglucosan predominantly remains in the particle phase, and therefore its loss due to gas-phase oxidation reactions is significantly reduced. Furthermore, the movement of the levoglucosan from the bulk of the particle to the particle surface is reduced due to low diffusivity in the semi-solid state. The simplified model developed in this study reasonably reproduces upper and lower bounds of the lifetime of levoglucosan investigated in previous studies. The model results show that the levoglucosan depletion after seven days reduces significantly from ∼98% at 25 °C to marker (lifetime > 1 week) even at 60% relative humidity irrespective of the assumed fragility parameter D that controls estimated diffusivity. The model shows that lifetime of an organic molecular marker strongly depends on assumed D especially when a semi-volatile marker is in semi-solid organic aerosol.

  18. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong


    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the “candidate genes” and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops. PMID:26388887

  19. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica. (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong


    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the "candidate genes" and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops.

  20. A combination of molecular markers and clinical features improve the classification of pancreatic cysts. (United States)

    Springer, Simeon; Wang, Yuxuan; Dal Molin, Marco; Masica, David L; Jiao, Yuchen; Kinde, Isaac; Blackford, Amanda; Raman, Siva P; Wolfgang, Christopher L; Tomita, Tyler; Niknafs, Noushin; Douville, Christopher; Ptak, Janine; Dobbyn, Lisa; Allen, Peter J; Klimstra, David S; Schattner, Mark A; Schmidt, C Max; Yip-Schneider, Michele; Cummings, Oscar W; Brand, Randall E; Zeh, Herbert J; Singhi, Aatur D; Scarpa, Aldo; Salvia, Roberto; Malleo, Giuseppe; Zamboni, Giuseppe; Falconi, Massimo; Jang, Jin-Young; Kim, Sun-Whe; Kwon, Wooil; Hong, Seung-Mo; Song, Ki-Byung; Kim, Song Cheol; Swan, Niall; Murphy, Jean; Geoghegan, Justin; Brugge, William; Fernandez-Del Castillo, Carlos; Mino-Kenudson, Mari; Schulick, Richard; Edil, Barish H; Adsay, Volkan; Paulino, Jorge; van Hooft, Jeanin; Yachida, Shinichi; Nara, Satoshi; Hiraoka, Nobuyoshi; Yamao, Kenji; Hijioka, Susuma; van der Merwe, Schalk; Goggins, Michael; Canto, Marcia Irene; Ahuja, Nita; Hirose, Kenzo; Makary, Martin; Weiss, Matthew J; Cameron, John; Pittman, Meredith; Eshleman, James R; Diaz, Luis A; Papadopoulos, Nickolas; Kinzler, Kenneth W; Karchin, Rachel; Hruban, Ralph H; Vogelstein, Bert; Lennon, Anne Marie


    The management of pancreatic cysts poses challenges to both patients and their physicians. We investigated whether a combination of molecular markers and clinical information could improve the classification of pancreatic cysts and management of patients. We performed a multi-center, retrospective study of 130 patients with resected pancreatic cystic neoplasms (12 serous cystadenomas, 10 solid pseudopapillary neoplasms, 12 mucinous cystic neoplasms, and 96 intraductal papillary mucinous neoplasms). Cyst fluid was analyzed to identify subtle mutations in genes known to be mutated in pancreatic cysts (BRAF, CDKN2A, CTNNB1, GNAS, KRAS, NRAS, PIK3CA, RNF43, SMAD4, TP53, and VHL); to identify loss of heterozygozity at CDKN2A, RNF43, SMAD4, TP53, and VHL tumor suppressor loci; and to identify aneuploidy. The analyses were performed using specialized technologies for implementing and interpreting massively parallel sequencing data acquisition. An algorithm was used to select markers that could classify cyst type and grade. The accuracy of the molecular markers was compared with that of clinical markers and a combination of molecular and clinical markers. We identified molecular markers and clinical features that classified cyst type with 90%-100% sensitivity and 92%-98% specificity. The molecular marker panel correctly identified 67 of the 74 patients who did not require surgery and could, therefore, reduce the number of unnecessary operations by 91%. We identified a panel of molecular markers and clinical features that show promise for the accurate classification of cystic neoplasms of the pancreas and identification of cysts that require surgery. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

  1. Determinants of molecular marker based classification of rice (Oryza ...

    African Journals Online (AJOL)

    mr devi singh


    Jan 7, 2015 ... 1Molecular Biology Laboratory, Department of Genetics and Plant Breeding, SVP University of Agriculture and ... Basmati and non-Basmati rice adapted to different agro- ecological ..... acid soils in southern New South Wales?

  2. Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe. (United States)

    Ahonsi, Monday O; Ling, Yin; Kageyama, Koji


    Phytophthora nicotianae and Pythium helicoides are important water-borne oomycete pathogens of irrigated ornamentals particularly ebb-and-flow irrigated kalanchoe in Japan. We developed novel PCR-based sequence characterized amplified region markers and assays for rapid identification and species-specific detection of both pathogens in separate PCR reactions or simultaneously in a duplex PCR.

  3. Usefulness of molecular markers in the diagnosis of occupational and recreational histoplasmosis outbreaks. (United States)

    Frías-De-León, María Guadalupe; Ramírez-Bárcenas, José Antonio; Rodríguez-Arellanes, Gabriela; Velasco-Castrejón, Oscar; Taylor, Maria Lucia; Reyes-Montes, María Del Rocío


    Histoplasmosis is considered the most important systemic mycosis in Mexico, and its diagnosis requires fast and reliable methodologies. The present study evaluated the usefulness of PCR using Hcp100 and 1281-1283 (220) molecular markers in detecting Histoplasma capsulatum in occupational and recreational outbreaks. Seven clinical serum samples of infected individuals from three different histoplasmosis outbreaks were processed by enzyme-linked immunosorbent assay (ELISA) to titre anti-H. capsulatum antibodies and to extract DNA. Fourteen environmental samples were also processed for H. capsulatum isolation and DNA extraction. Both clinical and environmental DNA samples were analysed by PCR with Hcp100 and 1281-1283 (220) markers. Antibodies to H. capsulatum were detected by ELISA in all serum samples using specific antigens, and in six of these samples, the PCR products of both molecular markers were amplified. Four environmental samples amplified one of the two markers, but only one sample amplified both markers and an isolate of H. capsulatum was cultured from this sample. All PCR products were sequenced, and the sequences for each marker were analysed using the Basic Local Alignment Search Tool (BLASTn), which revealed 95-98 and 98-100 % similarities with the reference sequences deposited in the GenBank for Hcp100 and 1281-1283 (220) , respectively. Both molecular markers proved to be useful in studying histoplasmosis outbreaks because they are matched for pathogen detection in either clinical or environmental samples.

  4. Segmental distribution of some common molecular markers for colorectal cancer (CRC): influencing factors and potential implications. (United States)

    Papagiorgis, Petros Christakis


    Proximal and distal colorectal cancers (CRCs) are regarded as distinct disease entities, evolving through different genetic pathways and showing multiple clinicopathological and molecular differences. Segmental distribution of some common markers (e.g., KRAS, EGFR, Ki-67, Bcl-2, COX-2) is clinically important, potentially affecting their prognostic or predictive value. However, this distribution is influenced by a variety of factors such as the anatomical overlap of tumorigenic molecular events, associations of some markers with other clinicopathological features (stage and/or grade), and wide methodological variability in markers' assessment. All these factors represent principal influences followed by intratumoral heterogeneity and geographic variation in the frequency of detection of particular markers, whereas the role of other potential influences (e.g., pre-adjuvant treatment, interaction between markers) remains rather unclear. Better understanding and elucidation of the various influences may provide a more accurate picture of the segmental distribution of molecular markers in CRC, potentially allowing the application of a novel patient stratification for treatment, based on particular molecular profiles in combination with tumor location.

  5. A Preliminary Study on the Pattern, the Physiological Bases and the Molecular Mechanism of the Adductor Muscle Scar Pigmentation in Pacific Oyster Crassostrea gigas

    Directory of Open Access Journals (Sweden)

    Wenchao Yu


    Full Text Available The melanin pigmentation of the adductor muscle scar and the outer surface of the shell are among attractive features and their pigmentation patterns and mechanism still remains unknown in the Pacific oyster Crassostrea gigas. To study these pigmentation patterns, the colors of the adductor muscle scar vs. the outer surface of the shell on the same side were compared. No relevance was found between the colors of the adductor muscle scars and the corresponding outer surface of the shells, suggesting that their pigmentation processes were independent. Interestingly, a relationship between the color of the adductor muscle scars and the dried soft-body weight of Pacific oysters was found, which could be explained by the high hydroxyl free radical scavenging capacity of the muscle attached to the black adductor muscle scar. After the transcriptomes of pigmented and unpigmented adductor muscles and mantles were studied by RNAseq and compared, it was found that the retinol metabolism pathway were likely to be involved in melanin deposition on the adductor muscle scar and the outer surface of the shell, and that the different members of the tyrosinase or Cytochrome P450 gene families could play a role in the independent pigmentation of different organs.

  6. Molecular markers for detection of resistance to chemotherapy

    International Nuclear Information System (INIS)

    Auner, V.


    Objectives: The scope of this thesis was to select new biomarkers for the response to standard chemotherapies and new targeted therapies in ovarian cancer. Furthermore the utility of new platforms for the routine testing of biomarkers on RNA and DNA level was evaluated. Such markers are especially interesting for ovarian cancer as after initial good response to chemotherapy most tumors acquire multiple drug resistance (MDR). Material and Methods: Mutational status of KRAS was determined in fresh frozen and formalin fixed paraffin embedded (FFPE) ovarian tissue samples. The experiments were conducted on two different platforms, Gastoxin, a micro array system, and a reverse hybridisation strip assay. Gene expression of nine ATP-binding cassette (ABC) transporters were analysed in recurrent ovarian cancer samples and benign tissue with real-time Pcr. Transporters exhibiting a significant overexpression in recurrent disease were further evaluated in primary cancer tissue. Furthermore real-time Pcr results were validated with two novel platforms. Results: In 15% of ovarian carcinoma samples KRAS was mutated. Mutation rates in fresh and FFPE tissue were approximately the same which leads to the conclusion that both assays are able to process these types of tissue. Four of the ABC transporters were significantly higher expressed in recurrent cancer tissue. Primary lesions compared to benign tissue showed no mentionable differences in gene expression. Therefore the examined transporters are not feasible as prognostic markers but some seem to play a role in MDR of ovarian cancer. Regarding the two tested platforms, the Quantitating 2.0 Reagent System was found to be an adequate alternative to real-time Pcr. For the Approve-B platform the first optimization experiments were promising, further development is currently ongoing. Conclusion: Mutation of KRAS is no prognostic marker for patients under standard therapy, but in the light of the new anti-EGF R therapies, which are

  7. Micro RNAs as molecular markers of glioblastoma multiform

    Energy Technology Data Exchange (ETDEWEB)

    Farace, M G [Department Experimental Medicine and Biochemical Sciences, University of Tor Vergata, Rome (Italy); Finocchiaro, G [Istituto Neurologico Besta, Milan (Italy); Ricci Vitiani, L [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanita, Rome (Italy)


    The aim of this project was to unravel the role that miR-221 and miR-222, of which we had already demonstrated the specific differential expression in glioblastoma multiforme compared to normal brain, play in the control of cell proliferation, with the ultimate goal to provide new insights in the molecular basis of cancer. The results of our research allowed to identify an important molecular target for miRNA-221 and miR-222, highly expressed in glioblastoma multiforme tissues and cell lines, and to precisely recognize the mRNA regions responsible for this regulation.

  8. Micro RNAs as molecular markers of glioblastoma multiform

    International Nuclear Information System (INIS)

    Farace, M.G.; Finocchiaro, G.; Ricci Vitiani, L.


    The aim of this project was to unravel the role that miR-221 and miR-222, of which we had already demonstrated the specific differential expression in glioblastoma multiforme compared to normal brain, play in the control of cell proliferation, with the ultimate goal to provide new insights in the molecular basis of cancer. The results of our research allowed to identify an important molecular target for miRNA-221 and miR-222, highly expressed in glioblastoma multiforme tissues and cell lines, and to precisely recognize the mRNA regions responsible for this regulation

  9. An assessment of the use of molecular markers in developing countries

    International Nuclear Information System (INIS)

    Sonnino, A.; Carena, M.J.; Guimaraes, E.P.; Baumung, R.; Pilling, D.; Rischkowsky, B.


    Four different sources of information were analysed to assess the current uses of molecular markers in crops, forest trees and livestock in developing countries: the FAO Biotechnology in Developing Countries (FAO-BioDeC) database of biotechnology in developing countries; country reports evaluating the current status of applied plant breeding and related biotechnologies; country reports on animal genetic resources management for preparing the First Report on the State of the World's Animal Genetic Resources (SoW-AnGR); and the results of a questionnaire survey on animal genetic diversity studies. Even if still largely incomplete, the current data show that molecular markers are widely used for plant breeding in the developing world and most probably their use will increase in the future. In the animal sector the use of molecular markers seems less developed and limited or absent in most developing countries. Major differences exist among and within regions regarding the application of molecular marker techniques in plant and animal breeding and genetics. These can be explained by the relatively high investments in infrastructure and human resources necessary to undertake research in these fields. The spectrum of application of molecular markers in crop plants is quite wide, covering many plants relevant to the enhancement of food security, but other important plant species are still neglected. The practical results of marker-assisted selection (MAS) in the field are disappointingly modest, possibly due to: low levels of investment; limited coordination between biotechnologists and practical breeders; instable, non-focused or ill-addressed research projects; and the lack of linkages between research and farmers. Partnerships between developed and developing countries may be a means of better realizing the potential of molecular marker techniques for improving both animal and crop production. (author)

  10. Identificação de marcas moleculares associadas à ausência de sementes em videira Identification of molecular markers associated to the absence of seeds in grapevine

    Directory of Open Access Journals (Sweden)

    Ana Veruska Cruz da Silva


    Full Text Available A ausência de sementes tem sido uma característica bastante exigida pelos consumidores de uvas de mesa. O objetivo deste trabalho foi identificar marcas moleculares associadas à ausência de sementes, utilizando as técnicas RAPD e fAFLP. Foram utilizadas folhas jovens de 19 cultivares. Na análise RAPD 30, iniciadores possibilitaram amplificação de todas as amostras, produzindo 392 bandas polimórficas. Foi possível encontrar uma marca específica para a ausência de sementes, utilizando o iniciador UBC 443, que poderá futuramente ser utilizado para o desenvolvimento de marcadores SCAR, possibilitando a criação de um teste de identificação rápida e precoce de apirenia em videira. A análise fAFLP proporcionou a visualização de um dendrograma com grupos específicos de cultivares com sementes, sem sementes e porta enxertos.Seedless has been an important characteristic of table grapes required by consumers. The objective was to identify molecular markers associated to seedless, by RAPD and fAFLP techniques with young leaves samples of 19 cultivars. Thirty primers were used for RAPD analysis, producing a total of 337 polymorphic bands. It was also to find a specific mark for seedless, using UBC 443 primer. This mark would be transformed in a scar marker, making possible the early identification of seedless grape possible. The fAFLP analysis provided a visualization of a dendrogram with specific groups, separated in three different cultivars: with seeds, without seeds and the rootstocks.

  11. Molecular markers to study competition and diversity of Rhizobium

    NARCIS (Netherlands)

    Sessitsch, A.


    The research described in this thesis was directed to the development of molecular identification and detection techniques for studying the ecology of Rhizobium, a nitrogen- fixing bacterium of agricultural importance. Competition of inoculant strains with indigenous

  12. A graph-clustering approach to search important molecular markers ...

    African Journals Online (AJOL)

    Here, we performed a comprehensive gene level assessment of Parkinson's disease using 16 colorectal cancer samples and nine normal samples. The results show that SLC6A3, SLC18A2, and EN1, etc., are related to Parkinson's disease. Besides, we further mined the underlying molecular mechanism within these ...

  13. LTR-retrotransposons-based molecular markers in cultivated ...

    African Journals Online (AJOL)



    Jul 3, 2006 ... LTR-retrotransposons represent a standard component of the Gossypium Genome (Zaki and Abdel Ghany,. 2003). The analysis of the molecular existence and distribution of ancient and active LTR-retrotransposons, therefore, provides a comprehensive evaluation of the evolutionary history of Gossypium.

  14. Molecular marker-assisted selection for resistance to pathogens in tomato

    International Nuclear Information System (INIS)

    Barone, A.; Frusciante, L.


    Since the 1980s, the use of molecular markers has been suggested to improve the efficiency of releasing resistant varieties, thus overcoming difficulties met with classical breeding. For tomato, a high-density molecular map is available in which more than 40 resistance genes are localized. Markers linked to these genes can be used to speed up gene transfer and pyramiding. Suitable PCR markers targeting resistance genes were constructed directly on the sequences of resistance genes or on restriction fragment length polymorphisms (RFLPs) tightly linked to them, and used to select resistant genotypes in backcross schemes. In some cases, the BC 5 generation was reached, and genotypes that cumulated two homozygous resistant genes were also obtained. These results supported the feasibility of using marker-assisted selection (MAS) in tomato and reinforcing the potential of this approach for other genes, which is today also driven by the development of new techniques and increasing knowledge about the tomato genome. (author)

  15. [Physical therapy for scars]. (United States)

    Masanovic, Marguerite Guillot


    Physical therapy consists notably of hand or mechanical massages, pressure therapy using various fabrics or splints, cryotherapy, laser therapy, etc. It forms part of the range of therapies used to treat pathological scars, including medical and surgical treatment. While the results are often satisfactory for hypertrophic scars, they remain uncertain for major keloids.

  16. Characterization of some bread wheat genotypes using molecular markers for drought tolerance. (United States)

    Ateş Sönmezoğlu, Özlem; Terzi, Begüm


    Because of its wide geographical adaptation and importance in human nutrition, wheat is one of the most important crops in the world. However, wheat yield has reduced due to drought stress posing threat to sustainability and world food security in agricultural production. The first stage of drought tolerant variety breeding occurs on the molecular and biochemical characterization and classification of wheat genotypes. The aim of the present study is characterization of widely grown bread wheat cultivars and breeding lines for drought tolerance so as to be adapted to different regions in Turkey. The genotypes were screened with molecular markers for the presence of QTLs mapped to different chromosomes. Results of the molecular studies identified and detected 15 polymorphic SSR markers which gave the clearest PCR bands among the control genotypes. At the end of the research, bread wheat genotypes which were classified for tolerance or sensitivity to drought and the genetic similarity within control varieties were determined by molecular markers. According to SSR based dendrogram, two main groups were obtained for drought tolerance. At end of the molecular screening with SSR primers, genetic similarity coefficients were obtained that ranged from 0.14 to 0.71. The ones numbered 8 and 11 were the closest genotypes to drought tolerant cultivar Gerek 79 and the furthest genotypes from this cultivar were number 16 and to drought sensitive cultivar Sultan 95. The genotypes as drought tolerance due to their SSR markers scores are expected to provide useful information for drought related molecular breeding studies.

  17. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts


    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  18. Molecular performance of commercial MTG variety oil palm based on RAPD markers (United States)

    Putri, L. A. P.; Setyo, I. E.; Basyuni, M.; Bayu, E. S.; Setiado, H.; Reynaldi, N. F.; Laia, H.; Puteri, S. A. K.; Arifiyanto, D.; Syahputra, I.


    The oil palm, an economically important tree in Indonesia, has been one of the world’s major sources of edible oil and a significant precursor of biodiesel fuel. This research is conducted by taking individual tree sample of commercial MTG variety germplasm oil palm one years old. The purpose of this research is to analyse molecular performance of some oil palm MTG variety based on RAPD markers. In this experiment, the DNA profile diversity was assessed using markers of oil palm’s random RAPD markers (OPD-20, SB-19, OPM-01 and OPO-11). A total of 15 trees commercial MTG oil palm variety were used for analysis. The results of the experiment indicated out of 4 RAPD markers (OPD-20, SB-19, OPM-01 and OPO-11) showed polymorphic of PCR product. These preliminary results demonstrated RAPD marker can be used to evaluate genetic relatedness among trees of commercial MTG variety oil palm and detecting either genetic variants or mislabelled.

  19. Development and Molecular Characterization of Novel Polymorphic Genomic DNA SSR Markers in Lentinula edodes. (United States)

    Moon, Suyun; Lee, Hwa-Yong; Shim, Donghwan; Kim, Myungkil; Ka, Kang-Hyeon; Ryoo, Rhim; Ko, Han-Gyu; Koo, Chang-Duck; Chung, Jong-Wook; Ryu, Hojin


    Sixteen genomic DNA simple sequence repeat (SSR) markers of Lentinula edodes were developed from 205 SSR motifs present in 46.1-Mb long L. edodes genome sequences. The number of alleles ranged from 3-14 and the major allele frequency was distributed from 0.17-0.96. The values of observed and expected heterozygosity ranged from 0.00-0.76 and 0.07-0.90, respectively. The polymorphic information content value ranged from 0.07-0.89. A dendrogram, based on 16 SSR markers clustered by the paired hierarchical clustering' method, showed that 33 shiitake cultivars could be divided into three major groups and successfully identified. These SSR markers will contribute to the efficient breeding of this species by providing diversity in shiitake varieties. Furthermore, the genomic information covered by the markers can provide a valuable resource for genetic linkage map construction, molecular mapping, and marker-assisted selection in the shiitake mushroom.

  20. Facial Scar Revision: Understanding Facial Scar Treatment (United States)

    ... keep the head elevated when lying down, to use cold compresses to reduce swelling, and to avoid any activity that places undue stress on the area of the incision. Depending on the surgery performed and the site of the scar, the facial plastic surgeon will explain the types of activities to ...

  1. Markers (United States)

    Healthy Schools Network, Inc., 2011


    Dry erase whiteboards come with toxic dry erase markers and toxic cleaning products. Dry erase markers labeled "nontoxic" are not free of toxic chemicals and can cause health problems. Children are especially vulnerable to environmental health hazards; moreover, schools commonly have problems with indoor air pollution, as they are more densely…

  2. Molecular profiling identifies prognostic markers of stage IA lung adenocarcinoma. (United States)

    Zhang, Jie; Shao, Jinchen; Zhu, Lei; Zhao, Ruiying; Xing, Jie; Wang, Jun; Guo, Xiaohui; Tu, Shichun; Han, Baohui; Yu, Keke


    We previously showed that different pathologic subtypes were associated with different prognostic values in patients with stage IA lung adenocarcinoma (AC). We hypothesize that differential gene expression profiles of different subtypes may be valuable factors for prognosis in stage IA lung adenocarcinoma. We performed microarray gene expression profiling on tumor tissues micro-dissected from patients with acinar and solid predominant subtypes of stage IA lung adenocarcinoma. These patients had undergone a lobectomy and mediastinal lymph node dissection at the Shanghai Chest Hospital, Shanghai, China in 2012. No patient had preoperative treatment. We performed the Gene Set Enrichment Analysis (GSEA) analysis to look for gene expression signatures associated with tumor subtypes. The histologic subtypes of all patients were classified according to the 2015 WHO lung Adenocarcinoma classification. We found that patients with the solid predominant subtype are enriched for genes involved in RNA polymerase activity as well as inactivation of the p53 pathway. Further, we identified a list of genes that may serve as prognostic markers for stage IA lung adenocarcinoma. Validation in the TCGA database shows that these genes are correlated with survival, suggesting that they are novel prognostic factors for stage IA lung adenocarcinoma. In conclusion, we have uncovered novel prognostic factors for stage IA lung adenocarcinoma using gene expression profiling in combination with histopathology subtyping.

  3. Molecular markers for tumor cell dissemination in female cancers

    International Nuclear Information System (INIS)

    Obermayr, E.


    In the fight against cancer many advances have been made in early detection and treatment of the disease during the last few decades. Nevertheless, many patients still die of cancer due to metastatic spreading of the disease. Tumor cell dissemination may occur very early and usually is not discovered at the time of initial diagnosis. In these cases, the mere excision of the primary tumor is an insufficient treatment. Microscopic tumor residues will remain in the blood, lymph nodes, or the bone marrow and will cause disease recurrence. To improve the patient's prognosis, a sensitive tool for the detection of single tumor cells supplementing conventional diagnostic procedures is required. As the blood is more easily accessible than the bone marrow or tissue biopsies, we intended to identify gene markers for the detection of circulating tumor cells in the blood of cancer patients. We focused on patients with breast, ovarian, endometrial or cervical cancer. Starting from a genome-wide gene expression analysis of tumor cells and blood cells, we found six genes higher expression levels in cancer patients compared to healthy women. These findings suggest that an increased expression of these genes in the blood indicates the presence of circulating tumor cells inducing future metastases and thus the need for adjuvant therapy assisting the primary treatment. Measuring the expression levels of these six genes in the blood may supplement conventional diagnostic tests and improve the patient's prognosis. (author) [de

  4. Molecular tissue changes in early myocardial ischemia: from pathophysiology to the identification of new diagnostic markers. (United States)

    Aljakna, Aleksandra; Fracasso, Tony; Sabatasso, Sara


    Diagnosing early myocardial ischemia (the initial 4 to 6 h after interruption of blood flow to part of the myocardium) remains a challenge for clinical and forensic pathologists. Several immunohistochemical markers have been proposed for improving postmortem detection of early myocardial ischemia; however, no single marker appears to be both sufficiently specific as well as sensitive. This review summarizes the diverse categories of molecular tissue markers that have been investigated in human autopsy samples with acute myocardial infarction as well as in the well-established and widely used in vivo animal model of early myocardial ischemia (permanent ligation of the coronary artery). Recently identified markers appearing during the initial 2 h of myocardial ischemia are highlighted. Among them, only six were tested for specificity (C5b-9, hypoxia-inducible factor 1-alpha, vascular endothelial growth factor, heart fatty acid binding protein, connexin 43, and JunB). Despite the discovery of several potentially promising markers (in terms of early expression and specificity), many of them remain to be tested and validated for application in routine diagnostics in clinical and forensic pathology. In particular, research investigating the postmortem stability of these markers is required before any might be implemented into routine diagnostics. Establishing a standardized panel of immunohistochemical markers may be more useful for improving sensitivity and specificity than searching for a single marker.

  5. Molecular characterization of cultivated species of the genus Pachyrhizus Rich. ex DC. by AFLP markers

    DEFF Research Database (Denmark)

    Santayana, Monica; Rossel, Genoveva; Núñez, Jorge


    ) molecular markers in order to estimate genetic diversity and interspecific relationships. To complement molecular marker information, individuals from each accession were analyzed in order to confirmploidy levels. Eight AFLP primer combinations detected 136 (68.7 %) polymorphic bands. Shannon’s diversity...... indices (Hs) for each species were 1.04 (P. ahipa), 1.07 (P. tuberosus), and 2.42 (P. erosus), while the total diversity index was 2.45. Phylogenetic analysis, principal coordinate analysis and analysis of molecular variance (FST=0.796) all showed significant species differentiation. All accessions were...... diploid (2n=2x=22), which is characteristic of the tribe Phaseoleae. Finally, a misclassified accession of P. tuberosus was identified. Molecular characterization of accessions is necessary for efficient management of germplasm collections....

  6. Biomedical wellness monitoring system based upon molecular markers (United States)

    Ingram, Whitney


    We wish to assist caretakers with a sensor monitoring systems for tracking the physiological changes of homealone patients. One goal is seeking biomarkers and modern imaging sensors like stochastic optical reconstruction microscopy (STORM), which has achieved visible imaging at the nano-scale range. Imaging techniques like STORM can be combined with a fluorescent functional marker in a system to capture the early transformation signs from wellness to illness. By exploiting both microscopic knowledge of genetic pre-disposition and the macroscopic influence of epigenetic factors we hope to target these changes remotely. We adopt dual spectral infrared imaging for blind source separation (BSS) to detect angiogenesis changes and use laser speckle imaging for hypertension blood flow monitoring. Our design hypothesis for the monitoring system is guided by the user-friendly, veteran-preferred "4-Non" principles (noninvasive, non-contact, non-tethered, non-stop-to-measure) and by the NIH's "4Ps" initiatives (predictive, personalized, preemptive, and participatory). We augment the potential storage system with the recent know-how of video Compressive Sampling (CSp) from surveillance cameras. In CSp only major changes are saved, which reduces the manpower cost of caretakers and medical analysts. This CSp algorithm is based on smart associative memory (AM) matrix storage: change features and detailed scenes are written by the outer-product and read by the inner product without the usual Harsh index for image searching. From this approach, we attempt to design an effective household monitoring approach to save healthcare costs and maintain the quality of life of seniors.

  7. Efficiency of Floristic and Molecular Markers to Determine Diversity in Iranian Populations of T. boeoticum


    M. R. Naghavi; M. Maleki; S. F. Tabatabaei


    In order to study floristic and molecular classification of common wild wheat (Triticum boeoticum Boiss.), an analysis was conducted on populations of the Triticum boeoticum collected from different regions of Iran. Considering all floristic compositions of habitats, six floristic groups (syntaxa) within the populations were identified. A high level of variation of T. boeoticum also detected using SSR markers. Our results showed that molecular method confirmed the groupin...

  8. Molecular phylogeny of elasmobranchs inferred from mitochondrial and nuclear markers. (United States)

    Pavan-Kumar, A; Gireesh-Babu, P; Babu, P P Suresh; Jaiswar, A K; Hari Krishna, V; Prasasd, K Pani; Chaudhari, Aparna; Raje, S G; Chakraborty, S K; Krishna, Gopal; Lakra, W S


    The elasmobranchs (sharks, rays and skates) being the extant survivors of one of the earliest offshoots of the vertebrate evolutionary tree are good model organisms to study the primitive vertebrate conditions. They play a significant role in maintaining the ecological balance and have high economic value. Due to over-exploitation and illegal fishing worldwide, the elasmobranch stocks are being decimated at an alarming rate. Appropriate management measures are necessary for restoring depleted elasmobranch stocks. One approach for restoring stocks is implementation of conservation measures and these measures can be formulated effectively by knowing the evolutionary relationship among the elasmobranchs. In this study, a total of 30 species were chosen for molecular phylogeny studies using mitochondrial cytochrome c oxidase subunit I, 12S ribosomal RNA gene and nuclear Internal Transcribed Spacer 2. Among different genes, the combined dataset of COI and 12S rRNA resulted in a well resolved tree topology with significant bootstrap/posterior probabilities values. The results supported the reciprocal monophyly of sharks and batoids. Within Galeomorphii, Heterodontiformes (bullhead sharks) formed as a sister group to Lamniformes (mackerel sharks): Orectolobiformes (carpet sharks) and to Carcharhiniformes (ground sharks). Within batoids, the Myliobatiformes formed a monophyly group while Pristiformes (sawfishes) and Rhinobatiformes (guitar fishes) formed a sister group to all other batoids.

  9. Effect of lifelong football training on the expression of muscle molecular markers involved in healthy longevity

    DEFF Research Database (Denmark)

    Mancini, A; Vitucci, D; Labruna, G


    PURPOSE: We investigated whether lifelong football training affects the expression of healthy longevity-related muscle molecular markers. METHODS: Biopsies were collected from the vastus lateralis muscle of 10 lifelong football-trained men (68.2 ± 3.0 years) and of 10 active untrained healthy men...... the expression of key markers involved in muscle oxidative metabolism, and in the DNA repair and senescence suppression pathways, thus providing the molecular basis for healthy longevity....... (66.7 ± 1.3 years). Gene and protein expression was measured by RTqPCR on RNA and by western blotting on protein extracts from muscle biopsies, respectively. RESULTS: The expression of AMPKα1/α2, NAMPT, TFAM and PGC1α, which are markers of oxidative metabolism, and MyHC β isoform expression was higher...

  10. Genetic studies and a search for molecular markers that are linked ...

    African Journals Online (AJOL)

    Molecular markers that are linked to witchweed resistance can expedite the development of resistant cultivars through adoption of appropriate markerassisted selection (MAS) strategies. The objectives of this investigation were to study the inheritance or low germination stimulant (lgs) production in cultivar SAR 29 and to ...

  11. An Educational Software for Simulating the Sample Size of Molecular Marker Experiments (United States)

    Helms, T. C.; Doetkott, C.


    We developed educational software to show graduate students how to plan molecular marker experiments. These computer simulations give the students feedback on the precision of their experiments. The objective of the software was to show students using a hands-on approach how: (1) environmental variation influences the range of the estimates of the…

  12. [Molecular markers: an important tool in the diagnosis, treatment and epidemiology of invasive aspergillosis]. (United States)

    Frías-de León, María Guadalupe; Acosta-Altamirano, Gustavo; Duarte-Escalante, Esperanza; Martínez-Hernández, José Enrique; Martínez-Rivera, María de Los Ángeles; Reyes-Montes, María Del Rocío


    Increase in the incidence of invasive aspergillosis has represented a difficult problem for management of patients with this infection due to its high rate of mortality, limited knowledge concerning its diagnosis, and therapeutic practice. The difficulty in management of patients with aspergillosis initiates with detection of the fungus in the specimens of immunosuppressed patients infected with Aspergillus fumigatus; in addition, difficulty exists in terms of the development of resistance to antifungals as a consequence of their indiscriminate use in prophylactic and therapeutic practice and to ignorance concerning the epidemiological data of aspergillosis. With the aim of resolving these problems, molecular markers is employed at present with specific and accurate results. However, in Mexico, the use of molecular markers has not yet been implemented in the routine of intrahospital laboratories; despite the fact that these molecular markers has been widely referred in the literature, it is necessary for it to validated and standardized to ensure that the results obtained in any laboratory would be reliable and comparable. In the present review, we present an update on the usefulness of molecular markers in accurate identification of A. fumigatus, detection of resistance to antifugal triazoles, and epidemiological studies for establishing the necessary measures for prevention and control of aspergillosis.

  13. Improving a Lecture-Size Molecular Model Set by Repurposing Used Whiteboard Markers (United States)

    Dragojlovic, Veljko


    Preparation of an inexpensive model set from whiteboard markers and either HGS molecular model set or atoms made of wood is described. The model set is relatively easy to prepare and is sufficiently large to be suitable as an instructor set for use in lectures.


    Directory of Open Access Journals (Sweden)

    A. A. Zabolotneva


    Full Text Available Bladder cancer (BC is the second most common urinary tract malignancy. Early diagnosis of BC generally increases the probability of successful treatment in a patient. The paper considers noninvasive diagnosis methods for BC and gives a database of the known molecular markers of this disease.

  15. Molecular genetic diversity of Punica granatum L. (pomegranate) as revealed by microsatellite DNA markers (United States)

    Pomegranate (Punica granatum L.) is one of the oldest known edible fruits and more and more it arouse interest of scientific community given its numerous biological activities. However, information about its genetic resources and characterization using reliable molecular markers are still scarce. In...

  16. A general mixture model for mapping quantitative trait loci by using molecular markers

    NARCIS (Netherlands)

    Jansen, R.C.


    In a segregating population a quantitative trait may be considered to follow a mixture of (normal) distributions, the mixing proportions being based on Mendelian segregation rules. A general and flexible mixture model is proposed for mapping quantitative trait loci (QTLs) by using molecular markers.

  17. A novel molecular marker for the study of Neotropical cichlid phylogeny. (United States)

    Fabrin, T M C; Gasques, L S; Prioli, S M A P; Prioli, A J


    The use of molecular markers has contributed to phylogeny and to the reconstruction of species' evolutionary history. Each region of the genome has different evolution rates, which may or may not identify phylogenetic signal at different levels. Therefore, it is important to assess new molecular markers that can be used for phylogenetic reconstruction. Regions that may be associated with species characteristics and are subject to selective pressure, such as opsin genes, which encode proteins related to the visual system and are widely expressed by Cichlidae family members, are interesting. Our aim was to identify a new nuclear molecular marker that could establish the phylogeny of Neotropical cichlids and is potentially correlated with the visual system. We used Bayesian inference and maximum likelihood analysis to support the use of the nuclear opsin LWS gene in the phylogeny of eight Neotropical cichlid species. Their use concatenated to the mitochondrial gene COI was also tested. The LWS gene fragment comprised the exon 2-4 region, including the introns. The LWS gene provided good support for both analyses up to the genus level, distinguishing the studied species, and when concatenated to the COI gene, there was a good support up to the species level. Another benefit of utilizing this region, is that some polymorphisms are associated with changes in spectral properties of the LWS opsin protein, which constitutes the visual pigment that absorbs red light. Thus, utilization of this gene as a molecular marker to study the phylogeny of Neotropical cichlids is promising.

  18. Molecular characterization and identification of markers for toxic and non-toxic varieties of Jatropha curcas L. using RAPD, AFLP and SSR markers. (United States)

    Sudheer Pamidimarri, D V N; Singh, Sweta; Mastan, Shaik G; Patel, Jalpa; Reddy, Muppala P


    Jatropha curcas L., a multipurpose shrub has acquired significant economic importance for its seed oil which can be converted to biodiesel, is emerging as an alternative to petro-diesel. The deoiled seed cake remains after oil extraction is toxic and cannot be used as a feed despite having best nutritional contents. No quantitative and qualitative differences were observed between toxic and non-toxic varieties of J. curcas except for phorbol esters content. Development of molecular marker will enable to differentiate non-toxic from toxic variety in a mixed population and also help in improvement of the species through marker assisted breeding programs. The present investigation was undertaken to characterize the toxic and non-toxic varieties at molecular level and to develop PCR based molecular markers for distinguishing non-toxic from toxic or vice versa. The polymorphic markers were successfully identified specific to non-toxic and toxic variety using RAPD and AFLP techniques. Totally 371 RAPD, 1,442 AFLP markers were analyzed and 56 (15.09%) RAPD, 238 (16.49%) AFLP markers were found specific to either of the varieties. Genetic similarity between non-toxic and toxic verity was found to be 0.92 by RAPD and 0.90 by AFLP fingerprinting. In the present study out of 12 microsatellite markers analyzed, seven markers were found polymorphic. Among these seven, jcms21 showed homozygous allele in the toxic variety. The study demonstrated that both RAPD and AFLP techniques were equally competitive in identifying polymorphic markers and differentiating both the varieties of J. curcas. Polymorphism of SSR markers prevailed between the varieties of J. curcas. These RAPD and AFLP identified markers will help in selective cultivation of specific variety and along with SSRs these markers can be exploited for further improvement of the species through breeding and Marker Assisted Selection (MAS).

  19. Keloids and Hypertrophic Scars (United States)

    ... to the skin both skin cells and connective tissue cells (fibroblasts) begin multiplying to repair the damage. A scar is made up of 'connective tissue', gristle-like fibers deposited in the skin by ...

  20. Radiation scars on mammograms

    International Nuclear Information System (INIS)

    Otto, H.; Breining, H.; Knappschafts-Krankenhaus Essen


    Six patients with radiation scars are described. In each case the diagnosis was confirmed histologically in five cases corresponding mammograms were available. The histological appearances of radiation scars are described and the radiological features are presented. These lesions can be diagnosed mammographically in vivo. Macroscopically differentiation from a scirrhous carcinoma is not possible and therefore a radiation scar must always be excised; this also leads to definitive cure. On mammographic screening the incidence is 0.5 to 0.9 per thousand. The significance of radiation scars depends on the fact that they are pre-cancerous and therefore are equivalent to the early diagnosis of a carcinoma with the possibility of a complete cure. (orig.) [de


    Nikiforov, Yuri E


    To describe the evolution and clinical utility of molecular testing for thyroid nodules and cancer achieved over the last 2 decades. Scientific reports on thyroid cancer genetics and molecular diagnostics in thyroid nodules. Over the last 2 decades, our understanding of the genetic mechanisms of thyroid cancer has dramatically expanded, such that most thyroid cancers now have known gene driver events. This knowledge provides the basis for establishing and further improving molecular tests for thyroid nodules and cancer and for the introduction of new entities such as noninvasive follicular thyroid neoplasm with papillary-like nuclear features. The progress with molecular tests for thyroid nodules started in the 1990s from demonstrating feasibility of detecting various molecular alterations in fine-needle aspiration (FNA) material collected from thyroid nodules. It was followed by the introduction of the first single-gene mutational markers, such as BRAF, and a small mutational panel into clinical practice in the mid 2000s. Currently, several more advanced molecular tests are available for clinical use. They are based on multiple molecular markers and have increasing impact on the clinical management of patients with thyroid nodules. The evolution of molecular tests for thyroid nodules followed the discovery of various diagnostic and prognostic molecular markers of thyroid cancer that can be applied to thyroid FNA samples to inform more individualized management of these patients. FNA = fine-needle aspiration miRNA = micro RNA NGS = next-generation sequencing NIFTP = noninvasive follicular thyroid neoplasm with papillary-like nuclear features NPV = negative predictive value PPV = positive predictive value PTC = papillary thyroid carcinoma RAI = radioactive iodine.

  2. Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

    Directory of Open Access Journals (Sweden)

    Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN


    Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

  3. Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

    Directory of Open Access Journals (Sweden)

    Waqas Malik


    Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

  4. Review: Biological and Molecular Differences between Tail Regeneration and Limb Scarring in Lizard: An Inspiring Model Addressing Limb Regeneration in Amniotes. (United States)

    Alibardi, Lorenzo


    Tissue regeneration in lizards represents a unique model of regeneration and scarring in amniotes. The tail and limb contain putative stem cells but also dedifferentiating cells contribute to regeneration. Following tail amputation, inflammation is low and cell proliferation high, leading to regeneration while the intense inflammation in the limb leads to low proliferation and scarring. FGFs stimulate tail and limb regeneration and are present in the wound epidermis and blastema while they disappear in the limb wound epidermis 2-3 weeks postamputation in the scarring outgrowth. FGFs localize in the tail blastema and the apical epidermal peg (AEP), an epidermal microregion that allows tail growth but is absent in the limb. Inflammatory cells invade the limb blastema and wound epidermis, impeding the formation of an AEP. An embryonic program of growth is activated in the tail, dominated by Wnt-positive and -negative regulators of cell proliferation and noncoding RNAs, that represent the key regenerative genes. The balanced actions of these regulators likely impede the formation of a tumor in the tail tip. Genes for FACIT and fibrillar collagens, protease inhibitors, and embryonic keratins are upregulated in the regenerating tail blastema. A strong downregulation of genes for both B and T-lymphocyte activation suggests the regenerating tail blastema is a temporal immune-tolerated organ, whereas a scarring program is activated in the limb. Wnt inhibitors, pro-inflammatory genes, negative regulators of cell proliferation, downregulation of myogenic genes, proteases, and oxidases favoring scarring are upregulated. The evolution of an efficient immune system may be the main limiting barrier for organ regeneration in amniotes, and the poor regeneration of mammals and birds is associated with the efficiency of their mature immune system. This does not tolerate embryonic antigens formed in reprogrammed embryonic cells (as for neoplastic cells) that are consequently

  5. Reconciling patterns of inter-ocean molecular variance from four classes of molecular markers in blue marlin (Makaira nigricans). (United States)

    Buonaccorsi, V P; McDowell, J R; Graves, J E


    Different classes of molecular markers occasionally yield discordant views of population structure within a species. Here, we examine the distribution of molecular variance from 14 polymorphic loci comprising four classes of molecular markers within approximately 400 blue marlin individuals (Makaira nigricans). Samples were collected from the Atlantic and Pacific Oceans over 5 years. Data from five hypervariable tetranucleotide microsatellite loci and restriction fragment length polymorphism (RFLP) analysis of whole molecule mitochondrial DNA (mtDNA) were reported and compared with previous analyses of allozyme and single-copy nuclear DNA (scnDNA) loci. Temporal variance in allele frequencies was nonsignificant in nearly all cases. Mitochondrial and microsatellite loci revealed striking phylogeographic partitioning among Atlantic and Pacific Ocean samples. A large cluster of alleles was present almost exclusively in Atlantic individuals at one microsatellite locus and for mtDNA, suggesting that, if gene flow occurs, it is likely to be unidirectional from Pacific to Atlantic oceans. Mitochondrial DNA inter-ocean divergence (FST) was almost four times greater than microsatellite or combined nuclear divergences including allozyme and scnDNA markers. Estimates of Neu varied by five orders of magnitude among marker classes. Using mathematical and computer simulation approaches, we show that substantially different distributions of FST are expected from marker classes that differ in mode of inheritance and rate of mutation, without influence of natural selection or sex-biased dispersal. Furthermore, divergent FST values can be reconciled by quantifying the balance between genetic drift, mutation and migration. These results illustrate the usefulness of a mitochondrial analysis of population history, and relative precision of nuclear estimates of gene flow based on a mean of several loci.

  6. Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Catur Herison


    Full Text Available Genetic diversity is the most important aspect in tomato breeding activities. Better assessment on the diversity of the collected accessions will come up with better result of the cultivar development. This study aimed at analyzing the genetic diversity of 27 tomato accessions by morphological and molecular markers. Twenty seven accessions collected from various regions of Indonesia were planted in the field and evaluated for their morphological traits, and RAPD analyzed for their molecular markers. The UPGMA clustering analyzes, elaborating the combination of morphological and molecular data, indicated that the tomato accessions could be grouped into 5 major groups with 70 % genetic similarity levels. Current study indicated that although many accessions came from different locations, they congregated into the same group. Cherry, Kudamati 1 and Lombok 3 were the farthest genetic distant accessions to the others. Those three genotypes will be the most valuable accessions, when they were crossed with other accessions, for designing a prospective breeding program in the future.

  7. Cerebrospinal fluid tau levels are a marker for molecular subtype in sporadic Creutzfeldt-Jakob disease. (United States)

    Karch, André; Hermann, Peter; Ponto, Claudia; Schmitz, Matthias; Arora, Amandeep; Zafar, Saima; Llorens, Franc; Müller-Heine, Annika; Zerr, Inga


    The molecular subtype of sporadic Creutzfeldt-Jakob disease (sCJD) is an important prognostic marker for patient survival. However, subtype determination is not possible during lifetime. Because the rate of disease progression is associated with the molecular subtype, this study aimed at investigating if total tau, a marker of neuronal death, allows premortem diagnosis of molecular subtype when codon 129 genotype is known. Two hundred ninety-six sCJD patients were tested for their cerebrospinal fluid total tau level at the time of diagnosis and were investigated for their sCJD subtype postmortem. There was a significant association between tau levels and the prion protein type in patients with codon 129 MM (p disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains]. (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Molecular markers to assess genetic diversity and mutant identifications in Jatropha curcas

    International Nuclear Information System (INIS)

    Azhar Mohamad; Yie Min Kwan; Fatin Mastura Derani; Abdul Rahim Harun


    Jatropha curcas (Linnaeus) belongs to the Euphorbiaceae family, is a multipurpose use, drought resistant and perennial plant. It is an economic important crop, which generates wide interest in understanding the genetic diversity of the species towards selection and breeding of superior genotypes. Jatropha accessions are closely related family species. Thus, better understanding of the effectiveness of the different DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of marker techniques in breeding programs. Inter-simple sequence repeats (ISSRs) has shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. These markers were used to understand diversity and differentiate amongst accessions of Jatropha population and mutant lines generated by acute gamma radiation. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of bio-diesel production and medication substances. A total of 62 ISSR primers were optimized for polymorphism evaluations on five foreign accessions (Africa, India, Myanmar, Indonesia, Thailand), nine local accessions and two mutants of Jatropha. Optimization was resulted 54 ISSR primers affirmative for the polymorphism evaluation study, which encountered 12 ISSR primers, showed significance polymorphism amongst the accessions and mutants. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Jatropha from accession to generated mutant varieties. (author)

  10. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini


    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  11. Cytogenetic and molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background. (United States)

    Gong, Wenping; Li, Guangrong; Zhou, Jianping; Li, Genying; Liu, Cheng; Huang, Chengyan; Zhao, Zhendong; Yang, Zujun


    Aegilops uniaristata has many agronomically useful traits that can be used for wheat breeding. So far, a Triticum turgidum - Ae. uniaristata amphiploid and one set of Chinese Spring (CS) - Ae. uniaristata addition lines have been produced. To guide Ae. uniaristata chromatin transformation from these lines into cultivated wheat through chromosome engineering, reliable cytogenetic and molecular markers specific for Ae. uniaristata chromosomes need to be developed. Standard C-banding shows that C-bands mainly exist in the centromeric regions of Ae. uniaristata but rarely at the distal ends. Fluorescence in situ hybridization (FISH) using (GAA)8 as a probe showed that the hybridization signal of chromosomes 1N-7N are different, thus (GAA)8 can be used to identify all Ae. uniaristata chromosomes in wheat background simultaneously. Moreover, a total of 42 molecular markers specific for Ae. uniaristata chromosomes were developed by screening expressed sequence tag - sequence tagged site (EST-STS), expressed sequence tag - simple sequence repeat (EST-SSR), and PCR-based landmark unique gene (PLUG) primers. The markers were subsequently localized using the CS - Ae. uniaristata addition lines and different wheat cultivars as controls. The cytogenetic and molecular markers developed herein will be helpful for screening and identifying wheat - Ae. uniaristata progeny.

  12. Prediction of industrial tomato hybrids from agronomic traits and ISSR molecular markers. (United States)

    Figueiredo, A S T; Resende, J T V; Faria, M V; Da-Silva, P R; Fagundes, B S; Morales, R G F


    Heterosis is a highly relevant phenomenon in plant breeding. This condition is usually established in hybrids derived from crosses of highly divergent parents. The success of a breeder in obtaining heterosis is directly related to the correct identification of genetically contrasting parents. Currently, the diallel cross is the most commonly used methodology to detect contrasting parents; however, it is a time- and cost-consuming procedure. Therefore, new tools capable of performing this task quickly and accurately are required. Thus, the purpose of this study was to estimate the genetic divergence in industrial tomato lines, based on agronomic traits, and to compare with estimates obtained using inter-simple sequence repeat (ISSR) molecular markers. The genetic divergence among 10 industrial tomato lines, based on nine morphological characters and 12 ISSR primers was analyzed. For data analysis, Pearson and Spearman correlation coefficients were calculated between the genetic dissimilarity measures estimated by Mahalanobis distance and Jaccard's coefficient of genetic dissimilarity from the heterosis estimates, combining ability, and means of important traits of industrial tomato. The ISSR markers efficiently detected contrasting parents for hybrid production in tomato. Parent RVTD-08 was indicated as the most divergent, both by molecular and morphological markers, that positively contributed to increased heterosis and by the specific combining ability in the crosses in which it participated. The genetic dissimilarity estimated by ISSR molecular markers aided the identification of the best hybrids of the experiment in terms of total fruit yield, pulp yield, and soluble solids content.

  13. A study on scar revision

    Directory of Open Access Journals (Sweden)

    Ashutosh Talwar


    Full Text Available Introduction: Scars are psychologically distressing for the patients and have an impact on the quality of life and self esteem of the patients. Scar revision is an aesthetic skill which is mastered by plastic surgeons and encroached now by dermatosurgeons. Scars on the face are aesthetically unacceptable and various techniques have been improvised for making a scar aesthetically acceptable. Various types of techniques are used for scar revision like W plasty, Z plasty and VY plasty. Aims: To see the efficacy of various scar revision techniques including Z plasty, VY plasty and W plasty in 30 patients with disfiguring scars. Methods: We selected twenty patients of disfiguring scars for the study. The scars from various causes including trauma and burns were included in our study. Various techniques of scar revision include Z plasty, W plasty and VY plasty were performed according to the type and site of scar. Results: Male: female was 1.5: 1. The scar revision surgery yielded excellent results with minimal complications including haematoma formation, secondary infection and delayed healing seen in 5% patients each. Regarding the efficacy of scar revision, excellent improvement was seen in 60% patients, moderate improvement was seen in 30% patients and mild improvement was seen in 10% patients. Conclusions: Dermatologists can employ a number of surgical scar revision techniques. While some are better suited to treat specific types of scars, they can be used in combination with each other or with adjunctive therapies to achieve optimal results.

  14. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.


    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  15. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass. (United States)

    Jespersen, David; Belanger, Faith C; Huang, Bingru


    Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L.) x creeping bentgrass (Agrostis stolonifera L.) hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease), antioxidant defense (catalase and glutathione-S-transferase), energy metabolism (glyceraldehyde-3-phosphate dehydrogenase), cell expansion (expansin), and stress protection (heat shock proteins HSP26, HSP70, and HSP101). Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.

  16. Candidate genes and molecular markers associated with heat tolerance in colonial Bentgrass.

    Directory of Open Access Journals (Sweden)

    David Jespersen

    Full Text Available Elevated temperature is a major abiotic stress limiting the growth of cool-season grasses during the summer months. The objectives of this study were to determine the genetic variation in the expression patterns of selected genes involved in several major metabolic pathways regulating heat tolerance for two genotypes contrasting in heat tolerance to confirm their status as potential candidate genes, and to identify PCR-based markers associated with candidate genes related to heat tolerance in a colonial (Agrostis capillaris L. x creeping bentgrass (Agrostis stolonifera L. hybrid backcross population. Plants were subjected to heat stress in controlled-environmental growth chambers for phenotypic evaluation and determination of genetic variation in candidate gene expression. Molecular markers were developed for genes involved in protein degradation (cysteine protease, antioxidant defense (catalase and glutathione-S-transferase, energy metabolism (glyceraldehyde-3-phosphate dehydrogenase, cell expansion (expansin, and stress protection (heat shock proteins HSP26, HSP70, and HSP101. Kruskal-Wallis analysis, a commonly used non-parametric test used to compare population individuals with or without the gene marker, found the physiological traits of chlorophyll content, electrolyte leakage, normalized difference vegetative index, and turf quality were associated with all candidate gene markers with the exception of HSP101. Differential gene expression was frequently found for the tested candidate genes. The development of candidate gene markers for important heat tolerance genes may allow for the development of new cultivars with increased abiotic stress tolerance using marker-assisted selection.


    Edwards, Alexis C; Aggen, Steven H; Cai, Na; Bigdeli, Tim B; Peterson, Roseann E; Docherty, Anna R; Webb, Bradley T; Bacanu, Silviu-Alin; Flint, Jonathan; Kendler, Kenneth S


    Major depressive disorder (MDD) has been associated with changes in mean telomere length and mitochondrial DNA (mtDNA) copy number. This study investigates if clinical features of MDD differentially impact these molecular markers. Data from a large, clinically ascertained sample of Han Chinese women with recurrent MDD were used to examine whether symptom presentation, severity, and comorbidity were related to salivary telomere length and/or mtDNA copy number (maximum N = 5,284 for both molecular and phenotypic data). Structural equation modeling revealed that duration of longest episode was positively associated with mtDNA copy number, while earlier age of onset of most severe episode and a history of dysthymia were associated with shorter telomeres. Other factors, such as symptom presentation, family history of depression, and other comorbid internalizing disorders, were not associated with these molecular markers. Chronicity of depressive symptoms is related to more pronounced telomere shortening and increased mtDNA copy number among individuals with a history of recurrent MDD. As these molecular markers have previously been implicated in physiological aging and morbidity, individuals who experience prolonged depressive symptoms are potentially at greater risk of adverse medical outcomes. © 2016 Wiley Periodicals, Inc.

  18. Multiple-clone infections of Plasmodium vivax: definition of a panel of markers for molecular epidemiology. (United States)

    de Souza, Aracele M; de Araújo, Flávia C F; Fontes, Cor J F; Carvalho, Luzia H; de Brito, Cristiana F A; de Sousa, Taís N


    Plasmodium vivax infections commonly contain multiple genetically distinct parasite clones. The detection of multiple-clone infections depends on several factors, such as the accuracy of the genotyping method, and the type and number of the molecular markers analysed. Characterizing the multiplicity of infection has broad implications that range from population genetic studies of the parasite to malaria treatment and control. This study compared and evaluated the efficiency of neutral and non-neutral markers that are widely used in studies of molecular epidemiology to detect the multiplicity of P. vivax infection. The performance of six markers was evaluated using 11 mixtures of DNA with well-defined proportions of two different parasite genotypes for each marker. These mixtures were generated by mixing cloned PCR products or patient-derived genomic DNA. In addition, 51 samples of natural infections from the Brazil were genotyped for all markers. The PCR-capillary electrophoresis-based method was used to permit direct comparisons among the markers. The criteria for differentiating minor peaks from artifacts were also evaluated. The analysis of DNA mixtures showed that the tandem repeat MN21 and the polymorphic blocks 2 (msp1B2) and 10 (msp1B10) of merozoite surface protein-1 allowed for the estimation of the expected ratio of both alleles in the majority of preparations. Nevertheless, msp1B2 was not able to detect the majority of multiple-clone infections in field samples; it identified only 6 % of these infections. The merozoite surface protein-3 alpha and microsatellites (PvMS6 and PvMS7) did not accurately estimate the relative clonal proportions in artificial mixtures, but the microsatellites performed well in detecting natural multiple-clone infections. Notably, the use of a less stringent criterion to score rare alleles significantly increased the sensitivity of the detection of multi-clonal infections. Depending on the type of marker used, a considerable

  19. Identification of differentiation-stage specific molecular markers for the osteoblastic phenotype

    DEFF Research Database (Denmark)

    Twine, Natalie; Chen, Li; Wilkins, Marc

    to age-matched control (n=4). Using RNA-seq and cluster analysis, we identified a set of stage-specific molecular markers that define the progression of OB phenotype during ex vivo culture of hMSC, predict in vivo bone formation capacity of hMSC and can be employed to study the mechanisms of impaired......The phenotype of osteoblastic (OB) cells in culture is currently defined using a limited number of markers of low sensitivity and specificity which belong mostly to extracellular matrix proteins. Also, for clinical use of human skeletal (mesenchymal) stem cells (hMSC) in bone regeneration......, there is a need to identify predictive markers for in vivo bone forming capacity. Thus, we employed Illumina RNA sequencing (RNASeq) to examine changes in gene expression across 8 time points between 0-12 days of ex vivo OB differentiation of hMSC. We identified a subset of expressed genes as potentially...

  20. Traditional and emerging molecular markers in neuroblastoma prognosis: the good, the bad and the ugly. (United States)

    Poremba, C; Hero, B; Goertz, H G; Scheel, C; Wai, D; Schaefer, K L; Christiansen, H; Berthold, F; Juergens, H; Boecker, W; Dockhorn-Dworniczak, B


    Neuroblastomas (NB) are a heterogeneous group of childhood tumours with a wide range of likelihood for tumour progression. As traditional parameters do not ensure completely accurate prognostic grouping, new molecular markers are needed for assessing the individual patient's prognosis more precisely. 133 NB of all stages were analysed in blind-trial fashion for telomerase activity (TA), expression of surviving, and MYCN status. These data were correlated with other traditional prognostic indicators and disease outcome. TA is a powerful independent prognostic marker for all stages and is capable of differentiating between good and poor outcome in putative "favourable" clinical or biological subgroups of NB patients. High surviving expression is associated with an adverse outcome, but is more difficult to interprete than TA because survivin expression needs to be accurately quantified to be of predictive value. We propose an extended progression model for NB including emerging prognostic markers, with emphasis on telomerase activity.

  1. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers. (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José


    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  2. A suite of molecular markers for identifying species, detecting introgression and describing population structure in spadefoot toads (Spea spp.). (United States)

    Pfennig, Karin S; Allenby, Ashley; Martin, Ryan A; Monroy, Anaïs; Jones, Corbin D


    Two congeneric species of spadefoot toad, Spea multiplicata and Spea bombifrons, have been the focus of hybridization studies since the 1970s. Because complex hybrids are not readily distinguished phenotypically, genetic markers are needed to identify introgressed individuals. We therefore developed a set of molecular markers (amplified fragment length polymorphism, polymerase chain reaction-restriction fragment length polymorphism and single nucleotide polymorphism) for identifying pure-species, F1 hybrids and more complex introgressed types. To do so, we tested a series of markers across both species and known hybrids using populations in both allopatry and sympatry. We retained those markers that differentiated the two pure-species and also consistently identified known species hybrids. These markers are well suited for identifying hybrids between these species. Moreover, those markers that show variation within each species can be used in conjunction with existing molecular markers in studies of population structure and gene flow. © 2012 Blackwell Publishing Ltd.

  3. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    Energy Technology Data Exchange (ETDEWEB)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.


    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  4. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    International Nuclear Information System (INIS)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.


    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  5. Molecular markers based identification of diversity for drought tolerance in bread wheat varieties and synthetic hexaploids. (United States)

    Shah, Zahid Hussain; Munir, Muhammad; Kazi, Abdul Mujeeb; Mujtaba, Tahir; Ahmed, Zaheer


    The complexity of the wheat genome has delayed the development and application of molecular markers to this species and wheat now lies behind barley, maize and rice in marker development. However, improvements in marker detection systems and in the techniques used to identify markers linked to useful traits has allowed considerable advances to be made in recent years. To evaluate the genetic diversity 53 genotypes of Richard's selection, were studied at National Agriculture Reseach Center (NARC) Islamabad. The present study found that RAPD analysis is a valuable diagnostic tool. Different sets of RAPD primers were used to study the polymorphism at molecular level. Highest number of amplifications was shown by primer OpG-2 in Richard's material. Coefficient of similarity as well as genetic distances among these three sets of materials was calculated by using Unweighted Pair Group of Arithamatic Means (UPGMA) function (Nei and Li, 1979). The SHs derived genotypes of Richard's selection were highly polymorphic with a polymorphism percentage of 69.70 as compared to NUYT (rainfed) and elite Pakistani bread wheat varieties with a polymorphism of 44.44% and 61.11% respectively. Cluster analysis was done in which grouping of genotypes was done on the basis of genetic distances. Cluster analysis revealed that genotypes of Richard's genotypes are showing high level of among cultivar variation as compared to NUYT (Rainfed) and elite Pakistani drought tolerant bread wheat varieties. These genotypes were also phenotypically evaluated.

  6. Cortical GABA markers identify a molecular subtype of psychotic and bipolar disorders. (United States)

    Volk, D W; Sampson, A R; Zhang, Y; Edelson, J R; Lewis, D A


    Deficits in gamma aminobutyric acid (GABA) neuron-related markers, including the GABA-synthesizing enzyme GAD67, the calcium-binding protein parvalbumin, the neuropeptide somatostatin, and the transcription factor Lhx6, are most pronounced in a subset of schizophrenia subjects identified as having a 'low GABA marker' (LGM) molecular phenotype. Furthermore, schizophrenia shares degrees of genetic liability, clinical features and cortical circuitry abnormalities with schizoaffective disorder and bipolar disorder. Therefore, we determined the extent to which a similar LGM molecular phenotype may also exist in subjects with these disorders. Transcript levels for GAD67, parvalbumin, somatostatin, and Lhx6 were quantified using quantitative PCR in prefrontal cortex area 9 of 184 subjects with a diagnosis of schizophrenia (n = 39), schizoaffective disorder (n = 23) or bipolar disorder (n = 35), or with a confirmed absence of any psychiatric diagnoses (n = 87). A blinded clustering approach was employed to determine the presence of a LGM molecular phenotype across all subjects. Approximately 49% of the subjects with schizophrenia, 48% of the subjects with schizoaffective disorder, and 29% of the subjects with bipolar disorder, but only 5% of unaffected subjects, clustered in the cortical LGM molecular phenotype. These findings support the characterization of psychotic and bipolar disorders by cortical molecular phenotype which may help elucidate more pathophysiologically informed and personalized medications.

  7. Cesarean scar pregnancy

    DEFF Research Database (Denmark)

    Petersen, Kathrine Birch; Hoffmann, Elise; Rifbjerg Larsen, Christian


    OBJECTIVE: To study treatment modalities for cesarean scar pregnancies (CSPs), focusing on efficacy and complications in relation to study quality. DESIGN: Systematic review. SETTING: Not applicable. PATIENT(S): A total of 2,037 women with CSP. INTERVENTION(S): Review of MEDLINE, EMBASE, and Coch......OBJECTIVE: To study treatment modalities for cesarean scar pregnancies (CSPs), focusing on efficacy and complications in relation to study quality. DESIGN: Systematic review. SETTING: Not applicable. PATIENT(S): A total of 2,037 women with CSP. INTERVENTION(S): Review of MEDLINE, EMBASE...

  8. The Association Between Molecular Markers in Colorectal Sessile Serrated Polyps and Colorectal Cancer Risk (United States)


    AWARD NUMBER: W81XWH-15-1-0273 TITLE: The Association between Molecular Markers in Colorectal Sessile Serrated Polyps and Colorectal Cancer ... Colorectal Cancer Risk 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-15-1-0273 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Andrea Burnett-Hartman 5d... cancer in patients with sessile serrated colorectal polyps (SSPs). The project’s specific aims are as follows: 1) Estimate the risk of colorectal

  9. Labeling and analysis of chicken taste buds using molecular markers in oral epithelial sheets


    Rajapaksha, Prasangi; Wang, Zhonghou; Venkatesan, Nandakumar; Tehrani, Kayvan F.; Payne, Jason; Swetenburg, Raymond L.; Kawabata, Fuminori; Tabata, Shoji; Mortensen, Luke J.; Stice, Steven L.; Beckstead, Robert; Liu, Hong-Xiang


    In chickens, the sensory organs for taste are the taste buds in the oral cavity, of which there are ~240?360 in total number as estimated by scanning electron microscopy (SEM). There is not an easy way to visualize all taste buds in chickens. Here, we report a highly efficient method for labeling chicken taste buds in oral epithelial sheets using the molecular markers Vimentin and ?-Gustducin. Immediate tissue fixation following incubation with sub-epithelially injected proteases enabled us t...

  10. Identification of molecular performance from oil palm clones based on SSR markers (United States)

    Putri, Lollie Agustina P.; Basyuni, M.; Bayu, Eva S.; Arvita, D.; Arifiyanto, D.; Syahputra, I.


    In Indonesia, the oil palms are an important economic crop, producing food and raw materials for the food, confectionary, cosmetics and oleo-chemical industrial demands of oil palm products. Clonal oil palm offers the potential for greater productivity because it is possible to establish uniform tree stands comprising identical copies (clones) of a limited number of highly productive oil palms. Unfortunately, tissue culture sometimes accentuates the expression of detects in oil palm, particularly when embryogenesis is induced in particullar callus for prolonged periods. This research is conducted by taking individual tree sample of clone germplasm two years old. The purpose of this research is to molecular performance analysis of some oil palm clones based on SSR markers. A total of 30 trees oil palm clones were used for analysis. In this experiment, the DNA profile diversity was assessed using five loci of oil palm’s specific SSR markers. The results of the experiment indicated out of 3 SSR markers (FR-0779, FR-3663 and FR-0782) showed monomorphic of PCR product and 2 SSR markers (FR-0783 and FR- 3745) showed polymorphic of PCR product. There are 10 total number of PCR product. These preliminary results demonstrated SSR marker can be used to evaluate genetic relatedness among trees of oil palm clones.

  11. From traditional biochemical signals to molecular markers for detection of sepsis after burn injuries. (United States)

    Muñoz, Balam; Suárez-Sánchez, Rocío; Hernández-Hernández, Oscar; Franco-Cendejas, Rafael; Cortés, Hernán; Magaña, Jonathan J


    Sepsis is a life-threatening organ-dysfunction condition caused by a dysregulated response to an infectious condition that can cause complications in patients with major trauma. Burns are one of the most destructive forms of trauma; despite the improvements in medical care, infections remain an important cause of burn injury-related mortality and morbidity, and complicated sepsis predisposes patients to diverse complications such as organ failure, lengthening of hospital stays, and increased costs. Accurate diagnosis and early treatment of sepsis may have a beneficial impact on clinical outcome of burn-injured patients. In this review, we offer a comprehensive description of the current and traditional markers used as indicative of sepsis in burned patients. However, although these are markers of the inflammatory post-burn response, they usually fail to predict sepsis in severely burned patients due to that they do not reflect the severity of the infection. Identification and measurement of biomarkers in early stages of infection is important in order to provide timely response and effective treatment of burned patients. Therefore, we compiled important experimental evidence, demonstrating novel biomarkers, including molecular markers such as genomic DNA variations, alterations of transcriptome profiling (mRNA, miRNAs, lncRNAs and circRNAs), epigenetic markers, and advances in proteomics and metabolomics. Finally, this review summarizes next-generation technologies for the identification of markers for detection of sepsis after burn injuries. Copyright © 2018 Elsevier Ltd and ISBI. All rights reserved.

  12. DNA-based molecular markers as tools for the discovery of γ-induced mutants in cereals and soybean

    International Nuclear Information System (INIS)

    Bondarenco, E.; Bondarenco, V.; Barbacar, N.; Coretchi, L.


    γ-induced mutagenesis is one of the present techniques effective in producing crops with enhanced quality and novel properties. The fast detection of mutants can be nowadays assured by the employment of DNA-based molecular markers. Different kinds of molecular markers are being widely used all over the world to monitor DNA sequence variation and identification of desired traits. In the given paper we present a short overview of the types of molecular markers and the first steps of the attempt of their use for mutants' characterization in the Republic of Moldova (authors)

  13. Genetic variation of rs438601 marker in the Iranian Population: An informative marker for molecular diagnosis of hemophilia B

    Directory of Open Access Journals (Sweden)

    P Dorri


    Conclusion: The study findings demonstrated that rs438601 marker due to high heterozygosity could be suggested as an appropriate diagnostic marker in linkage analysis and carrier detection of hemophilia B in regard with a sample of Iranian population.

  14. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill


    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding. PMID:28729875

  15. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu


    Full Text Available Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  16. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding. (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill


    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  17. Transferability of molecular markers from major legumes to Lathyrus spp. for their application in mapping and diversity studies. (United States)

    Almeida, Nuno Felipe; Trindade Leitão, Susana; Caminero, Constantino; Torres, Ana Maria; Rubiales, Diego; Vaz Patto, Maria Carlota


    Lathyrus cicera L. (chickling pea) and L. sativus L. (grass pea) have great potential among grain legumes due to their adaptability to inauspicious environments, high protein content and resistance to serious diseases. Nevertheless, due to its past underused, further activities are required to exploit this potential and to capitalise on the advances in molecular biology that enable improved Lathyrus spp. breeding programmes. In this study we evaluated the transferability of molecular markers developed for closely related legume species to Lathyrus spp. (Medicago truncatula, pea, lentil, faba bean and lupin) and tested the application of those new molecular tools on Lathyrus mapping and diversity studies. Genomic and expressed sequence tag microsatellite, intron-targeted amplified polymorphic, resistance gene analogue and defence-related gene markers were tested. In total 128 (27.7 %) and 132 (28.6 %) molecular markers were successfully cross-amplified, respectively in L. cicera and L. sativus. In total, the efficiency of transferability from genomic microsatellites was 5 %, and from gene-based markers, 55 %. For L. cicera, three cleaved amplified polymorphic sequence markers and one derived cleaved amplified polymorphic sequence marker based on the cross-amplified markers were also developed. Nine of those molecular markers were suitable for mapping in a L. cicera recombinant inbred line population. From the 17 molecular markers tested for diversity analysis, six (35 %) in L. cicera and seven (41 %) in L. sativus were polymorphic and discriminate well all the L. sativus accessions. Additionally, L. cicera accessions were clearly distinguished from L. sativus accessions. This work revealed a high number of transferable molecular markers to be used in current genomic studies in Lathyrus spp. Although their usefulness was higher on diversity studies, they represent the first steps for future comparative mapping involving these species.

  18. СD44+/CD24- markers of cancer stem cells in patients with breast cancer of different molecular subtypes. (United States)

    Chekhun, S V; Zadvorny, T V; Tymovska, Yu O; Anikusko, M F; Novak, O E; Polishchuk, L Z


    To determine frequency of tumors with immunohistochemical markers of cancer stem cells (CSC) CD44+/CD24- in patients with breast cancer (BC) of different molecular subtype and to evaluate their prognostic value. Surgical material of 132 patients with BC stage I-II, age from 23 to 75 years, mean age - 50.2 ± 3.1 years was studied. Clinical, immunohistochemical (expression CD44+/CD24-), morphological, statistical. BC is characterized by heterogeneity of molecular subtypes and expression of markers (CD44+/CD24-). Immunohistochemical study of expression of CSC markers in surgical material has detected their expression in 34 (25.4%) patients with BC of different molecular subtypes. The highest frequency of cells with expression of CSC marker was observed in patients with basal molecular subtype (44.8% patients). Most of BC patients with phenotype CD44+/CD24 had stage I of tumor process (34.3%). Statistical processing of data has showen that Yule colligation coefficient equaled 0.28 (р > 0.05) that argues poor correlation between stage of tumor process and number of tumors with positive expression of CSC markers. Statistical processing of data has showen high correlation between presence of cells with expression of CSC markers and metastases of BC in regional lymph nodes (Yule colligation coefficient equals 0.943; р molecular subtype depending on expression of CSC CD44+/CD24- markers was detected. Survival of patients with basal BC was reliably higher at lack in tumors of cells with CSC markers CD44+/CD24- and, correspondingly, lower at presence of such cells (р markers was not determined (р > 0.05). Significance of tumor cells with markers CD44+/CD24- within the limits of molecular subtype of BC may be additional criterion for advanced biological characteristic of BC, and in patients with BC of basal molecular subtype - for predictive evaluation of individual potential of tumor to aggressive clinical course.

  19. The Search for Molecular Prognostic Markers of Diabetic Nephropathy in Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    V. M. Ibragimov


    Full Text Available The purpose of this study was to search for molecular prognostic markers of diabetic nephropathy (DN in patients with type 2 diabetes mellitus (T2DM. The study included 205 patients with T2DM and DN (stages 1 to 4. All patients were stratified by the MDRD equation. The control group included 30 healthy individuals. All T2DM patients were divided into 4 groups depending on the DN stages. Group 1 included 42 patients with DN-Stage 1 (prenephropathy, Group 2 included 48 patients with DN-Stage 2 (incipient nephropathy; Group 3 included 65 patients with DN-Stage 3 (overt nephropathy, and Group 4 included 50 patients with DN-Stage 4 (kidney failure. Molecular phenotyping of urine was processed with methods of proteomics: the prefractionation, the separation of proteins with standard sets (MB-HIC C8 Kit, MB-IMAC Cu, MB-Wax Kit, «Bruker», USA, matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF-MS/MS, Ultraflex II, «Bruker», USA. The data of the molecular interactions and functional features of proteins were received with STRING 10.0 database. Potentially new molecular markers of DN development were identified. The research into signaling pathways and the molecules that are involved in ECM formation may help in developing strategies to prevent DN.

  20. Molecular markers predicting radiotherapy response: Report and recommendations from an International Atomic Energy Agency technical meeting

    International Nuclear Information System (INIS)

    West, Catharine M.L.; McKay, Michael J.; Hoelscher, Tobias; Baumann, Michael; Stratford, Ian J.; Bristow, Robert G.; Iwakawa, Mayumi; Imai, Takashi; Zingde, Surekha M.; Anscher, Mitchell S.; Bourhis, Jean; Begg, Adrian C.; Haustermans, Karin; Bentzen, Soren M.; Hendry, Jolyon H.


    Purpose: There is increasing interest in radiogenomics and the characterization of molecular profiles that predict normal tissue and tumor radioresponse. A meeting in Amsterdam was organized by the International Atomic Energy Agency to discuss this topic on an international basis. Methods and Materials: This report is not completely exhaustive, but highlights some of the ongoing studies and new initiatives being carried out worldwide in the banking of tumor and normal tissue samples underpinning the development of molecular marker profiles for predicting patient response to radiotherapy. It is generally considered that these profiles will more accurately define individual or group radiosensitivities compared with the nondefinitive findings from the previous era of cellular-based techniques. However, so far there are only a few robust reports of molecular markers predicting normal tissue or tumor response. Results: Many centers in different countries have initiated tissue and tumor banks to store samples from clinical trials for future molecular profiling analysis, to identify profiles that predict for radiotherapy response. The European Society for Therapeutic Radiology and Oncology GENEtic pathways for the Prediction of the effects of Irradiation (GENEPI) project, to store, document, and analyze sample characteristics vs. response, is the most comprehensive in this regard. Conclusions: The next 5-10 years are likely to see the results of these and other correlative studies, and promising associations of profiles with response should be validated in larger definitive trials

  1. Trend of different molecular markers in the last decades for studying human migrations. (United States)

    Kundu, Sharbadeb; Ghosh, Sankar Kumar


    Anatomically modern humans are known to have widely migrated throughout history. Different scientific evidences suggest that the entire human population descended from just several thousand African migrants. About 85,000 years ago, the first wave of human migration was out of Africa, that followed the coasts through the Middle East, into Southern Asia via Sri Lanka, and in due course around Indonesia and into Australia. Another wave of migration between 40,000 and 12,000 years ago brought humans northward into Europe. However, the frozen north limited human expansion in Europe, and created a land bridge, "Bering land bridge", connecting Asia with North America about 25,000 years ago. Although fossil data give the most direct information about our past, it has certain anomalies. So, molecular archeologists are now using different molecular markers to trace the "most recent common ancestor" and also the migration pattern of modern humans. In this study, we have studied the trend of molecular markers and also the methodologies implemented in the last decades (2003-2014). From our observation, we can say that D-loop region of mtDNA and Y chromosome based markers are predominant. Nevertheless, mtDNA, especially the D-loop region, has some unique features, which makes it a more effective marker for tracing prehistoric footprints of modern human populations. Although, natural selection should also be taken into account in studying mtDNA based human migration. As per technology is concerned, Sanger sequencing is the major technique that is being used in almost all studies. But, the emergence of different cost-effective-and-easy-to-handle NGS platforms has increased its popularity over Sanger sequencing in studying human migration. Copyright © 2014. Published by Elsevier B.V.

  2. Predictive gene signatures: molecular markers distinguishing colon adenomatous polyp and carcinoma.

    Directory of Open Access Journals (Sweden)

    Janice E Drew

    Full Text Available Cancers exhibit abnormal molecular signatures associated with disease initiation and progression. Molecular signatures could improve cancer screening, detection, drug development and selection of appropriate drug therapies for individual patients. Typically only very small amounts of tissue are available from patients for analysis and biopsy samples exhibit broad heterogeneity that cannot be captured using a single marker. This report details application of an in-house custom designed GenomeLab System multiplex gene expression assay, the hCellMarkerPlex, to assess predictive gene signatures of normal, adenomatous polyp and carcinoma colon tissue using archived tissue bank material. The hCellMarkerPlex incorporates twenty-one gene markers: epithelial (EZR, KRT18, NOX1, SLC9A2, proliferation (PCNA, CCND1, MS4A12, differentiation (B4GANLT2, CDX1, CDX2, apoptotic (CASP3, NOX1, NTN1, fibroblast (FSP1, COL1A1, structural (ACTG2, CNN1, DES, gene transcription (HDAC1, stem cell (LGR5, endothelial (VWF and mucin production (MUC2. Gene signatures distinguished normal, adenomatous polyp and carcinoma. Individual gene targets significantly contributing to molecular tissue types, classifier genes, were further characterised using real-time PCR, in-situ hybridisation and immunohistochemistry revealing aberrant epithelial expression of MS4A12, LGR5 CDX2, NOX1 and SLC9A2 prior to development of carcinoma. Identified gene signatures identify aberrant epithelial expression of genes prior to cancer development using in-house custom designed gene expression multiplex assays. This approach may be used to assist in objective classification of disease initiation, staging, progression and therapeutic responses using biopsy material.

  3. A reductionist approach to extract robust molecular markers from microarray data series - Isolating markers to track osseointegration. (United States)

    Barik, Anwesha; Banerjee, Satarupa; Dhara, Santanu; Chakravorty, Nishant


    Complexities in the full genome expression studies hinder the extraction of tracker genes to analyze the course of biological events. In this study, we demonstrate the applications of supervised machine learning methods to reduce the irrelevance in microarray data series and thereby extract robust molecular markers to track biological processes. The methodology has been illustrated by analyzing whole genome expression studies on bone-implant integration (ossointegration). Being a biological process, osseointegration is known to leave a trail of genetic footprint during the course. In spite of existence of enormous amount of raw data in public repositories, researchers still do not have access to a panel of genes that can definitively track osseointegration. The results from our study revealed panels comprising of matrix metalloproteinases and collagen genes were able to track osseointegration on implant surfaces (MMP9 and COL1A2 on micro-textured; MMP12 and COL6A3 on superimposed nano-textured surfaces) with 100% classification accuracy, specificity and sensitivity. Further, our analysis showed the importance of the progression of the duration in establishment of the mechanical connection at bone-implant surface. The findings from this study are expected to be useful to researchers investigating osseointegration of novel implant materials especially at the early stage. The methodology demonstrated can be easily adapted by scientists in different fields to analyze large databases for other biological processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Development of haplotype-specific molecular markers for the low-molecular-weight glutenin subunits (United States)

    Low-molecular-weight glutenin subunits (LMW-GSs) are one of the major components of gluten and their allelic variation has been widely associated with numerous wheat end-use quality parameters. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3 and...

  5. Molecular markers in transitional cell carcinoma of the bladder: New insights into mechanisms and prognosis

    Directory of Open Access Journals (Sweden)

    Behfar Ehdaie


    Full Text Available Urothelial carcinoma is potentially life-threatening and expensive to treat since for many patients, the diagnosis entails a lifetime of surveillance to detect recurrent disease. Advancements in technology have provided an understanding of the molecular mechanisms of carcinogenesis and defined distinct pathways in tumorigenesis and progression. At the molecular level, urothelial carcinoma is being seen as a disease with distinct pathways of carcinogenesis and progression and thus markers of these processes should be used as both diagnostics and predictors of progression and patient outcome. Herein we present a selective overview of the molecular underpinning of urothelial carcinogenesis and progression and discuss the potential for proteins involved in these processes to serve as biomarkers. The discovery of biomarkers has enabled the elucidation of targets for novel therapeutic agents to disrupt the deregulation underlying the development and progression of urothelial carcinogenesis.

  6. Fibromodulin reduces scar size and increases scar tensile strength in normal and excessive-mechanical-loading porcine cutaneous wounds. (United States)

    Jiang, Wenlu; Ting, Kang; Lee, Soonchul; Zara, Janette N; Song, Richard; Li, Chenshuang; Chen, Eric; Zhang, Xinli; Zhao, Zhihe; Soo, Chia; Zheng, Zhong


    Hypertrophic scarring is a major postoperative complication which leads to severe disfigurement and dysfunction in patients and usually requires multiple surgical revisions due to its high recurrence rates. Excessive-mechanical-loading across wounds is an important initiator of hypertrophic scarring formation. In this study, we demonstrate that intradermal administration of a single extracellular matrix (ECM) molecule-fibromodulin (FMOD) protein-can significantly reduce scar size, increase tensile strength, and improve dermal collagen architecture organization in the normal and even excessive-mechanical-loading red Duroc pig wound models. Since pig skin is recognized by the Food and Drug Administration as the closest animal equivalent to human skin, and because red Duroc pigs show scarring that closely resembles human proliferative scarring and hypertrophic scarring, FMOD-based technologies hold high translational potential and applicability to human patients suffering from scarring-especially hypertrophic scarring. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  7. Molecular marker studies in riverine buffaloes, for characterization and diagnosis of genetic defects

    International Nuclear Information System (INIS)

    Yadav, B.R.


    The buffalo is probably the last livestock species to have been domesticated, with many genetic, physiological and behavioural traits not yet well understood. Molecular markers have been used for characterizing animals and breeds, diagnosing diseases and identifying anatomical and physiological anomalies. RFLP studies showed low heterozygosity, but genomic and oligonucleotide probes showed species-specific bands useful for identification of carcass or other unknown samples. Use of RAPD revealed band frequencies, band sharing frequencies, genetic distances, and genetic and identity indexes in different breeds. Bovine microsatellite primers indicate that 70.9% of bovine loci were conserved in buffalo. Allele numbers, sizes, frequencies, heterozygosity and polymorphism information content showed breed-specific patterns. Different marker types - genomic and oligonucleotide probes, RAPD and microsatellites - are useful in parent identification. Individual specific DNA fingerprinting techniques were applied with twin-born animal (XX/XY) chimerism, sex identification, anatomically defective and XO individuals. Molecular markers are a potential tool for geneticists and breeders to evaluate existing germplasm and to manipulate it to develop character-specific strains and to provide the basis for effective genetic conservation. (author)

  8. Values of molecular markers in the differential diagnosis of thyroid abnormalities. (United States)

    Tennakoon, T M P B; Rushdhi, M; Ranasinghe, A D C U; Dassanayake, R S


    Thyroid cancer (TC), follicular adenoma (FA) and Hashimoto's thyroiditis (HT) are three of the most frequently reported abnormalities that affect the thyroid gland. A frequent co-occurrence along with similar histopathological features is observed between TC and FA as well as between TC and HT. The conventional diagnostic methods such as histochemical analysis present complications in differential diagnosis when these abnormalities occur simultaneously. Hence, the authors recognize novel methods based on screening genetic defects of thyroid abnormalities as viable diagnostic and prognostic methods that could complement the conventional methods. We have extensively reviewed the existing literature on TC, FA and HT and also on three genes, namely braf, nras and ret/ptc, that could be used to differentially diagnose the three abnormalities. Emphasis was also given to the screening methods available to detect the said molecular markers. It can be conferred from the analysis of the available data that the utilization of braf, nras and ret/ptc as markers for the therapeutic evaluation of FA and HT is debatable. However, molecular screening for braf, nras and ret/ptc mutations proves to be a conclusive method that could be employed to differentially diagnose TC from HT and FA in the instance of a suspected co-occurrence. Thyroid cancer patients can be highly benefited from the screening for the said genetic markers, especially the braf gene due to its diagnostic value as well as due to the availability of personalized medicine targeted specifically for braf mutants.

  9. Relative profile analysis of molecular markers for identification and genetic discrimination of loaches (Pisces, Nemacheilidae). (United States)

    Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao


    Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  10. Genotyping and Molecular Identification of Date Palm Cultivars Using Inter-Simple Sequence Repeat (ISSR) Markers. (United States)

    Ayesh, Basim M


    Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.

  11. Molecular and protein markers for clinical decision making in breast cancer: today and tomorrow. (United States)

    Harbeck, Nadia; Sotlar, Karl; Wuerstlein, Rachel; Doisneau-Sixou, Sophie


    In early breast cancer (eBC), established clinicopathological factors are not sufficient for clinical decision making particularly regarding adjuvant chemotherapy since substantial over- or undertreatment may occur. Thus, novel protein- and molecular markers have been put forward as decision aids. Since these potential prognosis and/or predictive tests differ substantially regarding their methodology, analytical and clinical validation, this review attempts to summarize the essential facts for clinicians. This review focuses on those markers which are the most advanced so far in their development towards routine clinical application, i.e. two protein markers (i.e. uPA/PAI-1 and IHC4) and six molecular multigene tests (i.e. Mammaprint®, Oncotype DX®, PAM50, Endopredict®, the 97-gene genomic grade, and 76 gene Rotterdam signatures). Next to methodological aspects, we summarized the clinical evidences, in particular the main prospective clinical trials which have already been fully recruited (i.e. MINDACT, TAILORx, WSG PLAN B) or are still ongoing (i.e. RxPONDER/SWOG S1007, WSG-ADAPT). Last but not least, this review points out the key elements for clinicians to select one test among the wide panel of proposed assays, for a specific population of patients in term of level of evidence, analytical and clinical validity as well as cost effectiveness. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Determination of genetic structure of germplasm collections: are traditional hierarchical clustering methods appropriate for molecular marker data?

    NARCIS (Netherlands)

    Odong, T.L.; Heerwaarden, van J.; Jansen, J.; Hintum, van T.J.L.; Eeuwijk, van F.A.


    Despite the availability of newer approaches, traditional hierarchical clustering remains very popular in genetic diversity studies in plants. However, little is known about its suitability for molecular marker data. We studied the performance of traditional hierarchical clustering techniques using

  13. Molecular markers validation to drought resistance in wheat meal (Triticum aestivum L. under greenhouse conditions

    Directory of Open Access Journals (Sweden)

    Gabriel Julio


    Full Text Available With the aim to study the genetic resistance to drought and validate molecular markers co-localized with genes/QTLs for this factor, 16 varieties were evaluated as well as advanced lines of wheat meal (Triticum aestivum in two stages of crop development. Physiological parameters were considered: amount of chlorophyll (clo, wilting or severity degree (SEV and recovery (reco, morphological parameters: foliage dry matter (FDM and root dry matter (RDM, the integrated resistance mechanisms: water use efficiency (WUE, other parameters: number of grains (Ngrain and grain weight (Wgrain, biochemical parameters: Catalaza (CAT, Ascorbate Peroxidase (APX and Guaiacol Peroxidase (POX and three microsatellite markers (Xwmc603, Xwmc596, Xwmc9. Results showed significant differences for MSR and Ngrain. It was observed that Anzaldo, ERR2V.L-20, EARII2V.L-5, EARIZV.L-11, ERR2V.L-11 and EE2V.L-19 were the most resistant to drough water stress. There was a highly significant negative correlation between the MSR and Ngrain. All other variables showed low and non-significant correlations. In biochemical analyzes, the Anzaldo variety showed an increased enzymatic activity compared to controls in all cases (CAT-APX and POX, being the most resistant to water stress by drought. Finally, it was found that SSR markers (Xwmc596 and Xwmc9 are co-located with the gene / QTL of drought resistance and can be used for marker-assisted selection.

  14. Prediction of genetic values of quantitative traits in plant breeding using pedigree and molecular markers. (United States)

    Crossa, José; Campos, Gustavo de Los; Pérez, Paulino; Gianola, Daniel; Burgueño, Juan; Araus, José Luis; Makumbi, Dan; Singh, Ravi P; Dreisigacker, Susanne; Yan, Jianbing; Arief, Vivi; Banziger, Marianne; Braun, Hans-Joachim


    The availability of dense molecular markers has made possible the use of genomic selection (GS) for plant breeding. However, the evaluation of models for GS in real plant populations is very limited. This article evaluates the performance of parametric and semiparametric models for GS using wheat (Triticum aestivum L.) and maize (Zea mays) data in which different traits were measured in several environmental conditions. The findings, based on extensive cross-validations, indicate that models including marker information had higher predictive ability than pedigree-based models. In the wheat data set, and relative to a pedigree model, gains in predictive ability due to inclusion of markers ranged from 7.7 to 35.7%. Correlation between observed and predictive values in the maize data set achieved values up to 0.79. Estimates of marker effects were different across environmental conditions, indicating that genotype × environment interaction is an important component of genetic variability. These results indicate that GS in plant breeding can be an effective strategy for selecting among lines whose phenotypes have yet to be observed.

  15. Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers

    Directory of Open Access Journals (Sweden)

    Rogier Christophe


    Full Text Available Abstract Background Several strategies are currently deployed in many countries in the tropics to strengthen malaria control toward malaria elimination. To measure the impact of any intervention, there is a need to detect malaria properly. Mostly, decisions still rely on microscopy diagnosis. But sensitive diagnosis tools enabling to deal with a large number of samples are needed. The molecular detection approach offers a much higher sensitivity, and the flexibility to be automated and upgraded. Methods Two new molecular methods were developed: dot18S, a Plasmodium-specific nested PCR based on the 18S rRNA gene followed by dot-blot detection of species by using species-specific probes and CYTB, a Plasmodium-specific nested PCR based on cytochrome b gene followed by species detection using SNP analysis. The results were compared to those obtained with microscopic examination and the "standard" 18S rRNA gene based nested PCR using species specific primers. 337 samples were diagnosed. Results Compared to the microscopy the three molecular methods were more sensitive, greatly increasing the estimated prevalence of Plasmodium infection, including P. malariae and P. ovale. A high rate of mixed infections was uncovered with about one third of the villagers infected with more than one malaria parasite species. Dot18S and CYTB sensitivity outranged the "standard" nested PCR method, CYTB being the most sensitive. As a consequence, compared to the "standard" nested PCR method for the detection of Plasmodium spp., the sensitivity of dot18S and CYTB was respectively 95.3% and 97.3%. Consistent detection of Plasmodium spp. by the three molecular methods was obtained for 83% of tested isolates. Contradictory results were mostly related to detection of Plasmodium malariae and Plasmodium ovale in mixed infections, due to an "all-or-none" detection effect at low-level parasitaemia. Conclusion A large reservoir of asymptomatic infections was uncovered using the

  16. Oral keratinocyte stem/progenitor cells: specific markers, molecular signaling pathways and potential uses. (United States)

    Calenic, Bogdan; Greabu, Maria; Caruntu, Constantin; Tanase, Cristiana; Battino, Maurizio


    Oral keratinocyte stem cells reside in the basal layers of the oral epithelium, representing a minor population of cells with a great potential to self-renew and proliferate over the course of their lifetime. As a result of the potential uses of oral keratinocyte stem cells in regenerative medicine and the key roles they play in tissue homeostasis, inflammatory conditions, wound healing and tumor initiation and progression, intense scientific efforts are currently being undertaken to identify, separate and reprogram these cells. Although currently there is no specific marker that can characterize and isolate oral keratinocyte stem cells, several suggestions have been made. Thus, different stem/progenitor-cell subpopulations have been categorized based on combinations of positive and/or negative membrane-surface markers, which include integrins, clusters of differentiation and cytokeratins. Important advances have also been made in understanding the molecular pathways that govern processes such as self-renewal, differentiation, proliferation, wound healing and programmed cell death. A thorough understanding of stem-cell biology and the molecular players that govern cellular fate is paramount in the quest for using stem-cell-derived therapies in the treatment of various oral pathologies. The current review focuses on recent advances in understanding the molecular signaling pathways coordinating the behavior of these cells and in identifying suitable markers used for their isolation and characterization. Special emphasis will also be placed on the roles played by oral keratinocyte stem and progenitor cells in normal and diseased oral tissues and on their potential uses in the fields of general medicine and dentistry. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Molecular markers of benzene polycarboxylic acids in describing biochar physiochemical properties and sorption characteristics. (United States)

    Chang, Zhaofeng; Tian, Luping; Wu, Min; Dong, Xudong; Peng, Juan; Pan, Bo


    Biochar function in soil is based on properties such as sorption characteristics, and these are expected to change throughout the life cycle of the biochar. Because biochar particles cannot easily be separated from soil particles, this change is seldom investigated. Biochar-related molecular markers, such as benzene polycarboxylic acids (BPCAs) are promising tools for studying the properties of biochars in complex environmental matrices. In this study, biochars were derived from corn straw and pine wood sawdust at 200-500 °C, and their aging was simulated with NaClO. Biochar properties were characterized by elemental analysis, BET surface characterization and BPCA molecular marker analysis. Chemical oxidation decreased the surface area (SA) but increased the O content of biochars. The oxidation decreased the amount of biochars, with a mass loss in the range of 10-55%. A similar mass loss was also observed for BPCAs and was negatively related to both the pyrolysis temperature and the extent of the condensed structure (higher aromaticity). The biochar amounts were calculated quantitatively using the sum of BPCA contents, with a conversion factor (the ratio of biochar amount to BPCA content) in the range of 3.3-5.5, and were negatively related to the B5CA content. Three model pollutants, namely, bisphenol A (BPA), sulfamethoxazole (SMX), and phenanthrene (PHE), were chosen to study the sorption characteristics of biochar before and after oxidation. Chemical oxidation generally increased SMX sorption but decreased PHE sorption. The nonlinear factor n, based on Freundlich equation modeling, was negatively related to B6CA for all three chemicals. The BPCA molecular markers, especially B5CA and B6CA, were correlated to the biochar properties before and after oxidation and are thus a potentially useful technique for describing the characteristics of biochar in the environment. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Use of molecular markers in identification and characterization of resistance to rice blast in India.

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Yadav

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs using molecular markers linked to twelve major blast resistance (R genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75% showed resistance, twenty one were moderately resistant (26.25% while remaining forty varieties (50% showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  19. Use of molecular markers in identification and characterization of resistance to rice blast in India. (United States)

    Yadav, Manoj Kumar; S, Aravindan; Ngangkham, Umakanta; Shubudhi, H N; Bag, Manas Kumar; Adak, Totan; Munda, Sushmita; Samantaray, Sanghamitra; Jena, Mayabini


    Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs) using molecular markers linked to twelve major blast resistance (R) genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75%) showed resistance, twenty one were moderately resistant (26.25%) while remaining forty varieties (50%) showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  20. Validation of systems biology derived molecular markers of renal donor organ status associated with long term allograft function. (United States)

    Perco, Paul; Heinzel, Andreas; Leierer, Johannes; Schneeberger, Stefan; Bösmüller, Claudia; Oberhuber, Rupert; Wagner, Silvia; Engler, Franziska; Mayer, Gert


    Donor organ quality affects long term outcome after renal transplantation. A variety of prognostic molecular markers is available, yet their validity often remains undetermined. A network-based molecular model reflecting donor kidney status based on transcriptomics data and molecular features reported in scientific literature to be associated with chronic allograft nephropathy was created. Significantly enriched biological processes were identified and representative markers were selected. An independent kidney pre-implantation transcriptomics dataset of 76 organs was used to predict estimated glomerular filtration rate (eGFR) values twelve months after transplantation using available clinical data and marker expression values. The best-performing regression model solely based on the clinical parameters donor age, donor gender, and recipient gender explained 17% of variance in post-transplant eGFR values. The five molecular markers EGF, CD2BP2, RALBP1, SF3B1, and DDX19B representing key molecular processes of the constructed renal donor organ status molecular model in addition to the clinical parameters significantly improved model performance (p-value = 0.0007) explaining around 33% of the variability of eGFR values twelve months after transplantation. Collectively, molecular markers reflecting donor organ status significantly add to prediction of post-transplant renal function when added to the clinical parameters donor age and gender.

  1. Caracterização molecular de butiazeiro por marcadores RAPD Molecular characterization of Pindo palm by RAPD markers

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes


    Full Text Available O grupo botânico Arecaceae é de extremo interesse por compreender plantas em extinção e por apresentar um grande potencial de exploração econômica. O butiazeiro (Butia capitata (Mart. Becc. ocorre naturalmente no Sul do Brasil. Sua caracterização molecular é de extremo interesse para futuros trabalhos de melhoramento genético. Assim sendo, verificou-se a variabilidade genética existente entre vinte e dois genótipos de butiazeiro da espécie (Butia capitata, pertencentes ao BAG (Banco Ativo de Germoplasma de frutíferas nativas do Centro Agropecuário da Palma - UFPel. Esses genótipos foram analisados usando marcadores do tipo RAPD (Random Amplified Polymorphic DNA. Um total de 136 fragmentos foram obtidos, sendo 77 polimórficos. O primer OPA11 apresentou maior polimorfismo, produzindo 9 perfis diferentes. A análise de agrupamento, realizada pelo método UPGMA, produziu um dendrograma que permitiu a clara separação dos genótipos em dois grupos principais. Verificou-se que, com a técnica de marcadores de RAPD, foi possível obter um perfil molecular único e uma estimativa da variabilidade existente entre os genótipos de butiazeiro avaliados.The study of the botanical group Arecaceae is of extreme interest for evolving several endangered species of plants and for presenting a great potential of economical exploration. The Pindo palm (or wine palm, jelly palm (Butia capitata (Mart. Becc. is natural from the south of Brazil. Its molecular characterization is of extreme interest for future researches of genetic improvement. Since little is known about the variability of the species, the existent genetic variability was verified among twenty-two genotypes of Pindo palm (or wine palm, jelly palm, from BAG (Germoplasm Assets Bank of fruit trees native from the Agricultural Center of the Palma - UFPEL, which were analyzed using markers RAPD (Random Amplified Polymorphic DNA with Operon Technologies' decamers primers. With 21 primers

  2. Molecular Markers Useful for Intraspecies Subtyping and Strain Differentiation of Dermatophytes. (United States)

    Mochizuki, Takashi; Takeda, Kiminobu; Anzawa, Kazushi


    Dermatophytosis is a very common skin disorder and the most frequent infection encountered by practicing dermatologists. The identification, pathogenicity, biology, and epidemiology of dermatophytes, the causative agents of dermatophytosis, are of interest for both dermatologists and medical mycologists. Recent advances in molecular methods have provided new techniques for identifying dermatophytes, including intraspecies variations. Intraspecies subtyping and strain differentiation have made possible the tracking of infections, the identification of common sources of infections, recurrence or reinfection after treatment, and analysis of strain virulence and drug resistance. This review describes molecular methods of intraspecies subtyping and strain differentiation, including analyses of mitochondrial DNA and non-transcribed spacer regions of ribosomal RNA genes, random amplification of polymorphic DNA, and microsatellite markers, along with their advantages and limitations.

  3. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms. (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio


    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from CONTACT: or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  4. Evaluation of white spot syndrome virus variable DNA loci as molecular markers of virus spread at intermediate spatiotemporal scales

    NARCIS (Netherlands)

    Bui Thi Minh Dieu,; Marks, H.; Zwart, M.P.; Vlak, J.M.


    Variable genomic loci have been employed in a number of molecular epidemiology studies of white spot syndrome virus (WSSV), but it is unknown which loci are suitable molecular markers for determining WSSV spread on different spatiotemporal scales. Although previous work suggests that multiple

  5. Detection of Variation in Long-Term Micropropagated Mature Pistachio via DNA-Based Molecular Markers. (United States)

    Akdemir, Hülya; Suzerer, Veysel; Tilkat, Engin; Onay, Ahmet; Çiftçi, Yelda Ozden


    Determination of genetic stability of in vitro-grown plantlets is needed for safe and large-scale production of mature trees. In this study, genetic variation of long-term micropropagated mature pistachio developed through direct shoot bud regeneration using apical buds (protocol A) and in vitro-derived leaves (protocol B) was assessed via DNA-based molecular markers. Randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) were employed, and the obtained PIC values from RAPD (0.226), ISSR (0.220), and AFLP (0.241) showed that micropropagation of pistachio for different periods of time resulted in "reasonable polymorphism" among donor plant and its 18 clones. Mantel's test showed a consistence polymorphism level between marker systems based on similarity matrices. In conclusion, this is the first study on occurrence of genetic variability in long-term micropropagated mature pistachio plantlets. The obtained results clearly indicated that different marker approaches used in this study are reliable for assessing tissue culture-induced variations in long-term cultured pistachio plantlets.

  6. Molecular Markers for Prostate Cancer in Formalin-Fixed Paraffin-Embedded Tissues

    Directory of Open Access Journals (Sweden)

    Tamara Sequeiros


    Full Text Available Prostate cancer (PCa is the most frequently diagnosed type of cancer in developed countries. The decisive method of diagnosis is based on the results of biopsies, morphologically evaluated to determine the presence or absence of cancer. Although this approach leads to a confident diagnosis in most cases, it can be improved by using the molecular markers present in the tissue. Both miRNAs and proteins are considered excellent candidates for biomarkers in formalin-fixed paraffin-embedded (FFPE tissues, due to their stability over long periods of time. In the last few years, a concerted effort has been made to develop the necessary tools for their reliable measurement in these types of samples. Furthermore, the use of these kinds of markers may also help in establishing tumor grade and aggressiveness, as well as predicting the possible outcomes in each particular case for the different treatments available. This would aid clinicians in the decision-making process. In this review, we attempt to summarize and discuss the potential use of microRNA and protein profiles in FFPE tissue samples as markers to better predict PCa diagnosis, progression, and response to therapy.

  7. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers. (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A


    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  8. Targeted introgression of cotton fibre quality quantitative trait loci using molecular markers

    International Nuclear Information System (INIS)

    Lacape, J.M.; Trung-Bieu Nguyen; Hau, B.; Giband, M.


    Within the framework of a cotton breeding programme, molecular markers are used to improve the efficiency of the introgression of fibre quality traits of Gossypium barbadense into G. hirsutum. A saturated genetic map was developed based on genotyping data obtained from the BC 1 (75 plants) and BC 2 (200 plants) generations. Phenotypic measurements conducted over three generations (BC 1 , BC 2 and BC 2 S 1 ) allowed 80 quantitative trait loci (QTL) to be detected for fibre length, uniformity, strength, elongation, fineness and colour. Positive QTL, i.e. those for which favourable alleles came from the G. barbadense parent, were harboured by 19 QTL-rich regions on 15 'carrier' chromosomes. In subsequent generations (BC 3 and BC 4 ), markers framing the QTL-rich regions were used to select about 10 percent of over 400 plants analysed in each generation. Although BC plants selected through the marker-assisted selection (MAS) process show promising fibre quality, only their full field evaluation will allow validation of the procedure. (author)

  9. Association of molecular markers with polyphenol oxidase activity in selected wheat genotypes

    International Nuclear Information System (INIS)

    Abbas, Z.; Javad, B.; Majeed, N.; Naqvi, S.


    Wheat (Triticum aestivum L.), a major staple food for the people of Pakistan and other Asian countries, is used as bread, chapatti, porridge, noodles and many other. It is established that color quality of wheat products depend on chemical and enzymatic factors especially the polyphenol oxidases (PPOs). These are copper containing enzymes which induce browning in wheat-based products. Various procedures for determining PPO activity available and differences in PPO activity among wheat genotypes have been documented. In present study, an attempt was made to establish the association of molecular markers with polyphenol oxidase activity in wheat genotypes having very high or very low PPO activities. Twelve pairs of markers were used out of which only three primer pairs viz. PPO43, PPO30 and WP2-2 yielded specific pattern discriminating high and low PPO genotypes. Cluster analysis for all 12 markers revealed that all the low PPO lline share the same sub cluster, but high PPO lines were dispersed in different clusters. (author)

  10. Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus. (United States)

    Manni, Mosè; Gomulski, Ludvik M; Aketarawong, Nidchaya; Tait, Gabriella; Scolari, Francesca; Somboon, Pradya; Guglielmino, Carmela R; Malacrida, Anna R; Gasperi, Giuliano


    The dramatic worldwide expansion of Aedes albopictus (the Asian tiger mosquito) and its vector competence for numerous arboviruses represent a growing threat to public health security. Molecular markers are crucially needed for tracking the rapid spread of this mosquito and to obtain a deeper knowledge of population structure. This is a fundamental requirement for the development of strict monitoring protocols and for the improvement of sustainable control measures. Wild population samples from putative source areas and from newly colonised regions were analysed for variability at the ribosomal DNA internal transcribed spacer 2 (ITS2). Moreover, a new set of 23 microsatellite markers (SSR) was developed. Sixteen of these SSRs were tested in an ancestral (Thailand) and two adventive Italian populations. Seventy-six ITS2 sequences representing 52 unique haplotypes were identified, and AMOVA indicated that most of their variation occurred within individuals (74.36%), while only about 8% was detected among populations. Spatial analyses of molecular variance revealed that haplotype genetic similarity was not related to the geographic proximity of populations and the haplotype phylogeny clearly indicated that highly related sequences were distributed across populations from different geographical regions. The SSR markers displayed a high level of polymorphism both in the ancestral and in adventive populations, and F ST estimates suggested the absence of great differentiation. The ancestral nature of the Thai population was corroborated by its higher level of variability. The two types of genetic markers here implemented revealed the distribution of genetic diversity within and between populations and provide clues on the dispersion dynamics of this species. It appears that the diffusion of this mosquito does not conform to a progressive expansion from the native Asian source area, but to a relatively recent and chaotic propagule distribution mediated by human activities

  11. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus) (United States)


    Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine

  12. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Timms Peter


    Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of

  13. Combined-modality treatment and organ preservation in bladder cancer. Do molecular markers predict outcome?

    International Nuclear Information System (INIS)

    Weiss, C.; Roedel, F.; Wolf, I.; Sauer, R.; Roedel, C.; Papadopoulos, T.; Engehausen, D.G.; Schrott, K.M.


    Purpose: in invasive bladder cancer, several groups have reported the value of organ preservation by a combined-treatment approach, including transurethral resection (TUR-BT) and radiochemotherapy (RCT). As more experience is acquired with this organ-sparing treatment, patient selection needs to be optimized. Clinical factors are limited in their potential to identify patients most likely to respond to RCT, thus, additional molecular markers for predicting treatment response of individual lesions are sorely needed. Patients and methods: the apoptotic index (AI) and Ki-67 index were evaluated by immunohistochemistry on pretreatment biopsies of 134 patients treated for bladder cancer by TUR-BT and RCT. Expression of each marker as well as clinicopathologic factors were then correlated with initial response, local control and cancer-specific survival with preserved bladder in univariate and multivariate analysis. Results: the median AI for all patients was 1.5% (range 0.2-7.4%). The percentage of Ki-67-positive cells in the tumors ranged from 0.2% to 85% with a median of 14.2%. A significant correlation was found for AI and tumor differentiation (G1/2: AI = 1.3% vs. G3/4: AI = 1.6%; p = 0.01). A complete response at restaging TUR-BT was achieved in 76% of patients. Factors predictive of complete response included T-category (p < 0.0001), resection status (p = 0.02), lymphovascular invasion (p = 0.01), and Ki-67 index (p = 0.02). For local control, AI (p = 0.04) and Ki-67 index (p = 0.05) as well as T-category (p = 0.005), R-status (p = 0.05), and lymphatic vessel invasion (p = 0.05) reached statistical significance. Out of the molecular markers only high Ki-67 levels were associated to cause-specific survival with preserved bladder. On multivariate analysis, T-category was the strongest independent factor for initial response, local control and cancer-specific survival with preserved bladder. Conclusion: The indices of pretreatment apoptosis and Ki-67 predict a

  14. Identification of the sources of primary organic aerosols at urban schools: A molecular marker approach

    International Nuclear Information System (INIS)

    Crilley, Leigh R.; Qadir, Raeed M.; Ayoko, Godwin A.; Schnelle-Kreis, Jürgen; Abbaszade, Gülcin; Orasche, Jürgen; Zimmermann, Ralf; Morawska, Lidia


    Children are particularly susceptible to air pollution and schools are examples of urban microenvironments that can account for a large portion of children's exposure to airborne particles. Thus this paper aimed to determine the sources of primary airborne particles that children are exposed to at school by analyzing selected organic molecular markers at 11 urban schools in Brisbane, Australia. Positive matrix factorization analysis identified four sources at the schools: vehicle emissions, biomass burning, meat cooking and plant wax emissions accounting for 45%, 29%, 16% and 7%, of the organic carbon respectively. Biomass burning peaked in winter due to prescribed burning of bushland around Brisbane. Overall, the results indicated that both local (traffic) and regional (biomass burning) sources of primary organic aerosols influence the levels of ambient particles that children are exposed at the schools. These results have implications for potential control strategies for mitigating exposure at schools. - Highlights: • Selected organic molecular markers at 11 urban schools were analyzed. • Four sources of primary organic aerosols were identified by PMF at the schools. • Both local and regional sources were found to influence exposure at the schools. • The results have implications for mitigation of children's exposure at schools. - The identification of the most important sources of primary organic aerosols at urban schools has implications for control strategies for mitigating children's exposure at schools

  15. Plastid and mitochondrial genomes of Coccophora langsdorfii (Fucales, Phaeophyceae and the utility of molecular markers.

    Directory of Open Access Journals (Sweden)

    Louis Graf

    Full Text Available Coccophora langsdorfii (Turner Greville (Fucales is an intertidal brown alga that is endemic to Northeast Asia and increasingly endangered by habitat loss and climate change. We sequenced the complete circular plastid and mitochondrial genomes of C. langsdorfii. The circular plastid genome is 124,450 bp and contains 139 protein-coding, 28 tRNA and 6 rRNA genes. The circular mitochondrial genome is 35,660 bp and contains 38 protein-coding, 25 tRNA and 3 rRNA genes. The structure and gene content of the C. langsdorfii plastid genome is similar to those of other species in the Fucales. The plastid genomes of brown algae in other orders share similar gene content but exhibit large structural recombination. The large in-frame insert in the cox2 gene in the mitochondrial genome of C. langsdorfii is typical of other brown algae. We explored the effect of this insertion on the structure and function of the cox2 protein. We estimated the usefulness of 135 plastid genes and 35 mitochondrial genes for developing molecular markers. This study shows that 29 organellar genes will prove efficient for resolving brown algal phylogeny. In addition, we propose a new molecular marker suitable for the study of intraspecific genetic diversity that should be tested in a large survey of populations of C. langsdorfii.

  16. Genetic Diversity Analysis of Tagetes Species Using PCR Based Molecular Markers

    International Nuclear Information System (INIS)

    Shahzadi, I.; Ahmad, R.; Waheed, U.; Shah, M. F.


    Tagetes is a genus of medicinally important wild and cultivated plants containing several chemical compounds. Lack of information on variation at molecular level present in Tagetes species is paramount to understand the genetic basis of medicinally important compounds. Current study aims at finding genetic variability in Tagetes species using random and specific molecular markers. Two primer systems including 25 RAPD and 3 STS (limonene gene) were used to ascertain genetic diversity of 15 Tagetes genotypes belonging to different species. We found that 20 of the 25 tested RAPD primers generated stable band patterns with 167 loci of amplification products. The proportion of polymorphic bands was 95.21 percent for RAPD primers. Three STS primers generated a total of 29 amplification products, of which 96.55 percent were polymorphic. Homology of genotypes was 53.18 percent and 51.11 percent with RAPD and STS primers respectively. The dendrogram obtained revealed that the range of overall genetic distances estimated was 22 percent to 100 percent through RAPD and 9 percent to 100 percent through STS markers. The findings help to establish that PCR-based assay such as RAPD and STS could be used successfully for estimation of genetic diversity of different genotypes of Tagetes that can be used for selection of parents for improvement of the species. (author)

  17. Molecular marker differences relate to developmental position and subsets of mesodiencephalic dopaminergic neurons.

    Directory of Open Access Journals (Sweden)

    Simone M Smits

    Full Text Available The development of mesodiencephalic dopaminergic (mdDA neurons located in the substantia nigra compacta (SNc and ventral tegmental area (VTA follow a number of stages marked by distinct events. After preparation of the region by signals that provide induction and patterning, several transcription factors have been identified, which are involved in specifying the neuronal fate of these cells. The specific vulnerability of SNc neurons is thought to root in these specific developmental programs. The present study examines the positions of young postmitotic mdDA neurons to relate developmental position to mdDA subset specific markers. MdDA neurons were mapped relative to the neuromeric domains (prosomeres 1-3 (P1-3, midbrain, and hindbrain as well as the longitudinal subdivisions (floor plate, basal plate, alar plate, as proposed by the prosomeric model. We found that postmitotic mdDA neurons are located mainly in the floorplate domain and very few in slightly more lateral domains. Moreover, mdDA neurons are present along a large proportion of the anterior/posterior axis extending from the midbrain to P3 in the diencephalon. The specific positions relate to some extent to the presence of specific subset markers as Ahd2. In the adult stage more of such subsets specific expressed genes are present and may represent a molecular map defining molecularly distinct groups of mdDA neurons.

  18. Labeling and analysis of chicken taste buds using molecular markers in oral epithelial sheets. (United States)

    Rajapaksha, Prasangi; Wang, Zhonghou; Venkatesan, Nandakumar; Tehrani, Kayvan F; Payne, Jason; Swetenburg, Raymond L; Kawabata, Fuminori; Tabata, Shoji; Mortensen, Luke J; Stice, Steven L; Beckstead, Robert; Liu, Hong-Xiang


    In chickens, the sensory organs for taste are the taste buds in the oral cavity, of which there are ~240-360 in total number as estimated by scanning electron microscopy (SEM). There is not an easy way to visualize all taste buds in chickens. Here, we report a highly efficient method for labeling chicken taste buds in oral epithelial sheets using the molecular markers Vimentin and α-Gustducin. Immediate tissue fixation following incubation with sub-epithelially injected proteases enabled us to peel off whole epithelial sheets, leaving the shape and integrity of the tissue intact. In the peeled epithelial sheets, taste buds labeled with antibodies against Vimentin and α-Gustducin were easily identified and counted under a light microscope and many more taste buds, patterned in rosette-like clusters, were found than previously reported with SEM. Broiler-type, female-line males have more taste buds than other groups and continue to increase the number of taste buds over stages after hatch. In addition to ovoid-shaped taste buds, big tube-shaped taste buds were observed in the chicken using 2-photon microscopy. Our protocol for labeling taste buds with molecular markers will factilitate future mechanistic studies on the development of chicken taste buds in association with their feeding behaviors.

  19. Acne Scar Treatment: A Multimodality Approach Tailored to Scar Type. (United States)

    Zaleski-Larsen, Lisa A; Fabi, Sabrina G; McGraw, Timothy; Taylor, Mark


    Acne scarring can be classified into atrophic icepick, boxcar, and rolling scars in addition to keloidal and hypertrophic scars. Additionally, these scars can be erythematous, hyperpigmented, and/or hypopigmented. Each scar type has a different structural cause warranting a customized approach. Many cosmetic options exist to address these changes individually, but little literature exists about the safety and efficacy of combining such procedures and devices. A Medline search was performed on combination treatments because it relates to facial acne scarring, and results are summarized. Practical applications for these combinations of procedures are also discussed. Studies examining the efficacy and safety of ablative, nonablative, fractionated, and nonfractionated lasers, dermabrasion, chemical peels, needling, subcision, radiofrequency, stem cell therapy, fat transplantation, platelet-rich plasma, and hyaluronic acid dermal fillers for acne scars were found. The authors review their experience in combining these techniques. Review of the literature revealed multiple single options for facial acne scarring treatment with minimal evidence in the literature found on the safety and efficacy of combining such procedures and devices. The authors' experience is that combining acne scar treatment techniques can be performed safely and synergistically with optimal patient outcomes.

  20. Chloroplast genome resources and molecular markers differentiate rubber dandelion species from weedy relatives. (United States)

    Zhang, Yingxiao; Iaffaldano, Brian J; Zhuang, Xiaofeng; Cardina, John; Cornish, Katrina


    Rubber dandelion (Taraxacum kok-saghyz, TK) is being developed as a domestic source of natural rubber to meet increasing global demand. However, the domestication of TK is complicated by its colocation with two weedy dandelion species, Taraxacum brevicorniculatum (TB) and the common dandelion (Taraxacum officinale, TO). TB is often present as a seed contaminant within TK accessions, while TO is a pandemic weed, which may have the potential to hybridize with TK. To discriminate these species at the molecular level, and facilitate gene flow studies between the potential rubber crop, TK, and its weedy relatives, we generated genomic and marker resources for these three dandelion species. Complete chloroplast genome sequences of TK (151,338 bp), TO (151,299 bp), and TB (151,282 bp) were obtained using the Illumina GAII and MiSeq platforms. Chloroplast sequences were analyzed and annotated for all the three species. Phylogenetic analysis within Asteraceae showed that TK has a closer genetic distance to TB than to TO and Taraxacum species were most closely related to lettuce (Lactuca sativa). By sequencing multiple genotypes for each species and testing variants using gel-based methods, four chloroplast Single Nucleotide Polymorphism (SNP) variants were found to be fixed between TK and TO in large populations, and between TB and TO. Additionally, Expressed Sequence Tag (EST) resources developed for TO and TK permitted the identification of five nuclear species-specific SNP markers. The availability of chloroplast genomes of these three dandelion species, as well as chloroplast and nuclear molecular markers, will provide a powerful genetic resource for germplasm differentiation and purification, and the study of potential gene flow among Taraxacum species.

  1. Status of potential PfATP6 molecular markers for artemisinin resistance in Suriname

    Directory of Open Access Journals (Sweden)

    Adhin Malti R


    Full Text Available Abstract Background Polymorphisms within the PfATP6 gene have been indicated as potential molecular markers for artemisinin efficacy. Since 2004, the use of artemisinin combination therapy (ACT was introduced as first-line treatment of the uncomplicated malaria cases in Suriname. The aim of this research was to determine changes in Suriname in the status of the polymorphic markers in the PfATP6 gene before and after the adoption of the ACT-regimen, particularly of the S769N mutation, which was reported to be associated with in vitro Artemether resistance in the neighboring country French Guiana. Methods The PfATP6 gene from Plasmodium falciparum parasites in Suriname was investigated in 28 samples using PCR amplification and restriction enzyme analysis, to assess and determine the prevalence of potentially interesting single nucleotide polymorphisms. The polymorphisms [L263E; A623E; S769N], which may be associated with the artemisinin resistant phenotype were characterized in parasites from three endemic regions before and after the adoption of the ACT-regimen. In addition, the status of these molecular markers was compared in paired P. falciparum isolates from patients with recurring malaria after controlled ACT. Results All the investigated samples exhibit the wild-type genotype at all three positions; L263, A623, S769. Conclusion All investigated isolates before and after the adoption of the ACT-regimen and independent of endemic region harbored the wild-type genotype for the three investigated polymorphisms. The study revealed that decreased artemisinin susceptibility could occur independent from PfATP6 mutations, challenging the assumption that artemisinin resistance is associated with these mutations in the PfATP6 gene.

  2. Molecular Assortment of Lens Species with Different Adaptations to Drought Conditions Using SSR Markers (United States)

    Singh, Dharmendra; Singh, Chandan Kumar; Tomar, Ram Sewak Singh; Taunk, Jyoti; Singh, Ranjeet; Maurya, Sadhana; Chaturvedi, Ashish Kumar; Pal, Madan; Singh, Rajendra; Dubey, Sarawan Kumar


    The success of drought tolerance breeding programs can be enhanced through molecular assortment of germplasm. This study was designed to characterize molecular diversity within and between Lens species with different adaptations to drought stress conditions using SSR markers. Drought stress was applied at seedling stage to study the effects on morpho-physiological traits under controlled condition, where tolerant cultivars and wilds showed 12.8–27.6% and 9.5–23.2% reduction in seed yield per plant respectively. When juxtaposed to field conditions, the tolerant cultivars (PDL-1 and PDL-2) and wild (ILWL-314 and ILWL-436) accessions showed 10.5–26.5% and 7.5%–15.6% reduction in seed yield per plant, respectively under rain-fed conditions. The reductions in seed yield in the two tolerant cultivars and wilds under severe drought condition were 48–49% and 30.5–45.3% respectively. A set of 258 alleles were identified among 278 genotypes using 35 SSR markers. Genetic diversity and polymorphism information contents varied between 0.321–0.854 and 0.299–0.836, with mean value of 0.682 and 0.643, respectively. All the genotypes were clustered into 11 groups based on SSR markers. Tolerant genotypes were grouped in cluster 6 while sensitive ones were mainly grouped into cluster 7. Wild accessions were separated from cultivars on the basis of both population structure and cluster analysis. Cluster analysis has further grouped the wild accessions on the basis of species and sub-species into 5 clusters. Physiological and morphological characters under drought stress were significantly (P = 0.05) different among microsatellite clusters. These findings suggest that drought adaptation is variable among wild and cultivated genotypes. Also, genotypes from contrasting clusters can be selected for hybridization which could help in evolution of better segregants for improving drought tolerance in lentil. PMID:26808306

  3. Transcriptome survey of Patagonian southern beech Nothofagus nervosa (= N. Alpina: assembly, annotation and molecular marker discovery

    Directory of Open Access Journals (Sweden)

    Torales Susana L


    Full Text Available Abstract Background Nothofagus nervosa is one of the most emblematic native tree species of Patagonian temperate forests. Here, the shotgun RNA-sequencing (RNA-Seq of the transcriptome of N. nervosa, including de novo assembly, functional annotation, and in silico discovery of potential molecular markers to support population and associations genetic studies, are described. Results Pyrosequencing of a young leaf cDNA library generated a total of 111,814 high quality reads, with an average length of 447 bp. De novo assembly using Newbler resulted into 3,005 tentative isotigs (including alternative transcripts. The non-assembled sequences (singletons were clustered with CD-HIT-454 to identify natural and artificial duplicates from pyrosequencing reads, leading to 21,881 unique singletons. 15,497 out of 24,886 non-redundant sequences or unigenes, were successfully annotated against a plant protein database. A substantial number of simple sequence repeat markers (SSRs were discovered in the assembled and annotated sequences. More than 40% of the SSR sequences were inside ORF sequences. To confirm the validity of these predicted markers, a subset of 73 SSRs selected through functional annotation evidences were successfully amplified from six seedlings DNA samples, being 14 polymorphic. Conclusions This paper is the first report that shows a highly precise representation of the mRNAs diversity present in young leaves of a native South American tree, N. nervosa, as well as its in silico deduced putative functionality. The reported Nothofagus transcriptome sequences represent a unique resource for genetic studies and provide a tool to discover genes of interest and genetic markers that will greatly aid questions involving evolution, ecology, and conservation using genetic and genomic approaches in the genus.

  4. Genetic molecular analysis of Coffea arabica (Rubiaceae hybrids using SRAP markers

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Mishra


    Full Text Available In Coffea arabica (arabica coffee, the phenotypic as well as genetic variability has been found low because of the narrow genetic basis and self fertile nature of the species. Because of high similarity in phenotypic appearance among the majority of arabica collections, selection of parental lines for inter-varietals hybridization and identification of resultant hybrids at an early stage of plant growth is difficult. DNA markers are known to be reliable in identifying closely related cultivars and hybrids. Sequence Related Amplified Polymorphism (SRAP is a new molecular marker technology developed based on PCR. In this paper, sixty arabica-hybrid progenies belonging to six crosses were analyzed using 31 highly polymorphic SRAP markers. The analysis revealed seven types of SRAP marker profiles which are useful in discriminating the parents and hybrids. The number of bands amplified per primer pair ranges from 6.13 to 8.58 with average number of seven bands. Among six hybrid combinations, percentage of bands shared between hybrids and their parents ranged from 66.29% to 85.71% with polymorphic bands varied from 27.64% to 60.0%. Percentage of hybrid specific fragments obtained in various hybrid combinations ranged from 0.71% to 10.86% and ascribed to the consequence of meiotic recombination. Based on the similarity index calculation, it was observed that F1 hybrids share maximum number of bands with the female parent compared to male parent. The results obtained in the present study revealed the effectiveness of SRAP technique in cultivar identification and hybrid analysis in this coffee species. Rev. Biol. Trop. 59 (2: 607-617. Epub 2011 June 01.

  5. Molecular genetic markers for thyroid FNAB. Established assays and future perspective. (United States)

    Musholt, Thomas J; Musholt, P B


    Thyroid nodules > 1 cm are observed in about 12% of unselected adult employees aged 18-65 years screened by ultrasound scan (40). While intensive ultrasound screening leads to early detection of thyroid diseases, the determination of benign or malignant behaviour remains uncertain and may trigger anxieties in many patients and their physicians. A considerable number of thyroid resections are consecutively performed due to suspicion of malignancy in the detected nodes. Fine needle aspiration biopsy (FNAB) has been recommended for the assessment of thyroid nodules to facilitate detection of thyroid carcinomas but also to rule out malignancy and thereby avoid unnecessary thyroid resections. However, cytology results are dependent on experience of the respective cytologist and unfortunately inconclusive in many cases. Molecular genetic markers are already used nowadays to enhance sensitivity and specificity of FNAB cytology in some centers in Germany. The most clinically relevant molecular genetic markers as pre-operative diagnostic tools and the clinical implications for the intraoperative and postoperative management were reviewed. Molecular genetic markers predominantly focus on the preoperative detection of thyroid malignancies rather than the exclusion of thyroid carcinomas. While some centers routinely assess FNABs, other centers concentrate on FNABs with cytology results of follicular neoplasia or suspicion of thyroid carcinoma. Predominantly mutations of BRAF, RET/PTC, RAS, and PAX8/PPARγ or expression of miRNAs are analyzed. However, only the detection of BRAF mutations predicts the presence of (papillary) thyroid malignancy with almost 98% probability, indicating necessity of oncologic thyroid resections irrespective of the cytology result. Other genetic alterations are associated with thyroid malignancy with varying frequency and achieve less impact on the clinical management. Molecular genetic analysis of FNABs is increasingly performed in Germany

  6. Combustion inputs into a terrestrial archive over 265 years as evidenced by BPCA molecular markers (United States)

    Hanke, Ulrich M.; Eglinton, Timothy I.; Wiedemeier, Daniel B.; Schmidt, Michael W. I.


    Pyrogenic organic matter (PyOM) such as char and soot is produced during the incomplete combustion of biomass and fossil fuel. It is composed of condensed aromatic structures and can resist degradation processes, maybe over long periods of time. Land-use changes, industrial activity and its transport by wind and water affect the fluxes of PyOM from the source to its sedimentary archive. Investigating environmental PyOM with the molecular marker benzene polycarboxylic acid (BPCA) method provides various information about quantity, quality (BPCA distribution pattern) and about its isotopic composition (13C and 14C). Assessing PyOM quality can indicate whether it is mostly combustion condensate (soot) or combustion residue (charcoal) and potentially allow source apportionment. Our study area is the Pettaquamscutt River catchment area (35 km2), Rhode Island, U.S.A. It is located down-wind of industrial areas recording deposition of long-distance atmospheric transport as well as local catchment inputs, both from natural and anthropogenic sources. We investigated 50 samples of a sediment record over a time span of 265 years (1733-1998 AD). Previous investigations provided information on the age of deposition, the content of polycyclic aromatic hydrocarbons (PAH) as well as of the radiocarbon contents of total organic carbon (TOC) and PAH (Lima, 2004). We used the BPCA molecular marker method to quantify and characterize PyOM in the same record. First results show that quantity and quality of PyOM change over 265 years. Our investigation aims at understanding how different sources of PyOM are reflected in terrestrial archives by comparing the results of BPCA with radiocarbon-dated TOC and PAH records. Among other aspects, the PAH record reflects the Great Depression and the 1970s oil embargo in North America. We interpret the BPCA distribution patterns regarding the simultaneous shift of dominant fuels including wood, coal, petroleum and gas. Future work will include

  7. Molecular markers of carcinogenesis for risk stratification of individuals with colorectal polyps: a case-control study. (United States)

    Gupta, Samir; Sun, Han; Yi, Sang; Storm, Joy; Xiao, Guanghua; Balasubramanian, Bijal A; Zhang, Song; Ashfaq, Raheela; Rockey, Don C


    Risk stratification using number, size, and histology of colorectal adenomas is currently suboptimal for identifying patients at increased risk for future colorectal cancer. We hypothesized that molecular markers of carcinogenesis in adenomas, measured via immunohistochemistry, may help identify high-risk patients. To test this hypothesis, we conducted a retrospective, 1:1 matched case-control study (n = 216; 46% female) in which cases were patients with colorectal cancer and synchronous adenoma and controls were patients with adenoma but no colorectal cancer at baseline or within 5 years of follow-up. In phase I of analyses, we compared expression of molecular markers of carcinogenesis in case and control adenomas, blind to case status. In phase II of analyses, patients were randomly divided into independent training and validation groups to develop a model for predicting case status. We found that seven markers [p53, p21, Cox-2, β-catenin (BCAT), DNA-dependent protein kinase (DNApkcs), survivin, and O6-methylguanine-DNA methyltransferase (MGMT)] were significantly associated with case status on unadjusted analyses, as well as analyses adjusted for age and advanced adenoma status (P marker component). When applied to the validation set, a predictive model using these seven markers showed substantial accuracy for identifying cases [area under the receiver operation characteristic curve (AUC), 0.83; 95% confidence interval (CI), 0.74-0.92]. A parsimonious model using three markers performed similarly to the seven-marker model (AUC, 0.84). In summary, we found that molecular markers of carcinogenesis distinguished adenomas from patients with and without colorectal cancer. Furthermore, we speculate that prospective studies using molecular markers to identify individuals with polyps at risk for future neoplasia are warranted. ©2014 American Association for Cancer Research.

  8. Roentgenodiagnosis of stomach postulcer scar

    International Nuclear Information System (INIS)

    Strunin, A.E.


    A study was made of the X-ray picture of the stomach postulcer scar in correlation with fibrogastroscopy in 39 patients. The X-ray picture was characterized by considerable polymorphism and at the same time it was difficult to single out pathognomonic features. For specified diagnosis and differentiation the detection of the postulcer scar must become a multifaceted roentgenoendoscopic problem. Stomach ulcers may scar, sometimes with the complete regeneration of the mucosa relief, however their recurrences can develop in the zone of the postulcer scar

  9. Molecular markers derived from bombesin for tumor diagnosis by SPECT and PET

    International Nuclear Information System (INIS)

    Pujatti, Priscilla Brunelli


    A high number of molecules have already been identified to have high affinity to some receptors overexpressed on tumour cells and the radiolabelling of those molecules offers the possibility of new compounds for tumour diagnosis and therapy by nuclear medicine. Among of those molecules, bombesin (BBN) has become focus of interest, as its BB 2 receptors are known to be overexpressed in prostate, breast, colon, pancreatic and lung tumour, as long as glioblastomas and neuroblastomas. BBN agonists and antagonists have already been described for this purpose and promising results were obtained in preclinical studies. However, most of them exhibited high abdominal accumulation, especially in pancreas and intestines, which can compromise diagnosis accuracy and cause serious adverse effects in therapy. In this context, the goal of the present work to radiolabel new BBN derivatives with 11 1In and 68 Ga and to evaluate their potential for BB 2 positive tumors diagnosis by single photon emission tomography (SPECT) and positron emission tomography (PET). The structure of studied peptides was Q-YG n -BBN(6-14), where Q is the chelator, n is the number of glycine aminoacids in the spacer YG n and BBN(6-14) is the original bombesin sequence from the aminoacid 6 to 14. The derivative in which the last aminoacid (methionine, Met) was replaced by norleucine (Nle) was also evaluated. The experimental evaluation of the bombesin derivatives was divided into four steps: computational studies, molecular markers for SPECT, molecular markers for PET and toxicological studies. The theoretical partition (log P) and distribution (log D) coefficients were calculated for all bombesin derivatives conjugated to DTPA (diethylenetriaminepentaacetic acid) and DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) chelators applying computational programmes. Bombesin derivatives for SPECT were developed by radiolabelling DTPA-conjugated bombesin derivatives with 111 In to determine the best

  10. Molecular markers of anti-malarial drug resistance in Lahj Governorate, Yemen: baseline data and implications

    Directory of Open Access Journals (Sweden)

    Chance Michael L


    Full Text Available Abstract Background This is an investigation of anti-malarial molecular markers coupled with a therapeutic efficacy test of chloroquine (CQ against falciparum malaria in an area of unstable malaria in Lahj Governorate, Yemen. The study was aimed at assessment of therapeutic response to CQ and elucidation of baseline information on molecular markers for Plasmodium falciparum resistance against CQ and sulphadoxine/pyrimethamine (SP. Methods Between 2002 and 2003 the field test was conducted according to the standard WHO protocol to evaluate the therapeutic efficacy of CQ in 124 patients with falciparum malaria in an endemic area in Lahj Governorate in Yemen. Blood samples collected during this study were analysed for P. falciparum chloroquine resistance transporter gene (pfcrt-76 polymorphisms, mutation pfcrt-S163R and the antifolate resistance-associated mutations dihydrofolate reductase (dhfr-C59R and dihydropteroate synthase (dhps-K540E. Direct DNA sequencing of the pfcrt gene from three representative field samples was carried out after DNA amplification of the 13 exons of the pfcrt gene. Results Treatment failure was detected in 61% of the 122 cases that completed the 14-day follow-up. The prevalence of mutant pfcrt T76 was 98% in 112 amplified pre-treatment samples. The presence of pfcrt T76 was poorly predictive of in vivo CQ resistance (PPV = 61.8%, 95% CI = 52.7-70.9. The prevalence of dhfr Arg-59 mutation in 99 amplified samples was 5%, while the dhps Glu-540 was not detected in any of 119 amplified samples. Sequencing the pfcrt gene confirmed that Yemeni CQ resistant P. falciparum carry the old world (Asian and African CQ resistant haplotype CVIETSESI at positions 72,73,74,75,76,220,271, 326 and 371. Conclusion This is the first study to report baseline information on the characteristics and implications of anti-malarial drug resistance markers in Yemen. It is also the first report of the haplotype associated with CQR P. falciparum

  11. Molecular markers of anti-malarial drug resistance in Lahj Governorate, Yemen: baseline data and implications. (United States)

    Mubjer, Reem A; Adeel, Ahmed A; Chance, Michael L; Hassan, Amir A


    This is an investigation of anti-malarial molecular markers coupled with a therapeutic efficacy test of chloroquine (CQ) against falciparum malaria in an area of unstable malaria in Lahj Governorate, Yemen. The study was aimed at assessment of therapeutic response to CQ and elucidation of baseline information on molecular markers for Plasmodium falciparum resistance against CQ and sulphadoxine/pyrimethamine (SP). Between 2002 and 2003 the field test was conducted according to the standard WHO protocol to evaluate the therapeutic efficacy of CQ in 124 patients with falciparum malaria in an endemic area in Lahj Governorate in Yemen. Blood samples collected during this study were analysed for P. falciparum chloroquine resistance transporter gene (pfcrt)-76 polymorphisms, mutation pfcrt-S163R and the antifolate resistance-associated mutations dihydrofolate reductase (dhfr)-C59R and dihydropteroate synthase (dhps)-K540E. Direct DNA sequencing of the pfcrt gene from three representative field samples was carried out after DNA amplification of the 13 exons of the pfcrt gene. Treatment failure was detected in 61% of the 122 cases that completed the 14-day follow-up. The prevalence of mutant pfcrt T76 was 98% in 112 amplified pre-treatment samples. The presence of pfcrt T76 was poorly predictive of in vivo CQ resistance (PPV = 61.8%, 95% CI = 52.7-70.9). The prevalence of dhfr Arg-59 mutation in 99 amplified samples was 5%, while the dhps Glu-540 was not detected in any of 119 amplified samples. Sequencing the pfcrt gene confirmed that Yemeni CQ resistant P. falciparum carry the old world (Asian and African) CQ resistant haplotype CVIETSESI at positions 72,73,74,75,76,220,271, 326 and 371. This is the first study to report baseline information on the characteristics and implications of anti-malarial drug resistance markers in Yemen. It is also the first report of the haplotype associated with CQR P. falciparum parasites from Yemen. Mutant pfcrtT76 is highly prevalent but it

  12. [Development of indel markers for molecular authentication of Panax ginseng and P. quinquefolius]. (United States)

    Wang, Rong-Bo; Tian, Hui-Li; Wang, Hong-Tao; Li, Gui-Sheng


    Panax ginseng and P. quinquefolius are two kinds of important medicinal herbs. They are morphologically similar but have different pharmacological effects. Therefore, botanical origin authentication of these two ginsengs is of great importance for ensuring pharmaceutical efficacy and food safety. Based on the fact that intron position in orthologous genes is highly conserved across plant species, intron length polymorphisms were exploited from unigenes of ginseng. Specific primers were respectively designed for these two species based on their insertion/deletion sequences of cytochrome P450 and glyceraldehyde 3-phosphate dehydrogenase, and multiplex PCR was conducted for molecular authentication of P.ginseng and P. quinquefolius. The results showed that the developed multiplex PCR assay was effective for molecular authentication of P.ginseng and P. quinquefolius without strict PCR condition and the optimization of reaction system.This study provides a preferred ideal marker system for molecular authentication of ginseng,and the presented method can be employed in origin authentication of other herbal preparations. Copyright© by the Chinese Pharmaceutical Association.

  13. Evolutionary history of genus Macrobrachium inferred from mitochondrial markers: a molecular clock approach. (United States)

    Jose, Deepak; Harikrishnan, Mahadevan


    Caridea, an infraorder of shrimps coming under Pleocyemata was first reported from the oceans before 417 million years followed by their radiation recorded during the Permian period. Hitherto, about 3877 extant caridean species were accounted within which one quarter constitute freshwater species. Freshwater prawns of genus Macrobrachium (Infraorder Caridea; Family Palaemonidae), with more than 240 species are inhabitants of diverse aquatic habitats like coastal lagoons, lakes, tropical streams, ponds and rivers. Previous studies on Macrobrachium relied on the highly variable morphological characters which were insufficient for accurate diagnosis of natural species groups. Present study focuses on the utility of molecular markers (viz. COI and 16S rRNA) for resolving the evolutionary history of genus Macrobrachium using a combination of phylogeny and timescale components. It is for the first time a molecular clock approach had been carried out towards genus Macrobrachium in a broad aspect with the incorporation of congeners inhabiting diverse geographical realms including endemic species M. striatum from South West coast of India. Molecular results obtained revealed the phylogenetic relationships between congeners of genus Macrobrachium at intra/inter-continental level along with the corresponding evolutionary time estimates.

  14. Molecular analysis of commercial date palm cultivars in Lybia using ISSR and SRAP PCR-based markers

    Directory of Open Access Journals (Sweden)

    Khalifa Noha S.


    Full Text Available Little is known about the molecular structure of the date palm (Phoenix dactylifera L. despite its importance as invaluable drought tolerant crop. Intervarietal variation and cultivar identification are crucial for breeding and gene bank conservation of this plant worldwide. In this work, two PCR based marker systems (ISSR and SRAP were applied on top quality eight commercial cultivars in Libya (Umfetity, Bekrary, Alhamraya, Sufeer Genab, Alsaeedy Show, Farag Barameel, Majhool Alheelo and Alkhadraya. DNA variations were explored using eleven ISSR and nine combinations of SRAP markers. All markers used generated polymorphic bands among the different cultivars that can be used as molecular markers for their differentiation. The genetic distance between cultivars was also estimated from banding patterns. Our results indicate that ISSR and SRAP systems can efficiently identify and differentiate between the selected cultivars. This work can be used as a model to establish a road map for all date palm cultivars worldwide.

  15. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1 (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.


    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  16. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.). (United States)

    Robarts, Daniel W H; Wolfe, Andrea D


    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  17. Analysis of molecular markers as predictive factors of lymph node involvement in breast carcinoma. (United States)

    Paula, Luciana Marques; De Moraes, Luis Henrique Ferreira; Do Canto, Abaeté Leite; Dos Santos, Laurita; Martin, Airton Abrahão; Rogatto, Silvia Regina; De Azevedo Canevari, Renata


    Nodal status is the most significant independent prognostic factor in breast cancer. Identification of molecular markers would allow stratification of patients who require surgical assessment of lymph nodes from the large numbers of patients for whom this surgical procedure is unnecessary, thus leading to a more accurate prognosis. However, up to now, the reported studies are preliminary and controversial, and although hundreds of markers have been assessed, few of them have been used in clinical practice for treatment or prognosis in breast cancer. The purpose of the present study was to determine whether protein phosphatase Mg2+/Mn2+ dependent 1D, β-1,3-N-acetylglucosaminyltransferase, neural precursor cell expressed, developmentally down-regulated 9, prohibitin, phosphoinositide-3-kinase regulatory subunit 5 (PIK3R5), phosphatidylinositol-5-phosphate 4-kinase type IIα, TRF1-interacting ankyrin-related ADP-ribose polymerase 2, BCL2 associated agonist of cell death, G2 and S-phase expressed 1 and PAX interacting protein 1 genes, described as prognostic markers in breast cancer in a previous microarray study, are also predictors of lymph node involvement in breast carcinoma Reverse transcription-quantitative polymerase chain reaction analysis was performed on primary breast tumor tissues from women with negative lymph node involvement (n=27) compared with primary tumor tissues from women with positive lymph node involvement (n=23), and was also performed on primary tumors and paired lymph node metastases (n=11). For all genes analyzed, only the PIK3R5 gene exhibited differential expression in samples of primary tumors with positive lymph node involvement compared with primary tumors with negative lymph node involvement (P=0.0347). These results demonstrate that the PIK3R5 gene may be considered predictive of lymph node involvement in breast carcinoma. Although the other genes evaluated in the present study have been previously characterized to be involved with

  18. De novo transcriptome analysis and molecular marker development of two Hemarthria species

    Directory of Open Access Journals (Sweden)

    Xiu eHuang


    Full Text Available Hemarthria R. Br. is an important genus of perennial forage grasses that is widely used in subtropical and tropical regions. Hemarthria grasses have made remarkable contributions to the development of animal husbandry and agro-ecosystem maintenance; however, there is currently a lack of comprehensive genomic data available for these species. In this study, we used Illumina high-throughput deep sequencing to characterize of two agriculturally important Hemarthria materials, H. compressa ‘Yaan’ and H. altissima ‘1110.’ Sequencing runs that used each of four normalized RNA samples from the leaves or roots of the two materials yielded more than 24 million high-quality reads. After de novo assembly, 137,142 and 77,150 unigenes were obtained for ‘Yaan’ and ‘1110’, respectively. In addition, a total of 86,731 ‘Yaan’ and 48,645 ‘1110’ unigenes were successfully annotated. After consolidating the unigenes for both materials, 42,646 high-quality SNPs were identified in 10,880 unigenes and 10,888 SSRs were identified in 8,330 unigenes. To validate the identified markers, high quality PCR primers were designed for both SNPs and SSRs. We randomly tested 16 of the SNP primers and 54 of the SSR primers and found that the majority of these primers successfully amplified the desired PCR product. In addition, high cross-species transferability (61.11%-87.04% of SSR markers was achieved for four other Poaceae species. The amount of RNA sequencing data that was generated for these two Hemarthria species greatly increases the amount of genomic information available for Hemarthria and the SSR and SNP markers identified in this study will facilitate further advancements in genetic and molecular studies of the Hemarthria genus.

  19. Assessment on Evaluating Parameters of Rice Core Collections Constructed by Genotypic Values and Molecular Marker Information

    Directory of Open Access Journals (Sweden)

    Jian-cheng WANG


    Full Text Available Eleven evaluating parameters for rice core collection were assessed based on genotypic values and molecular marker information. Monte Carlo simulation combined with mixed linear model was used to eliminate the interference from environment in order to draw more reliable results. The coincidence rate of range (CR was the optimal parameter. Mean Simpson index (MD, mean Shannon-Weaver index of genetic diversity (MI and mean polymorphism information content (MPIC were important evaluating parameters. The variable rate of coefficient of variation (VR could act as an important reference parameter for evaluating the variation degree of core collection. Percentage of polymorphic loci (p could be used as a determination parameter for the size of core collection. Mean difference percentage (MD was a determination parameter for the reliability judgment of core collection. The effective evaluating parameters for core collection selected in the research could be used as criteria for sampling percentage in different plant germplasm populations.

  20. Genetic Diversity of Some Tunisian Botrytis cinerea Isolates Using Molecular Markers

    Directory of Open Access Journals (Sweden)

    D. ben Ahmed


    Full Text Available The genetic diversity of Botrytis cinerea in Tunisia was studied using molecular markers, and the level of resistance to the fungicide fenhexamid was shown. Isolates from different plants (grape, tomato, cucumber, onion, strawberry, gerbera and rose and different parts of the country were analysed in order to determine whether the two groups, transposa and vacuma, that were detected in French vineyards, are also present in Tunisia. A combined PCR and Dot Blot method was developed to identify the transposable elements Boty and Flipper that distinguish between these two B. cinerea groups. Both the transposa and vacuma groups, and isolates containing the transposable element Boty, were found in Tunisia. Moreover, analysis of the Bc-hch locus by PCR and restriction enzyme digestion identified only the B. cinerea group corresponding to one allelic type. Finally, by using the level of resistance shown by B. cinerea to the fungicide fenhexamid as a marker, it was confirmed that this was the only group of B. cinerea in the Tunisian population.

  1. Molecular marker analysis as a guide to the sources of fine organic aerosols

    International Nuclear Information System (INIS)

    Rogge, W.F.; Cass, G.R.; Hildemann, L.M.; Simoneit, B.R.T.


    The molecular composition of fine particulate (D p ≥ 2 μm) organic aerosol emissions from the most important sources in the Los Angeles area has been determined. Likewise, ambient concentration patterns for more than 80 single organic compounds have been measured at four urban sites (West Los Angeles, Downtown Los Angeles, Pasadena, and Rubidoux) and at one remote offshore site (San Nicolas Island). It has been found that cholesterol serves as a marker compound for emissions from charbroilers and other meat cooking operations. Vehicular exhaust being emitted from diesel and gasoline powered engines can be traced in the Los Angeles atmosphere using fossil petroleum marker compounds such as steranes and pentacyclic triterpanes (e.g., hopanes). Biogenic fine particle emission sources such as plant fragments abraded from leaf surfaces by wind and weather can be traced in the urban atmosphere. Using distinct and specific source organic tracers or assemblages of organic compounds characteristic for the sources considered it is possible to estimate the influence of different source types at any urban site where atmospheric data are available

  2. Detection of molecular markers by comparative sequence analysis of enzymes from mycobacteria species

    International Nuclear Information System (INIS)

    Asad, S.; Hussain, M.; Siddiqua, A.; Ain, Q.U.


    Mycobacterial species are one of the most important pathogens and among these members of non-tuberculous mycobacteria (NTM) and mycobacterial tuberculousis complex (MTC) are the causative agent of a relatively milder form of Tuberculosis. Traditional methods for identification of these groups of pathogens are time consuming, lack specificity and sensitivity and furthermore lead to the misidentification due to high similarity index. Therefore, more rapid, specific and cost-effective methods are required for the accurate identification of Mycobacterium species in routine diagnostics. In our study, we identified molecular markers in order to differentiate closely related cousin species of genus Mycobacterium including M. bovis, M. avium, M. leprae and M. tuberculosis. The nucleotide sequences of selected unique markers, i.e., enzymes (used previously in various biochemical tests for the identification of M. species) were selected and their ORFs were retrieved and selected functional proteins of respective biosynthetic pathways were compared in-silico. Result suggested that the variations in nucleotide sequences of the selected enzymes can be directly used for M. species discrimination in one step PCR test. We believe that the in-silico identification and storage of these distinctive characteristics of individual M. species will help in more precise recognition of pathogenic strains and hence specie specific targeted therapy. (author)

  3. Transcriptome analysis in Concholepas concholepas (Gastropoda, Muricidae): mining and characterization of new genomic and molecular markers. (United States)

    Cárdenas, Leyla; Sánchez, Roland; Gomez, Daniela; Fuenzalida, Gonzalo; Gallardo-Escárate, Cristián; Tanguy, Arnaud


    The marine gastropod Concholepas concholepas, locally known as the "loco", is the main target species of the benthonic Chilean fisheries. Genetic and genomic tools are necessary to study the genome of this species in order to understand the molecular basis of its development, growth, and other key traits to improve the management strategies and to identify local adaptation to prevent loss of biodiversity. Here, we use pyrosequencing technologies to generate the first transcriptomic database from adult specimens of the loco. After trimming, a total of 140,756 Expressed Sequence Tag sequences were achieved. Clustering and assembly analysis identified 19,219 contigs and 105,435 singleton sequences. BlastN analysis showed a significant identity with Expressed Sequence Tags of different gastropod species available in public databases. Similarly, BlastX results showed that only 895 out of the total 124,654 had significant hits and may represent novel genes for marine gastropods. From this database, simple sequence repeat motifs were also identified and a total of 38 primer pairs were designed and tested to assess their potential as informative markers and to investigate their cross-species amplification in different related gastropod species. This dataset represents the first publicly available 454 data for a marine gastropod endemic to the southeastern Pacific coast, providing a valuable transcriptomic resource for future efforts of gene discovery and development of functional markers in other marine gastropods. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Three Molecular Markers Show No Evidence of Population Genetic Structure in the Gouldian Finch (Erythrura gouldiae.

    Directory of Open Access Journals (Sweden)

    Peri E Bolton

    Full Text Available Assessment of genetic diversity and connectivity between regions can inform conservation managers about risk of inbreeding, potential for adaptation and where population boundaries lie. The Gouldian finch (Erythrura gouldiae is a threatened species in northern Australia, occupying the savannah woodlands of the biogeographically complex monsoon tropics. We present the most comprehensive population genetic analysis of diversity and structure the Gouldian finch using 16 microsatellite markers, mitochondrial control region and 3,389 SNPs from genotyping-by-sequencing. Mitochondrial diversity is compared across three related, co-distributed finches with different conservation threat-statuses. There was no evidence of genetic differentiation across the western part of the range in any of the molecular markers, and haplotype diversity but not richness was lower than a common co-distributed species. Individuals within the panmictic population in the west may be highly dispersive within this wide area, and we urge caution when interpreting anecdotal observations of changes to the distribution and/or flock sizes of Gouldian finch populations as evidence of overall changes to the population size of this species.

  5. Associations between colorectal cancer molecular markers and pathways with clinicopathologic features in older women. (United States)

    Samadder, N Jewel; Vierkant, Robert A; Tillmans, Lori S; Wang, Alice H; Weisenberger, Daniel J; Laird, Peter W; Lynch, Charles F; Anderson, Kristin E; French, Amy J; Haile, Robert W; Potter, John D; Slager, Susan L; Smyrk, Thomas C; Thibodeau, Stephen N; Cerhan, James R; Limburg, Paul J


    Colorectal tumors have a large degree of molecular heterogeneity. Three integrated pathways of carcinogenesis (ie, traditional, alternate, and serrated) have been proposed, based on specific combinations of microsatellite instability (MSI), CpG island methylator phenotype (CIMP), and mutations in BRAF and KRAS. We used resources from the population-based Iowa Women's Health Study (n = 41,836) to associate markers of colorectal tumors, integrated pathways, and clinical and pathology characteristics, including survival times. We assessed archived specimens from 732 incident colorectal tumors and characterized them as microsatellite stable (MSS), MSI high or MSI low, CIMP high or CIMP low, CIMP negative, and positive or negative for BRAF and/or KRAS mutations. Informative marker data were collected from 563 tumors (77%), which were assigned to the following integrated pathways: traditional (MSS, CIMP negative, BRAF mutation negative, and KRAS mutation negative; n = 170), alternate (MSS, CIMP low, BRAF mutation negative, and KRAS mutation positive; n = 58), serrated (any MSI, CIMP high, BRAF mutation positive, and KRAS mutation negative; n = 142), or unassigned (n = 193). Multivariable-adjusted Cox proportional hazards regression models were used to assess the associations of interest. Patients' mean age (P = .03) and tumors' anatomic subsite (P = .0001) and grade (P = .0001) were significantly associated with integrated pathway assignment. Colorectal cancer (CRC) mortality was not associated with the traditional, alternate, or serrated pathways, but was associated with a subset of pathway-unassigned tumors (MSS or MSI low, CIMP negative, BRAF mutation negative, and KRAS mutation positive) (n = 96 cases; relative risk = 1.76; 95% confidence interval, 1.07-2.89, compared with the traditional pathway). We identified clinical and pathology features associated with molecularly defined CRC subtypes. However, additional studies are needed to determine how these features

  6. Can Acne Scars Be Removed? (United States)

    ... Safe Videos for Educators Search English Español Can Acne Scars Be Removed? KidsHealth / For Teens / Can Acne ... eliminar las cicatrices del acné? Different Types of Acne Scars from acne can seem like double punishment — ...

  7. Effect of lifelong football training on the expression of muscle molecular markers involved in healthy longevity. (United States)

    Mancini, A; Vitucci, D; Labruna, G; Imperlini, E; Randers, M B; Schmidt, J F; Hagman, M; Andersen, T R; Russo, R; Orrù, S; Krustrup, P; Salvatore, F; Buono, P


    We investigated whether lifelong football training affects the expression of healthy longevity-related muscle molecular markers. Biopsies were collected from the vastus lateralis muscle of 10 lifelong football-trained men (68.2 ± 3.0 years) and of 10 active untrained healthy men (66.7 ± 1.3 years). Gene and protein expression was measured by RTqPCR on RNA and by western blotting on protein extracts from muscle biopsies, respectively. The expression of AMPKα1/α2, NAMPT, TFAM and PGC1α, which are markers of oxidative metabolism, and MyHC β isoform expression was higher in the muscle of football-trained men vs untrained men. Also citrate synthase activity was higher in trained than in untrained men (109.3 ± 9.2 vs 75.1 ± 9.2 mU/mg). These findings were associated with a healthier body composition in trained than in untrained men [body weight: 78.2 ± 6.5 vs 91.2 ± 11.2 kg; body mass index BMI: 24.4 ± 1.6 vs 28.8 ± 4.0 kg m -2 ; fat%: 22.6 ± 8.0 vs 31.4 ± 5.0%)] and with a higher maximal oxygen uptake (VO 2 max: 34.7 ± 3.8 vs 27.3 ± 4.0 ml/min/kg). Also the expression of proteins involved in DNA repair and in senescence suppression (Erk1/2, Akt and FoxM1) was higher in trained than in untrained men. At BMI- and age-adjusted multiple linear regression analysis, fat percentage was independently associated with Akt protein expression, and VO 2 max was independently associated with TFAM mRNA and with Erk1/2 protein expression. Lifelong football training increases the expression of key markers involved in muscle oxidative metabolism, and in the DNA repair and senescence suppression pathways, thus providing the molecular basis for healthy longevity.

  8. Widespread utility of highly informative AFLP molecular markers across divergent shark species. (United States)

    Zenger, Kyall R; Stow, Adam J; Peddemors, Victor; Briscoe, David A; Harcourt, Robert G


    Population numbers of many shark species are declining rapidly around the world. Despite the commercial and conservation significance, little is known on even the most fundamental aspects of their population biology. Data collection that relies on direct observation can be logistically challenging with sharks. Consequently, molecular methods are becoming increasingly important to obtain knowledge that is critical for conservation and management. Here we describe an amplified fragment length polymorphism method that can be applied universally to sharks to identify highly informative genome-wide polymorphisms from 12 primer pairs. We demonstrate the value of our method on 15 divergent shark species within the superorder Galeomorphii, including endangered species which are notorious for low levels of genetic diversity. Both the endangered sand tiger shark (Carcharodon taurus, N = 18) and the great white shark (Carcharodon carcharias, N = 7) displayed relatively high levels of allelic diversity. A total of 59 polymorphic loci (H(e) = 0.373) and 78 polymorphic loci (H(e) = 0.316) were resolved in C. taurus and C. carcharias, respectively. Results from other sharks (e.g., Orectolobus ornatus, Orectolobus sp., and Galeocerdo cuvier) produced remarkably high numbers of polymorphic loci (106, 94, and 86, respectively) from a limited sample size of only 2. A major constraint to obtaining much needed genetic data from sharks is the time-consuming process of developing molecular markers. Here we demonstrate the general utility of a technique that provides large numbers of informative loci in sharks.

  9. Molecular Markers for Interspecies Transmission of Avian Influenza Viruses in Mammalian Hosts (United States)

    Lee, Taehyung


    In the last decade, a wide range of avian influenza viruses (AIVs) have infected various mammalian hosts and continuously threaten both human and animal health. It is a result of overcoming the inter-species barrier which is mostly associated with gene reassortment and accumulation of mutations in their gene segments. Several recent studies have shed insights into the phenotypic and genetic changes that are involved in the interspecies transmission of AIVs. These studies have a major focus on transmission from avian to mammalian species due to the high zoonotic potential of the viruses. As more mammalian species have been infected with these viruses, there is higher risk of genetic evolution of these viruses that may lead to the next human pandemic which represents and raises public health concern. Thus, understanding the mechanism of interspecies transmission and molecular determinants through which the emerging AIVs can acquire the ability to transmit to humans and other mammals is an important key in evaluating the potential risk caused by AIVs among humans. Here, we summarize previous and recent studies on molecular markers that are specifically involved in the transmission of avian-derived influenza viruses to various mammalian hosts including humans, pigs, horses, dogs, and marine mammals. PMID:29236050

  10. Long-term monitoring of molecular markers can distinguish different seasonal patterns of fecal indicating bacteria sources. (United States)

    Riedel, Timothy E; Thulsiraj, Vanessa; Zimmer-Faust, Amity G; Dagit, Rosi; Krug, Jenna; Hanley, Kaitlyn T; Adamek, Krista; Ebentier, Darcy L; Torres, Robert; Cobian, Uriel; Peterson, Sophie; Jay, Jennifer A


    Elevated levels of fecal indicator bacteria (FIB) have been observed at Topanga Beach, CA, USA. To identify the FIB sources, a microbial source tracking study using a dog-, a gull- and two human-associated molecular markers was conducted at 10 sites over 21 months. Historical data suggest that episodic discharge from the lagoon at the mouth of Topanga Creek is the main source of bacteria to the beach. A decline in creek FIB/markers downstream from upper watershed development and a sharp increase in FIB/markers at the lagoon sites suggest sources are local to the lagoon. At the lagoon and beach, human markers are detected sporadically, dog marker peaks in abundance mid-winter, and gull marker is chronically elevated. Varied seasonal patterns of FIB and source markers were identified showing the importance of applying a suite of markers over long-term spatial and temporal sampling to identify a complex combination of sources of contamination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. [Genetic polymorphism of flax Linum usitatissimum based on use of molecular cytogenetic markers]. (United States)

    Rachinskaia, O A; Lemesh, V A; Muravenko, O V; Iurkevich, O Iu; Guzenko, E V; Bol'sheva, N L; Bogdanova, M V; Samatadze, T E; Popov, K V; Malyshev, S V; Shostak, N G; Heller, K; Khotyleva, L V; Zelenin, A V


    Using a set of approaches based on the use of molecular cytogenetic markers (DAPI/C-banding, estimation of the total area of DAPI-positive regions in prophase nuclei, FISH with 26S and 5S rDNA probes) and the microsatellite (SSR-PCR) assay, we studied genomic polymorphism in 15 flax (Linum usitatissimum L.) varieties from different geographic regions belonging to three directions of selection (oil, fiber, and intermediate flaxes) and in the k-37 x Viking hybrid. All individual chromosomes have been identified in the karyotypes of these varieties on the basis of the patterns of differential DAPI/C-banding and the distribution of 26S and 5S rDNA, and idiograms of the chromosomes have been generated. Unlike the oil flax varieties, the chromosomes in the karyotypes of the fiber flax varieties have, as a rule, pericentromeric and telomeric DAPI-positive bands of smaller size, but contain larger intercalary regions. Two chromosomal rearrangements (chromosome 3 inversions) were discovered in the variety Luna and in the k-37 x Viking hybrid. In both these forms, no colocalization of 26S rDNA and 5S rDNA on the satellite chromosome was detected. The SSR assay with the use of 20 polymorphic pairs of primers revealed 22 polymorphic loci. Based on the SSR data, we analyzed genetic similarity of the flax forms studied and constructed a genetic similarity dendrogram. The genotypes studied here form three clusters. The oil varieties comprise an independent cluster. The genetically related fiber flax varieties Vita and Luna, as well as the landrace Lipinska XIII belonging to the intermediate type, proved to be closer to the oil varieties than the remaining fiber flax varieties. The results of the molecular chromosomal analysis in the fiber and oil flaxes confirm their very close genetic similarity. In spite of this, the combined use of the chromosomal and molecular markers has opened up unique possibilities for describing the genotypes of flax varieties and creating their genetic

  12. The Wiphala Genomics: the deployment of molecular markers in small-scale potato crop systems in the Bolivian Andes

    NARCIS (Netherlands)

    Puente, D.


    The deployment of molecular markers in the small-scale potato systems in the Bolivian Andes takes place within two contradictory understandings of potato biodiversity. On the one hand, biodiversity is understood as raw material; farmers' varieties have no intrinsic value, value is added by breeders

  13. Processes underpinning development and maintenance of diversity in rice in West Africa: Evidence from combining morphological and molecular markers

    NARCIS (Netherlands)

    Mokuwa, G.A.; Nuijten, H.A.C.P.; Okry, F.; Teeken, B.W.E.; Maat, H.; Richards, P.; Struik, P.C.


    We assessed the interplay of artificial and natural selection in rice adaptation in low-input farming systems in West Africa. Using 20 morphological traits and 176 molecular markers, 182 farmer varieties of rice (Oryza spp.) from 6 West African countries were characterized. Principal component

  14. Molecular markers in disease detection and follow-up of patients with non-muscle invasive bladder cancer. (United States)

    Maas, Moritz; Walz, Simon; Stühler, Viktoria; Aufderklamm, Stefan; Rausch, Steffen; Bedke, Jens; Stenzl, Arnulf; Todenhöfer, Tilman


    Diagnosis and surveillance of non-muscle invasive bladder cancer (NMIBC) is mainly based on endoscopic bladder evaluation and urine cytology. Several assays for determining additional molecular markers (urine-, tissue- or blood-based) have been developed in recent years but have not been included in clinical guidelines so far. Areas covered: This review gives an update on different molecular markers in the urine and evaluates their role in patients with NMIBC in disease detection and surveillance. Moreover, the potential of recent approaches such as DNA methylation assays, multi-panel RNA gene expression assays and cell-free DNA analysis is assessed. Expert commentary: Most studies on various molecular urine markers have mainly focused on a potential replacement of cystoscopy. New developments in high throughput technologies and urine markers may offer further advantages as they may represent a non-invasive approach for molecular characterization of the disease. This opens new options for individualized surveillance strategies and may help to choose the best therapeutic option. The implementation of these technologies in well-designed clinical trials is essential to further promote the use of urine diagnostics in the management of patients with NMIBC.

  15. Evaluation of molecular markers for Phytophthora ramorum detection and identification: Testing for specificity using a standardized library of isolates (United States)

    F.N. Martin; M.D. Coffey; K. Zeller; R.C. Hamelin; P. Tooley; M. Garbelotto; K.J.D. Hughes; T. Kubisiak; G.J. Bilodeau; L. Levy; C. Blomquist; P.H. Berger


    Given the importance of Phytophthora ramorum from a regulatory standpoint, it is imperative that molecular markers for pathogen detection are fully tested to evaluate their specificity in detection of the pathogen. In an effort to evaluate 11 reported diagnostic techniques, we assembled a standardized DNA library using accessions from the World...

  16. [Molecular markers of Alzheimer disease early diagnostic: investigation perspectives of peripheral tissues. (United States)

    Paltsev, M A; Zuev, V A; Kozhevnikova, E O; Linkova, N S; Kvetnaia, T V; Polyakova, V O; Kvetnoy, I M


    Alzheimer's disease (AD) is a progressive neurodegenerative disorder of elderly and old age people. For intravital diagnosis of the expression of signaling molecules - AD markers, cerebrospinal fluid (CSF) and peripheral tissues are used: lymphocytes and blood platelets, buccal and olfactory epithelium, skin fibroblasts. There are several changes in the production of hyper phosphorylated form of τ-protein, BACE1 and peptide Аβ42 in CSF in case of AD, but CSF taking may have a number of side effects. Less traumatic taking of sampling tissues for the diagnosis of AD is in use of epithelium biopsy and blood portion. An increase in the expression of the hyper phosphorylated form of τ-protein is shown in blood lymphocytes of AD patients. An increase in the content of high molecular weight forms of phosphorylated t-protein and amyloid precursor protein-APP was also revealed in blood platelets of AD patients. Changes in the amount of 2 miRNA families - miR-132 family and miR-134 family were revealed in blood cells 1-5 years before the manifestation of clinical signs of AD. An increase in the concentration of bound calcium, synthesis of peptides Aβ40 and Aβ42, τ protein was observed in AD skin fibroblasts. In the olfactory and buccal epithelium an increase in the expression of hyper phosphorylated form of τ-protein and Aβ peptide was detected in patients with AD. Verification of AD markers in peripheral tissues for biopsy have the important significant for life diagnostics, prevention and and target AD treatment.

  17. Genetic rearrangements of six wheat-agropyron cristatum 6P addition lines revealed by molecular markers.

    Directory of Open Access Journals (Sweden)

    Haiming Han

    Full Text Available Agropyron cristatum (L. Gaertn. (2n = 4x = 28, PPPP not only is cultivated as pasture fodder but also could provide many desirable genes for wheat improvement. It is critical to obtain common wheat-A. cristatum alien disomic addition lines to locate the desired genes on the P genome chromosomes. Comparative analysis of the homoeologous relationships between the P genome chromosome and wheat genome chromosomes is a key step in transferring different desirable genes into common wheat and producing the desired alien translocation line while compensating for the loss of wheat chromatin. In this study, six common wheat-A. cristatum disomic addition lines were produced and analyzed by phenotypic examination, genomic in situ hybridization (GISH, SSR markers from the ABD genomes and STS markers from the P genome. Comparative maps, six in total, were generated and demonstrated that all six addition lines belonged to homoeologous group 6. However, chromosome 6P had undergone obvious rearrangements in different addition lines compared with the wheat chromosome, indicating that to obtain a genetic compensating alien translocation line, one should recombine alien chromosomal regions with homoeologous wheat chromosomes. Indeed, these addition lines were classified into four types based on the comparative mapping: 6PI, 6PII, 6PIII, and 6PIV. The different types of chromosome 6P possessed different desirable genes. For example, the 6PI type, containing three addition lines, carried genes conferring high numbers of kernels per spike and resistance to powdery mildew, important traits for wheat improvement. These results may prove valuable for promoting the development of conventional chromosome engineering techniques toward molecular chromosome engineering.

  18. The effect of sugar and artificial sweetener on molecular markers of metabolic syndrome: a mice study

    Directory of Open Access Journals (Sweden)

    Subali, D.,


    Full Text Available The usage of aspartame, as one of the most widely used sweetener, has been approved in many types of food products. Moreover, many studies have proven that replacing sugar with aspartame would contribute favorable effects on several health parameters; such as, body weight, blood glucose level, and inflammatory status. In this experiment, we examined the effects of aspartame consumption on some biomarkers; which potentially acted as early signals for a personal metabolic status. This study was aimed to investigate the effect of aspartame on the expression of a number of molecular markers related with appetite regulation (fto, fat accumulation markers (fabp4 and alt2 and inflammation marker (tnf-α in Sprague Dawley rats. The population of Clostridium coccoides was also observed to give an insight about the effect of sweetener consumption on gut microbiota profiles. 15 healthy, male, eight-weeks old Sprague-Dawley rats were fed a standard diet and divided into 3 groups (n=5 for each: water only, sucrose (30% b/v, and aspartame (0.15% b/v. Body weight was measured weekly and blood glucose measurement was carried out on day 1 and 40. At the end of the experiment, all rats were euthanized and blood was collected from the vein. The liver, brain, and visceral adipose tissue were excised, weighed, and grinded with liquid nitrogen. Feces samples were collected on day 0 and 40. At the end of our experimental period; the body weight, liver weight, and blood glucose level of sucrose-treated rats were significantly higher (p <0.05 than aspartame and control group. Sucrose showed the lowest level of fto gene expression; yet, the fto gene expression in aspartame group was still lower than the control group. Expression of several genes considered as metabolic syndrome-related biomarkers were measured (fabp4, alt2, and tnf-α; and our data demonstrated that sucrose treatment gave the highest increase in expression level of those genes; while aspartame treatment

  19. Molecular Strain Typing of Clinical Isolates, Trichophyton rubrum using Non Transcribed Spacer (NTS) Region as a Molecular Marker. (United States)

    Ramaraj, Vijayakumar; Vijayaraman, Rajyoganandh S; Elavarashi, Elangovan; Rangarajan, Sudha; Kindo, Anupma Jyoti


    Dermatophytes are a group of fungi which infect keratinized tissues and causes superficial mycoses in humans and animals. The group comprises of three major genera, Trichophyton , Microsporum and Epidermophyton . Among them Trichophyton rubrum is a predominant anthropophilic fungi which causes chronic infections. Although, the infection is superficial and treatable, reinfection/coinfection causes inflation in the treatment cost. Identifying the source and mode of transmission is essential to prevent its transmission. Accurate discrimination is required to understand the clinical (relapse or reinfection) and epidemiological implications of the genetic heterogeneity of this species. Polymorphism in the Non Transcribed Spacer (NTS) region of ribosomal DNA (rDNA) clusters renders an effective way to discriminate strains among T. rubrum . To carry out the strain typing of the clinical isolates, Trichophyton rubrum using NTS as a molecular marker. Seventy T.rubrum clinical isolates obtained from April-2011-March 2013, from Sri Ramachandra Medical Centre, Chennai, Tamil Nadu, India, were identified by conventional phenotypic methods and included in this prospective study. The isolates were then subjected to Polymerase Chain Reaction (PCR) targeting two subrepeat elements (SREs), TRS-1 and TRS-2 of the NTS region. Strain-specific polymorphism was observed in both subrepeat loci. Total, nine different strains were obtained on combining both TRS-1 and TRS-2, SREs. The outcome has given a strong representation for using NTS region amplification in discriminating the T. rubrum clinical isolates. The method can be adapted as a tool for conducting epidemiology and population based study in T. rubrum infections. This will help in future exploration of the epidemiology of T. rubrum .


    Directory of Open Access Journals (Sweden)

    Patrycja Zagata


    Full Text Available The aim of this study is an identification of Paramecium bursaria syngens originating from different geographical locations and proving the correlation between distributions and belonging to any of five syngens. Ten strains of Paramecium bursaria belonging to five different syngens and strain of Paramecium multimicronucleatum were investigated using molecular marker — mitochondrial cytochrome c oxidase subunit I (COI. According to results, obtained in this study, using phylogenetic methods like Neighbor Joining (NJ and Maximum Likelihood (ML, relationship between analyzing strains through their clustering in clusters and correlation between strains belonging to any syngen and syngen’s distribution was confirmed. Phylograms constructed using NJ and ML methods revealed strains’ grouping in five clusters. Results which were obtained revealed usefulness of COI as a biomarker, which is important in identification of Paramecium bursaria syngens. This reports to a great potential of COI as a molecular marker and obtaining dependable results through combination of molecular methods with classical ones.

  1. The expression of selected molecular markers of immune tolerance in psoriatic patients. (United States)

    Bartosińska, Joanna; Purkot, Joanna; Kowal, Małgorzata; Michalak-Stoma, Anna; Krasowska, Dorota; Chodorowska, Grażyna; Giannopoulos, Krzysztof


    Psoriasis is a chronic autoinflammatory disease whose underlying molecular mechanisms remain unclear. The disease is mediated by the cells and molecules of both the innate and adaptive immune systems. Some T cell surface molecules, including neuropilin-1 (NRP1), programmed death 1 (PD-1) and the human leukocyte antigen G (HLA-G), are known to play a role in the maintenance of immune tolerance. The aim of this study was to investigate HLA-G, NRP1 and programmed cell death gene (PDCD1) mRNA expression in psoriatic patients. The study included 72 psoriatic patients and 35 healthy individuals. Twentyone patients (29.17%) suffered from concomitant psoriatic arthritis. The mRNA expression of HLA-G, NRP1, and PDCD1 were determined using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). The severity of skin lesions was assessed by means of the Psoriasis Area and Severity Index (PASI), Body Surface Area (BSA), the Patient Global Assessment (PGA), and the Dermatology Life Quality Index (DLQI). The median value of the PASI was 11.5, and of BSA was 15.8%. The expressions of NRP1 and PDCD1, but not HLA-G, were significantly lower in psoriatic patients in comparison with the control group. The expression of HLA-G, NRP1 and PDCD1 were not significantly different in the psoriatic arthritis and psoriasis vulgaris patients. The results of this study suggest that the molecular markers of immune tolerance, i.e., HLA-G, NRP1, and PD-1, may be involved in the immune response in psoriatic patients.

  2. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers. (United States)

    Taïbi, Khaled; Del Campo, Antonio D; Vilagrosa, Alberto; Bellés, José M; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J; López-Nicolás, José M; Mulet, José M


    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis . Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  3. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Khaled Taïbi


    Full Text Available Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of predicting the ability of formerly uncharacterized seedlings to cope with drought stress. Gas-exchange, water potential, photosynthetic pigments, soluble sugars, free amino acids, glutathione and proteomic analyses were carried out on control and drought-stressed seedlings in greenhouse conditions. Gas-exchange determinations were also assessed in field-planted seedlings in order to validate the greenhouse experimental conditions. Drought-tolerant seed sources presented higher values of photosynthetic rates, water use efficiency, photosynthetic pigments and soluble carbohydrates concentrations. We observed the same pattern of variation of photosynthesis rate and maximal efficiency of PSII in field. Interestingly drought-tolerant seed sources exhibited increased levels of glutathione, methionine and cysteine. The proteomic profile of drought tolerant seedlings identified two heat shock proteins and an enzyme related to methionine biosynthesis that were not present in drought sensitive seedlings, pointing to the synthesis of sulfur amino acids as a limiting factor for drought tolerance in Pinus halepensis. Our results established physiological and molecular traits useful as distinctive markers to predict drought tolerance in Pinus halepensis provenances that could be reliably used in reforestation programs in drought prone areas.

  4. Prognostic Value of Molecular Markers and Implication for Molecular Targeted Therapies in Nasopharyngeal Carcinoma: An Update in an Era of New Targeted Molecules Development. (United States)

    Liu, Mu-Tai; Chen, Mu-Kuan; Huang, Chia-Chun; Huang, Chao-Yuan


    The aim of the study was to evaluate the prognostic significance of molecular biomarkers which could provide information for more accurate prognostication and development of novel therapeutic strategies for nasopharyngeal carcinoma (NPC). NPC is a unique malignant epithelial carcinoma of head and neck region, with an intimate association with the Epstein-Barr virus (EBV). Currently, the prediction of NPC prognosis is mainly based on the clinical TNM staging; however, NPC patients with the same clinical stage often present different clinical outcomes, suggesting that the TNM stage is insufficient to precisely predict the prognosis of this disease. In this review, we give an overview of the prognostic value of molecular markers in NPC and discuss potential strategies of targeted therapies for treatment of NPC. Molecular biomarkers, which play roles in abnormal proliferation signaling pathways (such as Wnt/β-catenin pathway), intracellular mitogenic signal aberration (such as hypoxia-inducible factor (HIF)-1α), receptor-mediated aberrations (such as vascular endothelial growth factor (VEGF)), tumor suppressors (such as p16 and p27 activity), cell cycle aberrations (such as cyclin D1 and cyclin E), cell adhesion aberrations (such as E-cadherin), apoptosis dysregualtion (such as survivin) and centromere aberration (centromere protein H), are prognostic markers for NPC. Plasma EBV DNA concentrations and EBV-encoded latent membrane proteins are also prognostic markers for NPC. Implication of molecular targeted therapies in NPC was discussed. Such therapies could have potential in combination with different cytotoxic agents to combat and eradicate tumor cells. In order to further improve overall survival for patients with loco-regionally advanced NPC, the development of innovative strategies, including prognostic molecular markers and molecular targeted agents is needed.

  5. De novo DNA sequence driven bulk segregant analysis can pinpoint candicate loci for Total Glycoalkaloid (TGA) content in potato without prior knowledge of molecular markers

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Sønderkær, Mads; Petersen, Annabeth Høgh

    is discarded based on the absence of desired molecular marker already at the seed or seedling stage. However, the number of molecular markers known in potato with appropriate linkage to agronomical traits is presently insufficient to establish a comprehensive MAS breeding platform for potato....

  6. Tuberculin reaction and BCG scar

    DEFF Research Database (Denmark)

    Timmermann, Clara Amalie Gade; Biering-Sørensen, Sofie; Aaby, Peter


    rate ratio (MRR) comparing children with a BCG scar with those without was 0.42 (95% CI = 0.19; 0.93). There was a similar tendency for TST positivity: MRR = 0.47 (95% CI = 0.14; 1.54). For LBW children who had both a positive TST reaction and a scar, the MRR was 0.22 (95% CI = 0.05; 0.87). For NBW...

  7. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna


    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  8. Evolutionary dynamics of molecular markers during local adaptation: a case study in Drosophila subobscura

    Directory of Open Access Journals (Sweden)

    Matos Margarida


    Full Text Available Abstract Here we present a correction to our article "Evolutionary dynamics of molecular markers during local adaptation: a case study in Drosophila subobscura". We have recently detected an error concerning the application of the Ln RH formula – a test to detect positive selection – to our microsatellite data. Here we provide the corrected data and discuss its implications for our overall findings. The corrections presented here have produced some changes relative to our previous results, namely in a locus (dsub14 that presents indications of being affected by positive selection. In general, our populations present less consistent indications of positive selection for this particular locus in both periods studied – between generations 3 and 14 and between generation 14 and 40 of laboratory adaptation. Despite this, the main findings of our study regarding the possibility of positive selection acting on that particular microsatellite still hold. As previously concluded in our article, further studies should be performed on this specific microsatellite locus (and neighboring areas to elucidate in greater detail the evolutionary forces acting on this specific region of the O chromosome of Drosophila subobscura.

  9. Tumor Heterogeneity: Mechanisms and Bases for a Reliable Application of Molecular Marker Design (United States)

    Diaz-Cano, Salvador J.


    Tumor heterogeneity is a confusing finding in the assessment of neoplasms, potentially resulting in inaccurate diagnostic, prognostic and predictive tests. This tumor heterogeneity is not always a random and unpredictable phenomenon, whose knowledge helps designing better tests. The biologic reasons for this intratumoral heterogeneity would then be important to understand both the natural history of neoplasms and the selection of test samples for reliable analysis. The main factors contributing to intratumoral heterogeneity inducing gene abnormalities or modifying its expression include: the gradient ischemic level within neoplasms, the action of tumor microenvironment (bidirectional interaction between tumor cells and stroma), mechanisms of intercellular transference of genetic information (exosomes), and differential mechanisms of sequence-independent modifications of genetic material and proteins. The intratumoral heterogeneity is at the origin of tumor progression and it is also the byproduct of the selection process during progression. Any analysis of heterogeneity mechanisms must be integrated within the process of segregation of genetic changes in tumor cells during the clonal expansion and progression of neoplasms. The evaluation of these mechanisms must also consider the redundancy and pleiotropism of molecular pathways, for which appropriate surrogate markers would support the presence or not of heterogeneous genetics and the main mechanisms responsible. This knowledge would constitute a solid scientific background for future therapeutic planning. PMID:22408433

  10. Use of radioisotopes in agriculture: DNA based molecular markers in crop improvement

    International Nuclear Information System (INIS)

    Sivaramakrishnan, S.; Seetharama, N.; Kannan, Seetha


    Agriculture has always benefited from the use of radioisotopes in many ways. In the beginning radioisotopes were mostly used for physiological studies to measure photosynthetic efficiency, nutrient uptake, and for mutation breeding. Radioisotopes have now become a part of the biotechnological tools that are being increasingly used in improving crops and production systems. The tools of biotechnology are being increasingly used to hasten breeding and address problems of biotic and abiotic stresses. Some of the non-radioactive methods have replaced radiotracer techniques and thus led to automation often at high cost. However, still there remain many applications where radioisotopes seem almost indispensable. For some of the applications like comparative genome mapping, the confirmation of transgenics, and establishment of gene copy number, use of RFLP with radioisotopes is essential. The following research areas at ICRISAT use radioisotopes: (1) physiological basis of adaptation to abiotic stresses (ii) development and use of appropriate DNA markers crop improvement; (iii) characterization of cytoplasmic male sterile systems and genetic diversity of breeding materials, land races and the wild relatives and (iv) molecular basis of disease resistance; (v) comparative genome mapping across cereals, (vi) isolation and characterization of genes of potential value to genetic improvement and (vii) verification of genetic transformation events. (author)

  11. Treatment Outcome and Prognostic Molecular Markers of Supratentorial Primitive Neuroectodermal Tumors.

    Directory of Open Access Journals (Sweden)

    Seo Hee Choi

    Full Text Available To identify prognostic factors and define the optimal management of patients with supratentorial primitive neuroectodermal tumors (sPNETs, we investigated treatment outcomes and explored the prognostic value of specific molecular markers.A total of 47 consecutive patients with pathologically confirmed sPNETs between May 1985 and June 2012 were included. Immunohistochemical analysis of LIN28, OLIG2, and Rad51 expression was performed and correlated with clinical outcome.With a median follow-up of 70 months, 5-year overall survival (OS and progression-free survival (PFS was 55.5% and 40%, respectively, for all patients. Age, surgical extent, and radiotherapy were significant prognostic factors for OS and PFS. Patients who received initially planned multimodal treatment without interruption (i.e., radiotherapy and surgery (≥subtotal resection, with or without chemotherapy showed significantly higher 5-year OS (71.2% and PFS (63.1%. In 29 patients with available tumor specimens, tumors with high expression of either LIN28 or OLIG2 or elevated level of Rad51 were significantly associated with poorer prognosis.We found that multimodal treatment improved outcomes for sPNET patients, especially when radiotherapy and ≥subtotal resection were part of the treatment regimen. Furthermore, we confirmed the prognostic significance of LIN28 and OLIG2 and revealed the potential role of Rad51 in sPNETs.

  12. Molecular characterization of UV-treated sugar beet somaclones using RFLP markers

    International Nuclear Information System (INIS)

    Levall, M.W.; Bengtsson, K.; Nilsson, N.-O.; Hjerdin, A.; Hallden, C.


    Sugar beet plants regenerated from UV-treated calluses were examined by restriction fragment length polymorphism (RFLP) analysis to determine the extent of somaclonal variation occurring at the DNA level. In total, 50 random sugar beet DNA sequences were used to screen 42 somaclones for genetic alterations. Three polymorphisms were detected among the 7 644 alleles analysed. From these data a mutation frequency of 0.03 ± 0.02% per allele was estimated. This frequency is in agreement with similar studies of somaclonal DNA variation using molecular markers and lies in the upper range of the spontaneous gene mutation frequencies found in plants. The two probegenotype combinations showing independent polymorphisms, were further analysed using the restriction enzymes Bam HI, Eco RI, Eco RV and Hind III. Both polymorphisms are likely to result from structural rearrangements rather than from point mutations. Differences in methylation among 10 of the investigated somaclones were tested for by comparing Hpa II and Msp I generated RFLP patterns. The somaclones showed extensive methylation, but no differences in their degree of methylation. Cytological analysis revealed 34 diploid, 8 tetraploid, but no aneuploid plants. (author)

  13. Collagen crosslink location: a molecular marker for fibrosis in lungs of rats with experimental silicosis

    International Nuclear Information System (INIS)

    Gerriets, J.E.; Reiser, K.M.; Last, J.A.


    Collagen content is increased in lungs of animals with experimental silicosis. They hypothesize that the collagen deposited in such fibrotic lungs differs structurally from normal lung collagen. Silicotic lung collagen shows an increase in lysine hydroxylation. In addition, the ratio of the difunctional crosslinks DHLNL (dihydroxylysinonorleucine) to HLNL (hydroxylysinonorleucine) is sharply elevated compared to that in control lungs. The peptide α1(I)CB7 x α2(I)CB1 crosslinked by HLNL was demonstrated in NaB 3 H 4 -reduced, CNBr-digested collagen from rat tail tendon by peptide purification, followed by periodate oxidation and amino acid analysis. Further structural analysis of this peptide was obtained by digestion of the crosslinked peptide with trypsin and purification of the tryptic peptide containing this crosslink followed by amino acid analysis. They then examined the analogous collagenous peptide in normal and silicotic lungs and analyzed the crosslink it contained. They observed that DHLNL was present at specific sites previously containing HLNL; that is, the collagen in fibrotic lungs is altered at specific sites by post-translational modification of a lysine residue by hydroxylation in a predictable way. They conclude that such unusual hydroxylation of a specific lysine residue in the α2 chain provides a molecular marker for fibrotic lung collagen

  14. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Kárita Cláudia Freitas-Lidani


    Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

  15. Pink berry grape (Vitis vinifera L.) characterization: Reflectance spectroscopy, HPLC and molecular markers. (United States)

    Rustioni, Laura; De Lorenzis, Gabriella; Hârţa, Monica; Failla, Osvaldo


    Color has a fundamental role for the qualitative evaluation and cultivar characterization of fruits. In grape, a normally functional pigment biosynthesis leads to the accumulation of a high quantity of anthocyanins. In this work, 28 Vitis vinifera L. cultivars accumulating low anthocyanins in berries were studied to characterize the biosynthetic dysfunctions in both a phenotypic and genotypic point of view. Reflectance spectroscopy, HPLC profiles and molecular markers related to VvMybA1 and VvMybA2 genes allowed a detailed description of the pigment-related characteristics of these cultivars. Data were consistent concerning the heterozygosity of the non-functional allele in both investigated genes, resulting in a low colored phenotype as described by reflectance. However, the variability in berry colour among our samples was not fully explained by MybA locus, probably due to specific interferences among the biosynthetic pathways, as suggested by the anthocyanin profile variations detected among our samples. The results presented in this work confirmed the importance of the genetic background: grapes accumulating high levels of cyanidin-3-O-glucosides (di-substituted anthocyanin) are generally originated by white cultivar retro-mutations and they seem to preserve the anomalies in the flavonoid hydroxylases enzymes which negatively affect the synthesis of tri-substituted anthocyanins. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  16. Adverse biological effects of Milan urban PM looking for suitable molecular markers of exposure

    Directory of Open Access Journals (Sweden)

    Mantecca Paride


    Full Text Available The results presented summarise the ones obtained in the coordinated research project Tosca, which extensively analysed the impact of Milan urban PM on human health. The molecular markers of exposure and effects of seasonally and size-fractionated PMs (summer and winter PM10, PM2.5 were investigated in in vitro (human lung cell lines and in vivo (mice systems. The results obtained by the analyses of cytotoxic, pro-inflammatory and genotoxic parameters demonstrate that the biological responses are strongly dependent upon the PM samples seasonal and dimensional variability, that ultimately reflect their chemical composition and source. In fact summer PM10, enriched in crustal elements and endotoxins, was the most cytotoxic and pro-inflammatory fraction, while fine winter PMs induced genotoxic effects and xenobiotic metabolizing enzymes (like CYP1B1 production, likely as a consequence of the higher content in combustion derived particles reach in PAHs and heavy toxic metals. These outcomes outline the need of a detailed knowledge of the PMs physico-chemical composition on a local scale, coupled with the biological hazard directly associated to PM exposure. Apparently this is the only way allowing scientists and police-makers to establish the proper relationships between the respirable PM quantity/quality and the health outcomes described by clinicians and epidemiologists.

  17. Molecular characterization and function of tenomodulin, a marker of tendons and ligaments that integrate musculoskeletal components

    Directory of Open Access Journals (Sweden)

    Chisa Shukunami, DDS, PhD


    Full Text Available Tendons and ligaments are dense fibrous bands of connective tissue that integrate musculoskeletal components in vertebrates. Tendons connect skeletal muscles to the bone and function as mechanical force transmitters, whereas ligaments bind adjacent bones together to stabilize joints and restrict unwanted joint movement. Fibroblasts residing in tendons and ligaments are called tenocytes and ligamentocytes, respectively. Tenomodulin (Tnmd is a type II transmembrane glycoprotein that is expressed at high levels in tenocytes and ligamentocytes, and is also present in periodontal ligament cells and tendon stem/progenitor cells. Tnmd is related to chondromodulin-1 (Chm1, a cartilage-derived angiogenesis inhibitor, and both Tnmd and Chm1 are expressed in the CD31− avascular mesenchyme. The conserved C-terminal hydrophobic domain of these proteins, which is characterized by the eight Cys residues to form four disulfide bonds, may have an anti-angiogenic function. This review highlights the molecular characterization and function of Tnmd, a specific marker of tendons and ligaments.

  18. Sensitivity of molecular marker-based CMB models to biomass burning source profiles (United States)

    Sheesley, Rebecca J.; Schauer, James J.; Zheng, Mei; Wang, Bo

    To assess the contribution of sources to fine particulate organic carbon (OC) at four sites in North Carolina, USA, a molecular marker chemical mass balance model (MM-CMB) was used to quantify seasonal contributions for 2 years. The biomass burning contribution at these sites was found to be 30-50% of the annual OC concentration. In order to provide a better understanding of the uncertainty in MM-CMB model results, a biomass burning profile sensitivity test was performed on the 18 seasonal composites. The results using reconstructed emission profiles based on published profiles compared well, while model results using a single source test profile resulted in biomass burning contributions that were more variable. The biomass burning contribution calculated using an average regional profile of fireplace emissions from five southeastern tree species also compared well with an average profile of open burning of pine-dominated forest from Georgia. The standard deviation of the results using different source profiles was a little over 30% of the annual average biomass contributions. Because the biomass burning contribution accounted for 30-50% of the OC at these sites, the choice of profile also impacted the motor vehicle source attribution due to the common emission of elemental carbon and polycyclic aromatic hydrocarbons. The total mobile organic carbon contribution was less effected by the biomass burning profile than the relative contributions from gasoline and diesel engines.

  19. Molecular markers for identifying a new selected variety of Pacific white shrimp Litopenaeus vannamei (United States)

    Yu, Yang; Zhang, Xiaojun; Liu, Jingwen; Li, Fuhua; Huang, Hao; Li, Yijun; Liu, Xiaolin; Xiang, Jianhai


    Selective breeding of the Pacific white shrimp Litopenaeus vannamei during the last decade has produced new varieties exhibiting high growth rates and disease resistance. However, the identification of new varieties of shrimps from their phenotypic characters is difficult. This study introduces a new approach for identifying varieties of shrimps using molecular markers of microsatellites and mitochondrial control region sequences. The method was employed to identify a new selected variety, Kehai No. 1 (KH-1), from three representative stocks (control group): Zhengda; Tongwei; and a stock collected from Fujian Province, which is now cultured in mainland China. By pooled genotyping of KH-1 and the control group, five microsatellites showing differences between KH-1 and the control group were screened out. Individual genotyping data confirmed the results from pooled genotyping. The genotyping data for the five microsatellites were applied to the assignment analysis of the KH-1 group and the control group using the partial Bayesian assignment method in GENECLASS2. By sequencing the mitochondrial control regions of individuals from the KH-1 and control group, four haplotypes were observed in the KH-1 group, whereas 14 haplotypes were obtained in the control group. By combining the microsatellite assignment analysis with mitochondrial control region analysis, the average accuracy of identification of individuals in the KH-1 group and control group reached 89%. The five selected microsatellite loci and mitochondrial control region sequences were highly polymorphic and could be used to distinguish new selected varieties of L. vannamei from other populations cultured in China.

  20. Polyploidy creates higher diversity among Cynodon accessions as assessed by molecular markers. (United States)

    Gulsen, Osman; Sever-Mutlu, Songul; Mutlu, Nedim; Tuna, Metin; Karaguzel, Osman; Shearman, Robert C; Riordan, Terrance P; Heng-Moss, Tiffany M


    Developing a better understanding of associations among ploidy level, geographic distribution, and genetic diversity of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to: (1) determine ploidy analysis of Cynodon accessions collected from Turkey, (2) investigate associations between ploidy level and diversity, (3) determine whether geographic and ploidy distribution are related to nuclear genome variation, and (4) correlate among four nuclear molecular marker systems for Cynodon accessions' genetic analyses. One hundred and eighty-two Cynodon accessions collected in Turkey from an area south of the Taurus Mountains along the Mediterranean cost and ten known genotypes were genotyped using sequence related amplified polymorphism (SRAP), peroxidase gene polymorphism (POGP), inter-simple sequence repeat (ISSR), and random amplified polymorphic DNA (RAPD). The diploids, triploids, tetraploids, pentaploids, and hexaploids revealed by flow cytometry had a linear present band frequency of 0.36, 0.47, 0.49, 0.52, and 0.54, respectively. Regression analysis explained that quadratic relationship between ploidy level and band frequency was the most explanatory (r = 0.62, P Cynodon accessions' genetic structure can aid to enhance breeding programs and broaden genetic base of commercial cultivars.

  1. Tumor Heterogeneity: Mechanisms and Bases for a Reliable Application of Molecular Marker Design

    Directory of Open Access Journals (Sweden)

    Salvador J. Diaz-Cano


    Full Text Available Tumor heterogeneity is a confusing finding in the assessment of neoplasms, potentially resulting in inaccurate diagnostic, prognostic and predictive tests. This tumor heterogeneity is not always a random and unpredictable phenomenon, whose knowledge helps designing better tests. The biologic reasons for this intratumoral heterogeneity would then be important to understand both the natural history of neoplasms and the selection of test samples for reliable analysis. The main factors contributing to intratumoral heterogeneity inducing gene abnormalities or modifying its expression include: the gradient ischemic level within neoplasms, the action of tumor microenvironment (bidirectional interaction between tumor cells and stroma, mechanisms of intercellular transference of genetic information (exosomes, and differential mechanisms of sequence-independent modifications of genetic material and proteins. The intratumoral heterogeneity is at the origin of tumor progression and it is also the byproduct of the selection process during progression. Any analysis of heterogeneity mechanisms must be integrated within the process of segregation of genetic changes in tumor cells during the clonal expansion and progression of neoplasms. The evaluation of these mechanisms must also consider the redundancy and pleiotropism of molecular pathways, for which appropriate surrogate markers would support the presence or not of heterogeneous genetics and the main mechanisms responsible. This knowledge would constitute a solid scientific background for future therapeutic planning.

  2. Population Structure, Genetic Diversity and Molecular Marker-Trait Association Analysis for High Temperature Stress Tolerance in Rice.

    Directory of Open Access Journals (Sweden)

    Sharat Kumar Pradhan

    Full Text Available Rice exhibits enormous genetic diversity, population structure and molecular marker-traits associated with abiotic stress tolerance to high temperature stress. A set of breeding lines and landraces representing 240 germplasm lines were studied. Based on spikelet fertility percent under high temperature, tolerant genotypes were broadly classified into four classes. Genetic diversity indicated a moderate level of genetic base of the population for the trait studied. Wright's F statistic estimates showed a deviation of Hardy-Weinberg expectation in the population. The analysis of molecular variance revealed 25 percent variation between population, 61 percent among individuals and 14 percent within individuals in the set. The STRUCTURE analysis categorized the entire population into three sub-populations and suggested that most of the landraces in each sub-population had a common primary ancestor with few admix individuals. The composition of materials in the panel showed the presence of many QTLs representing the entire genome for the expression of tolerance. The strongly associated marker RM547 tagged with spikelet fertility under stress and the markers like RM228, RM205, RM247, RM242, INDEL3 and RM314 indirectly controlling the high temperature stress tolerance were detected through both mixed linear model and general linear model TASSEL analysis. These markers can be deployed as a resource for marker-assisted breeding program of high temperature stress tolerance.

  3. Population Structure, Genetic Diversity and Molecular Marker-Trait Association Analysis for High Temperature Stress Tolerance in Rice. (United States)

    Pradhan, Sharat Kumar; Barik, Saumya Ranjan; Sahoo, Ambika; Mohapatra, Sudipti; Nayak, Deepak Kumar; Mahender, Anumalla; Meher, Jitandriya; Anandan, Annamalai; Pandit, Elssa


    Rice exhibits enormous genetic diversity, population structure and molecular marker-traits associated with abiotic stress tolerance to high temperature stress. A set of breeding lines and landraces representing 240 germplasm lines were studied. Based on spikelet fertility percent under high temperature, tolerant genotypes were broadly classified into four classes. Genetic diversity indicated a moderate level of genetic base of the population for the trait studied. Wright's F statistic estimates showed a deviation of Hardy-Weinberg expectation in the population. The analysis of molecular variance revealed 25 percent variation between population, 61 percent among individuals and 14 percent within individuals in the set. The STRUCTURE analysis categorized the entire population into three sub-populations and suggested that most of the landraces in each sub-population had a common primary ancestor with few admix individuals. The composition of materials in the panel showed the presence of many QTLs representing the entire genome for the expression of tolerance. The strongly associated marker RM547 tagged with spikelet fertility under stress and the markers like RM228, RM205, RM247, RM242, INDEL3 and RM314 indirectly controlling the high temperature stress tolerance were detected through both mixed linear model and general linear model TASSEL analysis. These markers can be deployed as a resource for marker-assisted breeding program of high temperature stress tolerance.

  4. Transport of sewage molecular markers through saturated soil column and effect of easily biodegradable primary substrate on their removal. (United States)

    Foolad, Mahsa; Ong, Say Leong; Hu, Jiangyong


    Pharmaceutical and personal care products (PPCPs) and artificial sweeteners (ASs) are emerging organic contaminants (EOCs) in the aquatic environment. The presence of PPCPs and ASs in water bodies has an ecologic potential risk and health concern. Therefore, it is needed to detect the pollution sources by understanding the transport behavior of sewage molecular markers in a subsurface area. The aim of this study was to evaluate transport of nine selected molecular markers through saturated soil column experiments. The selected sewage molecular markers in this study were six PPCPs including acetaminophen (ACT), carbamazepine (CBZ), caffeine (CF), crotamiton (CTMT), diethyltoluamide (DEET), salicylic acid (SA) and three ASs including acesulfame (ACF), cyclamate (CYC), and saccharine (SAC). Results confirmed that ACF, CBZ, CTMT, CYC and SAC were suitable to be used as sewage molecular markers since they were almost stable against sorption and biodegradation process during soil column experiments. In contrast, transport of ACT, CF and DEET were limited by both sorption and biodegradation processes and 100% removal efficiency was achieved in the biotic column. Moreover, in this study the effect of different acetate concentration (0-100mg/L) as an easily biodegradable primary substrate on a removal of PPCPs and ASs was also studied. Results showed a negative correlation (r(2)>0.75) between the removal of some selected sewage chemical markers including ACF, CF, ACT, CYC, SAC and acetate concentration. CTMT also decreased with the addition of acetate, but increasing acetate concentration did not affect on its removal. CBZ and DEET removal were not dependent on the presence of acetate. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.). (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav


    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  6. Hypertrophic scars and keloids in surgery: current concepts. (United States)

    Song, Colin


    Hypertrophic scars and keloids remain a challenge in surgery. We appreciate that our understanding of the process at cellular and molecular level, profound as it is, when it comes to the clinical evidence much is left to be desired. Although the bench to bedside conundrum remains, the science of translational research calls for an even higher level of cooperation between the scientist and the clinician for the impetus to succeed.The clinicians alerted us to the possible theories in the pathogenesis of keloid formation, inter alia, the ischemia theory, mast cell theory, immune theory, transforming growth factor β interaction, mechanical theory, and the melanocyte stimulating hormone theory. All of the above presupposed a stimulus that would result in an uncontrolled upregulation of collagen and extracellular matrix expression in the pathogenesis of the keloid. This bedside to bench initiative, as in true science, realized more ponderables than possibilities.By the same token, research into the epidermal-mesenchymal signaling, molecular biology, genomics, and stem cell research holds much promise in the bench top arena. To assess efficacy, many scar assessment scores exist in the literature. The clinical measurement of scar maturity can aid in determining end points for therapeutics. Tissue oxygen tension and color assessment of scars by standardized photography proved to be useful.In surgery, the use of dermal substitutes holds some promise as we surmise that quality scars that arise from dermal elements, molecular and enzyme behavior, and balance. Although a systematic review shows some benefit for earlier closure and healing of wounds, no such review exists at this point in time for the use of dermal substitutes in scars.Adipose-derived stem cell, as it pertains to scars, will hopefully realize the potential of skin regeneration rather than by repair in which we are familiar with as well as the undesirable scarring as a result of healing through the inflammatory

  7. Genetic diversity and structure of tea plant in Qinba area in China by three types of molecular markers. (United States)

    Zhang, Yu; Zhang, Xiaojuan; Chen, Xi; Sun, Wang; Li, Jiao


    Qinba area has a long history of tea planting and is a northernmost region in China where Camellia sinensis L. is grown. In order to provide basic data for selection and optimization of molecular markers of tea plants. 118 markers, including 40 EST-SSR, 40 SRAP and 38 SCoT markers were used to evaluate the genetic diversity of 50 tea plant ( Camellia sinensis. ) samples collected from Qinb. tea germplasm, assess population structure. In this study, a total of 414 alleles were obtained using 38 pairs of SCoT primers, with an average of 10.89 alleles per primer. The percentage of polymorphic bands (PPB), polymorphism information content (PIC), resolving power (Rp), effective multiplex ratio (EMR), average band informativeness (Ib av ), and marker index (MI) were 96.14%, 0.79, 6.71, 10.47, 0.58, and 6.07 respectively. 338 alleles were amplified via 40 pairs of SRAP (8.45 per primer), with PPB, PIC, Rp, EMR, Ib av, and MI values of 89.35%, 0.77, 5.11, 7.55, 0.61, and 4.61, respectively. Furthermore, 320 alleles have been detected using 40 EST-SSR primers (8.00 per primer), with PPB, PIC, Rp, EMR, Ib av , and MI values of 94.06%, 0.85, 4.48, 7.53, 0.56, and 4.22 respectively. These results indicated that SCoT markers had higher efficiency.Mantel test was used to analyze the genetic distance matrix generated by EST-SSRs, SRAPs and SCoTs. The results showed that the correlation between the genetic distance matrix based on EST-SSR and that based on SRAP was very small ( r  = 0.01), followed by SCoT and SRAP ( r  = 0.17), then by SCoT and EST-SSR ( r  = 0.19).The 50 tea samples were divided into two sub-populations using STRUCTURE, Neighbor-joining (NJ) method and principal component analyses (PCA). The results produced by STRUCTURE were completely consistent with the PCA analysis. Furthermore, there is no obvious relationship between the results produced using sub-populational and geographical data. Among the three types of markers, SCoT markers has many

  8. How to measure separation and angles between inter-molecular fluorescent markers

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik

    Structure and function of an individual biomolecule can be explored with minimum two fluorescent markers of different colors. Since the light of such markers can be spec- trally separated and imaged simultaneously, the markers can be colocalized. Here, we describe the method used for such two......-color colocalization microscopy. Then we extend it to fluorescent markers with fixed orientations and in intramolecular proximity. Our benchmarking of this extension produced two extra results: (a) we established short double-labeled DNA molecules as probes of 3D orientation of anything to which one can attach them...

  9. Radio-sensibility study of pseudo cereals by means of molecular markers and electronic microscopy

    International Nuclear Information System (INIS)

    Allende C, L.


    With the purpose of observing the radio sensibility in two species of pseudo cereals group (Amaranthus hypochondria cus and Chenopodium berlandieri subsp. nuttalliae), germplasm of 4 amaranth genotypes was irradiated (A-21-0-10, Mixquic-09, M-2 and M-6) and 4 huauzontle genotypes (H-18, H-19, H-10 and red Chia) in the Gamma Irradiator of the ININ in a dose range of 50 to 500 Gy with intervals each 50 Gy and a treatment witness without irradiating. The evaluation of the material was carried out in three stages: 1) the pheno logy and morphology was evaluated during the plants development in each treatment under greenhouse conditions; 2) the radio sensibility was evaluated at molecular level by means of molecular markers type Ssr (Simple Sequence Repeats); and 3) the irradiated seeds were analyzed by under vacuum electronic microscopy. According to the results, the pheno logy phases were ahead in lower doses to 250 Gy for amaranth and higher doses to 150 Gy for huauzontle, there being a morphological variation in leaves and cob. The morphological variables were favored in dose from 50 to 200 Gy for amaranth, while in huauzontle the morphology presented more response variation to the radiation. In the DNA, the 21 Ssr were 100% polymorphic in amaranth and 97% polymorphic in huauzontle, being one of the more polymorphic the QCA0005 in amaranth and QCA0005 in huauzontle. The generated dendrograms showed greater similarity between Mixquic-09 and M-2 (amaranth) and between H-19 and H-10 (huauzontle). While by treatments, in amaranth the dose of 500 Gy presented most polymorphic difference and in huauzontle was the dose of 200 Gy. The under vacuum electronic microscopy did not show differences in the seed structure while the elemental analysis showed the presence of carbon, oxygen, aluminum, sulfur and calcium as the most common elements and in more concentration carbon and oxygen. For A. hypochondria cus the dose DL 50 (median lethal dose) was between 50 and 100 Gy and for

  10. The asphericity of the metabolic tumour volume in NSCLC: correlation with histopathology and molecular markers

    International Nuclear Information System (INIS)

    Apostolova, Ivayla; Ego, Kilian; Steffen, Ingo G.; Buchert, Ralph; Wertzel, Heinz; Achenbach, H.J.; Riedel, Sandra; Schreiber, Jens; Schultz, Meinald; Furth, Christian; Amthauer, Holger; Derlin, Thorsten; Hofheinz, Frank; Kalinski, Thomas


    overall survival. The ASP of primary NSCLCs on FDG PET images is associated with tumour dimensions and molecular markers of proliferation and angiogenesis. (orig.)

  11. The asphericity of the metabolic tumour volume in NSCLC: correlation with histopathology and molecular markers

    Energy Technology Data Exchange (ETDEWEB)

    Apostolova, Ivayla; Ego, Kilian; Steffen, Ingo G. [University Hospital, Otto-von-Guericke University Magdeburg, Clinic of Radiology and Nuclear Medicine, Magdeburg (Germany); Buchert, Ralph [University Medicine Charite, Clinic of Nuclear Medicine, Berlin (Germany); Wertzel, Heinz; Achenbach, H.J. [Lung Clinic Lostau GmbH, Lostau (Germany); Riedel, Sandra; Schreiber, Jens [University Hospital, Otto-von-Guericke University Magdeburg, Clinic of Pneumology, Magdeburg (Germany); Schultz, Meinald [Institute of Pathology Stendal, Stendal (Germany); Furth, Christian; Amthauer, Holger [University Hospital, Otto-von-Guericke University Magdeburg, Clinic of Radiology and Nuclear Medicine, Magdeburg (Germany); University Medicine Charite, Clinic of Nuclear Medicine, Berlin (Germany); Derlin, Thorsten [Hannover Medical School, Department of Nuclear Medicine, Hannover (Germany); Hofheinz, Frank [Helmholtz-Center Dresden-Rossendorf, Dresden (Germany); Kalinski, Thomas [University Hospital Magdeburg, Otto-von-Guericke University Magdeburg, Institute for Pathology, Magdeburg (Germany); Institute for Pathology Lademannbogen, Hamburg (Germany)


    overall survival. The ASP of primary NSCLCs on FDG PET images is associated with tumour dimensions and molecular markers of proliferation and angiogenesis. (orig.)

  12. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong


    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  13. Mucosal CCR1 gene expression as a marker of molecular activity in Crohn's disease: preliminary data. (United States)

    Dobre, Maria; Mănuc, Teodora Ecaterina; Milanesi, Elena; Pleşea, Iancu Emil; Ţieranu, Eugen Nicolae; Popa, Caterina; Mănuc, Mircea; Preda, Carmen Monica; Ţieranu, Ioana; Diculescu, Mihai Mircea; Ionescu, Elena Mirela; Becheanu, Gabriel


    A series of mechanisms of immune response, inflammation and apoptosis have been demonstrated to contribute to the appearance and evolution of Crohn's disease (CD) through the overexpression of several cytokines and chemokines in a susceptible host. The aim of this study was to identify the differences in gene expression profiles analyzing a panel of candidate genes in the mucosa from patients with active CD (CD-A), patients in remission (CD-R), and normal controls. Nine individuals were enrolled in the study: six CD patients (three with active lesions, three with mucosal healing) and three controls without inflammatory bowel disease (IBD) seen on endoscopy. All the individuals underwent mucosal biopsy during colonoscopy. Gene expression levels of 84 genes previously associated with CD were evaluated by polymerase chain reaction (PCR) array. Ten genes out of 84 were found significantly differentially expressed in CD-A (CCL11, CCL25, DEFA5, GCG, IL17A, LCN2, REG1A, STAT3, MUC1, CCR1) and eight genes in CD-R (CASP1, IL23A, STAT1, STAT3, TNF, CCR1, CCL5, and HSP90B1) when compared to controls. A quantitative gene expression analysis revealed that CCR1 gene was more expressed in CD-A than in CD-R. Our data suggest that CCR1 gene may be a putative marker of molecular activity of Crohn's disease. Following these preliminary data, a confirmation in larger cohort studies could represent a useful method in order to identify new therapeutic targets.

  14. Population genetic structure of rare and endangered plants using molecular markers (United States)

    Raji, Jennifer; Atkinson, Carter T.


    This study was initiated to assess the levels of genetic diversity and differentiation in the remaining populations of Phyllostegia stachyoides and Melicope zahlbruckneri in Hawai`i Volcanoes National Park and determine the extent of gene flow to identify genetically distinct individuals or groups for conservation purposes. Thirty-six Amplified Fragment Length Polymorphic (AFLP) primer combinations generated a total of 3,242 polymorphic deoxyribonucleic acid (DNA) fragments in the P. stachyoides population with a percentage of polymorphic bands (PPB) ranging from 39.3 to 65.7% and 2,780 for the M. zahlbruckneri population with a PPB of 18.8 to 64.6%. Population differentiation (Fst) of AFLP loci between subpopulations of P. stachyoides was low (0.043) across populations. Analysis of molecular variance of P. stachyoides showed that 4% of the observed genetic differentiation occurred between populations in different kīpuka and 96% when individuals were pooled from all kīpuka. Moderate genetic diversity was detected within the M. zahlbruckneri population. Bayesian and multivariate analyses both classified the P. stachyoides and M. zahlbruckneri populations into genetic groups with considerable sub-structuring detected in the P. stachyoides population. The proportion of genetic differentiation among populations explained by geographical distance was estimated by Mantel tests. No spatial correlation was found between genetic and geographic distances in both populations. Finally, a moderate but significant gene flow that could be attributed to insect or bird-mediated dispersal of pollen across the different kīpuka was observed. The results of this study highlight the utility of a multi-allelic DNA-based marker in screening a large number of polymorphic loci in small and closely related endangered populations and revealed the presence of genetically unique groups of individuals in both M. zahlbruckneri and P. stachyoides populations. Based on these findings

  15. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy- (United States)

    Ishitani, Y.


    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  16. Integrating molecular markers into the World Health Organization classification of CNS tumors: a survey of the neuro-oncology community. (United States)

    Aldape, Kenneth; Nejad, Romina; Louis, David N; Zadeh, Gelareh


    Molecular markers provide important biological and clinical information related to the classification of brain tumors, and the integration of relevant molecular parameters into brain tumor classification systems has been a widely discussed topic in neuro-oncology over the past decade. With recent advances in the development of clinically relevant molecular signatures and the 2016 World Health Organization (WHO) update, the views of the neuro-oncology community on such changes would be informative for implementing this process. A survey with 8 questions regarding molecular markers in tumor classification was sent to an email list of Society for Neuro-Oncology members and attendees of prior meetings (n=5065). There were 403 respondents. Analysis was performed using whole group response, based on self-reported subspecialty. The survey results show overall strong support for incorporating molecular knowledge into the classification and clinical management of brain tumors. Across all 7 subspecialty groups, ≥70% of respondents agreed to this integration. Interestingly, some variability is seen among subspecialties, notably with lowest support from neuropathologists, which may reflect their roles in implementing such diagnostic technologies. Based on a survey provided to the neuro-oncology community, we report strong support for the integration of molecular markers into the WHO classification of brain tumors, as well as for using an integrated "layered" diagnostic format. While membership from each specialty showed support, there was variation by specialty in enthusiasm regarding proposed changes. The initial results of this survey influenced the deliberations underlying the 2016 WHO classification of tumors of the central nervous system. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology.

  17. Molecular markers from three organellar genomes unravel complex taxonomic relationships within the coralline algal genus Chiharaea (Corallinales, Rhodophyta). (United States)

    Hind, Katharine R; Saunders, Gary W


    The use of molecular markers in taxonomic studies has become a standard practice in biology. However, consensus on which markers to use at the species level is lacking because evolutionary lineages show differences in divergence rates between organellar genomes. Ideally, researchers use multiple lines of evidence when first describing a species, such as the incorporation of several molecular markers from varied genomes (mitochondrion, plastid and nucleus). This study examined species boundaries in the red algal genus Chiharaea. We used five molecular markers, with at least one marker from each genome, coupled with thorough morphological analyses. We recognized three species in Chiharaea (C.americana, C. rhododactyla sp. nov., C. silvae) and two forms (C. americana f. americana and C. americana f. bodegensis (H.W. Johansen) stat. nov.). For C. americana f. americana and C. americana f. bodegensis differentiation based on morphological data was reflected in the plastid-encoded large subunit of RuBisCO (rbcL), but was not concordant with either the mitochondrial cytochrome c oxidase subunit 1 (COI-5P) or nuclear internal transcribed spacer (ITS) sequence data. We suggest that this discordance is indicative of ongoing hybridization and introgression between populations of C. americana f. americana and C. americana f. bodegensis. In addition, we used a PCR assay with ITS specific primers to amplify multiple ITS variants for collections assignable to C. americana indicating that there is genetic variability within ITS copies most likely due to introgression, crossing over and/or the retention of ancestral variants. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Construction of an SSR and RAD-Marker Based Molecular Linkage Map of Vigna vexillata (L.) A. Rich. (United States)

    Marubodee, Rusama; Ogiso-Tanaka, Eri; Isemura, Takehisa; Chankaew, Sompong; Kaga, Akito; Naito, Ken; Ehara, Hiroshi; Tomooka, Norihiko


    Vigna vexillata (L.) A. Rich. (tuber cowpea) is an underutilized crop for consuming its tuber and mature seeds. Wild form of V. vexillata is a pan-tropical perennial herbaceous plant which has been used by local people as a food. Wild V. vexillata has also been considered as useful gene(s) source for V. unguiculata (cowpea), since it was reported to have various resistance gene(s) for insects and diseases of cowpea. To exploit the potential of V. vexillata, an SSR-based linkage map of V. vexillata was developed. A total of 874 SSR markers successfully amplified single DNA fragment in V. vexillata among 1,336 SSR markers developed from Vigna angularis (azuki bean), V. unguiculata and Phaseolus vulgaris (common bean). An F2 population of 300 plants derived from a cross between salt resistant (V1) and susceptible (V5) accessions was used for mapping. A genetic linkage map was constructed using 82 polymorphic SSR markers loci, which could be assigned to 11 linkage groups spanning 511.5 cM in length with a mean distance of 7.2 cM between adjacent markers. To develop higher density molecular linkage map and to confirm SSR markers position in a linkage map, RAD markers were developed and a combined SSR and RAD markers linkage map of V. vexillata was constructed. A total of 559 (84 SSR and 475 RAD) markers loci could be assigned to 11 linkage groups spanning 973.9 cM in length with a mean distance of 1.8 cM between adjacent markers. Linkage and genetic position of all SSR markers in an SSR linkage map were confirmed. When an SSR genetic linkage map of V. vexillata was compared with those of V. radiata and V. unguiculata, it was suggested that the structure of V. vexillata chromosome was considerably differentiated. This map is the first SSR and RAD marker-based V. vexillata linkage map which can be used for the mapping of useful traits.

  19. Distinctive pattern of expression of spermatogenic molecular markers in testes of azoospermic men with non-mosaic Klinefelter syndrome. (United States)

    Kleiman, Sandra E; Yogev, Leah; Lehavi, Ofer; Yavetz, Haim; Hauser, Ron


    Mature sperm cells can be found in testicular specimens extracted from azoospermic men with non-mosaic Klinefelter syndrome (KS). The present study evaluates the expression of various known molecular markers of spermatogenesis in a population of men with KS and assesses the ability of those markers to predict spermatogenesis. Two groups of men with non-obstructive azoospermia who underwent testicular sperm-retrieval procedures were included in the study: 31 had non-mosaic KS (KS group) and 91 had normal karyotype (NK group). Each group was subdivided into mixed atrophy (containing some mature sperm cells) or Sertoli cell only syndrome according to testicular histology and cytology observations. Semi-quantitative histological morphometric analysis (interstitial hyperplasia and hyalinization, tubules with cells and abnormal thickness of the basement membrane) and expression of spermatogenetic markers (DAZ, RBM, BOLL, and CDY1) were evaluated and compared among those subgroups. Clear differences in the histological morphometry and spermatogenetic marker expression were noted between the KS and NK groups. There was a significant difference in the expression of spermatogenetic markers between the subgroups of the NK group (as expected), while no difference could be discerned between the two subgroups in the KS group. We conclude that molecular spermatogenetic markers have a pattern of expression in men with KS that is distinctively different from that of men with NK, and that it precludes and limits their use for predicting spermatogenesis in the former. It is suggested that this difference might be due to the specific highly abnormal histological morphometric parameters in KS specimens.

  20. Pheno2Geno - High-throughput generation of genetic markers and maps from molecular phenotypes for crosses between inbred strains. (United States)

    Zych, Konrad; Li, Yang; van der Velde, Joeri K; Joosen, Ronny V L; Ligterink, Wilco; Jansen, Ritsert C; Arends, Danny


    Genetic markers and maps are instrumental in quantitative trait locus (QTL) mapping in segregating populations. The resolution of QTL localization depends on the number of informative recombinations in the population and how well they are tagged by markers. Larger populations and denser marker maps are better for detecting and locating QTLs. Marker maps that are initially too sparse can be saturated or derived de novo from high-throughput omics data, (e.g. gene expression, protein or metabolite abundance). If these molecular phenotypes are affected by genetic variation due to a major QTL they will show a clear multimodal distribution. Using this information, phenotypes can be converted into genetic markers. The Pheno2Geno tool uses mixture modeling to select phenotypes and transform them into genetic markers suitable for construction and/or saturation of a genetic map. Pheno2Geno excludes candidate genetic markers that show evidence for multiple possibly epistatically interacting QTL and/or interaction with the environment, in order to provide a set of robust markers for follow-up QTL mapping. We demonstrate the use of Pheno2Geno on gene expression data of 370,000 probes in 148 A. thaliana recombinant inbred lines. Pheno2Geno is able to saturate the existing genetic map, decreasing the average distance between markers from 7.1 cM to 0.89 cM, close to the theoretical limit of 0.68 cM (with 148 individuals we expect a recombination every 100/148=0.68 cM); this pinpointed almost all of the informative recombinations in the population. The Pheno2Geno package makes use of genome-wide molecular profiling and provides a tool for high-throughput de novo map construction and saturation of existing genetic maps. Processing of the showcase dataset takes less than 30 minutes on an average desktop PC. Pheno2Geno improves QTL mapping results at no additional laboratory cost and with minimum computational effort. Its results are formatted for direct use in R/qtl, the leading R

  1. Development of Thinopyrum ponticum-specific molecular markers and FISH probes based on SLAF-seq technology. (United States)

    Liu, Liqin; Luo, Qiaoling; Teng, Wan; Li, Bin; Li, Hongwei; Li, Yiwen; Li, Zhensheng; Zheng, Qi


    Based on SLAF-seq, 67 Thinopyrum ponticum-specific markers and eight Th. ponticum-specific FISH probes were developed, and these markers and probes could be used for detection of alien chromatin in a wheat background. Decaploid Thinopyrum ponticum (2n = 10x = 70) is a valuable gene reservoir for wheat improvement. Identification of Th. ponticum introgression would facilitate its transfer into diverse wheat genetic backgrounds and its practical utilization in wheat improvement. Based on specific-locus-amplified fragment sequencing (SLAF-seq) technology, 67 new Th. ponticum-specific molecular markers and eight Th. ponticum-specific fluorescence in situ hybridization (FISH) probes have been developed from a tiny wheat-Th. ponticum translocation line. These newly developed molecular markers allowed the detection of Th. ponticum DNA in a variety of materials specifically and steadily at high throughput. According to the hybridization signal pattern, the eight Th. ponticum-specific probes could be divided into two groups. The first group including five dispersed repetitive sequence probes could identify Th. ponticum chromatin more sensitively and accurately than genomic in situ hybridization (GISH). Whereas the second group having three tandem repetitive sequence probes enabled the discrimination of Th. ponticum chromosomes together with another clone pAs1 in wheat-Th. ponticum partial amphiploid Xiaoyan 68.

  2. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex. (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W


    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  3. Molecular markers as a tool for breeding for flower longevity in Asiatic hybrid lilies.

    NARCIS (Netherlands)

    Meulen, van der J.J.M.; Oeveren, van J.C.; Sandbrink, J.M.; Tuyl, van J.M.


    Segregation of flower longevity in two lily populations was studied and the genetic linkage of morphological markers and RAPD markers with loci involved in flower longevity was investigated. A large variation in flower longevity was found within the two populations tested at individual plant level.

  4. Genetic diversity analyses of Lasiodiplodia theobromae on Morus alba and Agave sisalana based on RAPD and ISSR molecular markers

    Directory of Open Access Journals (Sweden)

    Hong-hui Xie


    Full Text Available Genetic diversity of 23 Lasiodiplodia theobromae isolates on Morus alba and 6 isolates on Agave sisalana in Guangxi province, China, was studied by using random amplified polymorphic DNA and inter-simple sequence repeat molecular markers. Results of two molecular markers showed that the average percentage of polymorphic loci of all isolates was more than 93%. Both dendrograms of two molecular markers showed obvious relationship between groups and the geographical locations where those strains were collected, among which, the 23 isolates on M. alba were divided into 4 populations and the 6 isolates on A. sisalana were separated as a independent population. The average genetic identity and genetic distance of 5 populations were 0.7215, 0.3284 and 0.7915, 0.2347, respectively, which indicated that the genetic identity was high and the genetic distance was short in the 5 populations. Average value of the gene diversity index (H and the Shannon’s information index (I of 29 isolates were significantly higher than 5 populations which showed that genetic diversity of those isolates was richer than the populations and the degree of genetic differentiation of the isolates was higher. The Gst and Nm of 29 isolates were 0.4411, 0.6335 and 0.4756, 0.5513, respectively, which showed that the genetic diversity was rich in those isolates.

  5. Rare complications of cesarean scar

    International Nuclear Information System (INIS)

    Mahajan, Divyesh; Kang, Mandeep; Sandhu, Manavjit Singh; Jain, Vanita; Kalra, Naveen; Khandelwal, Niranjan


    Cesarean scar pregnancy (CSP) and cesarean scar dehiscence (CSD) are the most dreaded complications of cesarean scar (CS). As the incidence of CS is increasing worldwide, so is the incidence of CSP, especially in cases with assisted reproduction techniques. It is of utmost importance to diagnose CSP in the early first trimester, as it can lead to myometrial rupture with fatal outcome. On the other hand, CSD may be encountered during pregnancy or in the postpartum period. CSD in the postpartum period is very rare and can cause secondary postpartum hemorrhage (PPH) leading to increased maternal morbidity or even death if not diagnosed and managed promptly. Both complications can be diagnosed on ultrasonography (USG) and confirmed on magnetic resonance imaging (MRI). These two conditions carry high morbidity and mortality. In this article, we highlight the role of imaging in the early diagnosis and management of these conditions

  6. Rare complications of cesarean scar

    Directory of Open Access Journals (Sweden)

    Divyesh Mahajan


    Full Text Available Cesarean scar pregnancy (CSP and cesarean scar dehiscence (CSD are the most dreaded complications of cesarean scar (CS. As the incidence of CS is increasing worldwide, so is the incidence of CSP, especially in cases with assisted reproduction techniques. It is of utmost importance to diagnose CSP in the early first trimester, as it can lead to myometrial rupture with fatal outcome. On the other hand, CSD may be encountered during pregnancy or in the postpartum period. CSD in the postpartum period is very rare and can cause secondary postpartum hemorrhage (PPH leading to increased maternal morbidity or even death if not diagnosed and managed promptly. Both complications can be diagnosed on ultrasonography (USG and confirmed on magnetic resonance imaging (MRI. These two conditions carry high morbidity and mortality. In this article, we highlight the role of imaging in the early diagnosis and management of these conditions.

  7. Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees and whole-genome-based data. (United States)

    Edwards, J D; Baldo, A M; Mueller, L A


    Ricebase ( is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining datasets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data and molecular marker fragment size data. Rice research has benefited from early adoption and extensive use of simple sequence repeat (SSR) markers; however, the majority of rice SSR markers were developed prior to the latest rice pseudomolecule assembly. Interpretation of new research using SNPs in the context of literature citing SSRs requires a common coordinate system. A new pipeline, using a stepwise relaxation of stringency, was used to map SSR primers onto the latest rice pseudomolecule assembly. The SSR markers and experimentally assayed amplicon sizes are presented in a relational database with a web-based front end, and are available as a track loaded in a genome browser with links connecting the browser and database. The combined capabilities of Ricebase link genetic markers, genome context, allele states across rice germplasm and potentially user curated phenotypic interpretations as a community resource for genetic discovery and breeding in rice. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the United States.

  8. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    Directory of Open Access Journals (Sweden)

    Yang Huaan


    Full Text Available Abstract Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM, and are now replacing the markers previously developed by a traditional DNA

  9. Application of molecular markers in germplasm enhancement of Cassava (Manihot esculenta L. Crantz) and Yams (Dioscorea spp.) at IITA

    International Nuclear Information System (INIS)

    Mignouna, H.D.; Asiedu, R.; Dixon, A.G.O.; Tonukari, J.; Ng, N.Q.; Thottappilly, G.; Knox, M.; Ellis, T.H.N.


    The genetic variation among 28 varieties of cassava (Manihot esculenta L. Crantz), collected from different parts of the Republic of Benin was determined using random amplified polymorphic DNA (RAPD) markers. A set of ten primers out of the one hundred that were screened, detected polymorphisms. Thirty-five cassava landraces from three countries of West Africa, along with five improved varieties and one genetic stock (58308), were analysed using both micro satellite markers and nine selected random primers which generated fifty-four polymorphic markers. Based on the unweighted pair group method with arithmetic averages (UPGMA) and Principal Component Analysis (PCA), six major groups of clusters were identified among the forty one genotypes. Clone 58308, the original source of resistance to African Cassava Mosaic Disease (ACMD) in IITA's cassava breeding program, and TMS 30572, an improved cultivar derived from clone 58308, were found in the same cluster group. All 34 of the landraces that are known to be resistant to ACMD were genetically distant from 58308 and TMS 30572. A diallel mating programme has been initiated to elucidate the genetics of these new sources of resistance to ACMD and determine their complementarity as well as allellism for resistance. A set of eight random primers for RAPD and two combinations of enzymes and specific primers for AFLP were used to generate DNA fingerprinting of twenty varietal groups among the 32 described for cultivated yams in the region. The results obtained confirm that a given varietal group is a mixture of different genotypes. The molecular taxonomy of 30 accessions of cultivated yams, D. rotundata and D. cayenensis, and 35 accessions of wild yams from Nigeria was established using RAPD and micro satellite markers. The cultivated yams separated into two distinct groups corresponding to the two species. D. rotundata genotypes showed relationship to the wild species D. abyssinica and D. praehensilis, whereas D. cayenensis

  10. Application of molecular markers in germplasm enhancement of Cassava (Manihot esculenta L. Crantz) and Yams (Dioscorea spp.) at IITA

    Energy Technology Data Exchange (ETDEWEB)

    Mignouna, H D; Asiedu, R; Dixon, A G.O.; Tonukari, J; Ng, N Q; Thottappilly, G [International Institute of Tropical Agriculture, Ibadan (Nigeria); Knox, M; Ellis, T H.N. [John Innes Centre, Norwich (United Kingdom)


    The genetic variation among 28 varieties of cassava (Manihot esculenta L. Crantz), collected from different parts of the Republic of Benin was determined using random amplified polymorphic DNA (RAPD) markers. A set of ten primers out of the one hundred that were screened, detected polymorphisms. Thirty-five cassava landraces from three countries of West Africa, along with five improved varieties and one genetic stock (58308), were analysed using both micro satellite markers and nine selected random primers which generated fifty-four polymorphic markers. Based on the unweighted pair group method with arithmetic averages (UPGMA) and Principal Component Analysis (PCA), six major groups of clusters were identified among the forty one genotypes. Clone 58308, the original source of resistance to African Cassava Mosaic Disease (ACMD) in IITA`s cassava breeding program, and TMS 30572, an improved cultivar derived from clone 58308, were found in the same cluster group. All 34 of the landraces that are known to be resistant to ACMD were genetically distant from 58308 and TMS 30572. A diallel mating programme has been initiated to elucidate the genetics of these new sources of resistance to ACMD and determine their complementarity as well as allellism for resistance. A set of eight random primers for RAPD and two combinations of enzymes and specific primers for AFLP were used to generate DNA fingerprinting of twenty varietal groups among the 32 described for cultivated yams in the region. The results obtained confirm that a given varietal group is a mixture of different genotypes. The molecular taxonomy of 30 accessions of cultivated yams, D. rotundata and D. cayenensis, and 35 accessions of wild yams from Nigeria was established using RAPD and micro satellite markers. The cultivated yams separated into two distinct groups corresponding to the two species. D. rotundata genotypes showed relationship to the wild species D. abyssinica and D. praehensilis, whereas D. cayenensis

  11. In vivo quantification of fluorescent molecular markers in real-time by ratio Imaging for diagnostic screening and image-guided surgery

    NARCIS (Netherlands)

    Bogaards, A.; Sterenborg, H. J. C. M.; Trachtenberg, J.; Wilson, B. C.; Lilge, L.


    Future applications of "molecular diagnostic screening" and "molecular image-guided surgery" will demand images of molecular markers with high resolution and high throughput (similar to >= 30 frames/second). MRI, SPECT, PET, optical fluorescence tomography, hyper-spectral fluorescence imaging, and

  12. Scars of the Wigner Function. (United States)

    Toscano; de Aguiar MA; Ozorio De Almeida AM


    We propose a picture of Wigner function scars as a sequence of concentric rings along a two-dimensional surface inside a periodic orbit. This is verified for a two-dimensional plane that contains a classical hyperbolic orbit of a Hamiltonian system with 2 degrees of freedom. The stationary wave functions are the familiar mixture of scarred and random waves, but the spectral average of the Wigner functions in part of the plane is nearly that of a harmonic oscillator and individual states are also remarkably regular. These results are interpreted in terms of the semiclassical picture of chords and centers.

  13. Classical resonances and quantum scarring

    International Nuclear Information System (INIS)

    Manderfeld, Christopher


    We study the correspondence between phase-space localization of quantum (quasi-)energy eigenstates and classical correlation decay, given by Ruelle-Pollicott resonances of the Frobenius-Perron operator. It will be shown that scarred (quasi-)energy eigenstates are correlated: pairs of eigenstates strongly overlap in phase space (scar in same phase-space regions) if the difference of their eigenenergies is close to the phase of a leading classical resonance. Phase-space localization of quantum states will be measured by L 2 norms of their Husimi functions

  14. IMPACT (Imaging and Molecular Markers for Patients with Lung Cancer: Approaches with Molecular Targets and Complementary, Innovative and Therapeutic Modalities)

    National Research Council Canada - National Science Library

    Hong, Waun Ki; Herbst, Roy


    .... These projects combine targeted approaches using molecular and imaging techniques to validate activity against a target and monitor response using imaging modalities specific to the receptor using...

  15. IMPACT (Imaging and Molecular Markers for Patients with Lung Cancer: Approaches with Molecular Targets and Complementary, Innovative and Therapeutic Modalities)

    National Research Council Canada - National Science Library

    Hong, Waun K; Herbst, Roy


    .... These projects combine targeted approaches using molecular and imaging techniques to validate activity against a target and monitor response using imaging modalities specific to the receptor using...

  16. IMPACT (Imaging and Molecular Markers for Patients with Lung Cancer: Approaches with Molecular Targets and Complementary, Innovative and Therapeutic Modalities)

    National Research Council Canada - National Science Library

    Hong, Waun K; Herbst, Roy


    .... These projects combine targeted approaches using molecular and imaging techniques to validate activity against a target and monitor response using imaging modalities specific to the receptor using...

  17. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B


    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  18. Etiopathogenesis of Post-endodontic Periapical Scar Formation

    Directory of Open Access Journals (Sweden)

    Edita Horká


    Full Text Available Introduction: A periapical scar represents a clinically asymptomatic, non-progressive, small, periapical radiolucency in patients with a previously well-performed root canal treatment.The hypothesis: We introduce a hypothesis that periapical scar formation is caused by osseoinhibitory molecular signaling from the epithelial cell rests of Malassez.Evaluation of the hypothesis: When epithelial cell rests of Malassez are present in teeth with an infected root canal system, a periapical cyst develops, whereas in the case of a treated root canal system infection, periapical inflammation is diminished and the periapical leasion heals until the regeneration process reaches the apical part of the tooth where epithelial cell rests of Malassez are present. Cytokines cause rapidly progressive defensive fibroproduction and scar formation, in which osteoblasts cannot differentiate into

  19. Variability among Capsicum baccatum accessions from Goiás, Brazil, assessed by morphological traits and molecular markers. (United States)

    Martinez, A L A; Araújo, J S P; Ragassi, C F; Buso, G S C; Reifschneider, F J B


    Capsicum peppers are native to the Americas, with Brazil being a significant diversity center. Capsicum baccatum accessions at Instituto Federal (IF) Goiano represent a portion of the species genetic resources from central Brazil. We aimed to characterize a C. baccatum working collection comprising 27 accessions and 3 commercial cultivars using morphological traits and molecular markers to describe its genetic and morphological variability and verify the occurrence of duplicates. This set included 1 C. baccatum var. praetermissum and 29 C. baccatum var. pendulum with potential for use in breeding programs. Twenty-two morphological descriptors, 57 inter-simple sequence repeat, and 34 random amplified polymorphic DNA markers were used. Genetic distance was calculated through the Jaccard similarity index and genetic variability through cluster analysis using the unweighted pair group method with arithmetic mean, resulting in dendrograms for both morphological analysis and molecular analysis. Genetic variability was found among C. baccatum var. pendulum accessions, and the distinction between the two C. baccatum varieties was evident in both the morphological and molecular analyses. The 29 C. baccatum var. pendulum genotypes clustered in four groups according to fruit type in the morphological analysis. They formed seven groups in the molecular analysis, without a clear correspondence with morphology. No duplicates were found. The results describe the genetic and morphological variability, provide a detailed characterization of genotypes, and discard the possibility of duplicates within the IF Goiano C. baccatum L. collection. This study will foment the use of this germplasm collection in C. baccatum breeding programs.

  20. Molecular studies in olive (Olea europaea L.): overview on DNA markers applications and recent advances in genome analysis. (United States)

    Bracci, T; Busconi, M; Fogher, C; Sebastiani, L


    Olive (Olea europaea L.) is one of the oldest agricultural tree crops worldwide and is an important source of oil with beneficial properties for human health. This emblematic tree crop of the Mediterranean Basin, which has conserved a very wide germplasm estimated in more than 1,200 cultivars, is a diploid species (2n = 2x = 46) that is present in two forms, namely wild (Olea europaea subsp. europaea var. sylvestris) and cultivated (Olea europaea subsp. europaea var. europaea). In spite of its economic and nutritional importance, there are few data about the genetic of olive if compared with other fruit crops. Available molecular data are especially related to the application of molecular markers to the analysis of genetic variability in Olea europaea complex and to develop efficient molecular tools for the olive oil origin traceability. With regard to genomic research, in the last years efforts are made for the identification of expressed sequence tag, with particular interest in those sequences expressed during fruit development and in pollen allergens. Very recently the sequencing of chloroplast genome provided new information on the olive nucleotide sequence, opening the olive genomic era. In this article, we provide an overview of the most relevant results in olive molecular studies. A particular attention was given to DNA markers and their application that constitute the most part of published researches. The first important results in genome analysis were reported.

  1. Emerging concepts in biomarker discovery; The US-Japan workshop on immunological molecular markers in oncology (United States)

    Tahara, Hideaki; Sato, Marimo; Thurin, Magdalena; Wang, Ena; Butterfield, Lisa H; Disis, Mary L; Fox, Bernard A; Lee, Peter P; Khleif, Samir N; Wigginton, Jon M; Ambs, Stefan; Akutsu, Yasunori; Chaussabel, Damien; Doki, Yuichiro; Eremin, Oleg; Fridman, Wolf Hervé; Hirohashi, Yoshihiko; Imai, Kohzoh; Jacobson, James; Jinushi, Masahisa; Kanamoto, Akira; Kashani-Sabet, Mohammed; Kato, Kazunori; Kawakami, Yutaka; Kirkwood, John M; Kleen, Thomas O; Lehmann, Paul V; Liotta, Lance; Lotze, Michael T; Maio, Michele; Malyguine, Anatoli; Masucci, Giuseppe; Matsubara, Hisahiro; Mayrand-Chung, Shawmarie; Nakamura, Kiminori; Nishikawa, Hiroyoshi; Palucka, A Karolina; Petricoin, Emanuel F; Pos, Zoltan; Ribas, Antoni; Rivoltini, Licia; Sato, Noriyuki; Shiku, Hiroshi; Slingluff, Craig L; Streicher, Howard; Stroncek, David F; Takeuchi, Hiroya; Toyota, Minoru; Wada, Hisashi; Wu, Xifeng; Wulfkuhle, Julia; Yaguchi, Tomonori; Zeskind, Benjamin; Zhao, Yingdong; Zocca, Mai-Britt; Marincola, Francesco M


    Supported by the Office of International Affairs, National Cancer Institute (NCI), the "US-Japan Workshop on Immunological Biomarkers in Oncology" was held in March 2009. The workshop was related to a task force launched by the International Society for the Biological Therapy of Cancer (iSBTc) and the United States Food and Drug Administration (FDA) to identify strategies for biomarker discovery and validation in the field of biotherapy. The effort will culminate on October 28th 2009 in the "iSBTc-FDA-NCI Workshop on Prognostic and Predictive Immunologic Biomarkers in Cancer", which will be held in Washington DC in association with the Annual Meeting. The purposes of the US-Japan workshop were a) to discuss novel approaches to enhance the discovery of predictive and/or prognostic markers in cancer immunotherapy; b) to define the state of the science in biomarker discovery and validation. The participation of Japanese and US scientists provided the opportunity to identify shared or discordant themes across the distinct immune genetic background and the diverse prevalence of disease between the two Nations. Converging concepts were identified: enhanced knowledge of interferon-related pathways was found to be central to the understanding of immune-mediated tissue-specific destruction (TSD) of which tumor rejection is a representative facet. Although the expression of interferon-stimulated genes (ISGs) likely mediates the inflammatory process leading to tumor rejection, it is insufficient by itself and the associated mechanisms need to be identified. It is likely that adaptive immune responses play a broader role in tumor rejection than those strictly related to their antigen-specificity; likely, their primary role is to trigger an acute and tissue-specific inflammatory response at the tumor site that leads to rejection upon recruitment of additional innate and adaptive immune mechanisms. Other candidate systemic and/or tissue-specific biomarkers were recognized that

  2. Emerging concepts in biomarker discovery; The US-Japan workshop on immunological molecular markers in oncology

    Directory of Open Access Journals (Sweden)

    Rivoltini Licia


    Full Text Available Abstract Supported by the Office of International Affairs, National Cancer Institute (NCI, the "US-Japan Workshop on Immunological Biomarkers in Oncology" was held in March 2009. The workshop was related to a task force launched by the International Society for the Biological Therapy of Cancer (iSBTc and the United States Food and Drug Administration (FDA to identify strategies for biomarker discovery and validation in the field of biotherapy. The effort will culminate on October 28th 2009 in the "iSBTc-FDA-NCI Workshop on Prognostic and Predictive Immunologic Biomarkers in Cancer", which will be held in Washington DC in association with the Annual Meeting. The purposes of the US-Japan workshop were a to discuss novel approaches to enhance the discovery of predictive and/or prognostic markers in cancer immunotherapy; b to define the state of the science in biomarker discovery and validation. The participation of Japanese and US scientists provided the opportunity to identify shared or discordant themes across the distinct immune genetic background and the diverse prevalence of disease between the two Nations. Converging concepts were identified: enhanced knowledge of interferon-related pathways was found to be central to the understanding of immune-mediated tissue-specific destruction (TSD of which tumor rejection is a representative facet. Although the expression of interferon-stimulated genes (ISGs likely mediates the inflammatory process leading to tumor rejection, it is insufficient by itself and the associated mechanisms need to be identified. It is likely that adaptive immune responses play a broader role in tumor rejection than those strictly related to their antigen-specificity; likely, their primary role is to trigger an acute and tissue-specific inflammatory response at the tumor site that leads to rejection upon recruitment of additional innate and adaptive immune mechanisms. Other candidate systemic and/or tissue-specific biomarkers

  3. Application of ISSR markers to analyze molecular relationships in Iranian jasmine (Jasminum spp.) accessions. (United States)

    Ghasemi Ghehsareh, Masood; Salehi, Hassan; Khosh-Khui, Morteza; Niazi, Ali


    There are many species of jasmines in different regions of Iran in natural or cultivated form, and there is no information about their genetic status. Therefore, inter-simple sequence repeat (ISSR) analysis was used to evaluate genetic variations of the 53 accessions representing eight species of Jasminum collected from different regions of Iran. A total of 21 ISSR primers were used which generated 981 bands of different sizes. Mean percentage of polymorphic bands was 90.64 %. Maximum resolving power, polymorphic information content average, and marker index values were 21.55, 0.35, and 14.42 for primers of 3, 4, and 3 respectively. The unweighted pair group method with arithmetic mean dendrogram based on Jaccard's coefficients indicated that 53 accessions were divided into two major clusters. The first major cluster was divided into two subclusters; the subcluster A included Jasminum grandiflorum L., J. officinale L., and J. azoricum L. and the subcluster B consisted of three forms of J. sambac L. (single, semi-double, and double flowers). The second major cluster was divided into two subclusters; the first subcluster (C) included J. humile L., J. primulinum Hemsl., J. nudiflorum Lindl. and the second subcluster (D) consisted of J. fruticans L. At the species level, the highest percentage of polymorphism (34.05 %), numbers of effective alleles (1.16), Shannon index (0.151), and Nei's genetic diversity (0.098) were observed in J. officinale. The lowest values of percentage polymorphism (0.011), number of effective alleles (1.009), Shannon index (0.007), and Nei's genetic diversity (0.005) were obtained for J. nudiflorum. Based on pairwise population matrix of Nei's unbiased genetic identity, the highest identity (0.85) was found between J.officinale and J. azoricum and the lowest identity (0.69) was between J. grandiflorum and J. perimulinum. Based on analysis of molecular variance, the amount of genetic variations among the eight populations was 83 %. This study

  4. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    Directory of Open Access Journals (Sweden)

    de Souza Emanuel M


    (IDC, and this difference was statistically significant (p = 0.0002. Conclusion ADAM33 gene silencing may be related to the discohesive histological appearance of ILCs. We suggest that ADAM33 promoter methylation may be a useful molecular marker for differentiating ILC and IDC.

  5. ADAM33 gene silencing by promoter hypermethylation as a molecular marker in breast invasive lobular carcinoma

    International Nuclear Information System (INIS)

    Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de


    statistically significant (p = 0.0002). ADAM33 gene silencing may be related to the discohesive histological appearance of ILCs. We suggest that ADAM33 promoter methylation may be a useful molecular marker for differentiating ILC and IDC

  6. Molecular markers for assessment of radiation-induced oxidant stress of occupationally exposed persons

    International Nuclear Information System (INIS)

    Stankova, K.; Zaharieva, E.; Aneva, N.; Kazarska, O.; Boteva, R.


    Full text: Introduction: The biological effects of ionizing radiation (IR) are mainly due to high creativity, oxygen - containing free radicals and molecules known as Reactive Oxygen Species (ROS). After irradiation the cells accumulate ROS, which may induce destructive changes in all cell structures and macromolecules (membranes, DNA, RNA , proteins and enzymes) and result in abnormalities on cell and tissue level. The effects of ROS are particularly important in chronic oxidative stress induced by prolonged occupational exposure that can permanently disrupt cellular redox homeostasis, which increase the risk of oncogenic, neurodegenerative, cardiovascular and other diseases. This requires the study of the antioxidant status of the Kozloduy NPP personnel who are professionally exposed to low dose irradiation. Materials and methods: As an antioxidant status markers, changes in the levels of the ROS and the electrochemical potential at mitochondrial lymphocytes (both before and after their additional in vitro exposure to 3 Gy), as well as the antioxidant activity of blood plasma are analyzed. The study was conducted with spectral methods and includes 40 professionally exposed people from the Kozloduy NPP (mean age 44.3, and radiation exposure from 0,1 to 257,9 mSv) and 20 unexposed controls (mean age 46.5 years). Results: Statistical analysis of the data shows that chronic exposure to low doses IR as a result of occupation exposure does not lead to significant changes in the levels of the ROS, the antioxidant activity of plasma and mitochondrial electrochemical potential. More significant impact on these indicators proves the age of the respondents, which is explained by a decrease in the activity of the cellular reparative and antioxidant systems induced by the natural processes of aging. Results for occupational exposure and non-exposure persons were heterogeneous due to the individual radio sensitivity of the persons included in biomonitoring. Conclusion

  7. Renal scar formation and kidney function following antibiotic-treated murine pyelonephritis

    Directory of Open Access Journals (Sweden)

    Patrick D. Olson


    Full Text Available We present a new preclinical model to study treatment, resolution and sequelae of severe ascending pyelonephritis. Urinary tract infection (UTI, primarily caused by uropathogenic Escherichia coli (UPEC, is a common disease in children. Severe pyelonephritis is the primary cause of acquired renal scarring in childhood, which may eventually lead to hypertension and chronic kidney disease in a small but important fraction of patients. Preclinical modeling of UTI utilizes almost exclusively females, which (in most mouse strains exhibit inherent resistance to severe ascending kidney infection; consequently, no existing preclinical model has assessed the consequences of recovery from pyelonephritis following antibiotic treatment. We recently published a novel mini-surgical bladder inoculation technique, with which male C3H/HeN mice develop robust ascending pyelonephritis, highly prevalent renal abscesses and evidence of fibrosis. Here, we devised and optimized an antibiotic treatment strategy within this male model to more closely reflect the clinical course of pyelonephritis. A 5-day ceftriaxone regimen initiated at the onset of abscess development achieved resolution of bladder and kidney infection. A minority of treated mice displayed persistent histological abscess at the end of treatment, despite microbiological cure of pyelonephritis; a matching fraction of mice 1 month later exhibited renal scars featuring fibrosis and ongoing inflammatory infiltrates. Successful antibiotic treatment preserved renal function in almost all infected mice, as assessed by biochemical markers 1 and 5 months post-treatment; hydronephrosis was observed as a late effect of treated pyelonephritis. An occasional mouse developed chronic kidney disease, generally reflecting the incidence of this late sequela in humans. In total, this model offers a platform to study the molecular pathogenesis of pyelonephritis, response to antibiotic therapy and emergence of sequelae

  8. Short Communication: Genetic linkage map of Cucurbita maxima with molecular and morphological markers. (United States)

    Ge, Y; Li, X; Yang, X X; Cui, C S; Qu, S P


    Cucurbita maxima is one of the most widely cultivated vegetables in China and exhibits distinct morphological characteristics. In this study, genetic linkage analysis with 57 simple-sequence repeats, 21 amplified fragment length polymorphisms, 3 random-amplified polymorphic DNA, and one morphological marker revealed 20 genetic linkage groups of C. maxima covering a genetic distance of 991.5 cM with an average of 12.1 cM between adjacent markers. Genetic linkage analysis identified the simple-sequence repeat marker 'PU078072' 5.9 cM away from the locus 'Rc', which controls rind color. The genetic map in the present study will be useful for better mapping, tagging, and cloning of quantitative trait loci/gene(s) affecting economically important traits and for breeding new varieties of C. maxima through marker-assisted selection.

  9. Molecular Genetic Diversity of Date (Phoenix dactylifera) Germplasm in Qatar based on Microsatellite Markers

    KAUST Repository

    Ahmed, Talaat


    Depending on morphological traits alone, studying the genetic diversity of date palm is a very difficult task since morphological characteristics are highly affected by the environment. DNA markers are excellent option that can help and enhance

  10. Use of molecular markers for predicting therapy response in cancer patients.

    LENUS (Irish Health Repository)

    Duffy, Michael J


    Predictive markers are factors that are associated with upfront response or resistance to a particular therapy. Predictive markers are important in oncology as tumors of the same tissue of origin vary widely in their response to most available systemic therapies. Currently recommended oncological predictive markers include both estrogen and progesterone receptors for identifying patients with breast cancers likely to benefit from hormone therapy, HER-2 for the identification of breast cancer patients likely to benefit from trastuzumab, specific K-RAS mutations for the identification of patients with advanced colorectal cancer unlikely to benefit from either cetuximab or panitumumab and specific EGFR mutations for selecting patients with advanced non-small-cell lung cancer for treatment with tyrosine kinase inhibitors such as gefitinib and erlotinib. The availability of predictive markers should increase drug efficacy and decrease toxicity, thus leading to a more personalized approach to cancer treatment.

  11. A resource of large-scale molecular markers for monitoring Agropyron cristatum chromatin introgression in wheat background based on transcriptome sequences. (United States)

    Zhang, Jinpeng; Liu, Weihua; Lu, Yuqing; Liu, Qunxing; Yang, Xinming; Li, Xiuquan; Li, Lihui


    Agropyron cristatum is a wild grass of the tribe Triticeae and serves as a gene donor for wheat improvement. However, very few markers can be used to monitor A. cristatum chromatin introgressions in wheat. Here, we reported a resource of large-scale molecular markers for tracking alien introgressions in wheat based on transcriptome sequences. By aligning A. cristatum unigenes with the Chinese Spring reference genome sequences, we designed 9602 A. cristatum expressed sequence tag-sequence-tagged site (EST-STS) markers for PCR amplification and experimental screening. As a result, 6063 polymorphic EST-STS markers were specific for the A. cristatum P genome in the single-receipt wheat background. A total of 4956 randomly selected polymorphic EST-STS markers were further tested in eight wheat variety backgrounds, and 3070 markers displaying stable and polymorphic amplification were validated. These markers covered more than 98% of the A. cristatum genome, and the marker distribution density was approximately 1.28 cM. An application case of all EST-STS markers was validated on the A. cristatum 6 P chromosome. These markers were successfully applied in the tracking of alien A. cristatum chromatin. Altogether, this study provided a universal method of large-scale molecular marker development to monitor wild relative chromatin in wheat.

  12. Endometriosis in an episiotomy scar

    Directory of Open Access Journals (Sweden)

    Mine islimye Taskin


    Full Text Available Endometriosis that is defined as the presence of functional endometrial tissue outside the uterine cavity is seen 5-10% of reproductive age women. Endometriosis can be seen any other site of the body; but the most frequently affected areas are ovaries, pelvic peritoneum, uterosacral ligament and Douglas pouche. Several teories exist for the development of endometriosis including retrograde menstruation, venous or lymphatic metastasis and immun dysfunction. Endometriosis of the perineum and vulva are extremely rare with the most common sites being episiotomy scars. Scar endometriosis is likely to be caused by mechanical transplantation of endometrium from the uterine cavity into the wound at the time of the surgery. The primary treatment for scar endometriosis is total surgical excision of the lesion. It is important not to leave residual tissue during surgery to prevent the recurrence. Here we present a patient who had her vaginal delivery 5 years ago, have a complaint of painful vulvar lump at the right mediolateral episiotomy scar since 1 year during her every menstruation period and whose final diagnosis was endometriosis after surgical removal and histopathologic examination. Althought vulvar endometrosis is rare, it should be considered in the patients who had a vaginal delivery and complaining painful vulvar lump with swelling in her mestrual cycle. [Cukurova Med J 2016; 41(1.000: 164-166

  13. Molecular diversity and phylogeny of Triticum-Aegilops species possessing D genome revealed by SSR and ISSR markers

    Directory of Open Access Journals (Sweden)

    Moradkhani Hoda


    Full Text Available The aim of this study is investigation the applicability of SSR and ISSR markers in evaluating the genetic relationships in twenty accessions of Aegilops and Triticum species with D genome in different ploidy levels. Totally, 119 bands and 46 alleles were detected using ten primers for ISSR and SSR markers, respectively. Polymorphism Information Content values for all primers ranged from 0.345 to 0.375 with an average of 0.367 for SSR, and varied from 0.29 to 0.44 with the average 0.37 for ISSR marker. Analysis of molecular variance (AMOVA revealed that 81% (ISSR and 84% (SSR of variability was partitioned among individuals within populations. Comparing the genetic diversity of Aegilops and Triticum accessions, based on genetic parameters, shows that genetic variation of Ae. crassa and Ae. tauschii species are higher than other species, especially in terms of Nei’s gene diversity. Cluster analysis, based on both markers, separated total accessions in three groups. However, classification based on SSR marker data was not conformed to classification according to ISSR marker data. Principal co-ordinate analysis (PCoA for SSR and ISSR data showed that, the first two components clarified 53.48% and 49.91% of the total variation, respectively. This analysis (PCoA, also, indicated consistent patterns of genetic relationships for ISSR data sets, however, the grouping of accessions was not completely accorded to their own geographical origins. Consequently, a high level of genetic diversity was revealed from the accessions sampled from different eco-geographical regions of Iran.

  14. Investigation and Analysis of Genetic Diversity of Diospyros Germplasms Using SCoT Molecular Markers in Guangxi. (United States)

    Deng, Libao; Liang, Qingzhi; He, Xinhua; Luo, Cong; Chen, Hu; Qin, Zhenshi


    Knowledge about genetic diversity and relationships among germplasms could be an invaluable aid in diospyros improvement strategies. This study was designed to analyze the genetic diversity and relationship of local and natural varieties in Guangxi Zhuang Autonomous Region of China using start codon targeted polymorphism (SCoT) markers. The accessions of 95 diospyros germplasms belonging to four species Diospyros kaki Thunb, D. oleifera Cheng, D. kaki var. silverstris Mak, and D. lotus Linn were collected from different eco-climatic zones in Guangxi and were analyzed using SCoT markers. Results indicated that the accessions of 95 diospyros germplasms could be distinguished using SCoT markers, and were divided into three groups at similarity coefficient of 0.608; these germplasms that belong to the same species were clustered together; of these, the degree of genetic diversity of the natural D. kaki var. silverstris Mak population was richest among the four species; the geographical distance showed that the 12 natural populations of D. kaki var. silverstris Mak were divided into two groups at similarity coefficient of 0.19. Meanwhile, in order to further verify the stable and useful of SCoT markers in diospyros germplasms, SSR markers were also used in current research to analyze the genetic diversity and relationship in the same diospyros germplasms. Once again, majority of germplasms that belong to the same species were clustered together. Thus SCoT markers were stable and especially useful for analysis of the genetic diversity and relationship in diospyros germplasms. The molecular characterization and diversity assessment of diospyros were very important for conservation of diospyros germplasm resources, meanwhile for diospyros improvement.

  15. The First Molecular Identification of an Olive Collection Applying Standard Simple Sequence Repeats and Novel Expressed Sequence Tag Markers. (United States)

    Mousavi, Soraya; Mariotti, Roberto; Regni, Luca; Nasini, Luigi; Bufacchi, Marina; Pandolfi, Saverio; Baldoni, Luciana; Proietti, Primo


    Germplasm collections of tree crop species represent fundamental tools for conservation of diversity and key steps for its characterization and evaluation. For the olive tree, several collections were created all over the world, but only few of them have been fully characterized and molecularly identified. The olive collection of Perugia University (UNIPG), established in the years' 60, represents one of the first attempts to gather and safeguard olive diversity, keeping together cultivars from different countries. In the present study, a set of 370 olive trees previously uncharacterized was screened with 10 standard simple sequence repeats (SSRs) and nine new EST-SSR markers, to correctly and thoroughly identify all genotypes, verify their representativeness of the entire cultivated olive variation, and validate the effectiveness of new markers in comparison to standard genotyping tools. The SSR analysis revealed the presence of 59 genotypes, corresponding to 72 well known cultivars, 13 of them resulting exclusively present in this collection. The new EST-SSRs have shown values of diversity parameters quite similar to those of best standard SSRs. When compared to hundreds of Mediterranean cultivars, the UNIPG olive accessions were splitted into the three main populations (East, Center and West Mediterranean), confirming that the collection has a good representativeness of the entire olive variability. Furthermore, Bayesian analysis, performed on the 59 genotypes of the collection by the use of both sets of markers, have demonstrated their splitting into four clusters, with a well balanced membership obtained by EST respect to standard SSRs. The new OLEST ( Olea expressed sequence tags) SSR markers resulted as effective as the best standard markers. The information obtained from this study represents a high valuable tool for ex situ conservation and management of olive genetic resources, useful to build a common database from worldwide olive cultivar collections

  16. Regression Association Analysis of Yield-Related Traits with RAPD Molecular Markers in Pistachio (Pistacia vera L.

    Directory of Open Access Journals (Sweden)

    Saeid Mirzaei


    Full Text Available Introduction: The pistachio (Pistacia vera, a member of the cashew family, is a small tree originating from Central Asia and the Middle East. The tree produces seeds that are widely consumed as food. Pistacia vera often is confused with other species in the genus Pistacia that are also known as pistachio. These other species can be distinguished by their geographic distributions and their seeds which are much smaller and have a soft shell. Continual advances in crop improvement through plant breeding are driven by the available genetic diversity. Therefore, the recognition and measurement of such diversity is crucial to breeding programs. In the past 20 years, the major effort in plant breeding has changed from quantitative to molecular genetics with emphasis on quantitative trait loci (QTL identification and marker assisted selection (MAS. The germplasm-regression-combined association studies not only allow mapping of genes/QTLs with higher level of confidence, but also allow detection of genes/QTLs, which will otherwise escape detection in linkage-based QTL studies based on the planned populations. The development of the marker-based technology offers a fast, reliable, and easy way to perform multiple regression analysis and comprise an alternative approach to breeding in diverse species of plants. The availability of many makers and morphological traits can help to regression analysis between these markers and morphological traits. Materials and Methods: In this study, 20 genotypes of Pistachio were studied and yield related traits were measured. Young well-expanded leaves were collected for DNA extraction and total genomic DNA was extracted. Genotyping was performed using 15 RAPD primers and PCR amplification products were visualized by gel electrophoresis. The reproducible RAPD fragments were scored on the basis of present (1 or absent (0 bands and a binary matrix constructed using each molecular marker. Association analysis between

  17. Molecular diversity and population structure of the forage grass Hemarthria compressa (Poaceae) in south China based on SRAP markers. (United States)

    Huang, L-K; Zhang, X-Q; Xie, W-G; Zhang, J; Cheng, L; Yan, H D


    Hemarthria compressa is one of the most important and widely utilized forage crops in south China, owing to its high forage yield and capability of adaptation to hot and humid conditions. We examined the population structure and genetic variation within and among 12 populations of H. compressa in south China using sequence-related amplified polymorphism (SRAP) markers. High genetic diversity was found in these samples [percentage polymorphic bands (PPB) = 82.21%, Shannon's diversity index (I) = 0.352]. However, there was relatively low level of genetic diversity at the population level (PPB = 29.17%, I = 0.155). A high degree of genetic differentiation among populations was detected based on other measures and molecular markers (Nei's genetic diversity analysis: G(ST) = 54.19%; AMOVA analysis: F(ST) = 53.35%). The SRAP markers were found to be more efficient than ISSR markers for evaluating population diversity. Based on these findings, we propose changes in sampling strategies for appraising and utilizing the genetic resources of this species.

  18. Molecular genetic diversity assessment of Citrus species grown in Iran revealed by SSR, ISSR and CAPS molecular markers

    Directory of Open Access Journals (Sweden)

    Ata Allah Sharafi


    Full Text Available In this study, genetic diversity in 19 citrus cultivars was analyzed using Simple Sequence Repeat (SSR, Inter-simple Sequence Repeat (ISSR and cleaved amplified polymorphic sequence (CAPS markers. Nine primers for SSR, nine ISSR primers and two primers for CAPS were used for allele scoring. One chloroplast DNA region (rbcL-ORF106 and one mitochondrial DNA region (18S-5S were analyzed using cleaved amplified polymorphic sequence (CAPS marker in 19 citrus accessions grown in Iran. In total, 45 SSR and 131 ISSR polymorphic alleles and tree organelle genome types were detected. Cluster analysis of SSR and ISSR data was performed using UPGMA method and based on Jaccard's coefficient. The result of this investigation showed that the SSR and ISSR primers were highly informative and efficient in detecting genetic variability and relationships of the citrus accessions. And CAPS marker analysis Results showed that Bakraee and one of off type Mexican lime had banding pattern similar to Clementine Mandarin, while Pummelo regarded as maternal parent of other studied genotypes Citron regarded as father parent showed definite banding pattern among 19 studied genotypes which it confirmed Cytoplasmic inheritance from mother cellular organelles.

  19. Skin cancer full-grown from scar

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.


    In this chapter authors investigate the peculiarities of skin cancer full-grown from scar, the theory of it's descent, quote some statistical data on skin cancer full-grown from scar and variety clinical forms of skin cancer full-grown from scar was shown, quote some methods of treatment

  20. Techniques for Optimizing Surgical Scars, Part 2: Hypertrophic Scars and Keloids. (United States)

    Potter, Kathryn; Konda, Sailesh; Ren, Vicky Zhen; Wang, Apphia Lihan; Srinivasan, Aditya; Chilukuri, Suneel


    Surgical management of benign or malignant cutaneous tumors may result in noticeable scars that are of great concern to patients, regardless of sex, age, or ethnicity. Techniques to optimize surgical scars are discussed in this three-part review. Part 2 focuses on scar revision for hypertrophic and keloids scars. Scar revision options for hypertrophic and keloid scars include corticosteroids, bleomycin, fluorouracil, verapamil, avotermin, hydrogel scaffold, nonablative fractional lasers, ablative and fractional ablative lasers, pulsed dye laser (PDL), flurandrenolide tape, imiquimod, onion extract, silicone, and scar massage.

  1. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species. (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf


    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  2. Towards the Development of a Molecular Map in Switchgrass: I. Microsatellite Marker Development; ANNUAL

    International Nuclear Information System (INIS)

    Gunter, L.E.


    The long-term goal of the switchgrass breeding program is to improve regionally adapted varieties and increase biomass yield and feedstock quality. Although, to some extent, biomass yields are dependent on environmental constraints, increased yield can be achieved through the development of genotypes with improved seasonal adaptation, tolerance to unfavorable environmental conditions, and improved resistance to pest and disease. To date, improvement in switchgrass has relied on recurrent breeding strategies based on phenotypic or genotypic selection. Yield improvements have been modest by this method. If we expect to make significant increase in yields, we need tools that will allow us to map complex traits and uncover the genes that influence them. A genetic linkage map could be a powerful tool for accelerating switchgrass development through marker-assisted selection, breeding and recombination. This type of mapping requires the development of markers that can be associated with phenotypic traits in a population of known pedigree. The most commonly used markers for mapping include restriction fragment length polymorphisms (RFLP) and simple sequence repeats (SSR). At ORNL, we have been concentrating on the development of SSR markers, while our colleagues at the University of Georgia are developing RFLP markers in order to select parents to produce a mapping population and from there to create a framework map from(approx)100 F1 progeny

  3. Genomic-Enabled Prediction Based on Molecular Markers and Pedigree Using the Bayesian Linear Regression Package in R

    Directory of Open Access Journals (Sweden)

    Paulino Pérez


    Full Text Available The availability of dense molecular markers has made possible the use of genomic selection in plant and animal breeding. However, models for genomic selection pose several computational and statistical challenges and require specialized computer programs, not always available to the end user and not implemented in standard statistical software yet. The R-package BLR (Bayesian Linear Regression implements several statistical procedures (e.g., Bayesian Ridge Regression, Bayesian LASSO in a unified framework that allows including marker genotypes and pedigree data jointly. This article describes the classes of models implemented in the BLR package and illustrates their use through examples. Some challenges faced when applying genomic-enabled selection, such as model choice, evaluation of predictive ability through cross-validation, and choice of hyper-parameters, are also addressed.

  4. Levels of some molecular and biochemical tumor markers in Egyptian patients with different grades and stages of bladder cancer

    International Nuclear Information System (INIS)

    Abd-elgoad, E.I.; Elkashef, H.S.; Hanfy, A.; El-maghraby, T.


    This study enrolled 64 patients with bladder cancer disease, 54 of them treated by surgery and 10 by radiotherapy. The patients were classified according to their clinical data that include infection with bilharziasis, grade, stage and type of tumor. The present study included determination of telomerase activity in tissue and urine using molecular methods and the levels of nuclear matrix protein 22 (NMP22) and fibronectin in urine. The applied tumor markers showed significant differences in malignant patients compared to control. The same picture was noticed in case of patients received radiotherapy but less pronounced. The results revealed that there is significant correlation between the three tumor markers and the grade of tumor, while NMP22 and fibronectin correlated with stage. Moreover, fibronectin only have significant correlation with the infection with the bilharziasis. The results indicated that determination of telomerase, fibronectin and NMP22 can give clear idea about the development of malignancy and may help in the prediction of cancer recurrence

  5. Small renal masses: The molecular markers associated with outcome of patients with kidney tumors 7 cm or less (United States)

    Spirina, L. V.; Usynin, Y. A.; Kondakova, I. V.; Yurmazov, Z. A.; Slonimskaya, E. M.; Pikalova, L. V.


    The investigation of molecular mechanisms of tumor cell behavior in small renal masses is required to achieve the better cancer survival. The aim of the study is to find molecular markers associated with outcome of patients with kidney tumors 7 cm or less. A homogenous group of 20 patients T1N0M0-1 (mean age 57.6 ± 2.2 years) with kidney cancer was selected for the present analysis. The content of transcription and growth factors was determined by ELISA. The levels of AKT-mTOR signaling pathway components were measured by Western blotting analysis. The molecular markers associated with unfavorable outcome of patients with kidney tumors 7 cm or less were high levels of NF-kB p50, NF-kB p65, HIF-1, HIF-2, VEGF and CAIX. AKT activation with PTEN loss also correlated with the unfavorable outcome of kidney cancer patients with tumor size 7 cm or less. It is observed that the biological features of kidney cancer could predict the outcome of patients.

  6. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes. (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud


    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  7. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants. (United States)

    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma


    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  8. [18F]-FMISO PET study of hypoxia in gliomas before surgery: correlation with molecular markers of hypoxia and angiogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Bekaert, Lien [CHU de Caen, Department of Neurology, Caen (France); Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); CHU de Caen, Department of Neurosurgery, Caen (France); CHU de Caen, Service de Neurochirurgie, Caen (France); Valable, Samuel; Collet, Solene; Bordji, Karim; Petit, Edwige; Bernaudin, Myriam [Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); Lechapt-Zalcman, Emmanuele [Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); CHU de Caen, Department of Pathology, Caen (France); Ponte, Keven [CHU de Caen, Department of Neurosurgery, Caen (France); Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); Constans, Jean-Marc [Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); CHU de Caen, Department of Neuroradiology, Caen (France); Levallet, Guenaelle [CHU de Caen, Department of Pathology, Caen (France); Branger, Pierre [CHU de Caen, Department of Neurology, Caen (France); Emery, Evelyne [CHU de Caen, Department of Neurosurgery, Caen (France); Manrique, Alain [CHU de Caen, Department of Nuclear Medicine, Caen (France); Barre, Louisa [Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/LDM-TEP group, Caen (France); Guillamo, Jean-Sebastien [CHU de Caen, Department of Neurology, Caen (France); Normandie Univ, UNICAEN, CEA, CNRS, ISTCT/CERVOxy Group, Caen (France); CHU de Nimes, Department of Neurology, Nimes (France)


    Hypoxia in gliomas is associated with tumor resistance to radio- and chemotherapy. However, positron emission tomography (PET) imaging of hypoxia remains challenging, and the validation of biological markers is, therefore, of great importance. We investigated the relationship between uptake of the PET hypoxia tracer [18F]-FMISO and other markers of hypoxia and angiogenesis and with patient survival. In this prospective single center clinical study, 33 glioma patients (grade IV: n = 24, III: n = 3, and II: n = 6) underwent [18F]-FMISO PET and MRI including relative cerebral blood volume (rCBV) maps before surgery. Maximum standardized uptake values (SUVmax) and hypoxic volume were calculated, defining two groups of patients based on the presence or absence of [18F]-FMISO uptake. After surgery, molecular quantification of CAIX, VEGF, Ang2 (rt-qPCR), and HIF-1α (immunohistochemistry) were performed on tumor specimens. [18F]-FMISO PET uptake was closely linked to tumor grade, with high uptake in glioblastomas (GB, grade IV). Expression of biomarkers of hypoxia (CAIX, HIF-1α), and angiogenesis markers (VEGF, Ang2, rCBV) were significantly higher in the [18F]-FMISO uptake group. We found correlations between the degree of hypoxia (hypoxic volume and SUVmax) and expression of HIF-1α, CAIX, VEGF, Ang2, and rCBV (p < 0.01). Patients without [18F]-FMISO uptake had a longer survival time than uptake positive patients (log-rank, p < 0.005). Tumor hypoxia as evaluated by [18F]-FMISO PET is associated with the expression of hypoxia markers on a molecular level and is related to angiogenesis. [18F]-FMISO uptake is a mark of an aggressive tumor, almost always a glioblastoma. Our results underline that [18F]-FMISO PET could be useful to guide glioma treatment, and in particular radiotherapy, since hypoxia is a well-known factor of resistance. (orig.)

  9. Molecular markers for tolerance of European ash (Fraxinus excelsior) to dieback disease identified using Associative Transcriptomics

    DEFF Research Database (Denmark)

    Harper, Andrea L.; McKinney, Lea Vig; Nielsen, Lene Rostgaard


    panel scored for disease symptoms and identified markers strongly associated with canopy damage in infected trees. Using these markers we predicted phenotypes in a test panel of unrelated trees, successfully identifying individuals with a low level of susceptibility to the disease. Co......Tree disease epidemics are a global problem, impacting food security, biodiversity and national economies. The potential for conservation and breeding in trees is hampered by complex genomes and long lifecycles, with most species lacking genomic resources. The European Ash tree Fraxinus excelsior...

  10. Investigating the KLF4 Gene Expression as a New Molecular Marker in Breast Tumors

    Directory of Open Access Journals (Sweden)

    MA Hosseinpour Feizi


    Results: The results showed that: 1 KLF4 is over expressed in Breast tumors rather than adjacent normal tissues. 2 KLF4 is an oncogene in breast tumors (at least in IDC type. 3 The KLF4 expression levels are related significantly with nature of malignant breast tumors. Conclusion: Findings do not confirm KLF4 as a diagnostic marker in classification and identification of tumoral tissues from non-tumoral ones in breast, but we can use this marker to identify at least 50% of invasive Ductal Carcinoma in breast and utilize it as a potential predictive factor to demonstrate severity degree in various tumors.

  11. Analysis of genetic diversity of certain species of Piper using RAPD-based molecular markers. (United States)

    Chowdhury, Utpal; Tanti, Bhaben; Rethy, Parakkal; Gajurel, Padma Raj


    The utility of RAPD markers in assessing genetic diversity and phenetic relationships of six different species of Piper from Northeast India was investigated. Polymerase chain reaction (PCR) with four arbitrary 10-mer oligonucleotide primers applied to the six species produced a total of 195 marker bands, of which, 159 were polymorphic. On average, six RAPD fragments were amplified per reaction. In the UPGMA phenetic dendrogram based on Jaccard's coefficient, the different accessions of Piper showed a high level of genetic variation. This study may be useful in identifying diverse genetic stocks of Piper, which may then be conserved on a priority basis.

  12. Forensic analysis of rockfall scars (United States)

    de Vilder, Saskia J.; Rosser, Nick J.; Brain, Matthew J.


    We characterise and analyse the detachment (scar) surfaces of rockfalls to understand the mechanisms that underpin their failure. Rockfall scars are variously weathered and comprised of both discontinuity release surfaces and surfaces indicative of fracturing through zones of previously intact rock, known as rock bridges. The presence of rock bridges and pre-existing discontinuities is challenging to quantify due to the difficulty in determining discontinuity persistence below the surface of a rock slope. Rock bridges form an important control in holding blocks onto rockslopes, with their frequency, extent and location commonly modelled from the surface exposure of daylighting discontinuities. We explore an alternative approach to assessing their role, by characterising failure scars. We analyse a database of multiple rockfall scar surfaces detailing the areal extent, shape, and location of broken rock bridges and weathered surfaces. Terrestrial laser scanning and gigapixel imagery were combined to record the detailed texture and surface morphology. From this, scar surfaces were mapped via automated classification based on RGB pixel values. Our analysis of the resulting data from scars on the North Yorkshire coast (UK) indicates a wide variation in both weathering and rock bridge properties, controlled by lithology and associated rock mass structure. Importantly, the proportion of rock bridges in a rockfall failure surface does not increase with failure size. Rather larger failures display fracturing through multiple rock bridges, and in contrast smaller failures fracture occurs only through a single critical rock bridge. This holds implications for how failure mechanisms change with rockfall size and shape. Additionally, the location of rock bridges with respect to the geometry of an incipient rockfall is shown to determine failure mode. Weathering can occur both along discontinuity surfaces and previously broken rock bridges, indicating the sequential stages of

  13. Development of molecular markers for zebrafish (Danio rerio) ovarian follicle growth assessment following in-vitro culture in cryopreservation studies. (United States)

    Anil, Siji; Rawson, David; Zhang, Tiantian


    Development of in vitro culture protocol for early stage ovarian follicles of zebrafish is important since cryopreserved early stage ovarian follicles would need to be matured in vitro following cryopreservation before they can be fertilised. Development of molecular markers for zebrafish (Danio rerio) ovarian follicle growth assessment following in vitro culture of early stage zebrafish ovarian follicles in ovarian tissue fragments is reported here for the first time although some work has been reported for in vitro culture of isolated early stage zebrafish ovarian follicles. The main aim of the present study was to develop molecular markers in an optimised in vitro culture protocol for stage I and stage II zebrafish ovarian follicles in ovarian tissue fragments. The effect of concentration of the hormones human chorionic gonadotropin and follicle stimulating hormones, and additives such as Foetal Bovine Serum and Bovine Serum Albumin were studied. The results showed that early stage zebrafish ovarian fragments containing stage I and stage II follicles which are cultured in vitro for 24 h in 20% FBS and 100mIU/ml FSH in 90% L-15 medium at 28 °C can grow to the size of stage II and stage III ovarian follicles respectively. More importantly the follicle growth from stage I to stage II and from stage II to stage III were confirmed using molecular markers such as cyp19a1a (also known as P450aromA) and vtg1 genes respectively. However, no follicle growth was observed following cryopreservation and in vitro culture. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Genetic relationships in an international collection of Puccinia horiana isolates based on newly identified molecular markers and demonstration of recombination. (United States)

    De Backer, M; Bonants, P; Pedley, K F; Maes, M; Roldan-Ruiz, I; Van Bockstaele, E; Heungens, K; van der Lee, T


    The obligate biotrophic pathogen Puccinia horiana is the causal agent of chrysanthemum white rust. Although P. horiana is a quarantine organism, it has been able to spread to most chrysanthemum-producing regions in the world since the 1960s; however, the transfer routes are largely obscure. An extremely low level of allelic diversity was observed in a geographically diverse set of eight isolates using complexity reduction of polymorphic sequences (CRoPS) technology. Only 184 of the 16,196 contigs (1.1%) showed one or more single-nucleotide polymorphisms (SNPs). Thirty-two SNPs and one simple-sequence repeat were translated into molecular markers and used to genotype 45 isolates originating from North and South America, Asia, and Europe. In most cases, phylogenetic clustering was related to geographic origin, indicating local establishment. The European isolates mostly grouped in two major populations that may relate to the two historic introductions previously reported. However, evidence of recent geographic transfer was also observed, including transfer events between Europe and South America and between Southeast Asia and Europe. In contrast with the presumed clonal propagation of this microcyclic rust, strong indications of marker recombination were observed, presumably as a result of anastomosis, karyogamy, and somatic meiosis. Recombination and transfer also explain the geographic dispersal of specific markers. A near-to-significant correlation between the genotypic data and previously obtained pathotype data was observed and one marker was associated with the most virulent pathotype group. In combination with a fast SNP detection method, the markers presented here will be helpful tools to further elucidate the transfer pathways and local survival of this pathogen.

  15. Molecular markers of anti-malarial drug resistance in Central, West and East African children with severe malaria


    Nguetse, Christian N.; Adegnika, Ayola Akim; Agbenyega, Tsiri; Ogutu, Bernhards R.; Krishna, Sanjeev; Kremsner, Peter G.; Velavan, Thirumalaisamy P.


    BACKGROUND: The Plasmodium falciparum multidrug resistance 1 (PfMDR1), P. falciparum Ca(2+)-ATPase (PfATP6) and Kelch-13 propeller domain (PfK13) loci are molecular markers of parasite susceptibility to anti-malarial drugs. Their frequency distributions were determined in the isolates collected from children with severe malaria originating from three African countries. METHODS: Samples from 287 children with severe malaria [(Gabon: n = 114); (Ghana: n = 89); (Kenya: n = 84)] were genotyped fo...

  16. De novo DNA sequence driven bulk segregant analysis can pinpoint candicate loci for Total Glycoalkaloid (TGA) content in potato without prior knowledge of molecular markers

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Sønderkær, Mads; Petersen, Annabeth Høgh

    is discarded based on the absence of desired molecular marker already at the seed or seedling stage. However, the number of molecular markers known in potato with appropriate linkage to agronomical traits is presently insufficient to establish a comprehensive MAS breeding platform for potato.......Potato breeding is a slow and costly affair, primarily done as a classical "mate and phenotype" approach using relatively small populations. In contrast, Marker Assisted Selection (MAS) allows cost-effective screening of much larger effective populations sizes because most of the offspring...

  17. Molecular Analysis of Synedrela Nodiflora (L. Gaertn. Resistance Against Fomesafen using RAPD Markers

    Directory of Open Access Journals (Sweden)

    Murni Dwiati


    Based on the RAPD markers used in this study, it can be concluded that genetic distance between susceptible and resistant S. nodiflora is higher than that within susceptible samples supporting our previous morphological and protein data, although genetic variation among susceptible individuals seems to be significantly high.

  18. Molecular characterization of peach [Prunus persica (L.) Batsch] germplasm in the United States using microsatellite markers (United States)

    Peach [Prunus persica (L.) Batsch] is an important medicinal fruit with immense health benefits and antioxidant activity. In this study, microsatellite markers were used as DNA fingerprinting tools for the identification and characterization of peach germplasm in the United States. Eleven microsatel...


    Herbicide drift (unintentional physical movement from target to off-target plants) is a cause of crop loss in US. Low-dose, high-potency herbicides that have short environmental persistence times constrain efforts to develop or identify metabolite or biochemical markers of exposu...

  20. Distribution of Mytilus taxa in European coastal areas as inferred from molecular markers

    NARCIS (Netherlands)

    Kijewski, T.; Zmietanka, B.; Zbawicka, M.; Gosling, E.; Hummel, H.; Wenne, R.


    The genetic constitution of mussels (Mytilus spp.) was studied by means of three nuclear (Me 15/16, EF-bis, ITS) and one mtDNA (ND2-COIII) marker on a large European scale. In addition to a sharp cline between Atlantic and Mediterranean M. galloprovincialis, we observed a clear genetic distinction

  1. Molecular prognostic markers in ovarian cancer : toward patient-tailored therapy

    NARCIS (Netherlands)

    Crijns, APG; Duiker, EW; de Jong, S; Willemse, PHB; van der Zee, AGJ; de Vries, EGE


    In ovarian cancer the ceiling seems to be reached with chemotherapeutic drugs. Therefore a paradigm shift is needed. Instead of treating all patients according to standard guidelines, individualized molecular targeted treatment should be aimed for. This means that molecular profiles of the distinct

  2. Candidate gene molecular markers as tools for analyzing genetic susceptibility to morbillivirus infection in stranded Cetaceans

    Czech Academy of Sciences Publication Activity Database

    Stejskalová, K.; Bayerova, Z.; Futas, J.; Hrazdilová, K.; Klumplerova, M.; Oppelt, J.; Šplíchalová, P.; Di Guardo, G.; Mazzariol, S.; Di Francesco, C. E.; Di Francesco, G.; Terracciano, G.; Paiu, R.M.; Ursache, T. D.; Modrý, David; Horin, P.


    Roč. 90, č. 6 (2017), s. 343-353 ISSN 2059-2302 Institutional support: RVO:60077344 Keywords : Cetacea * haplotype * immunity * innate * mhc-dqb * Phocoena phocoena * polymorphism * single nucleotide * Stenella coeruleoalba Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology

  3. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers. (United States)

    Wei, Jingli; Hu, Xiaorong; Yang, Jingjing; Yang, Wencai


    The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG) Release2.3 Predicted CDS (SL2.40) discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2%) of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  4. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers.

    Directory of Open Access Journals (Sweden)

    Jingli Wei

    Full Text Available The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG Release2.3 Predicted CDS (SL2.40 discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2% of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  5. Two dimensional unstable scar statistics.

    Energy Technology Data Exchange (ETDEWEB)

    Warne, Larry Kevin; Jorgenson, Roy Eberhardt; Kotulski, Joseph Daniel; Lee, Kelvin S. H. (ITT Industries/AES Los Angeles, CA)


    This report examines the localization of time harmonic high frequency modal fields in two dimensional cavities along periodic paths between opposing sides of the cavity. The cases where these orbits lead to unstable localized modes are known as scars. This paper examines the enhancements for these unstable orbits when the opposing mirrors are both convex and concave. In the latter case the construction includes the treatment of interior foci.

  6. Immunohistochemical Analysis of Scarring Trachoma Indicates Infiltration by Natural Killer and Undefined CD45 Negative Cells. (United States)

    Hu, Victor H; Luthert, Philip J; Derrick, Tamsyn; Pullin, James; Weiss, Helen A; Massae, Patrick; Mtuy, Tara; Makupa, William; Essex, David; Mabey, David C W; Bailey, Robin L; Holland, Martin J; Burton, Matthew J


    The phenotype and function of immune cells infiltrating the conjunctiva in scarring trachoma have yet to be fully characterized. We assessed tissue morphology and immunophenotype of cellular infiltrates found in trachomatous scarring compared to control participants. Clinical assessments and conjunctival biopsy samples were obtained from 34 individuals with trachomatous scarring undergoing trichiasis surgery and 33 control subjects undergoing cataract or retinal detachment surgery. Biopsy samples were fixed in buffered formalin and embedded in paraffin wax. Hematoxylin and eosin (H&E) staining was performed for assessment of the inflammatory cell infiltrate. Immunohistochemical staining of single markers on individual sections was performed to identify cells expressing CD3 (T-cells), CD4 (helper T-cells), CD8 (suppressor/cytotoxic T-cells and Natural Killer, NK, cells), NCR1 (NK cells), CD20 (B-cells), CD45 (nucleated hematopoietic cells), CD56 (NK and T-cells), CD68 (macrophages/monocytes) and CD83 (mature dendritic cells). The degree of scarring was assessed histologically using cross-polarized light to visualize collagen fibres. Scarring, regardless of clinical inflammation, was associated with increased inflammatory cell infiltrates on H&E and CD45 staining. Scarring was also associated with increased CD8+ and CD56+ cells, but not CD3+ cells, suggestive of a NK cell infiltrate. This was supported by the presence of NCR1+ cells. There was some increase in CD20+ cells, but no evidence for increased CD4+, CD68+ or CD83+ cells. Numerous CD45 negative cells were also seen in the population of infiltrating inflammatory cells in scarred conjunctiva. Disorganization of the normal collagen architecture was strongly associated with clinical scarring. These data point to the infiltration of immune cells with a phenotype suggestive of NK cells in conjunctival trachomatous scarring. A large proportion of CD45 negative inflammatory cells were also present. Future work should

  7. Imaging and Molecular Markers for Patients with Lung Cancer: Approaches with Molecular Targets, Complementary/Innovative Treatment, and Therapeutic Modalities (United States)


    Therapeutic and Imaging Agents to Lung Cancer (PI and co-PI: Renata Pasqualini , Ph.D., Wadih Arap, M.D., Ph.D.) The studies outlined in this proposal...with Drs. Pasqualini , Arap, and Wistuba. The IHC staining of lung cancer TMAs (390 cases) has been completed. We are working with investigators to...Project 3, R. Pasqualini ). This project was completed and a manuscript is in preparation by Dr. Pasqualini’s lab. b) Molecular abnormalities

  8. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches. (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P


    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  9. Survey of Paramecium duboscqui using three markers and assessment of the molecular variability in the genus Paramecium. (United States)

    Boscaro, Vittorio; Fokin, Sergei I; Verni, Franco; Petroni, Giulio


    The genus Paramecium (phylum Ciliophora) is one of the best-known among protozoa. Nevertheless, the knowledge on the diversity and distribution of species within this genus was remarkably scarce until recent times. In the last years a constantly growing amount of data has formed, especially on the distribution of species and the characterization of molecular markers. Much effort has been made on detecting clades inside each morphospecies, which could suggest the presence of sibling species complexes as in the famous case of Paramecium aurelia. In this work we present new data on Paramecium duboscqui, one of the morphospecies that have not yet been surveyed employing DNA sequences as markers. We obtained data from nine strains sampled around the world, using the three most commonly employed markers (18S rRNA gene, ITS1-5.8S-ITS2 and COI gene sequences). Moreover, we compared our results with those already available for other Paramecium species, and performed phylogenetic analyses for the entire genus. We also expanded the knowledge on the ITS2 secondary structure and its usefulness in studies on Paramecium. Our approach, that considers the data of all the species together, highlighted some characteristic patterns as well as some ambiguities that should be further investigated. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Pathogenicity Assay of Vibrio harveyi in Tiger Shrimp Larvae Employing Rifampicin-Resistant as A Molecular Marker

    Directory of Open Access Journals (Sweden)

    . Widanarni


    Full Text Available Rifampicin-resistant marker was employed as a reporter to assay pathogenicity of Vibrio harveyi  in shrimp larvae.  V. harveyi M. G3 and G7 that difference not schizotyping as shown by Pulsed-Filed Gel Electrophoresis (PFGE used in this study. Spontaneous mutation was conducted to generate V. harveyi resistant to rifampicin. Two groups of shrimp post-larvae (PL5 were immersed for 30 min in 106 CFU/ml of mutants and wild type of V. harveyi, respectively; and then placed in a 2 liter shrimp rearing tank for five days. A control group was immersed in sterile seawater. Growth curve analysis and pathogenicity assay of V. harveyi  showed that each of the V. harveyi mutant exhibited almost identical profiles to that of the wild type parental strain and did not show alteration in their pathogenicity. Sample from dead shrimp larvae showed that the dead shrimp larvae were infected by V. harveyi RfR, indicated that rifampicin-resistant marker effective as a reporter to assay pathogenicity of Vibrio harveyi in shrimp larvae. Key words: shrimp larvae, Vibrio harveyi, rifampicin-resistant, molecular marker

  11. Effect of starch microspheres on the passage of labelled erythrocytes and a low molecular weight marker through the liver

    International Nuclear Information System (INIS)

    Starkhammar, H.; Haakansson, L.


    Degradable starch microspheres (DSM) injected intra-arterially together with cytostatic drugs increase the regional uptake of the drug and as a result reduce the systemic drug concentration. Previous studies have indicated that fixed doses of DSM result in different degrees of vascular occlusion and therefore variable systemic concentration of the co-injected drug. Continuous registration of the systemic concentration of 99 Tc m -hydroxymethylene diphosphonate ( 99 Tc m -HDP) co-injected intra-arterially with DSM was earlier used to monitor treatment sessions and to optimize the dose of microspheres. Further to investigate the mechanism of DSM-induced retention, the effect of DSM on the passage of this low molecular weight marker and of labelled erythrocytes (a marker confined to the blood vessels), was compared in 10 patients with liver metastases. DSM reduced the amount of 99 Tc m -HDP passing through the liver by 6 to 47% while the amount of erythrocytes eventually passing the liver was much less reduced (0-14%). The rate of passage, however, was significantly reduced for both labelled markers. These results indicate that substances retained by co-injection of DSM are not to a significant extent lodged within the blood vessels but diffuse into extra-vasal tissue compartments. (orig.)

  12. Molecular markers detect stable genomic regions underlying tomato fruit shelf life and weight

    Directory of Open Access Journals (Sweden)

    Guillermo Raúl Pratta


    Full Text Available Incorporating wild germplasm such as S. pimpinellifolium is an alternative strategy to prolong tomato fruit shelf life(SL without reducing fruit quality. A set of recombinant inbred lines with discrepant values of SL and weight (FW were derived byantagonistic-divergent selection from an interspecific cross. The general objective of this research was to evaluate Genotype x Year(GY and Marker x Year (MY interaction in these new genetic materials for both traits. Genotype and year principal effects and GYinteraction were statistically significant for SL. Genotype and year principal effects were significant for FW but GY interaction wasnot. The marker principal effect was significant for SL and FW but both year principal effect and MY interaction were not significant.Though SL was highly influenced by year conditions, some genome regions appeared to maintain a stable effect across years ofevaluation. Fruit weight, instead, was more independent of year effect.

  13. Molecular phylogeny of Gavilea (Chloraeinae: Orchidaceae) using plastid and nuclear markers. (United States)

    Chemisquy, M Amelia; Morrone, Osvaldo


    A phylogenetic analysis is provided for 70% of the representatives of genus Gavilea, as well as for several species of the remaining genera of subtribe Chloraeinae: Bipinnula, Chloraea and Geoblasta. Sequences from the plastid markers rpoC1, matK-trnK and atpB-rbcL and the nuclear marker ITS, were analyzed using Maximum Parsimony and Bayesian Inference. Monophyly of subtribe Chloraeinae was confirmed, as well as its position inside tribe Cranichideae. Neither Chloraea nor Bipinnula were recovered as monophyletic. Gavilea turned out polyphyletic, with Chloraeachica embedded in the genus while Gavilea supralabellata was related to Chloraea and might be a hybrid between both genera. None of the two sections of Gavilea were monophyletic, and the topologies obtained do not suggest a new division of the genus. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. A molecular marker distinguishes the subspecies Melipona quadrifasciata quadrifasciata and Melipona quadrifasciata anthidioides (Hymenoptera: Apidae, Meliponinae)


    Ana M. Waldschmidt; Everaldo G. de Barros; Lucio A.O. Campos


    The stingless bee species Melipona quadrifasciata includes two subspecies, Melipona quadrifasciata anthidioids and Melipona quadrifasciata quadrifasciata. The morphological difference between the two subspecies is the presence of three to five continuous yellow stripes on the terga on the 3rd to 6th segments in workers and males of M. q. quadrifasciata, and two to five interrupted bands in M. q. anthidioides. We identified a DNA marker which is present in M. q. quadrifasciata and absent in M....

  15. Obtaining interspecific hybrids, and molecular analysis by microsatellite markers in grapevine


    Mariane Ruzza Schuck; Luiz Antonio Biasi; Ada Michele Mariano; Bernardo Lipski; Summaira Riaz; Michael Andrew Walker


    The objective of this work was to assess the potential of interspecific hybridization of Vitis labruscana and Muscadinia rotundifolia by using artificial cross-pollinations. Microsatellite markers were used to confirm interspecific hybridizations and the identity of the parental genotypes. In crosses in which M. rotundifolia was used as the female parent, no true hybrids were obtained. In the reciprocal crosses, 114 seedlings were identified as true V. labruscana x M. rotundifolia hybrids. Se...

  16. Molecular Characterization and Genetic Diversity of the Macaw Palm Ex Situ Germplasm Collection Revealed by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Fekadu G. Mengistu


    Full Text Available Macaw palm (Acrocomia aculeata is native to tropical forests in South America and highly abundant in Brazil. It is cited as a highly productive oleaginous palm tree presenting high potential for biodiesel production. The aim of this work was to characterize and study the genetic diversity of A. aculeata ex situ collections from different geographical states in Brazil using microsatellite (Simple Sequence Repeats, SSR markers. A total of 192 accessions from 10 provenances were analyzed with 10 SSR, and variations were detected in allelic diversity, polymorphism, and heterozygosity in the collections. Three major groups of accessions were formed using PCoA—principal coordinate analysis, UPGMA—unweighted pair-group method with arithmetic mean, and Tocher. The Mantel test revealed a weak correlation (r = 0.07 between genetic and geographic distances among the provenances reaffirming the result of the grouping. Reduced average heterozygosity (Ho < 50% per locus (or provenance confirmed the predominance of endogamy (or inbreeding in the germplasm collections as evidenced by positive inbreeding coefficient (F > 0 per locus (or per provenance. AMOVA—Analysis of Molecular Variance revealed higher (48.2% genetic variation within population than among populations (36.5%. SSR are useful molecular markers in characterizing A. aculeata germplasm and could facilitate the process of identifying, grouping, and selecting genotypes. Present results could be used to formulate appropriate conservation strategies in the genebank.

  17. Measles Virus: Identification in the M Protein Primary Sequence of a Potential Molecular Marker for Subacute Sclerosing Panencephalitis

    Directory of Open Access Journals (Sweden)

    Hasan Kweder


    Full Text Available Subacute Sclerosing Panencephalitis (SSPE, a rare lethal disease of children and young adults due to persistence of measles virus (MeV in the brain, is caused by wild type (wt MeV. Why MeV vaccine strains never cause SSPE is completely unknown. Hypothesizing that this phenotypic difference could potentially be represented by a molecular marker, we compared glycoprotein and matrix (M genes from SSPE cases with those from the Moraten vaccine strain, searching for differential structural motifs. We observed that all known SSPE viruses have residues P64, E89, and A209 (PEA in their M proteins whereas the equivalent residues for vaccine strains are either S64, K89, and T209 (SKT as in Moraten or PKT. Through the construction of MeV recombinants, we have obtained evidence that the wt MeV-M protein PEA motif, in particular A209, is linked to increased viral spread. Importantly, for the 10 wt genotypes (of 23 that have had their M proteins sequenced, 9 have the PEA motif, the exception being B3, which has PET. Interestingly, cases of SSPE caused by genotype B3 have yet to be reported. In conclusion, our results strongly suggest that the PEA motif is a molecular marker for wt MeV at risk to cause SSPE.

  18. Molecular identification and genetic variation of varieties of Styphnolobium japonicum (Fabaceae) using SRAP markers. (United States)

    Sun, R X; Zhang, C H; Zheng, Y Q; Zong, Y C; Yu, X D; Huang, P


    Thirty-four Styphnolobium japonicum varieties were analyzed using sequence-related amplified polymorphism (SRAP) markers, to investigate genetic variation and test the effectiveness of SRAP markers in DNA fingerprint establishment. Twelve primer pairs were selected from 120 primer combinations for their reproducibility and high polymorphism. We found a total of 430 amplified fragments, of which 415 fragments were considered polymorphic with an average of 34.58 polymorphic fragments for each primer combination. The percentage of polymorphic fragments was 96.60%, and four primer pairs showed 100% polymorphism. Moreover, simple matched coefficients ranged between 0.68 and 0.89, with an average of 0.785, indicating that the genetic variation among varieties was relatively low. This could be because of the narrow genetic basis of the selected breeding material. Based on the similarity coefficient value of 0.76, the varieties were divided into four major groups. In addition, abundant and clear SRAP fingerprints were obtained and could be used to establish DNA fingerprints. In the DNA fingerprints, each variety had its unique pattern that could be easily distinguished from others. The results demonstrated that 34 varieties of S. japonicum had a relatively narrow genetic variation. Hence, a broadening of the genetic basis of breeding material is necessary. We conclude that establishment of DNA fingerprint is feasible by means of SRAP markers.

  19. Assessment of genetic diversity in indigenous turmeric (Curcuma longa) germplasm from India using molecular markers. (United States)

    Verma, Sushma; Singh, Shweta; Sharma, Suresh; Tewari, S K; Roy, R K; Goel, A K; Rana, T S


    Curcuma longa L., commonly known as turmeric, is one of the economically and medicinally important plant species. It is predominantly cultivated in the tropical and sub tropical countries. India is the largest producer, and exporter of turmeric in the world, followed by China, Indonesia, Bangladesh and Thailand. In the present study, Directed Amplification of Minisatellite DNA (DAMD) and Inter Simple Sequence Repeats (ISSR), methods were used to estimate the genetic variability in indigenous turmeric germplasm. Cumulative data analysis for DAMD (15) and ISSR (13) markers resulted into 478 fragments, out of which 392 fragments were polymorphic, revealing 82 % polymorphism across the turmeric genotypes. Wide range of pairwise genetic distances (0.03-0.59) across the genotypes revealed that these genotypes are genetically quite diverse. The UPGMA dendrogram generated using cumulative data showed significant relationships amongst the genotypes. All 29 genotypes studied grouped into two clusters irrespective of their geographical affiliations with 100 % bootstrap value except few genotypes, suggesting considerable diversity amongst the genotypes. These results suggested that the current collection of turmeric genotypes preserve the vast majority of natural variations. The results further demonstrate the efficiency and reliability of DAMD and ISSR markers in determining the genetic diversity and relationships among the indigenous turmeric germplasm. DAMD and ISSR profiling have identified diverse turmeric genotypes, which could be further utilized in various genetic improvement programmes including conventional as well as marker assisted breeding towards development of new and desirable turmeric genotypes.

  20. Obtaining interspecific hybrids, and molecular analysis by microsatellite markers in grapevine

    Directory of Open Access Journals (Sweden)

    Mariane Ruzza Schuck


    Full Text Available The objective of this work was to assess the potential of interspecific hybridization of Vitis labruscana and Muscadinia rotundifolia by using artificial cross-pollinations. Microsatellite markers were used to confirm interspecific hybridizations and the identity of the parental genotypes. In crosses in which M. rotundifolia was used as the female parent, no true hybrids were obtained. In the reciprocal crosses, 114 seedlings were identified as true V. labruscana x M. rotundifolia hybrids. Self pollination occurred in direct and in reciprocal crosses. The crossings between 'Bordo' x 'Carlos', 'Magnolia', 'Regale' and' Roanoke', and between' Isabel' x 'Bountiful', 'Carlos', 'Magnolia', 'Regale' and 'Roanoke' were confirmed. The 15 markers evaluated showed that two M. rotundifolia parental genotypes had the same fingerprint profile, indicating a like lyplanting error. The success of hybridization depends mainly on the species and on the cultivar used as the female parent. Microsatellite markers are efficient to confirm the paternity of interspecific F1 hybrids and to determine the correct identity of M. rotundifolia cultivars.

  1. Histopathological and molecular prognostic markers in medulloblastoma: c-myc, N-myc, TrkC, and anaplasia. (United States)

    Eberhart, Charles G; Kratz, John; Wang, Yunyue; Summers, Krista; Stearns, Duncan; Cohen, Kenneth; Dang, Chi V; Burger, Peter C


    Several molecular and histopathological prognostic markers have been proposed for the therapeutic stratification of medulloblastoma patients. Amplification of the c-myc oncogene, elevated levels of c-myc mRNA, or tumor anaplasia have been associated with worse clinical outcomes. In contrast, high TrkC mRNA expression generally presages longer survival. The goal of this study was to evaluate the prognostic value of c-myc, N-myc and TrkC expression in medulloblastomas and compare them to histopathological classification. We used in situ hybridization to measure expression of these molecular markers. c-myc mRNA was detected in 18 of 59 (31%) cases, and was significantly associated with shorter patient survival times on both univariate and multivariate analyses (p = 0.04). The presence of c-myc mRNA was also significantly associated with tumor anaplasia. While survival rates were higher for patients with low N-myc or high TrkC expression, these differences were not statistically significant. The group of patients with either moderate or severely anaplastic tumors showed only a trend towards shorter survival (p = 0.11). However, severe anaplasia alone was significantly prognostic (p = 0.002). Given the prognostic import of c-myc, we investigated 2 potential mechanisms by which its expression might be regulated: Wnt signaling and Mxi-1 mutation. Nuclear translocation of beta-catenin, a marker of Wnt pathway activation, was more common in medulloblastomas with high c-myc than in tumors overall, but the difference was not statistically significant. No Mxi-1 mutations were detected in the 22 cases examined. The association we describe between c-myc expression, tumor anaplasia, and worse clinical outcomes provides further evidence for the importance of this oncogene in medulloblastoma pathobiology.

  2. Protein Based Molecular Markers Provide Reliable Means to Understand Prokaryotic Phylogeny and Support Darwinian Mode of Evolution

    Directory of Open Access Journals (Sweden)

    Vaibhav eBhandari


    Full Text Available The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning whether the Darwinian model of evolution is applicable to the prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs and conserved signature proteins (CSPs for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical

  3. Protein based molecular markers provide reliable means to understand prokaryotic phylogeny and support Darwinian mode of evolution. (United States)

    Bhandari, Vaibhav; Naushad, Hafiz S; Gupta, Radhey S


    The analyses of genome sequences have led to the proposal that lateral gene transfers (LGTs) among prokaryotes are so widespread that they disguise the interrelationships among these organisms. This has led to questioning of whether the Darwinian model of evolution is applicable to prokaryotic organisms. In this review, we discuss the usefulness of taxon-specific molecular markers such as conserved signature indels (CSIs) and conserved signature proteins (CSPs) for understanding the evolutionary relationships among prokaryotes and to assess the influence of LGTs on prokaryotic evolution. The analyses of genomic sequences have identified large numbers of CSIs and CSPs that are unique properties of different groups of prokaryotes ranging from phylum to genus levels. The species distribution patterns of these molecular signatures strongly support a tree-like vertical inheritance of the genes containing these molecular signatures that is consistent with phylogenetic trees. Recent detailed studies in this regard on the Thermotogae and Archaea, which are reviewed here, have identified large numbers of CSIs and CSPs that are specific for the species from these two taxa and a number of their major clades. The genetic changes responsible for these CSIs (and CSPs) initially likely occurred in the common ancestors of these taxa and then vertically transferred to various descendants. Although some CSIs and CSPs in unrelated groups of prokaryotes were identified, their small numbers and random occurrence has no apparent influence on the consistent tree-like branching pattern emerging from other markers. These results provide evidence that although LGT is an important evolutionary force, it does not mask the tree-like branching pattern of prokaryotes or understanding of their evolutionary relationships. The identified CSIs and CSPs also provide novel and highly specific means for identification of different groups of microbes and for taxonomical and biochemical studies.

  4. The soft mechanical signature of glial scars in the central nervous system (United States)

    Moeendarbary, Emad; Weber, Isabell P.; Sheridan, Graham K.; Koser, David E.; Soleman, Sara; Haenzi, Barbara; Bradbury, Elizabeth J.; Fawcett, James; Franze, Kristian


    Injury to the central nervous system (CNS) alters the molecular and cellular composition of neural tissue and leads to glial scarring, which inhibits the regrowth of damaged axons. Mammalian glial scars supposedly form a chemical and mechanical barrier to neuronal regeneration. While tremendous effort has been devoted to identifying molecular characteristics of the scar, very little is known about its mechanical properties. Here we characterize spatiotemporal changes of the elastic stiffness of the injured rat neocortex and spinal cord at 1.5 and three weeks post-injury using atomic force microscopy. In contrast to scars in other mammalian tissues, CNS tissue significantly softens after injury. Expression levels of glial intermediate filaments (GFAP, vimentin) and extracellular matrix components (laminin, collagen IV) correlate with tissue softening. As tissue stiffness is a regulator of neuronal growth, our results may help to understand why mammalian neurons do not regenerate after injury.

  5. A molecular marker distinguishes the subspecies Melipona quadrifasciata quadrifasciata and Melipona quadrifasciata anthidioides (Hymenoptera: Apidae, Meliponinae

    Directory of Open Access Journals (Sweden)

    Ana M. Waldschmidt


    Full Text Available The stingless bee species Melipona quadrifasciata includes two subspecies, Melipona quadrifasciata anthidioids and Melipona quadrifasciata quadrifasciata. The morphological difference between the two subspecies is the presence of three to five continuous yellow stripes on the terga on the 3rd to 6th segments in workers and males of M. q. quadrifasciata, and two to five interrupted bands in M. q. anthidioides. We identified a DNA marker which is present in M. q. quadrifasciata and absent in M. q. anthidioides. Only one among the M. q. quadrifasciata colonies did not present the marker. It was also absent in bees collected in northern Minas Gerais State (Brazil, despite their morphological resemblance to M. q. quadrifasciata. The marker can be used for studying the genetic structure of the hybridization zone formed by the intercrossing of the two subspecies.A espécie de abelha sem ferrão Melipona quadrifasciata apresenta duas subespécies, Melipona quadrifasciata quadrifasciata Lep. e Melipona quadrifasciata anthidioides Lep. A diferença morfológica entre as duas subespécies é a presença de três a cinco bandas tergais amarelas do 3º ao 6º segmentos em operárias e machos de M. q. quadrifasciata e duas a cinco bandas interrompidas em M. q. anthidioides. Nós identificamos um marcador de DNA que está presente em M. q. quadrifasciata e ausente em M. q. anthidioides. Este marcador está ausente em abelhas coletadas no norte do Estado de Minas Gerais (Brasil, embora esses indivíduos apresentem morfologia similar à de M. q. quadrifasciata. Este marcador poderá ser utilizado em estudos da zona de hibridação entre as subespécies.

  6. Molecular markers of oocyte differentiation in European eel during hormonally induced oogenesis. (United States)

    Rojo-Bartolomé, Iratxe; Martínez-Miguel, Leticia; Lafont, Anne-Gaëlle; Vílchez, M Carmen; Asturiano, Juan F; Pérez, Luz; Cancio, Ibon


    Reproduction in captivity is a key study issue in Anguilla anguilla as a possible solution for its dwindling population. Understanding the mechanisms controlling the production of ribosomal building blocks during artificially induced oocyte maturation could be particularly interesting. Transcription levels of ribosomal biogenesis associated genes could be used as markers to monitor oogenesis. Eels from the Albufera Lagoon were injected with carp pituitary extract for 15weeks and ovaries in previtellogenic (PV) stage (non-injected), in early-, mid-, late-vitellogenesis (EV, MV, LV), as well as in migratory nucleus stage (MN) were analysed. 5S rRNA and related genes were highly transcribed in ovaries with PV oocytes. As oocytes developed, transcriptional levels of genes related to 5S rRNA production (gtf3a), accumulation (gtf3a, 42sp43) and nucleocytoplasmic transport (rpl5, rpl11) and the 5S/18S rRNA index decreased (PV>EV>MV>LV>MN). On the contrary, 18S rRNA was at its highest at MN stage while ubtf1 in charge of activating RNA-polymerase I and synthesising 18S rRNA behaved as 5S related genes. Individuals that did not respond (NR) to the treatment showed 5S/18S index values similar to PV females, while studied genes showed EV/LV-like transcription levels. Therefore, NR females fail to express the largest rRNAs, which could thus be taken as markers of successful vitellogenesis progression. In conclusion, we have proved that the transcriptional dynamics of ribosomal genes provides useful tools to characterize induced ovarian development in European eels. In the future, such markers should be studied as putative indicators of response to hormonal treatments and of the quality of obtained eel oocytes. Copyright © 2017. Published by Elsevier Inc.

  7. A Secondary Antibody-Detecting Molecular Weight Marker with Mouse and Rabbit IgG Fc Linear Epitopes for Western Blot Analysis. (United States)

    Lin, Wen-Wei; Chen, I-Ju; Cheng, Ta-Chun; Tung, Yi-Ching; Chu, Pei-Yu; Chuang, Chih-Hung; Hsieh, Yuan-Chin; Huang, Chien-Chiao; Wang, Yeng-Tseng; Kao, Chien-Han; Roffler, Steve R; Cheng, Tian-Lu


    Molecular weight markers that can tolerate denaturing conditions and be auto-detected by secondary antibodies offer great efficacy and convenience for Western Blotting. Here, we describe M&R LE protein markers which contain linear epitopes derived from the heavy chain constant regions of mouse and rabbit immunoglobulin G (IgG Fc LE). These markers can be directly recognized and stained by a wide range of anti-mouse and anti-rabbit secondary antibodies. We selected three mouse (M1, M2 and M3) linear IgG1 and three rabbit (R1, R2 and R3) linear IgG heavy chain epitope candidates based on their respective crystal structures. Western blot analysis indicated that M2 and R2 linear epitopes are effectively recognized by anti-mouse and anti-rabbit secondary antibodies, respectively. We fused the M2 and R2 epitopes (M&R LE) and incorporated the polypeptide in a range of 15-120 kDa auto-detecting markers (M&R LE protein marker). The M&R LE protein marker can be auto-detected by anti-mouse and anti-rabbit IgG secondary antibodies in standard immunoblots. Linear regression analysis of the M&R LE protein marker plotted as gel mobility versus the log of the marker molecular weights revealed good linearity with a correlation coefficient R2 value of 0.9965, indicating that the M&R LE protein marker displays high accuracy for determining protein molecular weights. This accurate, regular and auto-detected M&R LE protein marker may provide a simple, efficient and economical tool for protein analysis.

  8. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water. (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S


    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology

  9. Molecular markers derived from bombesin for tumor diagnosis by SPECT and PET; Marcadores moleculares derivados da bombesina para diagnostico de tumores por SPECT e PET

    Energy Technology Data Exchange (ETDEWEB)

    Pujatti, Priscilla Brunelli


    A high number of molecules have already been identified to have high affinity to some receptors overexpressed on tumour cells and the radiolabelling of those molecules offers the possibility of new compounds for tumour diagnosis and therapy by nuclear medicine. Among of those molecules, bombesin (BBN) has become focus of interest, as its BB{sub 2} receptors are known to be overexpressed in prostate, breast, colon, pancreatic and lung tumour, as long as glioblastomas and neuroblastomas. BBN agonists and antagonists have already been described for this purpose and promising results were obtained in preclinical studies. However, most of them exhibited high abdominal accumulation, especially in pancreas and intestines, which can compromise diagnosis accuracy and cause serious adverse effects in therapy. In this context, the goal of the present work to radiolabel new BBN derivatives with {sup 11}1In and {sup 68}Ga and to evaluate their potential for BB{sub 2} positive tumors diagnosis by single photon emission tomography (SPECT) and positron emission tomography (PET). The structure of studied peptides was Q-YG{sub n}-BBN(6-14), where Q is the chelator, n is the number of glycine aminoacids in the spacer YG{sub n} and BBN(6-14) is the original bombesin sequence from the aminoacid 6 to 14. The derivative in which the last aminoacid (methionine, Met) was replaced by norleucine (Nle) was also evaluated. The experimental evaluation of the bombesin derivatives was divided into four steps: computational studies, molecular markers for SPECT, molecular markers for PET and toxicological studies. The theoretical partition (log P) and distribution (log D) coefficients were calculated for all bombesin derivatives conjugated to DTPA (diethylenetriaminepentaacetic acid) and DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) chelators applying computational programmes. Bombesin derivatives for SPECT were developed by radiolabelling DTPA-conjugated bombesin derivatives with

  10. Variabilidade genética de acessos de maracujá-suspiro com base em marcadores moleculares Genetic variability of wild passion fruit determined by molecular markers

    Directory of Open Access Journals (Sweden)

    Keize Pereira Junqueira


    Full Text Available Passiflora nitida é uma espécie silvestre amplamente distribuída pelo território brasileiro, constituindo-se em fonte de resistência a doenças foliares e de raízes. O objetivo deste trabalho foi avaliar a variabilidade genética entre acessos de P. nitida procedentes de diferentes tipos fitofisionômicos de Cerrado e estados brasileiros (Goiás, Distrito Federal, Tocantins, Mato Grosso e Amazonas, usando marcadores moleculares RAPD. O DNA genômico de cada acesso foi extraído, e doze iniciadores decâmeros foram utilizados para a obtenção de marcadores moleculares RAPD, que foram convertidos em matriz de dados binários, a partir da qual foram estimadas as distâncias genéticas entre os acessos e realizadas análises de agrupamento e de dispersão gráfica. Foram obtidos 196 marcadores para P. nitida, dos quais 63,81% foram polimórficos. As distâncias genéticas entre os acessos de maracujá variaram de 0,031 a 0,614 e, considerando apenas P. nitida, de 0,031 a 0,417. Os marcadores moleculares demonstraram alta variabilidade genética dos acessos de P. nitida. Menores distâncias genéticas foram verificadas entre os acessos originados do mesmo estado. Considerando-se os acessos de um mesmo estado, menores distâncias genéticas foram verificadas entre os acessos provenientes de tipos fitofisionômicos próximos. O acesso "Manaus 2" apresentou o maior distanciamento genético em relação aos demais acessos.Passiflora nitida is a wild species widely distributed in Brazilian territory. It is a source of resistance to foliar and soil borne diseases. The objective of this work was to evaluate the genetic variability among accessions of P. nitida proceeding from different types of Cerrado (Brazilian savannah vegetation and brazilian states (Goiás, Distrito Federal, Tocantins, Mato Grosso and Amazonas using RAPD molecular markers. The genomic DNA of each origin was extracted and amplified using 12 decamer primers to obtain RAPD

  11. A Case of Multiple Spontaneous Keloid Scars

    Directory of Open Access Journals (Sweden)

    Abdulhadi Jfri


    Full Text Available Keloid scars result from an abnormal healing response to cutaneous injury or inflammation that extends beyond the borders of the original wound. Spontaneous keloid scars forming in the absence of any previous trauma or surgical procedure are rare. Certain syndromes have been associated with this phenomenon, and few reports have discussed the evidence of single spontaneous keloid scar, which raises the question whether they are really spontaneous. Here, we present a 27-year-old mentally retarded single female with orbital hypertelorism, broad nasal bridge, repaired cleft lip and high-arched palate who presented with progressive multiple spontaneous keloid scars in different parts of her body which were confirmed histologically by the presence of typical keloidal collagen. This report supports the fact that keloid scars can appear spontaneously and are possibly linked to a genetic factor. Furthermore, it describes a new presentation of spontaneous keloid scars in the form of multiple large lesions in different sites of the body.

  12. Molecular Characterization of Cultivated Bromeliad Accessions with Inter-Simple Sequence Repeat (ISSR Markers

    Directory of Open Access Journals (Sweden)

    Yongming Yu


    Full Text Available Bromeliads are of great economic importance in flower production; however little information is available with respect to genetic characterization of cultivated bromeliads thus far. In the present study, a selection of cultivated bromeliads was characterized via inter-simple sequence repeat (ISSR markers with an emphasis on genetic diversity and population structure. Twelve ISSR primers produced 342 bands, of which 287 (~84% were polymorphic, with polymorphic bands per primer ranging from 17 to 34. The Jaccard’s similarity ranged from 0.08 to 0.89 and averaged ~0.30 for the investigated bromeliads. The Bayesian-based approach, together with the un-weighted paired group method with arithmetic average (UPGMA-based clustering and the principal coordinate analysis (PCoA, distinctly grouped the bromeliads from Neoregelia, Guzmania, and Vriesea into three separately clusters, well corresponding with their botanical classifications; whereas the bromeliads of Aechmea other than the recently selected hybrids were not well assigned to a cluster. Additionally, ISSR marker was proven efficient for the identification of hybrids and bud sports of cultivated bromeliads. The findings achieved herein will further our knowledge about the genetic variability within cultivated bromeliads and therefore facilitate breeding for new varieties of cultivated bromeliads in future as well.

  13. Genetic diversity, identification, and certification of Chilean rice varieties using molecular markers

    Directory of Open Access Journals (Sweden)

    Viviana Becerra


    Full Text Available It takes approximately 14 yr to produce a new rice (Oryza sativa L. variety, that is, from initial hybridization to its commercial release. Currently, new varieties are identified based on morphological descriptors, which have been efficient over time. However, due to the main constraints on seed type impose to other breeding objectives and the pressure of continuous release of varieties, high degree of parentage, and genetic and morphological uniformity has been observed in the breeding populations. The objectives of this study were: to determine the genetic variability of Chilean and foreign commercial rice varieties, and determine, identify, and certify the genetic relationships among varieties, using simple sequence repeat (SSR markers. A total of 16 commercial varieties, some of them closely related, were included in the study, which were genétically analyzed using 54 microsatellites. The 54 microsatellite loci allowed the discrimination among the 16 varieties. The number of alleles ranged between 2 and 8 with a mean of 3.54 alleles per locus, while the polymorphism information content (PIC presented a mean of 0.44. The genetic distance and diversity parameters between pairs of varieties indicate a limited diversity among these genotypes. The cluster analysis indicated that varieties were grouped according to their grain type and pedigree. Results demonstrate that the identification and certification of varieties using microsatellite markers could be a good complement to existing agro-morphological data when varieties are closed related.

  14. Diagnostic/prognostic molecular cytogenetic follow-up applied in satellited marker cases

    Energy Technology Data Exchange (ETDEWEB)

    Papenhausen, P.R.; Anderson, S.


    Special caution needs to be exercised in offering a good prognosis in Prader-Willi probe negative 15-derived marker cases, since it is clear that phenotypic effects can still be associated with the apparent presence of proximal sequences. We have had two postnatal cases in this category, one which was inherited from an unaffected paternal (non-mosaic) carrier, possibly demonstrating imprinting effects. Familial studies are continuing in this case. Although the D22/S9 locus appears diagnostic of cateye syndrome (CES), the dual specificity of the 14/22 centromeric probe leaves the possibility of a poor prognosis 14 derivation when the CES probe is negative. Therefore, it is imperative that proximal long arm 13, 14, 21 and more proximal 15 FISH probes be implemented so that a phenotypically correlated database may indicate the proper FISH probes necessary for accurate prognosis. Bisatellited markers is which a bipartite centromeric probe signal was found were considered to be higher risk than those with the single signal in counseling.

  15. GERD—Barrett—Adenocarcinoma: Do We Have Suitable Prognostic and Predictive Molecular Markers?

    Directory of Open Access Journals (Sweden)

    Romana Illig


    Full Text Available Due to unfavorable lifestyle habits (unhealthy diet and tobacco abuse the incidence of gastroesophageal reflux disease (GERD in western countries is increasing. The GERD-Barrett-Adenocarcinoma sequence currently lacks well-defined diagnostic, progressive, predictive, and prognostic biomarkers (i providing an appropriate screening method identifying the presence of the disease, (ii estimating the risk of evolving cancer, that is, the progression from Barrett’s esophagus (BE to esophageal adenocarcinoma (EAC, (iii predicting the response to therapy, and (iv indicating an overall survival—prognosis for EAC patients. Based on histomorphological findings, detailed screening and therapeutic guidelines have been elaborated, although epidemiological studies could not support the postulated increasing progression rates of GERD to BE and EAC. Additionally, proposed predictive and prognostic markers are rather heterogeneous by nature, lack substantial proofs, and currently do not allow stratification of GERD patients for progression, outcome, and therapeutic effectiveness in clinical practice. The aim of this paper is to discuss the current knowledge regarding the GERD-BE-EAC sequence mainly focusing on the disputable and ambiguous status of proposed biomarkers to identify promising and reliable markers in order to provide more detailed insights into pathophysiological mechanisms and thus to improve prognostic and predictive therapeutic approaches.

  16. Optimized measurements of separations and angles between intra-molecular fluorescent markers

    DEFF Research Database (Denmark)

    Mortensen, Kim; Sung, Jongmin; Flyvbjerg, Henrik


    We demonstrate a novel, yet simple tool for the study of structure and function of biomolecules by extending two-colour co-localization microscopy to fluorescent molecules with fixed orientations and in intra-molecular proximity. From each colour-separated microscope image in a time-lapse movie...

  17. Evaluation of molecular markers for Phytophthora ramorum detection and identification using a standardized library of isolates (United States)

    F.N. Martin; M. Coffey; R. Hamelin; P. Tooley; M. Garbelotto; K. Hughes; T. Kubisiak


    A number of molecular diagnostic procedures for detection of Phytophthora ramorum have been reported in the literature. In an effort to evaluate the specificity of 10 of these techniques a standardized DNA library for 317 isolates was assembled that included 60 described species as well as 22 taxonomically unclassified isolates. These were sent blind...

  18. Parasite histories and novel phylogenetic tools: alternative approaches to inferring parasite evolution from molecular markers

    Czech Academy of Sciences Publication Activity Database

    Hypša, Václav


    Roč. 36, č. 2 (2006), s. 141-155 ISSN 0020-7519 R&D Projects: GA ČR GA206/04/0520 Institutional research plan: CEZ:AV0Z60220518 Keywords : molecular phylogeny * parasite evolution Subject RIV: EE - Microbiology, Virology Impact factor: 3.337, year: 2006

  19. Molecular markers in breast cancer: new tools in imaging and prognosis

    NARCIS (Netherlands)

    Vermeulen, J.F.


    Breast cancer is the most frequently diagnosed cancer in women. Although breast cancer is mainly diagnosed by mammography, other imaging modalities (e.g. MRI, PET) are increasingly used. The most recent developments in the field of molecular imaging comprise the application of near-infrared

  20. Caracterização molecular de cultivares de pessegueiro e nectarineira com microssatélites Molecular characterization of peach and nectarine cultivars though microsatellites markers

    Directory of Open Access Journals (Sweden)

    Valmor João Bianchi


    Full Text Available Na certificação de mudas de plantas frutíferas, a identificação genética é importante em todas as etapas do processo de produção. Em pessegueiro, a identificação de genótipos baseada somente em características morfofenológicas deixa dúvidas quanto à verdadeira identidade de algumas cultivares. Marcadores moleculares de microssatélies foram utilizados objetivando a caracterização molecular de 8 cultivares de nectarineira e 28 de pessegueiro. Para a análise, foram utilizados 13 incializadores de microssatélites (primers, sendo que todos foram marcadores produzindo polimorfismo suficiente para identificar 32 das 36 cultivares analisadas. A maior similaridade genética verificada nas cultivares para consumo in natura foi entre Coral e Planalto (0,94 e entre Della Nona e Marfim (0,90, enquanto, para os pessegueiros para indústria, foi de 0,93 entre Jubileu e Capdeboscq e de 0,92 entre Jade e Esmeralda. Os marcadores de microssatélites permitiram separar em grupos distintos as nectarineiras e os pessegueiros de consumo in natura dos de indústria, havendo uma elevada concordância entre os dados genealógicos das cultivares e os dados gerados pelos microssatélites, confirmando a grande utilidade da técnica para a caracterização genética.Genetic identification of fruit tree plants is important in all phases of the production process. On peach the genotypes identification based only on the morphologic and phenologic characteristics leaves doubts on the true identity of some cultivars. Microsatellite markers were used aiming at the molecular characterization of eight nectarine and 28 peach cultivars. Thirteen microsatellite primers were used and all of them generated enough polimorfism that may identify 32 out of 36 of the analysed cultivars. The greatest genetic similarity was found between the fresh market 'Coral' and 'Planalto'(0,94 and between the 'Della Nona' and 'Marfim' cultivars (0,90, whereas for caning peaches the

  1. Mammographic scar for stereotaxic biopsy

    International Nuclear Information System (INIS)

    Guzman Tattis; Hincapie U, Ana Lucia; Patino P, Jairo Hernando


    It is reported the case of 56 years old woman who underwent a stereotactic biopsy because of having a circumscribed breast nodule. The histologic diagnosis was benign. After six months, during the mammographic control, it was noticed that the nodule showed irregular contours, because of that a surgical biopsy was performed. The histopathology was reported as benign. it is considered then, that the mammographic changes observed in the mammographic control are due to scar phenomenon after stereotactic biopsy. This findings has not been reported previously

  2. Novel Molecular Markers of Malignancy in Histologically Normal and Benign Breast

    Directory of Open Access Journals (Sweden)

    Aejaz Nasir


    Full Text Available To detect the molecular changes of malignancy in histologically normal breast (HNB tissues, we recently developed a novel 117-gene-malignancy-signature. Here we report validation of our leading malignancy-risk-genes, topoisomerase-2-alpha (TOP2A, minichromosome-maintenance-protein-2 (MCM2 and “budding-uninhibited-by-benzimidazoles-1-homolog-beta” (BUB1B at the protein level. Using our 117-gene malignancy-signature, we classified 18 fresh-frozen HNB tissues from 18 adult female breast cancer patients into HNB-tissues with low-grade (HNB-LGMA; =9 and high-grade molecular abnormality (HNB-HGMA; =9. Archival sections of additional HNB tissues from these patients, and invasive ductal carcinoma (IDC tissues from six other patients were immunostained for these biomarkers. TOP2A/MCM2 expression was assessed as staining index (% and BUB1B expression as H-scores (0–300. Increasing TOP2A, MCM2, and BUB1B protein expression from HNB-LGMA to HNB-HGMA tissues to IDCs validated our microarray-based molecular classification of HNB tissues by immunohistochemistry. We also demonstrated an increasing expression of TOP2A protein on an independent test set of HNB/benign/reductionmammoplasties, atypical-ductal-hyperplasia with and without synchronous breast cancer, DCIS and IDC tissues using a custom tissue microarray (TMA. In conclusion, TOP2A, MCM2, and BUB1B proteins are potential molecular biomarkers of malignancy in histologically normal and benign breast tissues. Larger-scale clinical validation studies are needed to further evaluate the clinical utility of these molecular biomarkers.

  3. Identification of Paramecium bursaria syngens through molecular markers--comparative analysis of three loci in the nuclear and mitochondrial DNA. (United States)

    Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian


    This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  4. Cutaneous osteosarcoma arising from a burn scar

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Min A.; Yi, Jaehyuck [Kyungpook National University, Department of Radiology, College of Medicine, Daegu (Korea, Republic of); Kyungpook National University Hospital, Department of Radiology, Daegu (Korea, Republic of); Chae, Jong Min [Kyungpook National University, Department of Pathology, College of Medicine, Daegu (Korea, Republic of)


    Tumors that develop in old burn scars are usually squamous cell carcinomas. Sarcomas have also been reported, albeit rarely. To our knowledge, there has been only one case report of an extraskeletal osteosarcoma arising in a prior burn scar reported in the English-language literature, mainly discussing the clinicopathological features. Herein, we present a case of cutaneous osteosarcoma visualized as a mineralized soft-tissue mass arising from the scar associated with a previous skin burn over the back. This seems to be the first report describing the imaging features of a cutaneous osteosarcoma from an old burn scar. (orig.)

  5. Caracterização de genótipos de mirtilo utilizando marcadores moleculares Characterization of blueberry genotypes using molecular markers

    Directory of Open Access Journals (Sweden)

    Sergio Delmar dos Anjos e Silva


    Full Text Available O cultivo do mirtilo está em expansão no Brasil, em especial em regiões de clima temperado, onde há grande demanda em relação a cultivares adaptadas às condições edafoclimáticas regionais. O objetivo deste trabalho foi caracterizar genótipos de mirtilo do programa de melhoramento da Embrapa Clima Temperado, utilizando marcadores moleculares do tipo RAPD e SSR. Foram caracterizados 40 genótipos de mirtilo por RAPD e oito cultivares por microssatélites. Os nove primers utilizados na técnica de RAPD geraram 89 marcadores. A similaridade genética entre os genótipos variou de 64 a 89%. Utilizando a similaridade média (66%, foram obtidos quatro grupos. Foram gerados 11 marcadores a partir de três pares de primers de microssatélites. A similaridade genética entre as cultivares variou de 25 a 75%. Com similaridade média (42,4%, foram obtidos três grupos. Com apenas três pares de primers de SSR, foi possível definir o padrão das oito cultivares de mirtilo, revelando a eficiência da técnica de microssatélite na caracterização de genótipos dessa espécie. Esses resultados revelam a eficiência dos marcadores tipo RAPD e SSR na caracterização de genótipos de mirtilo. Entretanto, os marcadores tipo microssatélites geram resultados mais precisos, sendo os mais recomendados para uso em programas de melhoramento e identificação de cultivares.The blueberry crop planting area is increasing in Brazil, especially in Temperate Climate Zones, generating demands relating to suitable cultivars adapted to regional climate and soil conditions. This work aimed to characterize blueberry genotypes from Embrapa Clima Temperado breeding program, using RAPD and SSR molecular markers. There were characterized 40 blueberry genotypes using RAPD and 8 cultivars using SSR molecular markers. The 9 RAPD primers generated 89 markers. The genetic similarity ranged from 64 to 89%. Through the average similarity (66%, it was possible to identify four

  6. Molecular characterization and differentiation of five horse breeds raised in Algeria using polymorphic microsatellite markers. (United States)

    Berber, N; Gaouar, S; Leroy, G; Kdidi, S; Tabet Aouel, N; Saïdi Mehtar, N


    In this study, genetic analyses of diversity and differentiation were performed on five horse breeds raised in Algeria (Barb, Arab-Barb, Arabian, Thoroughbred and French Trotter). All microsatellite markers were highly polymorphic in all the breeds. A total of 123 alleles from 14 microsatellite loci were detected in 201 horses. The average number of alleles per locus was the highest in the Arab-Barb horses (7.86) and lowest in the thoroughbred breed (5.71), whereas the observed and expected heterozygosities per breed ranged from 0.71 (Thoroughbred) to 0.752 (Barb) and 0.71 (Thoroughbred) to 0.77 (Arab-Barb), respectively. The genetic differentiation between the breeds was significant (p horse populations and the other breeds. The Barb and Arab-Barb breeds seem to be the most genetically related and support the decision to consider the breeds as same population. © 2014 Blackwell Verlag GmbH.

  7. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers. (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M


    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  8. Molecular Markers for Genetic Diversity Studies of European Hare (Lepus europaeus Pallas, 1778 Populations

    Directory of Open Access Journals (Sweden)

    Noémi Soós


    Full Text Available The purpose of this article is to give an overview of different molecular techniques which have been used in studies concerning population genetic issues of Lepus species and specifically of L. europaeus. The importance of these researches is ever-growing as the European populations of the brown hare have suffered several falloffs as a consequent upon both natural and anthropogenic effects. With developing tools and techniques molecular genetics have become the centrepiece of population genetics and conservation biology. Nucleic acid methods based on both bi- and uniparentally inherited DNA (allozymes, microsatellites, Y chromosome, mtDNA are often used to study genetic structure, diversity and phylogeography of different species’ populations due to their effectiveness in identifying genetic variability

  9. Using msa-2b as a molecular marker for genotyping Mexican isolates of Babesia bovis. (United States)

    Genis, Alma D; Perez, Jocelin; Mosqueda, Juan J; Alvarez, Antonio; Camacho, Minerva; Muñoz, Maria de Lourdes; Rojas, Carmen; Figueroa, Julio V


    Variable merozoite surface antigens of Babesia bovis are exposed glycoproteins having a role in erythrocyte invasion. Members of this gene family include msa-1 and msa-2 (msa-2c, msa-2a(1), msa-2a(2) and msa-2b). To determine the sequence variation among B. bovis Mexican isolates using msa-2b as a genetic marker, PCR amplicons corresponding to msa-2b were cloned and plasmids carrying the corresponding inserts were purified and sequenced. Comparative analysis of nucleotide and deduced amino acid sequences revealed distinct degrees of variability and identity among the coding gene sequences obtained from 16 geographically different Mexican B. bovis isolates and a reference strain. Clustal-W multiple alignments of the MSA-2b deduced amino acid sequences performed with the 17 B. bovis Mexican isolates, revealed the identification of three genotypes with a distinct set each of amino acid residues present at the variable region: Genotype I represented by the MO7 strain (in vitro culture-derived from the Mexico isolate) as well as RAD, Chiapas-1, Tabasco and Veracruz-3 isolates; Genotype II, represented by the Jalisco, Mexico and Veracruz-2 isolates; and Genotype III comprising the sequences from most of the isolates studied, Tamaulipas-1, Chiapas-2, Guerrero-1, Nayarit, Quintana Roo, Nuevo Leon, Tamaulipas-2, Yucatan and Guerrero-2. Moreover, these three genotypes could be discriminated against each other by using a PCR-RFLP approach. The results suggest that occurrence of indels within the variable region of msa-2b sequences can be useful markers for identifying a particular genotype present in field populations of B. bovis isolated from infected cattle in Mexico.

  10. Snord 3A: A Molecular Marker and Modulator of Prion Disease Progression (United States)

    Cohen, Eran; Avrahami, Dana; Frid, Kati; Canello, Tamar; Levy Lahad, Ephrat; Zeligson, Sharon; Perlberg, Shira; Chapman, Joab; Cohen, Oren S.; Kahana, Esther; Lavon, Iris; Gabizon, Ruth


    Since preventive treatments for prion disease require early identification of subjects at risk, we searched for surrogate peripheral markers characterizing the asymptomatic phases of such conditions. To this effect, we subjected blood mRNA from E200K PrP CJD patients and corresponding family members to global arrays and found that the expression of Snord3A, a non-coding RNA transcript, was elevated several times in CJD patients as compared to controls, while asymptomatic carriers presented intermediate Snord3A levels. In the brains of TgMHu2ME199K mice, a mouse model mimicking for E200K CJD, Snord 3A levels were elevated in an age and disease severity dependent manner, as was the case for brains of these mice in which disease was exacerbated by copper administration. Snord3A expression was also elevated in scrapie infected mice, but not in PrP0/0 mice, indicating that while the expression levels of this transcript may reflect diverse prion etiologies, they are not related to the loss of PrPC’s function. Elevation of Snord3A was consistent with the activation of ATF6, representing one of the arms of the unfolded protein response system. Indeed, SnoRNAs were associated with reduced resistance to oxidative stress, and with ER stress in general, factors playing a significant role in this and other neurodegenerative conditions. We hypothesize that in addition to its function as a disease marker, Snord3A may play an important role in the mechanism of prion disease manifestation and progression. PMID:23349890

  11. Snord 3A: a molecular marker and modulator of prion disease progression.

    Directory of Open Access Journals (Sweden)

    Eran Cohen

    Full Text Available Since preventive treatments for prion disease require early identification of subjects at risk, we searched for surrogate peripheral markers characterizing the asymptomatic phases of such conditions. To this effect, we subjected blood mRNA from E200K PrP CJD patients and corresponding family members to global arrays and found that the expression of Snord3A, a non-coding RNA transcript, was elevated several times in CJD patients as compared to controls, while asymptomatic carriers presented intermediate Snord3A levels. In the brains of TgMHu2ME199K mice, a mouse model mimicking for E200K CJD, Snord 3A levels were elevated in an age and disease severity dependent manner, as was the case for brains of these mice in which disease was exacerbated by copper administration. Snord3A expression was also elevated in scrapie infected mice, but not in PrP(0/0 mice, indicating that while the expression levels of this transcript may reflect diverse prion etiologies, they are not related to the loss of PrP(C's function. Elevation of Snord3A was consistent with the activation of ATF6, representing one of the arms of the unfolded protein response system. Indeed, SnoRNAs were associated with reduced resistance to oxidative stress, and with ER stress in general, factors playing a significant role in this and other neurodegenerative conditions. We hypothesize that in addition to its function as a disease marker, Snord3A may play an important role in the mechanism of prion disease manifestation and progression.

  12. Molecular Characterizations of Kenyan Brachiaria Grass Ecotypes with Microsatellite (SSR Markers

    Directory of Open Access Journals (Sweden)

    Naftali Ondabu


    Full Text Available Brachiaria grass is an emerging forage option for livestock production in Kenya. Kenya lies within the center of diversity for Brachiaria species, thus a high genetic variation in natural populations of Brachiaria is expected. Overgrazing and clearing of natural vegetation for crop production and nonagricultural uses and climate change continue to threaten the natural biodiversity. In this study, we collected 79 Brachiaria ecotypes from different parts of Kenya and examined them for genetic variations and their relatedness with 8 commercial varieties. A total of 120 different alleles were detected by 22 markers in the 79 ecotypes. Markers were highly informative in differentiating ecotypes with average diversity and polymorphic information content of 0.623 and 0.583, respectively. Five subpopulations: International Livestock Research Institute (ILRI, Kitui, Kisii, Alupe, and Kiminini differed in sample size, number of alleles, number of private alleles, diversity index, and percentage polymorphic loci. The contribution of within‐the‐individual difference to total genetic variation of Kenyan ecotype population was 81%, and the fixation index (FST = 0.021 and number of migrant per generation (Nm = 11.58 showed low genetic differentiation among the populations. The genetic distance was highest between Alupe and Kisii populations (0.510 and the lowest between ILRI and Kiminini populations (0.307. The unweighted neighborjoining (NJ tree showed test ecotypes grouped into three major clusters: ILRI ecotypes were present in all clusters; Kisii and Alupe ecotypes and improved varieties grouped in clusters I and II; and ecotypes from Kitui and Kiminini grouped in cluster I. This study confirms higher genetic diversity in Kenyan ecotypes than eight commercial varieties (Basilisk, Humidicola, Llanero, Marandú, MG4, Mulato II, Piatá and Xaraés that represent three species and one three‐way cross‐hybrid Mulato II. There is a need for further

  13. Molecular Genetic Diversity of Date (Phoenix dactylifera) Germplasm in Qatar based on Microsatellite Markers

    KAUST Repository

    Ahmed, Talaat


    Depending on morphological traits alone, studying the genetic diversity of date palm is a very difficult task since morphological characteristics are highly affected by the environment. DNA markers are excellent option that can help and enhance the discriminatory power of morphological characteristics. To study the genetic diversity among date palm cultivars grown in Qatar, fifteen Date palm samples were collected from Qatar University Experimental Farm. DNAs were extracted from fresh leaves by using commercial DNeasy Plant System Kit (Qiagen, Inc., Valencia, CA). Total of 18 (Inter Simple Sequence Repeat) ISSR single primers were used to amplify DNA fragments using genomic DNA of the 15 samples. First screening was done to test the ability of these primers to amplify clear bands using Date palm genomic DNA. All 18 ISSR primers successfully produced clear bands in the first screening. Then, each primer was used separately to genotype the whole set of 15 Date palm samples. Total of 4794 bands were generated using 18 ISSR primers for the 15 Date palm samples. On average, each primer generated 400 bands. The Number of amplified bands varied from cultivar to cultivar. The highest number of bands was obtained using Primers 2, 5 and 12 for the 15 (470 bands), while the lowest number of bands were obtained by Primers 1, 7 and 8 where they produced only 329 bands. Markers were scored for the presence and absence of the corresponding band among the different cultivars. Data were subjected to cluster analysis. A similarity matrix was constructed and the similarity values were used for cluster analysis.

  14. Targeted next generation sequencing for the detection of ciprofloxacin resistance markers using molecular inversion probes (United States)


    ecological studies have shown development of antibiotic resistance in bacterial pathogens caused by increased antibiotic usage in animals , food, al. Danish Integrated Antimicrobial Resistance Monitoring and Research Program. Emerging Infectious Diseases 13, 1633-1639, doi:10.3201...F. J. Molecular detection of antimicrobial resistance . Clin. Microbiol. Rev. 14, 836-871, table of contents, doi:10.1128/CMR.14.4.836-871.2001

  15. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers


    Taïbi, Khaled; Campo, Antonio D. del; Vilagrosa Carmona, Alberto; Bellés, José M.; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J.; López-Nicolás, José M.; Mulet, José M.


    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of pre...

  16. Molecular identification of three crested newt species (Triturus cristatus superspecies) by RAPD markers

    Czech Academy of Sciences Publication Activity Database

    Mikulíček, P.; Piálek, Jaroslav


    Roč. 24, č. 2 (2003), s. 201-207 ISSN 0173-5373 R&D Projects: GA ČR GA206/98/0115; GA ČR GA206/01/0695; GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6093917; CEZ:MSM 113100004 Keywords : Triturus cristatus * genetic variation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.417, year: 2003

  17. Cerebrospinal fluid markers in the differentiation of molecular subtypes of sporadic Creutzfeldt-Jakob disease. (United States)

    Gmitterová, K; Heinemann, U; Krasnianski, A; Gawinecka, J; Zerr, I


    Cerebrospinal fluid (CSF) analysis supports the clinical diagnosis of sporadic Creutzfeldt-Jakob disease (sCJD) when applied within an adequate clinical context. A diagnostic potential has been attributed to CSF proteins such as 14-3-3, but also tau protein, phosphorylated tau (181P) (p-tau) protein, amyloid β1-42 , S100B and neuron-specific enolase (NSE). There has been only limited information available about the contribution of CSF analysis in the differentiation of various molecular sCJD subtypes. The CSF levels of the aforementioned proteins from 73 sCJD patients with distinct molecular subtypes were determined. Differences in tau values were significant amongst the homozygous patients (MM and VV genotype) compared to the heterozygous group (P = 0.07 and P = 0.02 respectively). Significantly higher CSF tau levels (P = 0.003) and NSE (P = 0.02) but lower p-tau/tau ratio (P = 0.01) were observed in MM1 compared to MM2 patients. The p-tau/tau ratio enabled the differentiation of MV genotype with higher levels in PrP(sc) type 2 (P = 0.04). Elevation of S100B (P disease duration and clinical stage influenced the test sensitivity in all proteins. Cerebrospinal fluid protein levels might be useful in the pre-mortem differentiation of molecular sCJD subtypes when the codon 129 genotype is known. © 2016 EAN.

  18. Genetic variation assessment of acid lime accessions collected from south of Iran using SSR and ISSR molecular markers. (United States)

    Sharafi, Ata Allah; Abkenar, Asad Asadi; Sharafi, Ali; Masaeli, Mohammad


    Iran has a long history of acid lime cultivation and propagation. In this study, genetic variation in 28 acid lime accessions from five regions of south of Iran, and their relatedness with other 19 citrus cultivars were analyzed using Simple Sequence Repeat (SSR) and Inter-Simple Sequence Repeat (ISSR) molecular markers. Nine primers for SSR and nine ISSR primers were used for allele scoring. In total, 49 SSR and 131 ISSR polymorphic alleles were detected. Cluster analysis of SSR and ISSR data showed that most of the acid lime accessions (19 genotypes) have hybrid origin and genetically distance with nucellar of Mexican lime (9 genotypes). As nucellar of Mexican lime are susceptible to phytoplasma, these acid lime genotypes can be used to evaluate their tolerance against biotic constricts like lime "witches' broom disease".


    Directory of Open Access Journals (Sweden)

    Maki Cristina Sayuri


    Full Text Available The growth of thirty-four Lentinula edodes strains submitted to different mycelial cultivation conditions (pH and temperature was evaluated and strain variability was assessed by RAPD molecular markers. The growth at three pH values (5, 6 and 7 and four different temperatures (16, 25, 28 and 37ºC was measured using the in vitro mycelial development rate and water retention as parameters. Mycelial cultivation was successful at all pH tested, while the ideal temperature for mycelial cultivation ranged between 25 and 28ºC. The water content was lower in strains grown at 37ºC. Among 20 OPA primers (Operon Technologies, Inc. used for the RAPD analyses, seventeen presented good polymorphism (OPA01 to OPA05, OPA07 to OPA14, OPA17 to OPA20. The clustering based on similarity coefficients allowed the separation of strain in two groups with different geographic origins.

  20. Outcome after burns: An observational study on burn scar maturation and predictors for severe scarring

    NARCIS (Netherlands)

    van der Wal, M.B.A.; Vloemans, J.F.P.M.; Tuinebreijer, W.E.; van de Ven, P.M.; van Unen, E.; van Zuijlen, P.P.M.; Middelkoop, E.


    Long-term outcome of burn scars as well as the relation with clinically relevant parameters has not been studied quantitatively. Therefore, we conducted a detailed analysis on the clinical changes of burn scars in a longitudinal setup. In addition, we focused on the differences in scar quality in

  1. Molecular characterization and genetic structure of the local criollo pig breeds (Sus scrofa domestica from Ecuador, using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Julio César Vargas Burgos


    Full Text Available The molecular markers have shown their great utility in the characterization of the domestic animals, hence, the objective of this work was to characterize, genetically, the Creole pig of Ecuador by means of microsatellites. Samples of hair of 15 animals were gathered. A panel of 25 microsatellites, the amplification of the same was carried out by means of the reaction in chain of the polymerase and the amplified fragments, separated by electrophoresis in gels of polyacrylamide. In addition, were calculated the half number of alleles by locus (MNA, the allelic frequencies, the expected (He and the observed (Ho heterozygosity , the content of polymorphic information (PIC, as well as the balance Hardy-Weinberg (EHW and the FIS for marker. The half number of alleles found by locus has been of 6.2 and the percentage of individual heterozygote behaved above of 60%. Of the entirety of the studied loci the 68% showed a high PIC. These results show that the Ecuadorian Creole pig possesses a high genetic diversity, essential information to optimize the national strategies of conservation and it improvement of this genotype in Ecuador.

  2. Alteration in molecular markers of oocyte development and intersex condition in mullets impacted by wastewater treatment plant effluents. (United States)

    Valencia, Ainara; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Cancio, Ibon; Ortiz-Zarragoitia, Maren


    Wastewater Treatment Plant (WWTP) discharges are an important source of endocrine disrupting chemicals (EDCs) into the aquatic environment. Fish populations inhabiting downstream of WWTP effluents show alterations in gonad and gamete development such as intersex condition, together with xenoestrogenic effects such as vitellogenin up-regulation. However, the molecular mechanisms participating in the development of intersex condition in fish are not elucidated. The aim of this study was to assess the impact of two WWTPs effluents (Gernika and Bilbao-Galindo situated in the South East Bay of Biscay) with different contaminant loads, in thicklip grey mullet (Chelon labrosus) populations inhabiting downstream, examining the presence and severity of intersex condition, during two seasons. Molecular markers of xenoestrogenicity and oocyte differentiation and development (vtgAa, cyp19a1a, cyp19a1b, cyp11b, foxl2, dmrt1 and gtf3a) were also studied. Intersex mullets were identified downstream of both WWTPs and vtgAa was upregulated in intersex and non intersex males. Sex dependent differential transcription levels of target genes were detected in mullets from Galindo. However, no such pattern was observed in mullets from Gernika, suggesting an attenuating effect over studied genes caused by a higher presence of EDCs in this site, as indicated by the elevated prevalence of intersex mullets in this population. In conclusion, no direct association between xenoestrogenic responses and intersex condition was established. Mullets from Gernika showed signs of severe EDC exposure compared to those from Galindo, as demonstrated by the higher prevalence of intersex males and the reduction in transcription profile differences between sexes of gametogenic gene markers. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Classification of genetic variation for cadmium tolerance in Bermudagrass [Cynodon dactylon (L.) Pers.] using physiological traits and molecular markers. (United States)

    Xie, Yan; Luo, Hongji; Hu, Longxing; Sun, Xiaoyan; Lou, Yanhong; Fu, Jinmin


    Cadmium (Cd) is one of the most toxic pollutants that caused severe threats to animal and human health. Bermudagrass is a dominant species in Cd contaminated soils, which can prevent Cd flow and spread. The objectives of this study were to determine the genetic variations in major physiological traits related to Cd tolerance in six populations of Bermudagrass collected from China, and to examine the genetic diversity and relationships among these accessions that vary in Cd tolerance using molecular markers. Plants of 120 accessions (116 natural accessions and 4 commercial cultivars) were exposed to 0 (i.e. control) or 1.5 mM CdSO4·8/3H2O for 3 weeks in hydroponic culture. Turf quality, transpiration rate, chlorophyll content, leaf water content and growth rate showed wide phenotypic variation. The membership function method was used to comprehensively evaluate Cd-tolerance. According to the average subordinate function value, four accessions were classified as the most tolerant genotypes and four accessions as Cd-sensitive genotypes. The trend of Cd tolerance among the six studied populations was as follows: Hunan > South China > North China > Central China > West South China and Xinjiang population. Phylogenetic analysis revealed that the majority of accessions from the same or adjacent regions were clustered into the same groups or subgroups, and the accessions with similar cadmium tolerance displayed a close phylogenetic relationship. Screening genetically diverse germplasm by combining the physiological traits and molecular markers could prove useful in developing Cd-tolerant Bermudagrass for the remediation of mill tailings and heavy metal polluted soils.

  4. What are the currently available and in development molecular markers for bladder cancer? Will they prove to be useful in the future? (United States)

    Abdulmajed, Mohamed Ismat; Sancak, Eyüp Burak; Reşorlu, Berkan; Al-Chalaby, Gydhia Zuhair


    Urothelial carcinoma is the 9(th) most common cancer worldwide. Most urothelial tumors are non-muscle invasive on presentation. However, two-thirds of non-invasive bladder cancers will eventually recur with a 25% risk of progression to muscle-invasive bladder cancer. Tumor stage, histological grade and pathological invasion of blood vessels and lymphatic tissue are the main indicators for urothelial cancer prognosis. The gold standard for diagnosing bladder cancer is conventional white-light cystoscopy and biopsy. Urine cytology is a highly specific, sensitive test for high-grade tumors or carcinoma in situ (CIS). Urinary NMP22 has an overall sensitivity and specificity for detecting bladder cancer of 49% and 87%, respectively. However, there are false-positive results in the presence of urinary tract infection or hematuria. The detection of specific gene mutations related to urothelial cancers has been studied and employed to reproduce markers helpful for diagnosis. According to current studies, molecular markers can be used to predict tumor recurrence. From a prognostic point of view, new molecular markers have yet to be established as reliable indicators of tumor aggressiveness. We aimed to review the molecular markers with possible prognostic significance that have been discussed in the literature. This review examined the literature for various molecular markers under development for bladder cancer in an attempt to optimize patient care and reduce the costs of treating these patients.

  5. Investigation of molecular markers related to fecundity in local egyptian sheep

    International Nuclear Information System (INIS)

    Hassanin, W.F.E.


    The present experimental work aimed to investigate a number of molecular makers that influence fecundity in local Egyptian sheep. In the present study, twenty two (11 twin producing crossbred ewes, 7 single lamb producing crossbred ewes, 2 crossbred rams from twin producing ewes and 2 pure bred rams from twin producing ewes) were tested. They were carefully selected from the records of the Egyptian Nuclear Research Centre. The ewes were selected for their twin production in three repetitive production cycles while the rams were selected for being produced from prolific ewes as above. The presence of the booroola fecundity gene (FecB) (FecB mutation in bone morphogenic protein receptor gene 1B (BMPR1B)) and the Inverdale gene (FecX I ) (FecX I mutation in bone morphogenic receptor gene (BMP15)) using Forced restriction PCR of the FecB and FecX I mutations, 190 base pair (bp) was amplified using specific primer which was forward (5 ' -CCAGAGGACAATAGCAAAGCAAA -3 ' ) and reverse (5 ' -CAAGATGTTTTCATGCCTCATCAACAGGTC -3 ' ) and designed to introduce a point mutation in the resulting PCR products with FecB carrier sheep containing an AvaII restriction site (G|GACC). The FecB DNA test showed that there were no carriers for the FecB mutation in the selected prolific sheep sample. When a specific primer which was forward (5 ' -GAAGTAACCAGTGTTCCCTCCACCCTTTTCT-3 ' ) and reverse (5 ' -CATGATTGGGAGAATTGAGACC-3 ' ) used to test the presence of FecX I mutation no amplification resulted from DNA samples of the twin producing ewes while two amplified DNA fragments of molecular size 154 bp and 120 bp resulted from the single lamb producing females and male sheep under study. Serum samples were collected from sheep under study and tested using totallab 120 computer software analyses for Native protein gel images. Gel images revealed a protein pattern in twin producing ewe samples characterized by the presence of three bands with molecular weights 679.7, 524.3, and 431.1 kd and the

  6. Estimating animal abundance in ground beef batches assayed with molecular markers.

    Directory of Open Access Journals (Sweden)

    Xin-Sheng Hu

    Full Text Available Estimating animal abundance in industrial scale batches of ground meat is important for mapping meat products through the manufacturing process and for effectively tracing the finished product during a food safety recall. The processing of ground beef involves a potentially large number of animals from diverse sources in a single product batch, which produces a high heterogeneity in capture probability. In order to estimate animal abundance through DNA profiling of ground beef constituents, two parameter-based statistical models were developed for incidence data. Simulations were applied to evaluate the maximum likelihood estimate (MLE of a joint likelihood function from multiple surveys, showing superiority in the presence of high capture heterogeneity with small sample sizes, or comparable estimation in the presence of low capture heterogeneity with a large sample size when compared to other existing models. Our model employs the full information on the pattern of the capture-recapture frequencies from multiple samples. We applied the proposed models to estimate animal abundance in six manufacturing beef batches, genotyped using 30 single nucleotide polymorphism (SNP markers, from a large scale beef grinding facility. Results show that between 411∼1367 animals were present in six manufacturing beef batches. These estimates are informative as a reference for improving recall processes and tracing finished meat products back to source.

  7. Molecular markers reveal infestation dynamics of the bed bug (Hemiptera: Cimicidae) within apartment buildings. (United States)

    Booth, Warren; Saenz, Virna L; Santangelo, Richard G; Wang, Changlu; Schal, Coby; Vargo, Edward L


    The bed bug, Cimex lectularius L. (Hemiptera: Cimicidae), has experienced an extraordinary global resurgence in recent years, the reasons for which remain poorly understood. Once considered a pest of lower socioeconomic classes, bed bugs are now found extensively across all residential settings, with widespread infestations established in multiapartment buildings. Within such buildings, understanding the population genetic structure and patterns of dispersal may prove critical to the development of effective control strategies. Here, we describe the development of 24 high-resolution microsatellite markers through next generation 454 pyrosequencing and their application to elucidate infestation dynamics within three multistory apartment buildings in the United States. Results reveal contrasting characteristics potentially representative of geographic or locale differences. In Raleigh, NC, an infestation within an apartment building seemed to have started from a single introduction followed by extensive spread. In Jersey City, NJ, two or more introductions followed by spread are evident in two buildings. Populations within single apartments in all buildings were characterized by high levels of relatedness and low levels of diversity, indicative of foundation from small, genetically depauperate propagules. Regardless of the number of unique introductions, genetic data indicate that spread within buildings is extensive, supporting both active and human-mediated dispersal within and between adjacent rooms or apartments spanning multiple floors.

  8. Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers. (United States)

    Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej


    Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

  9. Molecular Characterization of Selected Local and Exotic Cattle Using RAPD Marker

    Directory of Open Access Journals (Sweden)

    M. Mahfuza Khatun


    Full Text Available In order to develop specific genetic markers and determine the genetic diversity of Bangladeshi native cattle (Pabna, Red Chittagong and exotic breeds (Sahiwal, randomly amplified polymorphic DNA (RAPD analysis was performed using 12 primers. Genomic DNA was extracted from 20 cattle (local and exotic blood samples and extracted DNA was observed by gel electrophoresis. Among the random primers three were matched and found to be polymorphic. Genetic relations between cattle’s were determined by RAPD polymorphisms from a total of 66.67%. Statistical analysis of the data, estimating the genetic distances between cattle and sketching the cluster trees were estimated by using MEGA 5.05 software. Comparatively highest genetic distance (0.834 was found between RCC-82 and SL-623. The lowest genetic distance (0.031 was observed between M-1222 and M-5730. The genetic diversity of Red Chittagong and Sahiwal cattle was relatively higher for a prescribed breed. Adequate diversity in performance and adaptability can be exploited from the study results for actual improvement accruing to conservation and development of indigenous cattle resources.

  10. Retrotransposon-Based Molecular Markers for Analysis of Genetic Diversity within the Genus Linum (United States)

    Melnikova, Nataliya V.; Kudryavtseva, Anna V.; Zelenin, Alexander V.; Lakunina, Valentina A.; Yurkevich, Olga Yu.; Speranskaya, Anna S.; Dmitriev, Alexey A.; Krinitsina, Anastasia A.; Belenikin, Maxim S.; Uroshlev, Leonid A.; Snezhkina, Anastasiya V.; Sadritdinova, Asiya F.; Koroban, Nadezda V.; Amosova, Alexandra V.; Samatadze, Tatiana E.; Guzenko, Elena V.; Lemesh, Valentina A.; Savilova, Anastasya M.; Rachinskaia, Olga A.; Kishlyan, Natalya V.; Rozhmina, Tatiana A.; Bolsheva, Nadezhda L.; Muravenko, Olga V.


    SSAP method was used to study the genetic diversity of 22 Linum species from sections Linum, Adenolinum, Dasylinum, Stellerolinum, and 46 flax cultivars. All the studied flax varieties were distinguished using SSAP for retrotransposons FL9 and FL11. Thus, the validity of SSAP method was demonstrated for flax marking, identification of accessions in genebank collections, and control during propagation of flax varieties. Polymorphism of Fl1a, Fl1b, and Cassandra insertions were very low in flax varieties, but these retrotransposons were successfully used for the investigation of Linum species. Species clusterization based on SSAP markers was in concordance with their taxonomic division into sections Dasylinum, Stellerolinum, Adenolinum, and Linum. All species of sect. Adenolinum clustered apart from species of sect. Linum. The data confirmed the accuracy of the separation in these sections. Members of section Linum are not as closely related as members of other sections, so taxonomic revision of this section is desirable. L. usitatissimum accessions genetically distant from modern flax cultivars were revealed in our work. These accessions are of utmost interest for flax breeding and introduction of new useful traits into flax cultivars. The chromosome localization of Cassandra retrotransposon in Linum species was determined. PMID:25243121

  11. Genetic Diversity Analysis of Iranian Jujube Ecotypes (Ziziphus spp. Using RAPD Molecular Marker

    Directory of Open Access Journals (Sweden)

    S Abbasi


    Full Text Available Jujube (Ziziphus jujuba Mill. is a valuable medicinal plant which is important in Iranian traditional medicines. Although the regional plants such as jujube play an important role in our economy, but they are forgotten in research and technology. Considering the economic and medicinal importance of jujube, the first step in breeding programs is determination of the genetic diversity among the individuals. 34 ecotypes of jujube, which have been collected from eight provinces of Iran, were used in this study. The genetic relationships of Iranian jujube ecotypes were analyzed using Random Amplified Polymorphic DNA (RAPD marker. Six out of 15 random decamer primers applied for RAPD analysis, showed an informative polymorphism. According to clustering analysis using UPGMA's methods, the ecotypes were classified into two major groups at the 0.81 level of genetic similarity. The highest value of similarity coefficient (0.92 was detected between Mazandaran and Golestan ecotypes and the most genetic diversity was observed in ecotypes of Khorasan-Jonoubi. The affinity of Khorasan-Jonoubi and Esfahan ecotypes indicated a possible common origin for the variation in these areas. Results indicated that RAPD analysis could be successfully used for the estimation of genetic diversity among Ziziphus ecotypes and it can be useful for further investigations.

  12. Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker (United States)

    Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood


    Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

  13. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.


    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  14. Development of aromatic giant-embryo rice by molecular marker-assisted selection

    Directory of Open Access Journals (Sweden)

    ZHU Yingdong


    Full Text Available Aromatic rice is loved for its distinctive aroma when cooking and eating.In this research,aromatic normal-embryo rice and non-aromatic giant-embryo rice,"Shangshida No.5",both bred by our laboratory,were selected as the parents for the hybridization.We used conventional breeding techniques as well as fragrance gene marker-assisted selection to derive new aromatic giant-embryo rice "Shangshida No.8".By comparing the agronomic and yield characters of "Shangshida No.5" and "Shangshida No.8",the average of filled grains per panicle of "Shangshida No.5" exceeds "Shangshida No.8" very significantly,while the average of effective panicles of "Shangshida No.8" is slightly more than "Shangshida No.5".Also,in the weight of thousand grains "Shangshida No.8" is slightly heavier than "Shangshida No.5".Thus,their grain weights per plant are close,29.10 g and 28.92 g respectively.By comparing the traits of rice embryo,there is no significant difference in embryo weight and volume.Also,there is no significant difference in weight ratio and volume ratio of embryo.This research has laid a solid foundation for further market development and application of aromatic giant-embryo rice.

  15. South American camelid illegal traffic detection by means of molecular markers. (United States)

    Di Rocco, F; Posik, D M; Ripoli, M V; Díaz, S; Maté, M L; Giovambattista, G; Vidal-Rioja, L


    South American camelids comprise the wild species guanaco and vicuña and their respective domestic relatives llama and alpaca. The aim of the present study was to determine by DNA analysis to which of these species belong a herd of camelids confiscated from a llama breeder but alleged to be alpacas by the prosecution, and to evaluate the usefulness of mitochondrial and autosomal DNA markers to solve judicial cases involving camelid taxa. Cytochrome b and cytochrome oxidase I mitochondrial genes and 7 STR were analyzed in 25 confiscated samples. Mitochondrial results were inconclusive because 18 of the sequestered samples presented haplotypes that corresponded to the guanaco haplogroup and the remaining seven belonged to a vicuña linage. Microsatellite data of casework samples and llama reference samples revealed different genetic profiles by the presence of private alleles at two microsatellites suggesting that the confiscated animals could be alpaca, or at least alpaca hybrids instead of pure llama. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. Molecular characterization of Iranian black cumin ( Nigella sativa L. accessions using RAPD marker

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghorbanzadeh Neghab


    Full Text Available Nigella sativa L. (2n = 12 is an annual flowering plant belonging to the family Ranunculaceae known for medicinal properties demonstrating valuable components that are widely used in food and pharmaceutical industries. Nine Random Amplified Polymorphic DNA markers (RAPD were used in this study, in order to characterize the genetic variation of 16 black cumin varieties collected from Iran’s different regions. The amplification reaction produced 95 bands with sizes ranging from about 100 to 500 bp. The average frequency of bands was 20 while the averages of polymorphism were about 8.11 per primer. The Jaccard similarity coefficient and the Unweighted Pair-Group Method Analysis (UPGMA clustering algorithm were applied to the RAPD data sets in order to understand the genetic relationships among the tested accessions. The accessions were categorized into three groups using cluster analysis. The results were supported by the Principal Coordinate Analysis (PCoA cluster analysis. The results showed that the tested black cumin genotypes had a high genetic diversity and could be used in black cumin germplasm conservation programs. Moreover, the RAPD is a versatile approach to the diversity analysis of native accessions of black cumin.

  17. Genetic identification of bucktooth parrotfish Sparisoma radians (Valenciennes, 1840 (Labridae, Scarinae by chromosomal and molecular markers

    Directory of Open Access Journals (Sweden)

    Fabilene Gomes Paim


    Full Text Available Parrotfishes (Labridae, Scarinae comprise a large marine fish group of difficult identification, particularly during juvenile phase when the typical morphology and coloration of adults are absent. Therefore, the goal of this study was to test cytogenetic markers and DNA barcoding in the identification of bucktooth parrtotfish Sparisoma radians from the northeastern coast of Brazil. Sequencing of cytochrome c oxidase subunit I (COI confirmed all studied samples as S. radians, and all showed high similarity (99-100% with Caribbean populations. The karyotype of this species was divergent from most marine Perciformes, being composed of 2n = 46 chromosomes. These consisted of a large number of metacentric and submetacentric pairs with small amounts of heterochromatin and GC-rich single nucleolar organizer regions (NORs not syntenic to 5S rDNA clusters. These are the first data about DNA barcoding in parrotfish from the Brazilian province and the first refined chromosomal analysis in Scarinae, providing useful data to a reliable genetic identification of S. radians.

  18. Molecular polymorphisms of the ABO locus as informative markers of ancestry in Central Argentina. (United States)

    Tavella, María Pía; García, Angelina; Pauro, Maia; Demarchi, Darío A; Nores, Rodrigo


    The aim of this study was to investigate the distribution of molecular polymorphisms of the ABO gene in four population samples from the province of Córdoba, in Central Argentina, and to compare them with other worldwide populations. A total of 110 buccal swab samples from autochthonous individuals of Córdoba were typified. Molecular characterization of the allelic variants was performed by the analysis of exons 6 and 7 of the ABO gene using PCR-RFLP analysis. Additionally, the Native American AIM O1v542 was characterized by direct sequencing. The four Córdoba populations did not show significant geographic structure, although the frequency of the O1v542 haplotype, detected in all the populations studied, ranged from 0.019 to 0.222. The principal component analysis based on O allele distribution showed that the populations from Córdoba clustered close to the admixed populations of Santiago and Mexico City, and at intermediate distances between European and Native American populations, while being distant from the African population. The results demonstrate that the analysis of the ABO system constitutes a useful tool for the study of the genetic structure and evolutionary history of human populations, reflecting accurately the relative contribution of parental continental contribution to the gene pool of admixed populations. © 2017 Wiley Periodicals, Inc.

  19. Immunoglobulin genes and T-cell receptors as molecular markers in children with acute lymphoblastic leukaemia

    Directory of Open Access Journals (Sweden)

    Lazić Jelena


    Full Text Available Introduction. Acute lymphoblastic leukaemia (ALL is a malignant clonal disease, one of the most common malignancies in childhood. Contemporary protocols ensure high remission rate and long term free survival. The ability of molecular genetic methods help to establish submicroscopic classification and minimal residual disease (MRD follow up, in major percent responsible for relapse. Objective. The aim of the study was to detect the frequency of IgH and TCR gene rearrangements and their correlation with clinical parameters. Methods. Forty-one children with ALL were enrolled in the study group, with initial diagnosis of IgH and TCR gene rearrangements by polimerase chain reaction ( PCR. MRD follow-up was performed in induction phase when morphological remission was expected, and after intensive chemiotherapy. Results. In the study group IgH rearrangement was detected in 82.9% of children at the diagnosis, while TCR rearrangement was seen in 56.1%. On induction day 33, clonal IgH rearrangements persisted in 39% and TCR rearrangements in 36.5% of children. Conclusion. Molecular analysis of genetic alterations and their correlation with standard prognostic parameters show the importance of risk stratification revision which leads to new therapy intensification approach. MRD stands out as a precise predictive factor for the relapse of disease.

  20. Molecular identification of Echinococcus granulosus on the Tibetan Plateau using mitochondrial DNA markers. (United States)

    Hu, D; Song, X; Wang, N; Zhong, X; Wang, J; Liu, T; Jiang, Z; Dawa, T; Gu, X; Peng, X; Yang, G


    Cystic echinococcosis (CE) is an important worldwide zoonotic disease that causes lar