The Distribution and Population Density of Bornean Tarsier, “Tarsius Bancanus Borneanus (Elliot)” in Secondary and Rehabilitated Forests of Universiti Putra Malaysia, Bintulu Sarawak Campus, Sarawak, Malaysia

Science.gov (United States)

Sahimi, Hani Nabilia Muhd; Chubo, John Keen; Top @ Mohd. Tah, Marina Mohd.; Saripuddin, Noor Bahiah; Ab Rahim, Siti Sarah

2018-01-01

Tarsius bancanus borneanus was first reported by Elliot in 1990 which an endemic species that can be found on the Island of Borneo consisting of Sabah and Sarawak of Malaysia, Brunei Darussalam and Kalimantan, Indonesia. This sub-species has been listed as a totally protected animal under the Sarawak Wild Life Protection Ordinance (1998) and vulnerable by the International Union for Conservation of Nature (IUCN). The present study was conducted at Universiti Putra Malaysia Bintulu Campus (UPMKB), Sarawak from October 2014 till March 2015. Through mark and recapture sampling covering an area of 37 ha of secondary forest patches and 7.13 ha of rehabilitated forest, a total of 16 tarsiers were captured using mist nets while one tarsier was recapture. The population density was 38 individuals/km2 was captured using mist nets in the secondary forest while 28 individuals/km2 was recorded for the rehabilitated forest. Using the catch per unit effort (net hour) method, the average time for capturing tarsiers in the secondary forest patches was 26.6 net hour per animal and 30.0 net hour per animal in the rehabilitated forest. The presented results provides information on the presence of tarsiers in both the secondary and rehabilitated forests of UPMKB, Sarawak, Malaysia which underlines the conservation value of these forested areas. PMID:29644021

Environmental Management Systems (EMS Adoption in Sarawak (Malaysia: Implementation Motivations

Directory of Open Access Journals (Sweden)

Lee Lee Ho

2017-09-01

Full Text Available Environmental management has been in the process of evolution since Industrial Revolutions of 18th and 19th centuries. And the more recent is the development of international environmental management standards and guidelines to facilitate global trade. These environmental management standards and guidelines are usually known as Environmental Management Systems (EMS. This research investigates the implementation motivations in relation to EMS adoption in Sarawak, Malaysia organizations. Empirical findings of a survey on the above in Sarawak organizations are presented. About 112 survey questionnaires invitations were forwarded to various organizations in Sarawak and a total of 47 responses were received. The results of this research show that among the Sarawak organizations, the top three implementation motivations or benefits from implementing EMS according to their importance by the Sarawak EMS user’s organizations are 1 Legal compliance as the top benefit of EMS implementation; 2 Improvement in operational environmental protection; and 3 Corporate image advantages.

Haplotype diversity of 17 Y-chromosomal STRs in three native Sarawak populations (Iban, Bidayuh and Melanau) in East Malaysia.

Science.gov (United States)

Chang, Yuet Meng; Swaran, Yuvaneswari; Phoon, Yoong Keat; Sothirasan, Kavin; Sim, Hang Thiew; Lim, Kong Boon; Kuehn, Daniel

2009-06-01

17 Y-STRs (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) have been analyzed in 320 male individuals from Sarawak, an eastern state of Malaysia on the Borneo island using the AmpFlSTR Y-filer (Applied Biosystems, Foster City, CA). These individuals were from three indigenous ethnic groups in Sarawak comprising of 103 Ibans, 113 Bidayuhs and 104 Melanaus. The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three groups. Analysis of molecular variance (AMOVA) indicated that 87.6% of the haplotypic variation was found within population and 12.4% between populations (fixation index F(ST)=0.124, p=0.000). This study has revealed that the indigenous populations in Sarawak are distinctly different to each other, and to the three major ethnic groups in Malaysia (Malays, Chinese and Indians), with the Melanaus having a strikingly high degree of shared haplotypes within. There are rare unusual variants and microvariants that were not present in Malaysian Malay, Chinese or Indian groups. In addition, occurrences of DYS385 duplications which were only noticeably present in Chinese group previously was also observed in the Iban group whilst null alleles were detected at several Y-loci (namely DYS19, DYS392, DYS389II and DYS448) in the Iban and Melanau groups.

Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak)

OpenAIRE

Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

2010-01-01

There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presen...

Seroepidemiological study of leptospirosis among the communities living in periurban areas of Sarawak, Malaysia.

Science.gov (United States)

Thayaparan, S; Robertson, I D; Fairuz, A; Suut, L; Gunasekera, U C; Abdullah, M T

2015-10-01

Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Malaysia. the purpose of this particular study was to determine the common leptospiral serovars present in human communities living around wildlife reserves/disturbed forest habitats. the objective of this study was to estimate the seroprevalence of leptospirosis and finding infecting serovars in villages surrounded habitats where wildlife lives in Sarawak, Malaysia. A cross-sectional serological survey of 198 humans was conducted in four villages around Kuching, Sarawak between January 2011 and March 2012. A seroprevalence of 35.9% (95%cI 29.2-43.0) to the MAt was detected in the tested humans. Antibodies to serovar Lepto 175 Sarawak were most commonly detected (31.3%; 95%cI 24.9-38.3) and were detected in individuals at all four locations. the presence of skin wounds (Or 3.1), farm animals (Or 2.5) and rats (Or 11.2) were all significantly associated with seropositivity in a multivariable logistic regression model. the results of the current study are important as wildlife may act as reservoirs of leptospires for humans. Health authorities should expand disease control measures to minimise the spill-over from wildlife to humans visiting, living or working in the sampled locations. the pathogenic status of serovar Lepto 175 Sarawak also requires further investigation.

Bioefficacy of Insect Growth Regulators Against Aedes albopictus (Diptera: Culicidea) From Sarawak, Malaysia: A Statewide Survey.

Science.gov (United States)

Lau, Koon Weng; Chen, Chee Dhang; Lee, Han Lim; Low, Van Lun; Sofian-Azirun, Mohd

2018-05-28

The susceptibility status of Aedes albopictus (Skuse; Diptera: Culicidea) larvae collected from 13 districts in Sarawak state, Malaysia was evaluated against five insect growth regulators (IGRs) namely, methoprene, pyriproxyfen, diflubenzuron, cyromazine, and novaluron. Field populations of Ae. albopictus were susceptible to methoprene, pyriproxyfen, cyromazine and novaluron with resistance ratios (RRs) ranging from 0.19-0.38, 0.05-0.14, 0.50-0.95, and 0.75-1.00, respectively. Nevertheless, tolerance towards diflubenzuron (0.33-1.33) was observed in this study. In general, these IGRs exhibited promising results and can be used as alternative control agents against field populations of Ae. albopictus in Sarawak, Malaysia.

Distribution of the Sunda Colugo (Galeopterus variegatus) in Malaysia (Peninsular, Sabah, Sarawak).

Science.gov (United States)

Nasir, Muhammad Dzulhelmi Muhammad; Abdullah, Mohd Tajuddin

2010-12-01

There is not much information available on the distribution of the Sunda colugo (Galeopterus variegates) in Malaysia, despite it being one of only two known species in the order Dermoptera. Data on the presence of the Sunda colugo and the vernacular names used by various ethnic groups throughout Malaysia were collected and compiled from various primary and secondary sources. There were 27 locations from Peninsular, 11 locations from Sabah and 34 locations from Sarawak that reported the presence of the Sunda colugo throughout Malaysia. The various ethnic groups of Malaysia adopted 37 different vernacular names to describe the Sunda colugo. This baseline data can be useful for the management authorities in conducting periodic monitoring and will enhance our knowledge of the population dynamics of the Sunda colugo in Malaysia.

Environmental Education in a Region of Rapid Economic Development: The Case of Sarawak.

Science.gov (United States)

Gough, Stephen.

1995-01-01

Discusses an innovative approach to environmental education that takes into account the interactions between cultural diversity and environmental controversy. Examines the situation in Sarawak, a State of East Malaysia, in the light of existing theoretical work. Contains 21 references. (JRH)

A solar power plant for Curtin University Malaysia

International Nuclear Information System (INIS)

Palanichamy, C

2016-01-01

The Curtin University, Sarawak Malaysia (Curtin Sarawak) is the first and largest offshore campus of Curtin University in Perth, Western Australia, and the first foreign university to be established in East Malaysia in partnership with the Sarawak State Government. Today's major concern of Curtin is its monthly electrical energy consumption and the electricity bill since its monthly energy consumption exceeds 0.3 Million kWh, and the corresponding electricity bill surpasses RM 95000. Such a situation necessitates Curtin to curtail the heavy energy consumption with immediate effect. Introducing Renewable Energy Source such as PV Solar Systems is a cost-effective and environmental friendly solution to reduce the exponential increase in energy consumption charges of Curtin. Hence, this paper proposes a 90 kW solar power plant for Curtin Sarawak. (paper)

A solar power plant for Curtin University Malaysia

Science.gov (United States)

Palanichamy, C.

2016-03-01

The Curtin University, Sarawak Malaysia (Curtin Sarawak) is the first and largest offshore campus of Curtin University in Perth, Western Australia, and the first foreign university to be established in East Malaysia in partnership with the Sarawak State Government. Today's major concern of Curtin is its monthly electrical energy consumption and the electricity bill since its monthly energy consumption exceeds 0.3 Million kWh, and the corresponding electricity bill surpasses RM 95000. Such a situation necessitates Curtin to curtail the heavy energy consumption with immediate effect. Introducing Renewable Energy Source such as PV Solar Systems is a cost-effective and environmental friendly solution to reduce the exponential increase in energy consumption charges of Curtin. Hence, this paper proposes a 90 kW solar power plant for Curtin Sarawak.

Unrealized diversity in an urban rainforest: A new species of Lygosoma (Squamata: Scincidae) from western Sarawak, Malaysia (Borneo).

Science.gov (United States)

Karin, Benjamin R; Freitas, Elyse S; Shonleben, Samuel; Grismer, L Lee; Bauer, Aaron M; Das, Indraneil

2018-01-12

We collected two specimens of an undescribed species of Lygosoma from pitfall traps in an urban rainforest in Kuching and from the base of a forested hill in western Sarawak, East Malaysia. The new species is diagnosable from all south-east Asian congeners by morphological characters, and most closely resembles Lygosoma herberti from the Thai-Malay Peninsula. The new species shows substantial molecular divergence from its closest relatives in two protein-coding genes, one mitochondrial (ND1) and one nuclear (R35) that we sequenced for several south-east Asian congeners. We describe the new species on the basis of this distinct morphology and genetic divergence. It is the third species of Lygosoma known from Borneo, and highlights the continuing rise in lizard species diversity on the island. In addition, the discovery of this species from a small urban rainforest underscores the importance of preserving intact rainforest areas of any size in maintaining species diversity.

Temporal and spatial mapping of hand, foot and mouth disease in Sarawak, Malaysia.

Science.gov (United States)

Sham, Noraishah M; Krishnarajah, Isthrinayagy; Ibrahim, Noor Akma; Lye, Munn-Sann

2014-05-01

Hand, foot and mouth disease (HFMD) is endemic in Sarawak, Malaysia. In this study, a geographical information system (GIS) was used to investigate the relationship between the reported HFMD cases and the spatial patterns in 11 districts of Sarawak from 2006 to 2012. Within this 7-years period, the highest number of reported HFMD cases occurred in 2006, followed by 2012, 2008, 2009, 2007, 2010 and 2011, in descending order. However, while there was no significant distribution pattern or clustering in the first part of the study period (2006 to 2011) based on Moran's I statistic, spatial autocorrelation (P = 0.068) was observed in 2012.

Detection of Cryptosporidium and Cyclospora Oocysts from Environmental Water for Drinking and Recreational Activities in Sarawak, Malaysia.

Science.gov (United States)

Bilung, Lesley Maurice; Tahar, Ahmad Syatir; Yunos, Nur Emyliana; Apun, Kasing; Lim, Yvonne Ai-Lian; Nillian, Elexson; Hashim, Hashimatul Fatma

2017-01-01

Cryptosporidiosis and cyclosporiasis are caused by waterborne coccidian protozoan parasites of the genera Cryptosporidium and Cyclospora, respectively. This study was conducted to detect Cryptosporidium and Cyclospora oocysts from environmental water abstracted by drinking water treatment plants and recreational activities in Sarawak, Malaysia. Water samples (12 each) were collected from Sungai Sarawak Kanan in Bau and Sungai Sarawak Kiri in Batu Kitang, respectively. In addition, 6 water samples each were collected from Ranchan Recreational Park and UNIMAS Lake at Universiti Malaysia Sarawak, Kota Samarahan, respectively. Water physicochemical parameters were also recorded. All samples were concentrated by the iron sulfate flocculation method followed by the sucrose floatation technique. Cryptosporidium and Cyclospora were detected by modified Ziehl-Neelsen technique. Correlation of the parasites distribution with water physicochemical parameters was analysed using bivariate Pearson correlation. Based on the 24 total samples of environmental water abstracted by drinking water treatment plants, all the samples (24/24; 100%) were positive with Cryptosporidium , and only 2 samples (2/24; 8.33%) were positive with Cyclospora . Based on the 12 total samples of water for recreational activities, 4 samples (4/12; 33%) were positive with Cryptosporidium , while 2 samples (2/12; 17%) were positive with Cyclospora . Cryptosporidium oocysts were negatively correlated with dissolved oxygen (DO).

Taxonomic assessment of seaweed community from the coastal areas of Bintulu, Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Mohd Hafizbillah Zawawi

2015-04-01

Full Text Available Basic taxonomic information forms the important basis for the documentation, resource management and utilization of marine biodiversity such as seaweeds. A taxonomic assessment of seaweeds in the coastal areas of Bintulu, Sarawak, East Malaysia, was conducted monthly from May 2011 to May 2012. Species composition was recorded following NaGISA protocols, direct observation, and SCUBA and snorkeling techniques. A total of 54 species were identified, classified into Rhodophyta (23 species, Chlorophyta (16 species and Phaeophyta (15 species. The highest abundance was recorded at Kuala Similajau (25 species while the lowest was recorded at Kuala Nyalau (12 species. As the present study was conducted by examining species collected from both rocky shores and the reef area for the first time, a higher number of species was documented compared to previous studies conducted in the same general area but focusing only on particular habitats. Thirty species found in the current survey represent new records for the locality including some with economic potentials.

Pediatric melioidosis in Sarawak, Malaysia: Epidemiological, clinical and microbiological characteristics.

Directory of Open Access Journals (Sweden)

Anand Mohan

2017-06-01

Full Text Available Melioidosis is a serious, and potentially fatal community-acquired infection endemic to northern Australia and Southeast Asia, including Sarawak, Malaysia. The disease, caused by the usually intrinsically aminoglycoside-resistant Burkholderia pseudomallei, most commonly affects adults with predisposing risk factors. There are limited data on pediatric melioidosis in Sarawak.A part prospective, part retrospective study of children aged <15 years with culture-confirmed melioidosis was conducted in the 3 major public hospitals in Central Sarawak between 2009 and 2014. We examined epidemiological, clinical and microbiological characteristics.Forty-two patients were recruited during the 6-year study period. The overall annual incidence was estimated to be 4.1 per 100,000 children <15 years, with marked variation between districts. No children had pre-existing medical conditions. Twenty-three (55% had disseminated disease, 10 (43% of whom died. The commonest site of infection was the lungs, which occurred in 21 (50% children. Other important sites of infection included lymph nodes, spleen, joints and lacrimal glands. Seven (17% children had bacteremia with no overt focus of infection. Delays in diagnosis and in melioidosis-appropriate antibiotic treatment were observed in nearly 90% of children. Of the clinical isolates tested, 35/36 (97% were susceptible to gentamicin. Of these, all 11 isolates that were genotyped were of a single multi-locus sequence type, ST881, and possessed the putative B. pseudomallei virulence determinants bimABp, fhaB3, and the YLF gene cluster.Central Sarawak has a very high incidence of pediatric melioidosis, caused predominantly by gentamicin-susceptible B. pseudomallei strains. Children frequently presented with disseminated disease and had an alarmingly high death rate, despite the absence of any apparent predisposing risk factor.

Dressed in black. A New Ansonia Stoliczka, 1870 (Lissamphibia: Anura: Bufonidae) from Gunung Murud, Sarawak, East Malaysia (Borneo).

Science.gov (United States)

Hertwig, Stefan T; Min, Pui Yong; Haas, Alexander; Das, Indraneil

2014-06-10

A new species of stream toad of the genus Ansonia is described from Gunung Murud, Pulong Tau National Park, of northern Sarawak, Malaysia, Borneo. Ansonia vidua, sp. nov., is morphologically distinguished from its Bornean congeners by the following combination of characters: medium size (SVL of adult females 33.5-34.4 mm); body uniformly black-brown in life; absence of a visible pattern on dorsum or limbs; presence of two low interorbital ridges; shagreened skin on dorsum, sides and upper surfaces of the limbs with numerous homogeneously small, rounded warts; first finger shorter than second; reduced webbing between the toes and an absence of a sharp tarsal ridge. Uncorrected genetic distances between related taxa of > 4.3% in 16S rRNA gene support its status as a hitherto undescribed species.

226Ra, 228Ra and 228Ra/226Ra in surface marine sediment of Malaysia

International Nuclear Information System (INIS)

Mei-Wo Yii; Zal Uyun Wan-Mahmood

2013-01-01

Surface sediment samples were collected at the West (east coast and west coast of Peninsular Malaysia) and East (Sabah and Sarawak) Malaysia in several expeditions within August 2003 until June 2008 for determining the level of natural radium isotopes. Activity concentrations of 226 Ra and 228 Ra in surface marine sediment at 176 sampling stations were measured. The activity concentrations of both radionuclides in Malaysia (East and West Malaysia) display varied with the range from 9 to 158 Bq/kg dry wt. and 13 to 104 Bq/kg dry wt., respectively. Meanwhile, the ratio distributions of 228 Ra/ 226 Ra were ranged from 0.62 to 3.75. This indicated that the ratios were slightly high at west coast of Peninsular Malaysia compared to other regions (east coast of Peninsular Malaysia, Sabah and Sarawak). The variation of activity concentrations of 226 Ra and 228 Ra and its ratios were also supported by the statistical analyses of one-way ANOVA and t test at 95 % confidence level, whereby there were proved that the measured values were different between the regions. These different were strictly related to their half-life, potential input sources (included their parents, 238 U and 232 Th), parent's characteristic, the geological setting/formation of the study area, environment origin and behavior. (author)

Comparative analysis of JKR Sarawak form of contract and Malaysia Standard form of building contract (PWD203A)

Science.gov (United States)

Yunus, A. I. A.; Muhammad, W. M. N. W.; Saaid, M. N. F.

2018-04-01

Standard form of contract is normally being used in Malaysia construction industry in establishing legal relation between contracting parties. Generally, most of Malaysia federal government construction project used PWD203A which is a standard form of contract to be used where Bills of Quantities Form Part of the Contract and it is issued by Public Works Department (PWD/JKR). On the other hand in Sarawak, the largest state in Malaysia, the state government has issued their own standard form of contract namely JKR Sarawak Form of Contract 2006. Even both forms have been used widely in construction industry; there is still lack of understanding on both forms. The aim of this paper is to identify significant provision on both forms of contract. Document analysis has been adopted in conducting an in-depth review on both forms. It is found that, both forms of contracts have differences and similarities on several provisions specifically matters to definitions and general; execution of the works; payments, completion and final account; and delay, dispute resolution and determination.

Two new Species of Simulium (Simulium) (Diptera: Simuliidae) From Mount Murud, Sarawak, Malaysia.

Science.gov (United States)

Takaoka, Hiroyuki; Ya'cob, Zubaidah; Sofian-Azirun, Mohd

2015-01-01

Two new species of black flies, Simulium (Simulium) murudense and Simulium (Simulium) cheedhangi, are described on the basis of females, males, pupae, and larvae collected in Mount Murud, Sarawak, Malaysia. Both species belong to the Simulium melanopus Edwards species group. S. (S.) murudense sp. nov. is distinguished from most known species by a combination of the haired basal portion of the radial vein and the darkened fore coxae, and S. (S.) cheedhangi sp. nov. is characterized in the female by having a medium-sized claw tooth and in the pupa by six somewhat inflated gill filaments. Notes are given on the S. melanopus species-group in Sarawak and Sabah. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The Sarawak lupus cohort: clinical features and disease patterns of 633 SLE patients in a single tertiary centre from East Malaysia.

Science.gov (United States)

Teh, C L; Ling, G R; Aishah, Wan Sharifah

2015-01-01

Systemic lupus erythematosus (SLE) has been well studied in West Malaysian populations but lacking in East Malaysian populations. The aim of this study was to examine the clinical features and disease patterns of patients with SLE in a multiethnic East Malaysian population in Sarawak. All SLE patients who were treated in Sarawak General Hospital were reviewed in a retrospective longitudinal study using a standard protocol from 1 January 2006 to 31 December 2013. There were a total of 633 patients in our study with the female to male ratio of 12:1. Our study patients were of multiethnic origins with predominant Chinese ethnic group. They had a mean age of 36.9 ± 13.2 years and a mean duration of illness of 7.2 ± 6.0 years. The main involvements were haematological (74.2 %), malar rash (64.0 %) and renal (58.6 %). Chinese patients were less likely to have discoid lupus, pleuritis and pericarditis, while Malay patients were more likely to have arthritis. Bidayuh patients were more likely to have oral ulcer. Secondary antiphospholipid syndrome was more common in Chinese. The majority of patients were in clinical remission with low SDI. There were 58 deaths (9.2 %) during 2006-2013 with the main causes of death being flare of disease and infection.

Chigger (Acarina:Trombiculidae) surveys of the west coast beaches of Sabah and Sarawak.

Science.gov (United States)

Dohany, A L; Phang, O W; Rapmund, G

1977-06-01

Leptotrombidium (Leptotrombidium) arenicola Traub, a vector of scrub typhus, had previously been found to occur in the coastal vegetation behind the edge of open sand along the beaches of Peninsular Malaysia. Surveys of the west coast beaches of Sabah and Sarawak were conducted to determine if this species occurs in similar habitat in East Malaysia on the island of Borneo. Leptotrombidium (L.) arenicola was not collected from the eighteen sites studied. Of the 11,982 mite larvae collected, 55 per cent were L.(L.) deliense (Walch), a well-known, widespread vector of scrub typhus.

Assessment of Gravity Field and Steady State Ocean Circulation Explorer (GOCE) geoid model using GPS levelling over Sabah and Sarawak

Science.gov (United States)

Othman, A. H.; Omar, K. M.; Din, A. H. M.; Som, Z. A. M.; Yahaya, N. A. Z.; Pa'suya, M. F.

2016-06-01

The GOCE satellite mission has significantly contributed to various applications such as solid earth physics, oceanography and geodesy. Some substantial applications of geodesy are to improve the gravity field knowledge and the precise geoid modelling towards realising global height unification. This paper aims to evaluate GOCE geoid model based on the recent GOCE Global Geopotential Model (GGM), as well as EGM2008, using GPS levelling data over East Malaysia, i.e. Sabah and Sarawak. The satellite GGMs selected in this study are the GOCE GGM models which include GOCE04S, TIM_R5 and SPW_R4, and the EGM2008 model. To assess these models, the geoid heights from these GGMs are compared to the local geometric geoid height. The GGM geoid heights was derived using EGMLAB1 software and the geometric geoid height was computed by available GPS levelling information obtained from the Department Survey and Mapping Malaysia. Generally, the GOCE models performed better than EGM2008 over East Malaysia and the best fit GOCE model for this region is the TIM_R5 model. The TIM_R5 GOCE model demonstrated the lowest R.M.S. of ± 16.5 cm over Sarawak, comparatively. For further improvement, this model should be combined with the local gravity data for optimum geoid modelling over East Malaysia.

Spatial patterns of seaweed distribution in Malaysia using GIS

Science.gov (United States)

Lian, Du Hai; Sim, Jillian Ooi Lean; Fauzi, Rosmadi; Moi, Phang Siew

2008-10-01

The objective of this article is to represent spatial patterns of seaweed distribution in Malaysia. Seaweeds have been collected since 1984 along coastlines of 4675 km of peninsular Malaysia, Sabah, and Sarawak. However, there is no seaweed database and they cannot be displayed in a geographic view. Therefore, a database with 805 georeferenced observations was setup and GIS is used to analyze seaweed diversity based on this database. The highest number of observations is 94 which occur along east coastline of peninsular Malaysia. The highest number of species richness is 82 which are also along east coastline of peninsular Malaysia. Rhodophyta has the highest species richness while Chlorophyta has the least species richness.

Public Awareness Program and Development of Education Toolkit for Green Sea Turtle Conservation in Sarawak, Malaysia

Science.gov (United States)

Hassan, Ruhana; Yahya, Nurhartini Kamalia; Ong, Leh Mui; Kheng, Lim Kian; Abidin, Zulkalnain Zainal; Ayob, Anuar; Jainal, Aslina Mohd

2017-01-01

Nobody knows exactly what happened during "the lost years" of the turtles in the wild, thus a green turtle headstarting project was carried out at Pantai Pandan, Lundu, Sarawak, Malaysia from June 2014 until December 2015 to shed some lights on the growth of hatchlings during a small part of their "lost years". As a consequent,…

Pronominal Differences in Languages of Sabah and Sarawak and the Effect on the Acquisition of Bahasa Malaysia.

Science.gov (United States)

Lee, Eileen Yen Ee; Boutin, Michael E.

Bilingual education programs must be based on a sound understanding of the linguistic, social, psychological, and cultural factors affecting students. This paper is concerned with linguistic factors that affect the acquisition of Bahasa Malaysia (BM) pronouns by non-native speakers from Sabah and Sarawak. Properties in the personal pronoun systems…

Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

OpenAIRE

Pui, Chai Fung; Bilung, Lesley Maurice; Apun, Kasing; Su’ut, Lela

2017-01-01

Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil...

Iodine deficiency disorders in Sarawak, Malaysia.

Science.gov (United States)

Kiyu, A; Tambi, Z; Ahmad, Y

1998-12-01

The state of Sarawak in Malaysia has a high prevalence of iodine deficiency disorders (IDD). This has been revealed through a review of goitre surveys that were carried out in the State from the early 1970s to the 1990s. The primary cause was low iodine intake. Contributory factors were low iodine content in the soil and water as well as high cassava consumption. Virtual elimination of IDD is one of the nutritional goals of the IDD prevention and control programs. The strategies adopted include the iodination of coarse salt, which is sold in the market by shopkeepers and also provided free from government health clinics; legislation requiring that salt sold in IDD-gazetted areas must be iodised; and the use of iodinators to iodise water supplied by the gravity-feed system to villages and boarding schools in rural areas. The indicators used in the monitoring and evaluation of the program include the availability of iodised salt in the market and households, iodine levels in water supply that had been fitted with iodinators, goitre volume measured by ultrasound, and urinary iodine excretion among school children.

Effects of System's and User's Characteristics on E-Learning Use: A Study at Universiti Malaysia Sarawak

Science.gov (United States)

Hong, Kian-Sam; Cheng, Julia Lee Ai; Liau, Tet-Loke

2005-01-01

The benefits of an e-learning system will not be maximised if learners do not use the system. This study was conducted with 26 postgraduate students at a faculty in Universiti Malaysia Sarawak taking an on-campus course supplemented with an e-learning system. The purpose of the study was to determine which factors were related to intention to use…

Simulium hiroyukii, a new species of the subgenus Gomphostilbia (Diptera: Simuliidae) from Mount Murud, Sarawak, Malaysia.

Science.gov (United States)

Ya'cob, Zubaidah; Takaoka, Hiroyuki; Sofian-Azirun, Mohd

2015-01-20

Simulium (Gomphostilbia) hiroyukii is described based on females, males, pupae and larvae collected in Mount Murud, Sarawak, Malaysia. This new species is assigned to the Simulium darjeelingense species-group of the subgenus Gomphostilbia, and is characterized by the darkened fore coxae and the pupal gill with eight long filaments, of which middle and dorsal triplets have elongated primary and secondary stalks, respectively. 

Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia

OpenAIRE

Sim, Siong Fong; Ling, Teck Yee; Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu; Bakeh, Tomy

2014-01-01

This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota sample...

Molecular epidemiology of tuberculosis in Malaysia.

Science.gov (United States)

Dale, J W; Nor, R M; Ramayah, S; Tang, T H; Zainuddin, Z F

1999-05-01

Molecular typing with IS6110 was applied to Mycobacterium tuberculosis isolates from all parts of Malaysia. The degree of clustering increased with patient age, suggesting that reactivation may contribute to clustering. Identical banding patterns were also obtained for isolates from widely separate regions. Therefore, the use of clustering as a measure of recent transmission must be treated with caution. Strains related to the Beijing family were common in Peninsular Malaysia but were less common in Sabah and Sarawak, while a distinct group of strains comprised nearly 40% of isolates from East Malaysia but such strains were rare in Peninsular Malaysia. Single-copy strains, common in South and Southeastern Asia, constituted nearly 20% of isolates from the peninsula but were virtually absent in East Malaysia. The marked geographical difference in the prevailing strains indicates not only a restricted dissemination of M. tuberculosis but also a considerable degree of stability in the banding patterns.

International Uranium Resources Evaluation Project (IUREP) national favourability studies: Malaysia

International Nuclear Information System (INIS)

1977-12-01

Malaysia is a country of 330,000 square kilometers and a population of 11.9 million. The country is divided into two parts 640 kilometers apart. West Malaysia consists of the Malay Peninsula, and East Malaysia of the provinces of Sarawak and Sabah, formerly North Borneo. The country is the world's leading producer of tin and rubber. Geologic descriptions in detail are difficult to find although maps are available. Uranium exploration, chiefly by the Malaysian Geological Survey, has been carried out without discovery of commercial quantities. Based on possible recovery of uranium from deeply weathered granites on the Malay Peninsula, and possible discoveries in East Malaysia, a uranium potential of 1,000 to 10,000 tonnes U (category 2) is assigned. (author)

Population and economic development in Sarawak, Malaysia

OpenAIRE

Furuoka, Fumitaka

2014-01-01

This paper chooses a Malaysian state in Borneo Island, Sarawak, as the case study to examine the relationship between population growth and economic development. The findings imply that there is no statistically significant long-run relationship, but a causal relationship between population growth and economic development in Sarawak. In other words, the empirical findings indicate that population can have neither positive nor negative impact on economic development. The findings also indicate...

Architecture and growth history of a Miocene carbonate platform from 3D seismic reflection data; Luconia province, offshore Sarawak, Malaysia

NARCIS (Netherlands)

Zampetti, V.; Schlager, W.; van Konijnenburg, J.H; Everts, A.J.

2004-01-01

Using 3D seismic reflection data and wireline logs we reconstruct in detail the architecture and growth history of a Miocene carbonate platform in the Luconia province, offshore Sarawak, Malaysia. Platform growth started in the Late Oligocene to Early Miocene, by coalescence of isolated patch reefs.

Soil carbon stocks in Sarawak, Malaysia

Energy Technology Data Exchange (ETDEWEB)

Padmanabhan, E., E-mail: Eswaran_padmanabhan@petronas.com.my [Department of Geosciences, Faculty of Geosciences and Petroleum Engineering, Universiti Teknologi PETRONAS, Tronoh, 31750, Perak (Malaysia); Eswaran, H.; Reich, P.F. [USDA-Natural Resources Conservation Service, Washington, DC 20250 (United States)

2013-11-01

The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO{sub 2}, CH{sub 4}, and N{sub 2}O have an anthropic source and of these CO{sub 2} is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m{sup −2} m{sup −1}), while Oxisols and Ultisols rate second (about 10–15 kg m{sup −2} m{sup −1}). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1 m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m{sup −2} m{sup −1}. Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. - Highlights: • Soil carbon stocks in different soils in Sarawak • In depth discussion of

Soil carbon stocks in Sarawak, Malaysia

International Nuclear Information System (INIS)

Padmanabhan, E.; Eswaran, H.; Reich, P.F.

2013-01-01

The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO 2 , CH 4 , and N 2 O have an anthropic source and of these CO 2 is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m −2 m −1 ), while Oxisols and Ultisols rate second (about 10–15 kg m −2 m −1 ). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1 m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m −2 m −1 . Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. - Highlights: • Soil carbon stocks in different soils in Sarawak • In depth discussion of soil carbon pools in Histosols • Strategies

Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

Science.gov (United States)

Pui, Chai Fung; Apun, Kasing; Su'ut, Lela

2017-01-01

Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii, intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri, respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak. PMID:28348601

Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia.

Science.gov (United States)

Pui, Chai Fung; Bilung, Lesley Maurice; Apun, Kasing; Su'ut, Lela

2017-01-01

Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR) method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107) of rats, 11.6% (34/292) of soil samples, and 1.9% (6/324) of water samples. Intermediate Leptospira was present in 2.7% (8/292) of soil samples and 1.9% (6/324) of water samples. Saprophytic Leptospira was present in 10.3% (11/107) of rats, 1.4% (4/292) of soil samples, and 0.3% (1/324) of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii , intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri , respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak.

Diversity of Leptospira spp. in Rats and Environment from Urban Areas of Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Chai Fung Pui

2017-01-01

Full Text Available Various prevalence studies on Leptospira in animals and humans, as well as environmental samples, had been conducted worldwide, including Malaysia. However, limited studies have been documented on the presence of pathogenic, intermediate, and saprophytic Leptospira in selected animals and environments. This study was therefore conducted to detect Leptospira spp. in rats, soil, and water from urban areas of Sarawak using the polymerase chain reaction (PCR method. A total of 107 rats, 292 soil samples, and 324 water samples were collected from April 2014 to February 2015. Pathogenic Leptospira was present in 5.6% (6/107 of rats, 11.6% (34/292 of soil samples, and 1.9% (6/324 of water samples. Intermediate Leptospira was present in 2.7% (8/292 of soil samples and 1.9% (6/324 of water samples. Saprophytic Leptospira was present in 10.3% (11/107 of rats, 1.4% (4/292 of soil samples, and 0.3% (1/324 of water samples. From this study, 76 Leptospira spp. were isolated. Based on DNA sequencing, the dominant Leptospira spp. circulating in urban areas of Sarawak are pathogenic Leptospira noguchii, intermediate Leptospira wolffii serovar Khorat, and saprophytic Leptospira meyeri, respectively. Overall, this study provided important surveillance data on the prevalence of Leptospira spp. from rats and the environment, with dominant local serovars in urban areas of Sarawak.

Marine sampling in Malaysia coastal area: the challenge, problems and solution

International Nuclear Information System (INIS)

Norfaizal Mohamed; Khairul Nizam Razali; Mohd Rafaie Mohd Murtadza; Muhammad Amin Abdul Ghani; Zaharudin Ahmad; Abdul Kadir Ishak

2005-01-01

Malaysia Marine Radioactivity Database Development Project is one of the five research contracts that was signed between MINT and AELB. Three marine sampling expeditions had been carried out using K.L. PAUS vessel owned by Malaysian Fisheries Institute, Chendering, Terengganu. The first marine sampling expedition was taken place at East Coast Peninsular Malaysia waters on August 2003, followed on February 2004 at West Coast Peninsular Malaysia waters, and lastly at Sarawak-Sabah waters on July 2004. Many challenges and problems were faced when collecting sediment, water, biota and plankton sample during this marine sampling. (Author)

Cadmium and lead in blood cockle (Anadara granosa) from Asajaya, Sarawak, Malaysia.

Science.gov (United States)

Hossen, Md Faruk; Hamdan, Sinin; Rahman, Md Rezaur

2014-01-01

The concentrations were ranged from 1.35 ± 0.16 to 2.22 ± 0.34 µg/g (dry weight) and 2.65 ± 0.34 to 4.36 ± 0.53 µg/g (dry weight) for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985). It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation.

Cadmium and Lead in Blood Cockle (Anadara granosa from Asajaya, Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Md. Faruk Hossen

2014-01-01

Full Text Available The concentrations were ranged from 1.35±0.16 to 2.22±0.34 µg/g (dry weight and 2.65±0.34 to 4.36±0.53 µg/g (dry weight for Cd and Pb, respectively, in blood cockle Anadara granosa from four sites of Sabang River, namely, Kampung Sambir, Kampung Tambirat, Beliong Temple, and Kampung Tanjung Apong, which are located at Asajaya, Sarawak, Malaysia. All values exceeded safety limits set by Malaysian Food Regulation (1985. It may be the cause of serious human health problems after long term consumption. Thus, consumer should have consciousness about such type of seafood from mentioned sites and need further investigation.

Biomass and Habitat Characteristics of Epiphytic Macroalgae in the Sibuti Mangroves, Sarawak, Malaysia.

Science.gov (United States)

Isa, Hasmidah Md; Kamal, Abu Hena Mustafa; Idris, Mohd Hanafi; Rosli, Zamri; Ismail, Johan

2017-01-01

Mangroves support diverse macroalgal assemblages as epibionts on their roots and tree trunks. These algae provide nutrients to the primary consumers in the aquatic food web and have been reported to be substantial contributors to marine ecosystems. The species diversity, biomass, and habitat characteristics of mangrove macroalgae were investigated at three stations in the Sibuti mangrove estuary, Sarawak, Malaysia, from November 2012 to October 2013. Three groups of macroalgae were recorded and were found to be growing on mangrove prop roots, namely Rhodophyta ( Caloglossa ogasawaraensis , Caloglossa adhaerens , Caloglossa stipitata , Bostrychia anomala, and Hypnea sp.), Chlorophyta ( Chaetomorpha minima and Chaetomorpha sp.), and Phaeophyta ( Dictyota sp.). The biomass of macroalgae was not influenced ( p >0.05) by the season in this mangrove forest habitat. The macroalgal species Hypnea sp. contributed the highest biomass at both Station 1 (210.56 mg/cm 2 ) and Station 2 (141.72 mg/cm 2 ), while the highest biomass was contributed by B. anomala (185.89 mg/cm 2 ) at Station 3. This study shows that the species distribution and assemblages of mangrove macroalgae were influenced by environmental parameters such as water nutrients, dissolved solids, and salinity in the estuarine mangrove habitats of Sibuti, Sarawak.

Clinical characteristics of basal cell carcinoma in a tertiary hospital in Sarawak, Malaysia.

Science.gov (United States)

Yap, Felix Boon Bin

2010-02-01

Basal cell carcinoma (BCC) is the most common skin cancer among Orientals. Data on this malignancy is lacking in Malaysia, prompting a retrospective study to determine the clinical characteristics in the skin clinic, Sarawak General Hospital between 2000 and 2008. Demographic data and clinical features of 64 histopathologically proven BCC from 43 patients were retrieved. Statistical analysis was performed comparing the clinical characteristics based on the region of involvement and gender. The mean age of presentation was 60.9 years. Male to female ratio was 1.05. Majority of the patients were Chinese (44.2%) followed by Malays (32.6%), Bidayuhs (14.0%) and Ibans (6.9%). Nodular BCC accounted for 95.3% of cases while 4.7% were superficial BCC. All the nodular BCC were pigmented. Ulceration was noted in 18%. There were 82.8% of BCC on the head and neck region and 17.2% on the trunk and limb region. BCC on the latter region were larger (mean 35.0 cf. 14.4 mm, p Sarawak were similar to other Asian studies. Additionally, BCC on the trunk and limbs and in men were larger, ulcerative and long standing warranting better efforts for earlier detection.

Reproductive Cycle of Hard Clam, Meretrix lyrata Sowerby, 1851 (Bivalvia: Veneridae) from Sarawak, Malaysia.

Science.gov (United States)

Hamli, Hadi; Idris, Mohd Hanafi; Rajaee, Amy Halimah; Kamal, Abu Hena Mustafa

2015-12-01

A study of the reproductive cycle of the hard clam, Meretrix lyrata, was documented based on histological observation and Gonad Index (GI). Samples were taken from estuarine waters of the Buntal River in Sarawak, Malaysia. The gonad of M. lyrata started to develop in September 2013. Gametogenesis continued to develop until the maturation and spawning stage from February to April 2014. The GI pattern for a one-year cycle showed a significant correlation with chlorophyll a. The corresponding GI with chlorophyll a suggested that the development of the reproductive cycle of M. lyrata required a high amount of food to increase gametogenesis.

An Experimental Investigation of Karanja Biodiesel Production in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Dewi Harreh

2018-01-01

Full Text Available The application of nonedible feedstock for the production of biodiesel has become an area of research interest among clean energy experts in the past few years. This research is aimed at the utilization of Pongamia pinnata (karanja, a nonedible feedstock from the state of Sarawak, Malaysia, to produce biodiesel to be known as crude karanja oil (CKO. A one-step transesterification process utilizing 7 : 1–10 : 1 wt% methanol (CH3OH and 0.5–1.2 wt% sodium hydroxide (NaOH at 65°C for 1.5 hrs has been used for the biodiesel production yielding 84% conversion. The physiochemical properties of the CKO produced revealed that it conforms with EN14214 standards for brake power (BP, brake specific fuel consumption (BSFC, and brake thermal efficiency (BTE as they are all noted be optimal at B40.

Clustering and genetic differentiation of the normocyte binding protein (nbpxa) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia and Malaysia Borneo.

Science.gov (United States)

Ahmed, Md Atique; Fong, Mun Yik; Lau, Yee Ling; Yusof, Ruhani

2016-04-26

The zoonotic malaria parasite Plasmodium knowlesi has become an emerging threat to South East Asian countries particular in Malaysia. A recent study from Sarawak (Malaysian Borneo) discovered two distinct normocyte binding protein xa (Pknbpxa) types of P. knowlesi. In the present study, the Pknbpxa of clinical isolates from Peninsular Malaysia and Sabah (Malaysian Borneo) were investigated for the presence of Pknbpxa types and natural selection force acting on the gene. Blood samples were collected from 47 clinical samples from Peninsular Malaysia (n = 35) and Sabah (Malaysian Borneo, n = 12) were used in the study. The Pknbpxa gene was successfully amplified and directly sequenced from 38 of the samples (n = 31, Peninsular Malaysia and n = 7, Sabah, Malaysian Borneo). The Pknbpxa sequences of P. knowlesi isolates from Sarawak (Malaysian Borneo) were retrieved from GenBank and included in the analysis. Polymorphism, genetic diversity and natural selection of Pknbpxa sequences were analysed using DNAsp v 5.10, MEGA5. Phylogentics of Pknbpxa sequences was analysed using MrBayes v3.2 and Splits Tree v4.13.1. The pairwise F ST indices were used to determine the genetic differentiation between the Pknbpxa types and was calculated using Arlequin 3.5.1.3. Analyses of the sequences revealed Pknbpxa dimorphism throughout Malaysia indicating co-existence of the two types (Type-1 and Type-2) of Pknbpxa. More importantly, a third type (Type 3) closely related to Type 2 Pknbpxa was also detected. This third type was found only in the isolates originating from Peninsular Malaysia. Negative natural selection was observed, suggesting functional constrains within the Pknbpxa types. This study revealed the existence of three Pknbpxa types in Malaysia. Types 1 and 2 were found not only in Malaysian Borneo (Sarawak and Sabah) but also in Peninsular Malaysia. A third type which was specific only to samples originating from Peninsular Malaysia was discovered. Further genetic

Peat-accumulating depositional systems of Sarawak, East Malaysia

Science.gov (United States)

Staub, James R.; Esterle, Joan S.

1994-02-01

Many coal deposits originate in deltaic, estuarine, and coastal plain settings and a knowledge of interrelationships between the tectonic and depositional elements active at the time of sediment deposition is necessary to formulate basin scale models. The prograding coastal depositional systems of Sarawak all contain domed peat-accumulating environments in which low-ash, low-sulfur peats are being deposited in areas of active clastic siliciclastic sedimentation. These depositional systems are as large as 11,400 km 2 and individual peat deposits within systems are in excess of 20 m thick and 1000 km 2 in area. The geographic positions and drainage basin areas of each depositional system are controlled by fault and fold systems. Although prograding into the same receiving basin, individual system geomorphology is variable and ranges from a wave-dominated microtidal delta, to a wave-dominated meso- to macro-tidal delta/coastal plain system, to a tide-dominated macrotidal estuarine embayment along a 450 km stretch of coastline. System variation is a function of sediment supply, shelf and embayment geometry, wave climate, and tidal range. These factors, which control depositional system geomorphology, also control the resulting long axis orientation of the thick, domed peat deposits. The surface vegetation and internal characteristics of most domed peat deposits, however, are similar. Internal characteristics consist of basal high-ash, high-sulfur, degraded peats overlain by low-ash, low-sulfur, well preserved peats in vertical profile. These systems demonstrate variable responses to late Pleistocene/Holocene sea-level rise and, in these instances, the variation is most attributable to local differences in siliciclastic sediment supply, which is a function of the drainage basin area.

Microbial keratitis in West and East Malaysia

OpenAIRE

Vanitha Ratnalingam; Thiageswari Umapathy; Kala Sumugam; Hanida Hanafi; Shamala Retnasabapathy

2017-01-01

AIM: To evaluate the epidemiological and etiological factors of microbial keratitis seen in tertiary hospitals in West and East Malaysia.METHODS: A total of 207 patients were enrolled. Patients referred for microbial keratitis to Sungai Buloh Hospital and Kuala Lumpur Hospital in West Malaysia and Queen Elizabeth Hospital and Kuching General Hospital in East Malaysia were recruited. Risk factors were documented. Corneal scrapings for microscopy and culture were performed.RESULTS: The most com...

Sarawak state elections 2016: revisiting federalism in Malaysia

OpenAIRE

Ali, Rashaad; Osman, Mohamed Nawab Mohamed

2017-01-01

The recent state elections in the Eastern Malaysian state of Sarawak in 2016 saw the ruling coalition, the Barisan Nasional, secure a comfortable victory through its component party, the Parti Pesaka Bumiputera Bersatu, led by the late Adenan Satem, who passed away suddenly on 11 January 2017. A key theme of Adenan’s election cam-paign was greater autonomy for the state of Sarawak, while he also distanced himself from the troubles of the Najib Razak administration and the federal government. ...

Estimation of stature from hand and handprint measurements in Iban population in Sarawak, Malaysia and its applications in forensic investigation.

Science.gov (United States)

Zulkifly, Nuranis-Raihan; Wahab, Roswanira Abd; Layang, Elizabeth; Ismail, Dzulkiflee; Desa, Wan Nur Syuhaila Mat; Hisham, Salina; Mahat, Naji A

2018-01-01

Handprints and dismembered hands are commonly found during crime scene investigations and disaster victim identifications, respectively. It has been indicated that the accuracy of handprint and hand measurements for estimating stature maybe population specific. Since Iban is the largest ethnic population in Sarawak, Malaysia and because the application of anthropometry of hand and handprint within this population as well as other populations within the Southeast Asian countries remain unreported, this present study that investigated the reliability and accuracy of these two anthropometric aspects acquires forensic significance. Upon measuring the height, 21 measurements were recorded on each hand and the corresponding handprint of 50 male and 52 female consented adult Iban subjects. Using univariate statistics as well as simple and multiple regression analyses, interpretation of the measurements examined here was attempted. Results revealed that lengths of hand and handprint are the more reliable traits for estimating stature in both the male and female Iban subjects (p Sarawak that may prove useful for crime scene investigations and disaster victim identifications in Malaysia. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Malaysia

International Nuclear Information System (INIS)

1992-01-01

Malaysia's oil reserves are found in 56 fields, 32 of which are in production. Gas is found in 54 fields, four of which are in production three off Sarawak and one off Terengganu. Oil reserves stand at 3.6 billion barrels and gas at 59 trillion cubic feet respectively. Malaysia's oil reserves are expected to last 12.5 years and gas reserves 73.8 years at current rates of production and consumption. Malaysia's production of crude oil increased in 1991 to 623,100 bpd, from 600,700 bpd in 1990 in response to both increased production capacity and demand. Condensates contribute an additional estimated 22,100 bpd to total output. 57% of the crude comes from 13 oil fields off Terengganu, 20% from nine fields off Sabah and 23% from 10 fields off Sarawak. (Author)

The effect of vaccination coverage and climate on Japanese encephalitis in Sarawak, Malaysia.

Directory of Open Access Journals (Sweden)

Daniel E Impoinvil

Full Text Available Japanese encephalitis (JE is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control.Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month, minimum temperature (lag 6-months and SOI (lag 6-months were positively associated with JE cases.This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects are ignored.

The effect of vaccination coverage and climate on Japanese encephalitis in Sarawak, Malaysia.

Science.gov (United States)

Impoinvil, Daniel E; Ooi, Mong How; Diggle, Peter J; Caminade, Cyril; Cardosa, Mary Jane; Morse, Andrew P; Baylis, Matthew; Solomon, Tom

2013-01-01

Japanese encephalitis (JE) is the leading cause of viral encephalitis across Asia with approximately 70,000 cases a year and 10,000 to 15,000 deaths. Because JE incidence varies widely over time, partly due to inter-annual climate variability effects on mosquito vector abundance, it becomes more complex to assess the effects of a vaccination programme since more or less climatically favourable years could also contribute to a change in incidence post-vaccination. Therefore, the objective of this study was to quantify vaccination effect on confirmed Japanese encephalitis (JE) cases in Sarawak, Malaysia after controlling for climate variability to better understand temporal dynamics of JE virus transmission and control. Monthly data on serologically confirmed JE cases were acquired from Sibu Hospital in Sarawak from 1997 to 2006. JE vaccine coverage (non-vaccine years vs. vaccine years) and meteorological predictor variables, including temperature, rainfall and the Southern Oscillation index (SOI) were tested for their association with JE cases using Poisson time series analysis and controlling for seasonality and long-term trend. Over the 10-years surveillance period, 133 confirmed JE cases were identified. There was an estimated 61% reduction in JE risk after the introduction of vaccination, when no account is taken of the effects of climate. This reduction is only approximately 45% when the effects of inter-annual variability in climate are controlled for in the model. The Poisson model indicated that rainfall (lag 1-month), minimum temperature (lag 6-months) and SOI (lag 6-months) were positively associated with JE cases. This study provides the first improved estimate of JE reduction through vaccination by taking account of climate inter-annual variability. Our analysis confirms that vaccination has substantially reduced JE risk in Sarawak but this benefit may be overestimated if climate effects are ignored.

The consumption of alcohol among men in rural Sarawak

OpenAIRE

Amit, Noh

2017-01-01

This research examined sociocultural factors associated with alcohol use among men in rural Sarawak, Malaysia. A mixed methods design was used to explore the phenomenon of alcohol use among young men in rural villages in Kuching and Samarahan Districts, Sarawak. A questionnaire (161 participants), semi structured individual interviews (50 participants), and eight focus group discussions (46 participants) were conducted with men from Iban, Bidayuh, and Malay ethnicities, aged 18-30 years. ...

Price convergence and market integration: evidence from Malaysia

OpenAIRE

Lee, Chin; Habibullah, Muzafar Shah

2008-01-01

The purpose of this study is to assess the markets integration within Malaysia by examine the price convergence across Peninsular Malaysia, Sabah and Sarawak. Disaggregate monthly price data for various types of goods or services in Peninsular Malaysia, Sabah and Sarawak were utilized. Levin and Lin (1993) panel unit root test was employed to test whether the price of various types of goods among 3 provinces/states in Malaysia are stationary. The result of panel unit roots test showed that in...

Activities concentration of 239+240Pu in sediment in Sabah and Sarawak coastal area

International Nuclear Information System (INIS)

Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Ahmad Sanadi Abu Bakar; Norfaizal Mohamed; Kamarozaman Ishak; Zulkifli Daud

2008-08-01

The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal area of the Sabah and Sarawak have been performed using alpha spectrometry counting system. The sampling coastal sediment for this study was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. This results show that the distribution of Plutonium, 239+240 Pu radionuclides in coastal sediment is consistent, their activities are depending on the sampling locations. Generally, the 239+240 Pu activities measured in Sabah and Sarawak coastal sediment are in the range of BDL - 1.83 Bq/kg and 0.11 - 0.841 Bq/kg dry weights, respectively. The sampling stations, Persisiran Lubok Sabanan, SB 15 and Sungai Similajau, SR 13 showed the highest plutonium, 239+240 Pu radionuclides isotopes activity in Sabah and Sarawak. Meanwhile, these two stations shows higher activity compare to West Coast of Peninsular of Malaysia station for the Marine Radioactivity Database Development Project for Malaysia. (Author)

The structure and stratigraphy of deepwater Sarawak, Malaysia: Implications for tectonic evolution

Science.gov (United States)

Madon, Mazlan; Kim, Cheng Ly; Wong, Robert

2013-10-01

The structural-stratigraphic history of the North Luconia Province, Sarawak deepwater area, is related to the tectonic history of the South China Sea. The Sarawak Basin initiated as a foreland basin as a result of the collision of the Luconia continental block with Sarawak (Sarawak Orogeny). The foreland basin was later overridden by and buried under the prograding Oligocene-Recent shelf-slope system. The basin had evolved through a deep foreland basin ('flysch') phase during late Eocene-Oligocene times, followed by post-Oligocene ('molasse') phase of shallow marine shelf progradation to present day. Seismic interpretation reveals a regional Early Miocene Unconformity (EMU) separating pre-Oligocene to Miocene rifted basement from overlying undeformed Upper Miocene-Pliocene bathyal sediments. Seismic, well data and subsidence analysis indicate that the EMU was caused by relative uplift and predominantly submarine erosion between ˜19 and 17 Ma ago. The subsidence history suggests a rift-like subsidence pattern, probably with a foreland basin overprint during the last 10 Ma. Modelling results indicate that the EMU represents a major hiatus in the sedimentation history, with an estimated 500-2600 m of missing section, equivalent to a time gap of 8-10 Ma. The EMU is known to extend over the entire NW Borneo margin and is probably related to the Sabah Orogeny which marks the cessation of sea-floor spreading in the South China Sea and collision of Dangerous Grounds block with Sabah. Gravity modelling indicates a thinned continental crust underneath the Sarawak shelf and slope and supports the seismic and well data interpretation. There is a probable presence of an overthrust wedge beneath the Sarawak shelf, which could be interpreted as a sliver of the Rajang Group accretionary prism. Alternatively, magmatic underplating beneath the Sarawak shelf could equally explain the free-air gravity anomaly. The Sarawak basin was part of a remnant ocean basin that was closed by

A new species of troglobitic crab of the genus Stygothelphusa Ng, 1989, from Sarawak, Malaysia (Crustacea: Decapoda: Brachyura: Gecarcinucidae).

Science.gov (United States)

Ng, Peter K L; Grinang, Jongkar

2014-03-04

A new species of cave crab, Stygothelphusa antu new species, is described from limestone formations in Temurang, Sarawak, Malaysia. The new species is the most highly adapted to a cavericolous lifestyle among the four known species of Stygothelphusa, having a pale body pigmentation, reduced eyes and elongated pereopods. In contrast, the other three species have normal eyes that almost completely fill the orbits. The new species also differs from its congeners by a number of carapace, pereopod and gonopod characters.

Japanese Encephalitis in Malaysia: An Overview and Timeline.

Science.gov (United States)

Kumar, Kiven; Arshad, Siti Suri; Selvarajah, Gayathri Thevi; Abu, Jalila; Toung, Ooi Peck; Abba, Yusuf; Yasmin, A R; Bande, Faruku; Sharma, Reuben; Ong, Bee Lee

2018-05-29

Japanese encephalitis (JE) is a vector-borne zoonotic disease caused by the Japanese encephalitis virus (JEV). It causes encephalitis in human and horses, and may lead to reproductive failure in sows. The first human encephalitis case in Malaya (now Malaysia) was reported during World War II in a British prison in 1942. Later, encephalitis was observed among race horses in Singapore. In 1951, the first JEV was isolated from the brain of an encephalitis patient. The true storyline of JE exposure among humans and animals has not been documented in Malaysia. In some places such as Sarawak, JEV has been isolated from mosquitoes before an outbreak in 1992. JE is an epidemic in Malaysia except Sarawak. There are four major outbreaks reported in Pulau Langkawi (1974), Penang (1988), Perak and Negeri Sembilan (1998-1999), and Sarawak (1992). JE is considered endemic only in Sarawak. Initially, both adults and children were victims of JE in Malaysia, however, according to the current reports; JE infection is only lethal to children in Malaysia. This paper describes a timeline of JE cases (background of each case) from first detection to current status, vaccination programs against JE, diagnostic methods used in hospitals and factors which may contribute to the transmission of JE among humans and animals in Malaysia. Copyright © 2018. Published by Elsevier B.V.

U-Th dating of speleothems to investigate the evolution of limestone caves in the Gunung Mulu National Park, Sarawak, Malaysia

OpenAIRE

Moseley, Gina E.; Richards, David A.; Smith, Christopher; Smart, Peter L.; Hoffmann, Dirk L.; Farrant, Andrew R.

2013-01-01

The Gunung Mulu National Park, Sarawak, Malaysia has been a focus of scientific research and exploration for several decades. Previous work investigated the relationship between fluvial incision into the limestone massif and the chronological evolution of the 500m-deep network of cave passages. This study involved analyses of newly available speleothem material using state-of-the-art U-Th dating methods and assessment of the potential for extension of the chronological record using U-Pb datin...

Trends analysis of rainfall and rainfall extremes in Sarawak, Malaysia using modified Mann-Kendall test

Science.gov (United States)

Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun

2017-11-01

This study assesses the spatial pattern of changes in rainfall extremes of Sarawak in recent years (1980-2014). The Mann-Kendall (MK) test along with modified Mann-Kendall (m-MK) test, which can discriminate multi-scale variability of unidirectional trend, was used to analyze the changes at 31 stations. Taking account of the scaling effect through eliminating the effect of autocorrelation, m-MK was employed to discriminate multi-scale variability of the unidirectional trends of the annual rainfall in Sarawak. It can confirm the significance of the MK test. The annual rainfall trend from MK test showed significant changes at 95% confidence level at five stations. The seasonal trends from MK test indicate an increasing rate of rainfall during the Northeast monsoon and a decreasing trend during the Southwest monsoon in some region of Sarawak. However, the m-MK test detected an increasing trend in annual rainfall only at one station and no significant trend in seasonal rainfall at any stations. The significant increasing trends of the 1-h maximum rainfall from the MK test are detected mainly at the stations located in the urban area giving concern to the occurrence of the flash flood. On the other hand, the m-MK test detected no significant trend in 1- and 3-h maximum rainfalls at any location. On the contrary, it detected significant trends in 6- and 72-h maximum rainfalls at a station located in the Lower Rajang basin area which is an extensive low-lying agricultural area and prone to stagnant flood. These results indicate that the trends in rainfall and rainfall extremes reported in Malaysia and surrounding region should be verified with m-MK test as most of the trends may result from scaling effect.

Cost estimation of a standalone photovoltaic power system in remote areas of Sarawak, Malaysia

International Nuclear Information System (INIS)

Jakhrani, A.Q.; Othman, A.K.; Rigit, A.R.H.; Samo, S.R.

2012-01-01

This paper aims to estimate the anticipated costs incurred from a standalone solar photovoltaic power system for the supply of electricity to the rural community in Sarawak, Malaysia. The life cycle cost analysis with net present value technique was employed for the evaluation of cost system. It was found that purchasing of solar photovoltaic components and the system installation cost will contribute 63% of the total investment and future anticipated costs will add to the remaining. Recurring cost will make 25% and components replacements 75% of future anticipated costs. It was discovered that the power generated from the solar photovoltaic system would be 38 times more expensive than electricity produced from the conventional sources. However, its installation in remote areas could be favourable where the grid-connected power supply is not accessible. (author)

Over two decades of Plasmodium knowlesi infections in Sarawak: Trend and forecast.

Science.gov (United States)

Ooi, Choo Huck; Bujang, Mohamad Adam; Tg Abu Bakar Sidik, Tg Mohd Ikhwan; Ngui, Romano; Lim, Yvonne Ai-Lian

2017-12-01

Malaria is still of great public health concern, especially in Malaysian Borneo. The aim of this study was to determine the trends of P. knowlesi infection in Sarawak, Malaysia and to forecast the incidence of P. knowlesi until the year 2040. Data on P. knowlesi malaria cases from 1992 to the year 2014 were obtained from the Sarawak Health Department, Malaysia. ARIMA model was applied to forecast the future incidence of P. knowlesi infection. The data for the whole of Sarawak and subsequently the selected six districts which have high incidence rates of P. knowlesi infection were analyzed. Results of the analysis showed that there was an increasing trend of P. knowlesi cases from the year 1992-2014 (p<0.001). The trend in the incidence started to increase in the year 2008 (p=0.029). The incidence rate per 100,000 populations was between 4.15 in the year 1992 and 42.03 in the year 2014. High incidence of P. knowlesi infections has been detected in the districts adjacent to each other within the interior region of Sarawak. The forecasted incidence and incidence rate per 100,000 populations in the year 2020 were 1229 and 44.04, respectively, while those in the year 2040 were 2056 and 62.91, respectively. The forecasted incidence showed an upward trend highlighting an urgent need to draw up strategic and holistic prevention plans to limit further the increase in P. knowlesi morbidity and mortality in Sarawak. It is imperative that these measures are customized taking into consideration the challenges faced in the interior areas of Sarawak and the behavior of the main vector of P. knowlesi (i.e., An. latens) in Sarawak. Copyright © 2017 Elsevier B.V. All rights reserved.

A study of palm biomass processing strategy in Sarawak

Science.gov (United States)

Lee, S. J. Y.; Ng, W. P. Q.; Law, K. H.

2017-06-01

In the past decades, palm industry is booming due to its profitable nature. An environmental concern regarding on the palm industry is the enormous amount of waste produced from palm industry. The waste produced or palm biomass is one significant renewable energy source and raw material for value-added products like fiber mats, activated carbon, dried fiber, bio-fertilizer and et cetera in Malaysia. There is a need to establish the palm biomass industry for the recovery of palm biomass for efficient utilization and waste reduction. The development of the industry is strongly depending on the two reasons, the availability and supply consistency of palm biomass as well as the availability of palm biomass processing facilities. In Malaysia, the development of palm biomass industry is lagging due to the lack of mature commercial technology and difficult logistic planning as a result of scattered locality of palm oil mill, where palm biomass is generated. Two main studies have been carried out in this research work: i) industrial study of the feasibility of decentralized and centralized palm biomass processing in Sarawak and ii) development of a systematic and optimized palm biomass processing planning for the development of palm biomass industry in Sarawak, Malaysia. Mathematical optimization technique is used in this work to model the above case scenario for biomass processing to achieve maximum economic potential and resource feasibility. An industrial study of palm biomass processing strategy in Sarawak has been carried out to evaluate the optimality of centralized processing and decentralize processing of the local biomass industry. An optimal biomass processing strategy is achieved.

Alteration mineral mapping using ETM+ and hyperion remote sensing data at Bau Gold Field, Sarawak, Malaysia

International Nuclear Information System (INIS)

Pour, A B; Hashim, M

2014-01-01

The area under investigation is the Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo. It has tropical climate with limited bedrock exposures. Bau is a gold field similar to Carlin style gold deposits. Geological analyses coupled with remote sensing data were used to detect hydrothermally altered rocks associated with gold mineralization. The Landsat Enhanced Thematic Mapper + (ETM + ) and Hyperion data were used to carry out mineral mapping of mineralized zones in the study area and surrounding terrain. Directed Principal Components Analysis (DPCA) transformation of four appropriate ETM+ band ratios were applied to produce DPC images, allowing the removal of the effects of vegetation from ETM+ data and the detection of separate mineral images at a regional scale. Linear Spectral Unmixing (LSU) was used to produce image maps of hydroxyl-bearing minerals using Hyperion data at a district scale. Results derived from the visible and near infrared and shortwave infrared bands of Hyperion represented iron oxide/hydroxide and clay minerals rich zones associated with the known gold prospects in the Bau district. The results show that the known gold prospects and potentially interesting areas are recognizable by the methods used, despite limited bedrock exposure in this region and the constraints imposed by the tropical environment. The approach used in this study can be more broadly applicable to provide an opportunity for detecting potentially interesting areas of gold mineralization using the ETM + and Hyperion data in the tropical/sub-tropical regions

Alteration mineral mapping using ETM+ and hyperion remote sensing data at Bau Gold Field, Sarawak, Malaysia

Science.gov (United States)

Pour, A. B.; Hashim, M.

2014-02-01

The area under investigation is the Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo. It has tropical climate with limited bedrock exposures. Bau is a gold field similar to Carlin style gold deposits. Geological analyses coupled with remote sensing data were used to detect hydrothermally altered rocks associated with gold mineralization. The Landsat Enhanced Thematic Mapper+ (ETM+) and Hyperion data were used to carry out mineral mapping of mineralized zones in the study area and surrounding terrain. Directed Principal Components Analysis (DPCA) transformation of four appropriate ETM+ band ratios were applied to produce DPC images, allowing the removal of the effects of vegetation from ETM+ data and the detection of separate mineral images at a regional scale. Linear Spectral Unmixing (LSU) was used to produce image maps of hydroxyl-bearing minerals using Hyperion data at a district scale. Results derived from the visible and near infrared and shortwave infrared bands of Hyperion represented iron oxide/hydroxide and clay minerals rich zones associated with the known gold prospects in the Bau district. The results show that the known gold prospects and potentially interesting areas are recognizable by the methods used, despite limited bedrock exposure in this region and the constraints imposed by the tropical environment. The approach used in this study can be more broadly applicable to provide an opportunity for detecting potentially interesting areas of gold mineralization using the ETM+ and Hyperion data in the tropical/sub-tropical regions.

Assessment of the Water and Sediment Quality of Tropical Forest Streams in Upper Reaches of the Baleh River, Sarawak, Malaysia, Subjected to Logging Activities

Directory of Open Access Journals (Sweden)

Teck-Yee Ling

2016-01-01

Full Text Available The study of the impact of logging activities on water and sediment quality of Sarawak forest streams is still scarce despite Sarawak being the largest exporter of timber in Malaysia. This study was aimed at determining the water and sediment quality of forest streams in Sarawak and the potential impact of logging activities. In situ parameters were measured, and water and sediment samples were collected at six stations before rain. Additionally, water quality was investigated at three stations after rain. The results showed that canopy removal resulted in large temperature variation and sedimentation in the forest streams. Lower suspended solids were found at stations with inactive logging (<2 mg/L compared to active logging (10–16 mg/L activities. The highest concentration of total nitrogen and total phosphorus in water and sediment was 4.4 mg/L, 77.6 μg/L, 0.17%, and 0.01%, respectively. Besides, significantly negative correlation of sediment nitrogen and water total ammonia nitrogen indicated the loss of nitrogen from sediment to water. Water quality of the streams deteriorated after rain, in particular, suspended solids which increased from 8.3 mg/L to 104.1 mg/L. This study reveals that logging activities have an impact on the water quality of Sarawak forest streams particularly in rainfall events.

Soil erosion from shifting cultivation and other smallholder land use in Sarawak, Malaysia

DEFF Research Database (Denmark)

Neergaard, Andreas de; Magid, Jakob; Mertz, Ole

2008-01-01

to compare soil erosion from three land use types in a shifting cultivation system, namely upland rice, pepper gardens and native forest. We used two sample sites within the humid tropical lowland zone in Sarawak, Malaysia. Both areas had steep slopes between 25° and 50°, and were characterised by a mosaic...... land use of native forest, secondary re-growth, upland rice fields and pepper gardens. Soil samples were collected to 90 cm depth from all three land use types, and analysed for various chemical parameters, including texture, total organic matter and 137Cs content. 137Cs is a radioactive isotope...... in the upper soil layers, are unlikely to change the carbon inventory dramatically. 137Cs content in the soil profile indicated largest retention of original topsoil in the native forest plots, and a loss of 18 and 35% of topsoil from upland rice and pepper gardens, respectively, over the past 40 years. When...

Soil carbon stocks in Sarawak, Malaysia.

Science.gov (United States)

Padmanabhan, E; Eswaran, H; Reich, P F

2013-11-01

The relationship between greenhouse gas emission and climate change has led to research to identify and manage the natural sources and sinks of the gases. CO2, CH4, and N2O have an anthropic source and of these CO2 is the least effective in trapping long wave radiation. Soil carbon sequestration can best be described as a process of removing carbon dioxide from the atmosphere and relocating into soils in a form that is not readily released back into the atmosphere. The purpose of this study is to estimate carbon stocks available under current conditions in Sarawak, Malaysia. SOC estimates are made for a standard depth of 100 cm unless the soil by definition is less than this depth, as in the case of lithic subgroups. Among the mineral soils, Inceptisols tend to generally have the highest carbon contents (about 25 kg m(-2) m(-1)), while Oxisols and Ultisols rate second (about 10-15 kg m(-2) m(-1)). The Oxisols store a good amount of carbon because of an appreciable time-frame to sequester carbon and possibly lower decomposition rates for the organic carbon that is found at 1m depths. Wet soils such as peatlands tend to store significant amounts of carbon. The highest values estimated for such soils are about 114 kg m(-2) m(-1). Such appreciable amounts can also be found in the Aquepts. In conclusion, it is pertinent to recognize that degradation of the carbon pool, just like desertification, is a real process and that this irreversible process must be addressed immediately. Therefore, appropriate soil management practices should be instituted to sequester large masses of soil carbon on an annual basis. This knowledge can be used effectively to formulate strategies to prevent forest fires and clearing: two processes that can quickly release sequestered carbon to the atmosphere in an almost irreversible manner. Copyright © 2013 Elsevier B.V. All rights reserved.

Activity concentrations of 239+240 Pu in sediment at Sabah and Sarawak coastal areas

International Nuclear Information System (INIS)

Jalal Sharib; Zaharudin Ahmad; Yii Mei Wo; Hidayah Shahar

2009-01-01

The coastal sediment sampling was carried out in July 2004 as part of the Marine Radioactivity Database Development Project for Malaysia. The determination of plutonium, 239+240 Pu activity concentration and their distributions along the coastal areas of Sabah and Sarawak was by the alpha spectrometry counting system. Prior to counting, the radionuclides were isolated from the samples using radiochemical separation technique and mounted on a stainless steel disc by using electro-deposition. The results show that the distribution of 239+240 Pu activity concentration in coastal sediment is consistent, ranging from BDL - 1.83 Bq/kg and 0.11 - 0.84 Bq/kg dry weight, respectively. Lubok Sabanan, SB 15, in Sabah and Sungai Similajau, SR 13, in Sarawak were sampling stations that gave highest 239+240 Pu activity concentration. Overall, the 239+240 Pu activity concentration of Sabah and Sarawak are slightly higher in comparison the West Coast coastal stations of Peninsular Malaysia, and can be used as database. (Author)

The identity of the semiterrestrial crab Terrathelphusa kuchingensis (Nobili, 1901) (Crustacea: Decapoda: Brachyura: Gecarcinucidae), with descriptions of four new species from southwestern Sarawak, Borneo, Malaysia.

Science.gov (United States)

Grinang, Jongkar; Ng, Peter K L

2015-04-10

Four new species of semiterrestrial gecarcinucid crabs are described from limestone and sandstone habitats in southwestern Sarawak, Malaysia: Terrathelphusa aglaia n. sp., T. cerina n. sp., T. kundong n. sp., and T. mas n. sp. The taxonomy of T. kuchingensis (Nobili, 1901) is discussed, its precise identity ascertained from fresh material, and its actual distribution determined. This increases the number of Terrathelphusa species in Borneo to eight.

Exploring strategies to overcome extra-organisational challenges faced by community pharmacies in Sarawak, Malaysia.

Science.gov (United States)

Kho, Boon Phiaw; Hassali, Mohamed Azmi; Lim, Ching Jou; Saleem, Fahad

2018-03-15

The aims of this research were to determine extra-organisational challenges (e.g. market competition, governing policies) faced by community pharmacies in Sarawak, the coping strategies employed to deal with these challenges and explore potential legislative changes that can attenuate the intensity of these challenges. Survey questionnaires (n = 184) were posted to all eligible community pharmacies in Sarawak, Malaysia. The questionnaire included sections on participants' demographic data, extra-organisational challenges faced, coping strategies employed and proposals to improve community pharmacy legislations. Items were constructed based on the findings of a prior qualitative research supplemented with relevant literature about these issues. High levels of homogeneity in responses were recorded on various extra-organisational challenges faced, particularly those economy-oriented. Strategic changes to counter these challenges were focused on pricing and product stocked, rather than services provision. Highly rated strategies included increasing discounts for customers (n = 54; 68%) and finding cheaper suppliers (n = 70; 88%). Legislative changes proposed that might increase their share of the pharmaceutical market were strongly supported by respondents, particularly about making it compulsory for general practitioners to provide patients the option to have their medicines dispensed in community pharmacies (n = 72; 90%). Current legislative conditions and Malaysian consumer mindset may have constrained the strategic choices of community pharmacies to deal with the strong extra-organisational challenges. A long-term multipronged approach to address these issues and increased involvement of community pharmacists themselves in this agenda are required to influence practice change. © 2018 Royal Pharmaceutical Society.

Statistical analysis of trends in monthly precipitation at the Limbang River Basin, Sarawak (NW Borneo), Malaysia

Science.gov (United States)

Krishnan, M. V. Ninu; Prasanna, M. V.; Vijith, H.

2018-05-01

Effect of climate change in a region can be characterised by the analysis of rainfall trends. In the present research, monthly rainfall trends at Limbang River Basin (LRB) in Sarawak, Malaysia for a period of 45 years (1970-2015) were characterised through the non-parametric Mann-Kendall and Spearman's Rho tests and relative seasonality index. Statistically processed monthly rainfall of 12 well distributed rain gauging stations in LRB shows almost equal amount of rainfall in all months. Mann-Kendall and Spearman's Rho tests revealed a specific pattern of rainfall trend with a definite boundary marked in the months of January and August with positive trends in all stations. Among the stations, Limbang DID, Long Napir and Ukong showed positive (increasing) trends in all months with a maximum increase of 4.06 mm/year (p = 0.01) in November. All other stations showed varying trends (both increasing and decreasing). Significant (p = 0.05) decreasing trend was noticed in Ulu Medalam and Setuan during September (- 1.67 and - 1.79 mm/year) and October (- 1.59 and - 1.68 mm/year) in Mann-Kendall and Spearman's Rho tests. Spatial pattern of monthly rainfall trends showed two clusters of increasing rainfalls (maximas) in upper and lower part of the river basin separated with a dominant decreasing rainfall corridor. The results indicate a generally increasing trend of rainfall in Sarawak, Borneo.

Sense of Efficacy among Beginning Teachers in Sarawak

Science.gov (United States)

Murshidi, Rahmah; Konting, Mohd Majid; Elias, Habibah; Fooi, Foo Say

2006-01-01

This study examined the level of teachers' sense of efficacy among beginning teachers in Sarawak, Malaysia. It also sought to investigate whether there is any difference in beginning teachers' sense of efficacy in relation to gender, race and types of teacher preparation program. The study was conducted by using the teacher sense of efficacy…

The menopausal experience among indigenous women of Sarawak, Malaysia.

Science.gov (United States)

Syed Alwi, S A R; Lee, P Y; Awi, I; Mallik, P S; Md Haizal, M N

2009-12-01

To document the common menopausal symptoms and quality of life in indigenous women of Sarawak in Malaysia. A face-to-face interview using the Menopause-specific Quality of Life questionnaire was conducted with 276 indigenous Sarawakian women aged 40-65 years to determine the mean age of menopause and common symptoms (divided into vasomotor, psychosocial, physical and sexual domains) associated with menopause. The mean age at menopause of postmenopausal women was 50.78 +/- 2.47 years (range 47.3-58.2 years). The most common symptoms reported were aching in muscles and joints (82.6%), lack of energy (77.5%) and low backache (77.2%). The typical menopausal symptoms of hot flushes, night sweats, sweating and vaginal dryness were experienced by 42.4%, 34.8%, 29.7% and 49.3%, respectively of the women studied. Perimenopausal women (n = 114) experienced the most physical and psychosocial symptoms, while postmenopausal women (n = 102) experienced most sexual symptoms. Perimenopausal and postmenopausal women were reported to suffer more than premenopausal women (p < 0.001) within the four domains of symptoms (vasomotor, psychosocial, physical and sexual). The menopausal symptoms in this study correspond to those in other studies on Asian women but the prevalence of typical and classical menopausal symptoms was lower compared to studies on Caucasian women. The perimenopausal women had the most significant decrease in quality of life, followed by postmenopausal women and premenopausal women. Vasomotor symptoms had a predominant influence on the quality of life.

Applicability of the stages of change and Weight Efficacy Lifestyle Questionnaire with natives of Sarawak, Malaysia.

Science.gov (United States)

Chang, C T

2007-01-01

There is an increase in the prevalence of overweight and obesity in Malaysia. Besides prevalence studies, not much is known about either overweight or obese individuals. The objective of this study was to determine the stages of change in losing weight and the self-efficacy in eating control of three indigenous groups of overweight and obese adults in Sarawak, Malaysia. A cross-sectional study was conducted in one rural region in Sarawak using a purposive sample. A structured questionnaire, which included two scales: (1) Weight: Stages of change (SOC) to assess readiness to change; and (2) Weight Efficacy Lifestyle Questionnaire (WEL) (both adopted from the transtheoretical model of change); and a set of pre-tested questionnaires on socio-demographic data, the presence of health problems and self-assessment of weight appropriateness, was used to interview respondents. The stage distribution for weight loss of these adults respondents (n = 271) showed that 60.5% (n = 164) were in the pre-contemplation stage, 20.7% (n = 56) were in the contemplation stage, 8.5% (n = 23) were in the preparation stage, and 8.9% (n = 24) were in the action stage, while only 1.5% (n = 4) were in the maintenance stage. Except for education, the stage differences were generally stable across age, sex, race, household income, presence or absence of health problem, self-perceived weight and presence of overweight or obesity. Respondents were least able to control their eating under social pressure and food availability, according to their WEL score. A large proportion of the overweight or obese adults was not intending to lose weight. The factor structure of the two WEL original subscales enabled partial differentiation between respondents who were able or unable to resist eating in situations where there were availability of food and experienced physical discomfort. The study results indicate the importance of assessing individuals' SOC score in order to implement stage-matched intervention

Malaysia power

Energy Technology Data Exchange (ETDEWEB)

Husin, Z.A. (Tenaga Nasional Berhad (Malaysia))

1994-09-01

Describes the organisation of the Malaysian electric power industry and the role of natural gas and coal in power generation in the country. At present, electricity is produced by three utilities: Tenaga Nasional Berhad (TNB) which was fully privatised in May 1992 with the Government holding about 73% of the equity, Sarawak Electricity Supply Corporation (SESCO) which the Government plans to privatise soon, and Sabah Electricity Board (SEB). These have installed capacities of 7000 MW, 400 MW and 350 MW, respectively. Five independent power producers have been given licences to build, own and operate power plants with a total installed capacity of 4000 MW. Natural gas is expected to account for about 72% of Malaysia's power generating fuel by the year 2010, compared to about 50% at present. Malaysia currently has only one coal-fired plant, but its expansion is in the final stage of contract awards. A number of small capacity coal-fired plants are being planned for Sabah and Sarawak where the bulk of Malaysia's coal resources are located. 3 figs., 1 photo.

Systematic studies of Bornean Zingiberaceae V. Zingiberoideae of Lambir Hills, Sarawak

NARCIS (Netherlands)

Sakai, S.; Nagamasu, H.

2006-01-01

This paper reports the subfamily Zingiberoideae (Zingiberaceae) of Lambir Hills National Park, Sarawak, Malaysia. Twelve species representing Boesenbergia, Globba, and Zingiber are recorded. Systematic and ecological notes are provided, and the key to the Bornean species of Boesenbergia is updated.

Analysis of three polymorphisms in Bidayuh ethnic of Sarawak ...

African Journals Online (AJOL)

Insertion/deletion polymorphism of YAP (DYS287), M96 and M120 polymorphisms in Bidayuh ethnic populations of Sarawak, Malaysia were analyzed in this study. Genomic DNA was extracted from 180 buccal samples and amplified by Hot-Start PCR method. The amplified PCR products were separated by using 2% ...

Malaysia

International Nuclear Information System (INIS)

2002-10-01

This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

Structural geology mapping using PALSAR data in the Bau gold mining district, Sarawak, Malaysia

Science.gov (United States)

Pour, Amin Beiranvand; Hashim, Mazlan

2014-08-01

The application of optical remote sensing data for geological mapping is difficult in the tropical environment. The persistent cloud coverage, dominated vegetation in the landscape and limited bedrock exposures are constraints imposed by the tropical climate. Structural geology investigations that are searching for epithermal or polymetallic vein-type ore deposits can be developed using Synthetic Aperture Radar (SAR) remote sensing data in tropical/sub-tropical regions. The Bau gold mining district in the State of Sarawak, East Malaysia, on the island of Borneo has been selected for this study. The Bau is a gold field similar to Carlin style gold deposits, but gold mineralization at Bau is much more structurally controlled. Geological analyses coupled with the Phased Array type L-band Synthetic Aperture Radar (PALSAR) remote sensing data were used to detect structural elements associated with gold mineralization. The PALSAR data were used to perform lithological-structural mapping of mineralized zones in the study area and surrounding terrain. Structural elements were detected along the SSW to NNE trend of the Tuban fault zone and Tai Parit fault that corresponds to the areas of occurrence of the gold mineralization in the Bau Limestone. Most of quartz-gold bearing veins occur in high-angle faults, fractures and joints within massive units of the Bau Limestone. The results show that four deformation events (D1-D4) in the structures of the Bau district and structurally controlled gold mineralization indicators, including faults, joints and fractures are detectable using PALSAR data at both regional and district scales. The approach used in this study can be more broadly applicable to provide preliminary information for exploration potentially interesting areas of epithermal or polymetallic vein-type mineralization using the PALSAR data in the tropical/sub-tropical regions.

Serological Prevalence of Leptospirosis Among Rural Communities in the Rejang Basin, Sarawak, Malaysia.

Science.gov (United States)

Suut, Lela; Mazlan, Mohamad Nur-Azim; Arif, Mohamad Taha; Yusoff, Haironi; Abdul Rahim, Nor-Aliza; Safii, Razitasham; Suhaili, Mohamad Raili

2016-07-01

Leptospirosis is an important zoonotic disease globally and is endemic in Malaysia. A study was conducted in the Rejang basin of Sarawak from June 2011 to May 2013 to determine the seroprevalence of leptospirosis among the communities and dominant infecting Leptospira serovars. A total of 508 human sera were analyzed using ELISA and the microscopic agglutination test (MAT). The seroprevalence of leptospirosis in the study area was 37.4%, with the highest prevalence in Kapit division. More women were positive for leptospirosis (59.5%), and the mean age of seropositive individuals was 42.2 (SD = 18.7) years. Antibody titers between 1:50 and 1:1600 were reported, and serovars djasiman (22.1%), shermani (13.2%), and pomona (7.9%) predominated, with varied distribution between geographical locations. This study highlighted the endemicity and diversity of existing Leptospira serovars within the community. This information should be communicated to local health personnel and communities at risk, and rapid diagnostic capability should be made available to local health facilities. © 2016 APJPH.

Critical factors of implementing Industrialised Building System in Sarawak: A research on SMEs

Science.gov (United States)

Hadi, N. A.; Muhamad, W. M. N. W.; Othman, M. K. F.

2017-05-01

Industrialised Building System (IBS) have been adopted in Malaysia for over five decades and is expected to grow consistent with Malaysia's economic development. In promoting the adoption of IBS in construction projects, the government has taken several steps such as levy exemption for contractors and developers. Despite its numerous advantages and efforts pulled by the government, the implementation and adoption of IBS are still below the expected figure. Many researchers investigated readiness, setbacks and issues related to the implementation of IBS in Malaysia's construction projects. However, most of the research mainly for projects located in urban areas of West Malaysia. Therefore, this paper aims to close the gap on factors affecting the implementation of IBS for SMEs in Sarawak, where the level urbanisation is low. A semi-structured interview was conducted with 10 SME's contractors to get better insight view. The study found that logistics and infrastructure problems, a limited number of the manufacturer, lack of incentive, conventional payment methods, lack of financial supports are among critical factors affecting the implementation of IBS. Therefore, it was concluded that government plays major role in providing supports, incentives and facilitating the improvement of infrastructure to successfully implementing IBS in Sarawak.

Methane emissions from paddy cultivation and livestock farming in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Peng E.K.

2017-01-01

Full Text Available In this study, implementation of Tier 1 methodology of 2006 IPCC (Intergovernmental Panel on Climate Change Guidelines in paddy cultivation and livestock farming has been applied to estimate methane emissions in Sarawak, Malaysia within the years from 1998 to 2009. Methane emission inventory has been developed in this study, based on volume 4, 2006 IPCC Guidelines. Based on cultivation area and livestock population data as input to Tier 1 methodology, variations in paddy cultivation area and amount of livestock has been identified as the main contributor to emissions of methane. Methane emissions increased from 1.61 to 1.72 Gg CH4/year during 1998 to 1999. Based on results obtained, the outcomes show that there would be a significant drop of methane emission from buffalo and sheep. Although there are gain and loss in emissions from enteric fermentation, drastic reduction is observed from 0.65 Gg CH4/year in 1998 to 0.44 Gg CH4/year in 2009 as well as 0.05 Gg CH4/year to 0.02 Gg CH4/year for buffalo and sheep respectively. Simultaneously, methane emissions from manure management of buffalo has decreased from 0.024 Gg CH4/year in 1998 to 0.016 Gg CH4/year in 2009 while for sheep, its emission from manure management dropped from 0.002 Gg CH4/year in 1998 to 0.0007 Gg CH4/year in 2009. Overall emission from paddy cultivation can be considered in upward trend due to gain from 1998 at 1.61 Gg CH4/year to 1.67 Gg CH4/year in 2009. As an addition, significant rise in methane emission by 0.24 Gg CH4/year from 2000 to 2006 as well as 0.1 Gg CH4/year from 2007 to 2009 show momentum gaining in enteric fermentation of cattle. It also indicates future increment in methane emission from cattle which coherently affects the state’s emission level. As for emissions from manure management, emissions from cattle, goat and deer are gaining momentum in Sarawak.

Peat in Malaysia

Energy Technology Data Exchange (ETDEWEB)

Ambak, K. [MARDI - Integrated Peat Research Station, Johor (Malaysia); Ah Chye, L. [MARDI Jalan Kebun, Selangor (Malaysia). Vegetable Research Centre

1996-12-31

Malaysian peatlands occur mostly in the water-saturated basins of the coastal lowlands. They are approximately 25 000 km{sup 2} in extent, of which about 10 000 km{sup 2} are in Peninsular Malaysia and another 15 000 km{sup 2} are distributed in Sarawak and Sabah. In Peninsular Malaysia, peatland classification is based mainly on peat depth and loss on ignition. In Sarawak, a more comprehensive approach is adopted, based on peat depth and the type of underlying mineral materials. As for Sabah, the classification follows FAD/UNESCO guidelines. Malaysian peatland is utilised mainly for agriculture. At present, about 32 % of the peatland area in Peninsular Malaysia is used for this purpose. In Sarawak, a much smaller percentage is used for agriculture. The main crops grown are oil-palm, rubber, coconut, padi and pineapple. Based on {sup 14}C datings, it has been estimated that peat in this region began to form between 4 000 and 5 000 years ago. The overall rate of accumulation of the peat since its initial formation has been about 2.81 mm ye` whereas the average rate during the early stages of formation ( 12-10 m) was 4.76 mm ye. In the intermediate stage (10-5 m), the average annual accumulation rate decreased to 3.14 mm, and to 2.22 mm in the final phase (5 m to the surface). (orig.) (17 refs.)

Checklist of Gastropods from the Exclusive Economic Zone (EEZ), Sarawak, Malaysia.

Science.gov (United States)

Morni, Wan Zabidii Wan; Rahim, Siti Akmar Khadijah Ab; Rumpet, Richard; Musel, Jamil; Hassan, Ruhana

2017-01-01

This study provides the first marine gastropod checklist from the Sarawak Exclusive Economic Zone (EEZ). Gastropod samples were collected from selected stations in the Sarawak EEZ using an otter trawl net with a stretched mesh size of 38 mm at the cod end. The trawling operations were conducted more than 12 nautical miles from the coast, and the area was divided into three depth strata: I) 20-50 m, II) 50-100 m and III) 100-200 m. A total of 23 gastropod species were identified during the two-month sampling period from 16 August until 6 October 2015, representing 8 superfamilies, 15 families and 20 genera. Superfamily Tonnoidea was represented by 7 species, followed by Muricoidea (5 species), Cypraeoidea (4 species), and Buccinoidea and Conoidea (both with 2 species). Other superfamilies were represented by a single species. Only 3 species were obtained in 2 depth strata, namely Melo melo , Murex aduncospinosus and Tonna galea . In addition, 9, 13 and 4 species of gastropods were found in strata I, II and III, respectively. The information on gastropod distributions at different depth strata in the Sarawak EEZ could be useful in updating the Malaysian species diversity database.

Mercury pollution in Malaysia.

Science.gov (United States)

Hajeb, Parvaneh; Jinap, S; Ismail, Ahmad; Mahyudin, Nor Ainy

2012-01-01

Although several studies have been published on levels of mercury contamination of the environment, and of food and human tissues in Peninsular Malaysia, there is a serious dearth of research that has been performed in East Malaysia (Sabah and Sarawak). Industry is rapidly developing in East Malaysia, and, hence, there is a need for establishing baseline levels of mercury contamination in environmental media in that part of the country by performing monitoring studies. Residues of total mercury and inorganic in food samples have been determined in nearly all previous studies that have been conducted; however, few researchers have analyzed samples for the presence of methlymercury residues. Because methylmercury is the most toxic form of mercury, and because there is a growing public awareness of the risk posed by methylmercury exposure that is associated with fish and seafood consumption, further monitoring studies on methylmercury in food are also essential. From the results of previous studies, it is obvious that the economic development in Malaysia, in recent years, has affected the aquatic environment of the country. Primary areas of environmental concern are centered on the rivers of the west Peninsular Malaysian coast, and the coastal waters of the Straits of Malacca, wherein industrial activities are rapidly expanding. The sources of existing mercury input to both of these areas of Malaysia should be studied and identified. Considering the high levels of mercury that now exists in human tissues, efforts should be continued, and accelerated in the future, if possible, to monitor mercury contamination levels in the coastal states, and particularly along the west Peninsular Malaysian coast. Most studies that have been carried out on mercury residues in environmental samples are dated, having been conducted 20-30 years ago; therefore, the need to collect much more and more current data is urgent. Furthermore, establishing baseline levels of mercury exposure to

Malaysia; Malaisie

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-10-01

This document presents the energy profile of Malaysia: national organizations and energy policy (Economic Planning Unit (EPU), Ministry of Energy, Communication and Multi-media, Energy Commission); electric power companies: Tenaga National Brhd (TNB), Sarawak Electricity Supply Corporation (SESCO) and Sabah Electricity Sdn Bhd (SESB); petroleum companies: Petronas and Petronas Carigali; natural gas companies: Petronas Gas Sdn Bhd (PGSB), Malaysia LNG Ltd, Gas Malaysia Sdn Bhd and Sabah Energy Corporation (SEC) as public utility; supplies (resources, electric power, oil and gas); prices; consumption; stakes and perspectives (combined cycle power plants, Trans Thai Malaysia pipeline, refineries, Asean Grid Power project of interconnected power grids, Trans Asean Gas Pipeline (TAGP) project of interconnected gas networks, Bakun dam). (J.S.)

Metal concentrations in sediments from tourist beaches of Miri City, Sarawak, Malaysia (Borneo Island).

Science.gov (United States)

Nagarajan, R; Jonathan, M P; Roy, Priyadarsi D; Wai-Hwa, L; Prasanna, M V; Sarkar, S K; Navarrete-López, M

2013-08-15

Forty-three sediment samples were collected from the beaches of Miri City, Sarawak, Malaysia to identify the enrichment of partially leached trace metals (PLTMs) from six different tourist beaches. The samples were analyzed for PLTMs Fe, Mn, Cr, Co, Cu, Ni, Pb, Sr and Zn. The concentration pattern suggest that the southern side of the study area is enriched with Fe (1821-6097 μg g(-1)), Mn (11.57-90.22 μg g(-1)), Cr (51.50-311 μg g(-1)), Ni (18-51 μg g(-1)), Pb (8.81-84.05 μg g(-1)), Sr (25.95-140.49 μg g(-1)) and Zn (12.46-35.04 μg g(-1)). Compared to the eco-toxicological values, Cr>Effects range low (ERL), Lowest effect level (LEL), Severe effect level (SEL); Cu>Unpolluted sediments, ERL, LEL; Pb>Unpolluted sediments and Ni>ERL and LEL. Comparative results with other regions indicate that Co, Cr, Cu, Ni and Zn are higher, indicating an external input rather than natural process. Copyright © 2013 Elsevier Ltd. All rights reserved.

Leptospiral agglutinins in captive and free ranging non-human primates in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

S. Thayaparan

2014-06-01

Full Text Available Aim: The proposed study was carried out to determine the extent of exposure to leptospirosis in non-human primates. Materials and Methods: Trapping of non-human primates was carried out opportunistically around the Bako National Park and the Matang Wildlife Center in the vicinity of human settlements and tourism areas of Sarawak. Blood samples were obtained from the saphenous vein to determine the presence of antibodies by the Microscopic Agglutination Test (MAT to 17 serovars of Leptospira commonly found in Malaysia. Results: This study reports the screening of twelve primates (eight captive and four free ranging for leptospirosis. Eight of the 12 monkeys (66.6%; 95% CI 34.9-90.1 reacted against one or two serovars of Leptospira (Lai and Leptospira Lepto175. The serovar Lai is considered pathogenic for different mammals, including humans. Leptospira Lepto 175 has been identified as an intermediate strain and further studies are being undertaken on this serovar. Conclusion: These results are important as primates may act as reservoirs of Leptospira spp. for humans, which may potentially affect tourism (economic loss, conservation efforts and public health.

Optimization of a large integrated area development of gas fields offshore Sarawak, Malaysia

International Nuclear Information System (INIS)

Inyang, S.E.; Tak, A.N.H.; Costello, G.

1995-01-01

Optimizations of field development plans are routine in the industry. The size, schedule and nature of the upstream gas supply project to the second Malaysia LNG (MLNG Dua) plant in Bintulu, Sarawak made the need for extensive optimizations critical to realizing a robust and cost effective development scheme, and makes the work of more general interest. The project comprises the upstream development of 11 offshore fields for gas supply to MLNG Dua plant at an initial plateau production of 7.8 million tons per year of LNG. The gas fields span a large geographical area in medium water depths (up to 440 ft), and contain gas reserves of a distinctly variable gas quality. This paper describes the project optimization efforts aimed to ensure an upstream gas supply system effectiveness of over 99% throughout the project life while maintaining high safety and environmental standards and also achieving an economic development in an era of low hydrocarbon prices. Fifty percent of the first of the three phases of this gas supply project has already been completed and the first gas from these fields is scheduled to be available by the end of 1995

Refining clinical phenotypes by contrasting ethnically different populations with schizophrenia from Australia, India and Sarawak.

Science.gov (United States)

McLean, Duncan; John, Sujit; Barrett, Robert; McGrath, John; Loa, Peter; Thara, Rangaswamy; Mowry, Bryan

2012-04-30

We contrasted demographic and clinical characteristics in transethnic schizophrenia populations from Australia (n=821), India (n=520) and Sarawak, Malaysia (n=298) and proposed cultural explanations for identified site differences. From these we aimed to identify candidate variables free from significant cultural confounding that are hence suitable for inclusion in genetic analyses. We observed five phenomena: (1) more individuals were living alone in Australia than India or Sarawak; (2) drug use was lower in India than Australia or Sarawak; (3) duration of untreated psychosis (DUP) was longer in India than Australia or Sarawak; (4) the rate of schizoaffective disorder was lower in India than Australia or Sarawak; and (5) age at psychosis onset (AAO) was older in Sarawak than Australia or India. We suggest that site differences for living arrangements, drug use and DUP are culturally confounded. The schizoaffective site difference likely results from measurement bias. The AAO site difference, however, has no obvious cultural or measurement bias explanation. Therefore, this may be an ideal candidate for use in genetic studies, given that genetic variants affecting AAO have already been proposed. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Neglected Intestinal Parasites, Malnutrition and Associated Key Factors: A Population Based Cross-Sectional Study among Indigenous Communities in Sarawak, Malaysia.

Directory of Open Access Journals (Sweden)

Yamuna Rajoo

Full Text Available Intestinal parasitic infections (IPIs have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1-2.7; p = 0.002 and close contact with animals (OR = 1.8; 95% CI = 1.3-2.9; p = 0.027 as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2-3.0; p = 0.006 was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9-1.7; p = 0.024. Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8-22.2; p = 0.001 and underweight (OR = 1.9; 95% CI = 5.6-18.7; p = 0.037, respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous

Neglected Intestinal Parasites, Malnutrition and Associated Key Factors: A Population Based Cross-Sectional Study among Indigenous Communities in Sarawak, Malaysia.

Science.gov (United States)

Rajoo, Yamuna; Ambu, Stephen; Lim, Yvonne Ai Lian; Rajoo, Komalaveni; Tey, Siew Chang; Lu, Chan Woon; Ngui, Romano

2017-01-01

Intestinal parasitic infections (IPIs) have been recognized as one of the most significant causes of illness among disadvantaged communities. Many studies have been conducted on the prevalence of IPIs in Malaysia. However, these studies mostly focused on the indigenous groups in Peninsular Malaysia. The present study was conducted to provide the current baseline data on prevalence of IPIs, anaemia, malnutrition and associated risk factors among the indigenous communities in Sarawak, situation at northwest Borneo island of Malaysia. A cross sectional study was conducted among the longhouses communities. Stool samples were obtained and examined for the presence of IPIs using microscopy technique. Haemoglobin measurement was done using a portable haemoglobin analyzer. Malnutrition (i.e., stunting, underweight and wasting) was assessed using the WHO Anthro software. Statistical analysis was carried out using SPSS software. A total of 341participants took part in this study. The overall prevalence of IPIs was 57.5%. Multivariate analysis indicated that the absence of toilets (OR = 1.6; 95% CI = 1.1-2.7; p = 0.002) and close contact with animals (OR = 1.8; 95% CI = 1.3-2.9; p = 0.027) as significant predictors for IPIs. The incidence of anaemia was 36.4%. The incidence of underweight, wasting and stunting were 22.2%, 5.6% and 35.4%, respectively. Multivariate analysis demonstrated that low level of parental education attainment (OR = 1.9; 95% CI = 1.2-3.0; p = 0.006) was identified as significant predictor for anaemia. The incidence of wasting was significantly associated with mild anaemia (OR = 1.2; 95% CI = 0.9-1.7; p = 0.024). Low household income was identified as significant predictor for stunting (OR = 2.1; 95% CI = 9.8-22.2; p = 0.001) and underweight (OR = 1.9; 95% CI = 5.6-18.7; p = 0.037), respectively. Essentially, the present study highlighted that intestinal parasitic infections, anaemia and malnutrition are still prevalent among rural indigenous community

Variable impact of Malaysia's national language planning on non-Malay speakers in Sarawak Impacto variável do planejamento linguístico nacional da Malásia sobre não falantes do Malaio em Sarawak

Directory of Open Access Journals (Sweden)

Su-Hie Ting

2012-06-01

Full Text Available The study examined the impact of the national language policy on the language use of three main ethnic groups in the Malaysian state of Sarawak. The data analyzed was based on a sociolinguistic survey on language use in six domains that involved 937 Malay, Chinese and Iban adolescents from three major towns in Sarawak. The results showed that the use of Bahasa Malaysia exceeded English usage for all three ethnic groups, showing the success of compulsory education in the national language. However, the language planning has greater impact on the Iban than on the Chinese who are shifting away from the ethnic languages of the Chinese sub-groups to Mandarin Chinese. The availability of an alternative standard language with international standing which also functions as a symbol of cultural solidarity compromises the impact of the national language policy.Este estudo examinou o impacto da política de ensino da língua nacional de três principais grupos étnicos no estado malaio de Sarawak. Os dados analisados basearam-se em uma pesquisa sociolinguística sobre o uso da língua em seis domínios e envolveu 937 adolescentes malaios, chineses e Iban de três grandes cidades de Sarawak. Os resultados mostraram que o uso da língua Bahasa da Malásia superou o uso do inglês para todos os três grupos étnicos, comprovando o sucesso da escolaridade obrigatória em língua nacional. No entanto, o planejamento do estudo da língua tem maior impacto sobre o Iban do que sobre os chineses. Estes estão se afastando das línguas étnicas dos subgrupos chineses para o chinês Mandarim. A disponibilidade de uma língua alternativa padrão, com prestígio internacional, que também funciona como um símbolo de solidariedade cultural, compromete o impacto da política de ensino da língua nacional.

Borderlands and Tourism Development in Kalimantan Island: Kalimantan Barat, Indonesia - Sarawak, Malaysia 'Head to Head'

Directory of Open Access Journals (Sweden)

Syaiful Muazir

2013-12-01

Full Text Available As part of the regions that share lands and boundaries, Sarawak-Malaysia and Kalimantan Barat-Indonesia have respective characteristics in the borderlands treatment. This paper aims to explore and compare the border areas between two nations, ranging from the borderlands profiles, (tourism development and planning, and their opportunities. Besides, this paper also wants to highlight tourism development as one of the strategies. This paper uses documentary research to seek 'text and context' by narratively describing and compiling the documents. From the discussion, it can be seen that both regions have different characteristics of conditions and problems. For tourism development, different approaches are also 'colored' with timing, momentum, and priorities; as influenced and supported by the national plans. Tourism in the borderlands is the impetus in which each regions has already been aware of this potential because of the traction of informal flow, accessibility, supply, and demand. Furthermore, we argue that if tourism has exist at the first place, in the future, by its backward linkages, it will encourage more physical and economic development and cooperation between nations.

Two new species of diminutive leaf-litter skinks (Squamata: Scincidae: Tytthoscincus) from Gunung Penrissen, Sarawak, Malaysia (northern Borneo).

Science.gov (United States)

Karin, Benjamin R; Das, Indraneil; Bauer, Aaron M

2016-03-22

We describe two new species of skinks from Gunung Penrissen, Sarawak, Malaysia, in northern Borneo, Tytthoscincus batupanggah sp. nov. and T. leproauricularis sp. nov. Morphological and molecular analyses both corroborate the two new species as unique compared to all other Tytthoscincus and additional Sphenomorphus that are candidates for taxonomic placement in the genus Tytthoscincus. Despite their phenotypic similarity and sympatric distribution, a molecular analysis shows that the new species are not sister taxa and exhibit a deep genetic divergence between each of their respective sister taxa. We discuss how historical climatic and geographic processes may have led to the co-distribution of two relatively distantly related phenotypically similar species. In light of these discoveries, we also emphasize the importance of conserving primary montane tropical rainforest for maintaining species diversity.

Growth and reproductive performance of sambar deer in Sabal Forest Reserve of Sarawak, Malaysia.

Science.gov (United States)

Dahlan, Ismail; Dawend, Jiwan

2013-10-01

We examined the growth, reproduction, rutting behavior, and health status of sambar deer (Cervus unicolor brookei) in secondary Acacia mangium plantation. The data were collected over 11 years from a breeding herd of 21 stags and 33 hinds in Sabal Forest Reserve, Sarawak, Malaysia. Brody's growth model of the pooled data is Y t  = 148.56 (1 - 0.98e(-0.023t)), which estimates that maximum weights of adults are 184 and 115 kg for males and females respectively. Sambar deer are nonseasonal breeders with the breeding peak in February. Although the earliest age at which a female reached sexual maturity was 11 months, the mean age was 23 ± 7 months. Mean age of first fawning was 32 ± 8 months. Mean gestation period was 259 ± 12 days (n = 82). Stags shed antlers mostly between March and July. Velvet hardens at 103 ± 27 days (n = 23), and velvet harvesting is best at 7-9 weeks when antler length is 25-30 cm. Sambar deer are suitable as a farm species in forest plantations and have a vast potential to uplift rural living standards.

A new species of Leptolalax (Anura: Megophryidae) from Gunung Mulu National Park, Sarawak, East Malaysia (Borneo).

Science.gov (United States)

Dehling, J Maximilian; Matsui, Masafumi

2013-01-01

We describe a new species of Leptolalax from Gunung Mulu National Park in eastern Sarawak, Malaysian Borneo. The new species had been assigned to Leptolalax dringi and Leptolalax gracilis in the past. It is shown to differ from both these species and from all other species of the genus by a unique combination of morphological characters including large body size, rounded snout, interorbital distance being smaller than width of upper eyelid, bipartite subgular vocal sac in males, basal toe webbing, shagreened skin with tiny tubercles on dorsum and dorsal side of head, angled supratympanic fold, small pectoral glands, absence of supraaxillary glands and ventrolateral glandular ridges, spotted venter, advertisement call consisting of long series of 8-289 notes, each composed of three or four pulses, and dominant frequency at 7225-9190 Hz, with prominent frequency modulation.

Burkholderia vietnamiensis isolated from root tissues of Nipa Palm (Nypa fruticans) in Sarawak, Malaysia, proved to be its major endophytic nitrogen-fixing bacterium.

Science.gov (United States)

Tang, Sui-Yan; Hara, Shintaro; Melling, Lulie; Goh, Kah-Joo; Hashidoko, Yasuyuki

2010-01-01

Root-associating bacteria of the nipa palm (Nypa fruticans), preferring brackish-water affected mud in Sarawak, Malaysia, were investigated. In a comparison of rhizobacterial microbiota between the nipa and the sago (Metroxylon sagu) palm, it was found that the nipa palm possessed a group of Burkholderia vietnamiensis as its main active nitrogen-fixing endophytic bacterium. Acetylene reduction by the various isolates of B. vietnamiensis was constant (44 to 68 nmol h(-1) in ethylene production rate) in soft gel medium containing 0.2% sucrose as sole carbon source, and the bacterium also showed motility and biofilm-forming capacity. This is the first report of endophytic nitrogen-fixing bacteria from nipa palm.

A new montane species of Philautus (Amphibia: Anura: Rhacophoridae) from western Sarawak, Malaysia, Borneo.

Science.gov (United States)

Dehling, J Maximilian; Dehling, Matthias

2013-01-01

A new species of Philautus is described from western Sarawak. The new species was collected in lower montane forest in two national parks in Sarawak and recorded from another park. It differs from its congeners by a unique combination of morphological characters, including a long, acuminate snout, long legs, and comparatively extensive toe webbing. The advertisement call of the new species differs from all calls of other species that have been analyzed so far. Comparison of the mitochondrial 16S rRNA gene sequence corroborates its distinct specific status.

Language Use and Sustainability Status of Indigenous Languages in Sarawak, Malaysia

Science.gov (United States)

Ting, Su-Hie; Ling, Teck-Yee

2013-01-01

The study examines the sustainability status of Sarawak indigenous languages through a survey on adolescents' language use using the Expanded Graded Intergenerational Disruption Scale (EGIDS). The specific aspects examined were: the presence of ethnic languages in relation to other languages in selected domains of language use; the adolescents'…

Soil CO2 flux from three ecosystems in tropical peatland of Sarawak, Malaysia

International Nuclear Information System (INIS)

Melling, Lulie; Hatano, Ryusuke

2005-01-01

Soil CO 2 flux was measured monthly over a year from tropical peatland of Sarawak, Malaysia using a closed-chamber technique. The soil CO 2 flux ranged from 100 to 533 mg C/m 2 /h for the forest ecosystem, 63 to 245 mg C/m 2 /h for the sago and 46 to 335 mg C/m 2 /h for the oil palm. Based on principal component analysis (PCA), the environmental variables over all sites could be classified into three components, namely, climate, soil moisture and soil bulk density, which accounted for 86% of the seasonal variability. A regression tree approach showed that CO 2 flux in each ecosystem was related to different underlying environmental factors. They were relative humidity for forest, soil temperature at 5 cm for sago and water-filled pore space for oil palm. On an annual basis, the soil CO 2 flux was highest in the forest ecosystem with an estimated production of 2.1 kg C/m 2 /yr followed by oil palm at 1.5 kg C/m 2 /yr and sago at 1.1 kg C/m 2 /yr. The different dominant controlling factors in CO 2 flux among the studied ecosystems suggested that land use affected the exchange of CO 2 between tropical peatland and the atmosphere

Distribution of Major and Trace Elements in a Tropical Hydroelectric Reservoir in Sarawak, Malaysia.

Science.gov (United States)

Sim, Siong Fong; Ling, Teck Yee; Nyanti, Lee; Ean Lee, Terri Zhuan; Mohd Irwan Lu, Nurul Aida Lu; Bakeh, Tomy

2014-01-01

This paper reports the metals content in water, sediment, macroalgae, aquatic plant, and fish of Batang Ai Hydroelectric Reservoir in Sarawak, Malaysia. The samples were acid digested and subjected to atomic absorption spectrometry analysis for Na, K, Mn, Cr, Ni, Zn, Mg, Fe, Sn, Al, Ca, As, Se, and Hg. The total Hg content was analysed on the mercury analyser. Results showed that metals in water, sediment, macroalgae, aquatic plant, and fish are distinguishable, with sediment and biota samples more susceptible to metal accumulation. The distributions of heavy metals in water specifically Se, Sn, and As could have associated with the input of fish feed, boating, and construction activities. The accumulation of heavy metals in sediment, macroalgae, and aquatic plant on the other hand might be largely influenced by the redox conditions in the aquatic environment. According to the contamination factor and the geoaccumulation index, sediment in Batang Ai Reservoir possesses low risk of contamination. The average metal contents in sediment and river water are consistently lower than the literature values reported and well below the limit of various guidelines. For fishes, trace element Hg was detected; however, the concentration was below the permissible level suggested by the Food and Agriculture Organization.

Distributional changes in rainfall and river flow in Sarawak, Malaysia

Science.gov (United States)

Sa'adi, Zulfaqar; Shahid, Shamsuddin; Ismail, Tarmizi; Chung, Eun-Sung; Wang, Xiao-Jun

2017-11-01

Climate change may not change the rainfall mean, but the variability and extremes. Therefore, it is required to explore the possible distributional changes of rainfall characteristics over time. The objective of present study is to assess the distributional changes in annual and northeast monsoon rainfall (November-January) and river flow in Sarawak where small changes in rainfall or river flow variability/distribution may have severe implications on ecology and agriculture. A quantile regression-based approach was used to assess the changes of scale and location of empirical probability density function over the period 1980-2014 at 31 observational stations. The results indicate that diverse variation patterns exist at all stations for annual rainfall but mainly increasing quantile trend at the lowers, and higher quantiles for the month of January and December. The significant increase in annual rainfall is found mostly in the north and central-coastal region and monsoon month rainfalls in the interior and north of Sarawak. Trends in river flow data show that changes in rainfall distribution have affected higher quantiles of river flow in monsoon months at some of the basins and therefore more flooding. The study reveals that quantile trend can provide more information of rainfall change which may be useful for climate change mitigation and adaptation planning.

A preliminary field survey of ectoparasites of rodents in urban park, Sarawak, Malaysian Borneo.

Science.gov (United States)

Madinah, A; Mariana, A; Fatimah, A; Abdullah, M T

2013-09-01

A survey of ectoparasites was carried out during Eco-Zoonoses Expedition in Bukit Aup Jubilee Park (BAJP), Sibu, Sarawak, Malaysian Borneo from 5(th) to 9(th) June 2008. A total of nine individuals comprising two species of rodents were captured. The species of rodents screened for ectoparasites were Sundamys muelleri and Callosciurus notatus. Four genera and six species of ectoparasites were collected, namely, Ixodes granulatus, Ixodes sp., Laelaps sedlaceki, Laelaps nuttalli, Hoplopleura dissicula and Listrophoroides sp. Three species of the ectoparasites are known to have potential health risk. The species were Ixodes granulatus, Laelaps nuttalli and Hoplopleura dissicula. This survey produced the first list of ectoparasites in Bukit Aup Jubilee Park, Sarawak, Malaysia.

A pilot study on the functional performance and acceptability of an innovative female condom (Wondaleaf®) in Malaysia

OpenAIRE

Ting,Rachel Sing-Kiat; Wong,Ee Lynn; Tnay,Jessie Koh-Sing

2018-01-01

Rachel Sing-Kiat Ting,1 Ee-Lynn Wong,2 Jessie Koh-Sing Tnay3 1School of Sociology, China University of Political Sciences and Law, Beijing, China; 2InPsych Psychological and Counselling Services, Kuala Lumpur, 3Institute of Borneo Studies, Universiti Malaysia Sarawak, Sarawak, Malaysia Background: Female condom (FC) has been available for over 30 years, but it still lacks wide acceptability. To overcome misdirection and invagination occurring in FC and to provide a wider area of protection, W...

Language Choices of CEOs of Chinese Family Business in Sarawak, Malaysia

Science.gov (United States)

Ting, Su-Hie

2017-01-01

The study investigated the language choices of Chief Executive Officers (CEOs) of Chinese family business and the factors guiding their choices. Interviews were conducted with 17 CEOs of family businesses located in Sarawak, some of whom are the sons and grandsons of the founder of the business. The results showed that all the CEOs can speak their…

The prevalence of cardiovascular risk factors in the young and middle-aged rural population in Sarawak, Malaysia.

Science.gov (United States)

Chang, Ching Thon; Lee, Ping Yein; Cheah, Whye Lian

2012-04-01

Coronary heart disease (CHD) was the second leading cause of death in Malaysia in 2006. CHD has known risk factors including hypertension, diabetes mellitus, and obesity. This cross-sectional study examined the prevalence of cardiovascular risk factors among 260 participants aged 20 to 65 years in a rural community in Sarawak. The prevalences of overweight and obesity in this study were 39.6% and 11.9%, respectively. Approximately 13% of participants had hypertension, and 1.5% had a random blood sugar greater than 11.1 mmol/L. Chi-square tests showed significant associations between obesity and gender (P = 0.007), low high-density lipoprotein cholesterol and race (P = 0.05), high total cholesterol and age (P = 0.007), age and hypertension (P = 0.011), smoking and gender (P 45 years) were 0.395 times more likely to have high cholesterol and that those with a higher monthly household income (> RM830) were 2.471 times more likely to smoke. These findings indicate that we should be concerned about the high rates of overweight in this rural community to prevent obesity.

The moderating effect of tourism by-products on the relationship between tourism core products and destination image (Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Zahari Mohd Salehuddin Mohd

2017-01-01

Full Text Available This paper reports an empirical investigation on the moderating effects of the tourism by- products in building Sarawak destination image. Using causal research design through a quantitative method, self-reported and self-administered questionnaire, this study surveyed international tourists who had visited Sarawak and experienced the state core tourism products which include purchasing the local tourism by-products. Through the descriptive and inferential statistics, some useful insights about the issue investigated were significantly obtained. It's interesting to note that besides experiencing the tourism core products, the Sarawak Tourism by-products are also catching the international tourist's attention. The moderating effect of tourism by-products on the relationship between tourism core products (culture, adventure, and nature and Sarawak destination image was empirically confirmed. In fact, in addition to the core culture, adventure and nature product, the local tourism by- products undeniably building and strengthening the image of Sarawak as a tourist destination. This promising indication is, therefore, should not be ignored by the state government, tourism authority, tour operators, the local government, hotels and other related local authorities.

Airborne geoid mapping of land and sea areas of East Malaysia

Science.gov (United States)

Jamil, H.; Kadir, M.; Forsberg, R.; Olesen, A.; Isa, M. N.; Rasidi, S.; Mohamed, A.; Chihat, Z.; Nielsen, E.; Majid, F.; Talib, K.; Aman, S.

2017-02-01

This paper describes the development of a new geoid-based vertical datum from airborne gravity data, by the Department of Survey and Mapping Malaysia, on land and in the South China Sea out of the coast of East Malaysia region, covering an area of about 610,000 square kilometres. More than 107,000 km flight line of airborne gravity data over land and marine areas of East Malaysia has been combined to provide a seamless land-to-sea gravity field coverage; with an estimated accuracy of better than 2.0 mGal. The iMAR-IMU processed gravity anomaly data has been used during a 2014-2016 airborne survey to extend a composite gravity solution across a number of minor gaps on selected lines, using a draping technique. The geoid computations were all done with the GRAVSOFT suite of programs from DTU-Space. EGM2008 augmented with GOCE spherical harmonic model has been used to spherical harmonic degree N = 720. The gravimetric geoid first was tied at one tide-gauge (in Kota Kinabalu, KK2019) to produce a fitted geoid, my_geoid2017_fit_kk. The fitted geoid was offset from the gravimetric geoid by +0.852 m, based on the comparison at the tide-gauge benchmark KK2019. Consequently, orthometric height at the six other tide gauge stations was computed from HGPS Lev = hGPS - Nmy_geoid2017_.t_kk. Comparison of the conventional (HLev) and GPS-levelling heights (HGPS Lev) at the six tide gauge locations indicate RMS height difference of 2.6 cm. The final gravimetric geoidwas fitted to the seven tide gauge stations and is known as my_geoid2017_fit_east. The accuracy of the gravimetric geoid is estimated to be better than 5 cm across most of East Malaysia land and marine areas

Glycaemic control of diabetic patients in an urban primary health care setting in Sarawak: the Tanah Puteh Health Centre experience.

Science.gov (United States)

Wong, J S; Rahimah, N

2004-08-01

Achieving glycaemic goals in diabetics has always been a problem, especially in a developing country with inadequate facilities such as in Sarawak in Malaysia. There are no reported studies on the control of diabetes mellitus in a diabetic clinic in the primary health care setting in Sarawak. This paper describes the profile of 1031 patients treated in Klinik Kesihatan Tanah Puteh Health Centre. The mean age was 59 years, the mean BMI 27 kg/m2. There was a female preponderance and mainly type-2 diabetes. Mean HbA1c was 7.4%. Glycaemic control was optimal in 28% (HbA1c 7.5%). Reasonable glycaemic control can be achieved in the primary health care setting in Sarawak.

Assessment of Near-Bottom Water Quality of Southwestern Coast of Sarawak, Borneo, Malaysia: A Multivariate Statistical Approach

Directory of Open Access Journals (Sweden)

Chen-Lin Soo

2017-01-01

Full Text Available The study on Sarawak coastal water quality is scarce, not to mention the application of the multivariate statistical approach to investigate the spatial variation of water quality and to identify the pollution source in Sarawak coastal water. Hence, the present study aimed to evaluate the spatial variation of water quality along the coastline of the southwestern region of Sarawak using multivariate statistical techniques. Seventeen physicochemical parameters were measured at 11 stations along the coastline with approximately 225 km length. The coastal water quality showed spatial heterogeneity where the cluster analysis grouped the 11 stations into four different clusters. Deterioration in coastal water quality has been observed in different regions of Sarawak corresponding to land use patterns in the region. Nevertheless, nitrate-nitrogen exceeded the guideline value at all sampling stations along the coastline. The principal component analysis (PCA has determined a reduced number of five principal components that explained 89.0% of the data set variance. The first PC indicated that the nutrients were the dominant polluting factors, which is attributed to the domestic, agricultural, and aquaculture activities, followed by the suspended solids in the second PC which are related to the logging activities.

Care demands on mothers caring for a child with Down syndrome: Malaysian (Sarawak) mothers' perspectives.

Science.gov (United States)

Chan, Kim Geok; Lim, Khatijah Abdullah; Ling, How Kee

2015-10-01

This paper examines the experiences of mothers caring for a child with Down syndrome in the Malaysian (Sarawak) context. Qualitative interviews were conducted with 26 biological mothers of children with Down syndrome aged 18 years and below. They were accessed through selected child health clinics, community-based rehabilitation centres and schools using purposive sampling within two regions in Sarawak, one of the two Borneo States of Malaysia. Major themes emerging within the context of care demands were children's health, developmental delays, daily needs and behaviour issues. The insights obtained into the care demands experienced by mothers of children with Down syndrome have several implications for practice by care professionals. © 2014 Wiley Publishing Asia Pty Ltd.

Child Care Services in Malaysia

Science.gov (United States)

Pheng, Liew Sau

2007-01-01

Malaysia is a multi-ethnic, multi-racial, and multi-religious country with a population of more than 25 million people who live in the Peninsular and the States of Sabah and Sarawak on Borneo Island. It is a harmonious and peaceful nation comprised of Malays, who are the ethnic majority, followed by Chinese, Indians, Ibans, Kadazandusuns, and…

Comparing schizophrenia symptoms in the Iban of Sarawak with other populations to elucidate clinical heterogeneity.

Science.gov (United States)

McLean, Duncan; Barrett, Robert; Loa, Peter; Thara, Rangaswamy; John, Sujit; McGrath, John; Gratten, Jake; Mowry, Bryan

2015-03-01

The symptom profile of schizophrenia can vary between ethnic groups. We explored selected symptom variables previously reported to be characteristic of schizophrenia in the Iban of Sarawak in transethnic populations from Australia, India, and Sarawak, Malaysia. We tested site differences to confirm previous research, and to explore implications of differences across populations for future investigations. We recruited schizophrenia samples in Australia (n = 609), India (n = 310) and Sarawak (n = 205) primarily for the purposes of genetic studies. We analyzed seven identified variables and their relationship to site using logistic regression, including: global delusions, bizarre delusions, thought broadcast/insertion/withdrawal delusions, global hallucinations, auditory hallucinations, disorganized behavior, and prodromal duration. We identified a distinct symptom profile in our Sarawak sample. Specifically, the Iban exhibit: low frequency of thought broadcast/insertion/withdrawal delusions, high frequency of auditory hallucinations and disorganized behavior, with a comparatively short prodrome when compared with Australian and Indian populations. Understanding between-site variation in symptom profile may complement future transethnic genetic studies, and provide important clues as to the nature of differing schizophrenia expression across ethnically distinct groups. A comprehensive approach to subtyping schizophrenia is warranted, utilizing comprehensively ascertained transethnic samples to inform both schizophrenia genetics and nosology. Copyright © 2013 Wiley Publishing Asia Pty Ltd.

Incidence and risk factors for breast cancer subtypes in three distinct South-East Asian ethnic groups: Chinese, Malay and natives of Sarawak, Malaysia.

Science.gov (United States)

Devi, C R Beena; Tang, Tieng Swee; Corbex, Marilys

2012-12-15

We determined the incidences of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) subtypes among breast cancer cases in Sarawak, Malaysia and their correlation with various risk factors in the three ethnic groups: Chinese, Malay and native. Subtype status was ascertained for 1,034 cases of female breast cancer (93% of all cases diagnosed since 2003), and the age-standardized incidence rates (ASRs) of each subtype were inferred. Case-case comparisons across subtypes were performed for reproductive risk factors. We found 48% luminal A (ER+/PR+/HER2-), 29% triple-negative (ER-/PR-/HER2-), 12% triple-positive (ER+/PR+/HER2+) and 11% HER2-overexpressing (ER-/PR-/HER2+) subtypes, with ASRs of 10.6, 6.0, 2.8 and 2.8 per 100,000, respectively. The proportions of subtypes and ASRs differed significantly by ethnic groups: HER2-positive cases were more frequent in Malays (29%; 95% CI [23;35]) than Chinese (22%; [19;26] and natives (21%; [16;26]); triple-negative cases were less frequent among Chinese (23%; [20;27]) than Malays (33%; [27;39]) and natives (37%; [31;43]). The results of the case-case comparison were in accordance with those observed in western case series. Some uncommon associations, such as between triple-negative subtype and older age at menopause (OR, 1.59; p < 0.05), were found. The triple-negative and HER2+ subtypes predominate in our region, with significant differences among ethnic groups. Our results support the idea that the risk factors for different subtypes vary markedly. Westernized populations are more likely to have factors that increase the risk for the luminal A type, while risk factors for the triple-negative type are more frequent in local populations. Copyright © 2012 UICC.

Report on the FY 1993 basic survey for industrialization related to the survey of overseas geological structure (Tebulan East area, Malaysia); 1993 nendo kaigai chishitsu kozo nado chosa ni kakawaru kigyoka kiso chosa (Malaysia Tebulan higashi chiku) hokokusho

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-03-01

The survey was conducted based on 'Scope of work for detailed coal exploration in the Tebulan East block of the Merit Pila coal field, Sarawak, Malaysia' concluded on June 19, 1993 between NEDO and Global Mineral which owns the mining right. The field survey was for the geological survey, survey of conditions of open pit mining, and infrastructure survey. The confirmed/estimated coal amount totaled 22,65 million tons in 4 coal seams. The all sulfur content is low, approximately 0.12%. The heating value is 5,820 kcal/kg. As to the infrastructure, various conditions are good for transportation, shipping facilities, etc. from mine site to truck transport/barge transport/external route shipping. The drilling was planned to be made by open pit mining by the truck and shovel system, and the scale of the planned production was 0.3 million tons. The ash is low in amount, and there was no coal preparation. Clean coal is produced by crushing, sieving and washing. Attached were the borehole log (JN9940782), route map, and trench sketch (JN9940783). (NEDO)

Age and provenance of Triassic to Cenozoic sediments of West and Central Sarawak, Malaysia

Science.gov (United States)

Breitfeld, H. Tim; Galin, Thomson; Hall, Robert

2015-04-01

Sarawak is located on the northern edge of Sundaland in NW Borneo. West and Central Sarawak include parts of the Kuching and Sibu Zones. These contain remnants of several sedimentary basins with ages from Triassic to Cenozoic. New light mineral, heavy mineral and U-Pb detrital zircon ages show differences in provenance reflecting the tectonic evolution of the region. The oldest clastic sediments are Triassic (Sadong Formation and its deep marine equivalent Kuching Formation). They were sourced by a Triassic (Carnian to Norian) volcanic arc and reworked Paleoproterozoic detritus derived from Cathaysialand. The Upper Jurassic to Cretaceous Pedawan Formation is interpreted as forearc basin fill with distinctive zircon populations indicating subduction beneath present-day West Sarawak which initiated in the Late Jurassic. Subsequent subduction until the early Late Cretaceous formed the Schwaner Mountains magmatic arc. After collision of SW Borneo and other microcontinental fragments with Sundaland in the early Late Cretaceous, deep marine sedimentation (Pedawan Formation) ceased, and there was uplift forming the regional Pedawan-Kayan unconformity. Two episodes of extension followed and were responsible for basin development on land in West Sarawak from the latest Cretaceous onwards, probably in a pull-apart setting. The first episode is associated with sediments of the Kayan Group, deposited in the Latest Cretaceous (Maastrichtian) to Eocene, and the second episode with Upper Eocene sediments of the Ketungau Basin. Zircon ages indicate volcanic activity throughout the Early Cenozoic in NW Borneo, and inherited zircon ages indicate reworking of Triassic and Cretaceous rocks. A large deep marine basin, the Rajang Basin, was north of the Lupar Line Fault in Central Sarawak (Sibu Zone) from the Late Cretaceous to the Late Eocene. Zircons from sediments of the Rajang Basin indicate they have similar ages and provenance to contemporaneous terrestrial sediments of the Kayan

Correlation between soil physicochemical properties and vegetation parameters in secondary tropical forest in Sabal, Sarawak, Malaysia

Science.gov (United States)

Karyati, K.; Ipor, I. B.; Jusoh, I.; Wasli, M. E.

2018-04-01

The tree growth is influenced by soil morphological and physicochemical properties in the site. The purpose of this study was to describe correlation between soil properties under various stage secondary forests and vegetation parameters, such as floristic structure parameters and floristic diversity indices. The vegetation surveys were conducted in 5, 10, and 20 years old at secondary tropical forests in Sarawak, Malaysia. Nine sub plots sized 20 m × 20 m were established within each study site. The Pearson analysis showed that soil physicochemical properties were significantly correlated to floristic structure parameters and floristic diversity indices. The result of PCA clarified the correlation among most important soil properties, floristic structure parameters, and floristic diversity indices. The PC1 represented cation retention capacity and soil texture which were little affected by the fallow age and its also were correlated by floristic structure and diversity. The PC2 was linked to the levels of soil acidity. This property reflected the remnant effects of ash addition and fallow duration, and the significant correlation were showed among pH (H2O), floristic structure and diversity. The PC3 represented the soil compactness. The soil hardness could be influenced by fallow period and it was also correlated by floristic structure.

Monitoring of Waterborne Parasites in Two Drinking Water Treatment Plants: A Study in Sarawak, Malaysia.

Science.gov (United States)

Richard, Reena Leeba; Ithoi, Init; Abd Majid, Mohamad Azlan; Wan Sulaiman, Wan Yusoff; Tan, Tian Chye; Nissapatorn, Veeranoot; Lim, Yvonne Ai Lian

2016-06-28

The occurrence of waterborne parasites coupled with water parameters at various processing sites of two drinking water treatment plants (A and B) and seven distribution system (DS) sites in Sarawak, Malaysia were studied. Ten liters of water underwent immunomagnetic separation (IMS) technique to detect the presence of Giardia and Cryptosporidium (oo)cysts. The remaining supernatant was used to detect other parasites whilst 50 mL of water sample was each used in the detection of free-living amoebae and fecal coliforms. Sampled water was positive for Giardia (32.9%; 28/85), Cryptosporidium (18.8%; 16/85) followed by Spirometra ova-like (25.9%; 22/85), Blastocystis-like (25.9%; 22/85), nematode larvae-like (8.2%; 7/85) and Taenia ova-like (1.2%; 1/85). Meanwhile, 90.2% (55/61) samples were positive for Acanthamoeba and Naegleria via cultivation and of these, 11 isolates were confirmed as Acanthamoeba genotype T3 (5/7) and T4 (2/7) followed by Naegleria sp. (4/11), Naegleria italica (2/11), Naegleria australiensis (1/11), Naegleria angularis (1/11) and Vahlkampfia sp. (3/11). Cryptosporidium, Acanthamoeba and Naegleria were also detected in one of the seven tested DS sites. Only Giardia and Cryptosporidium showed significant correlations with fluoride and fecal coliforms. These results describe the occurrence of waterborne parasites that will assist key stakeholders in mitigating contamination at the specific sites.

Differences in Prokaryotic Species Between Primary and Logged-Over Deep Peat Forest in Sarawak, Malaysia

International Nuclear Information System (INIS)

Mohd Shawal Thakib Maidin; Sakinah Safari; Nur Aziemah Ghani; Sharifah Azura Syed Ibrahim; Shamsilawani Ahamed Bakeri; Mohamed Mazmira Mohd Masri; Siti Ramlah Ahmad Ali

2016-01-01

Peat land has an important role in environmental sustainability which can be used for agricultural purposes. However, deforestation in the logged-over forest may disrupt the diversity of microbial population in peat soil. Therefore, this study focuses on the differences of microbial populations in Maludam primary forest and Cermat Ceria logged-over forest in Sarawak, Malaysia. The prokaryotic 16S rDNA region was amplified followed by denaturing gradient gel electrophoresis (16S PCR-DGGE) analysis. Berger-Parker and Shannon-Weaver Biodiversity Index showed that Maludam (0.11, 7.75) was more diverse compared to Cermat Ceria (0.19, 7.63). Sequence analysis showed that the bacterial community in Maludam and Cermat Ceria were dominated by unclassified bacteria, followed by Acidobacteria, Actinobacteria, Firmicutes and a-Proteobacteria. Based on the findings, the distinct species that can be found in Maludam were Acidobacterium capsulatum, Solibacter sp., Mycobacterium intracellulare, Rhodoplanes sp., Clostridia bacterium, Exiguobacterium sp. and Lysinibacillus fusiformis. While, the distinct species that can be found in Cermat Ceria were Telmatobacter, Mycobacterium tuberculosis and Bacillus tequilensis. Overall, the findings showed that microbial population in the logged-over forest are less diverse compared to primary forest. Higher prokaryotic diversity identified in the primary forest compared to logged-over forest showed that deforestation might cause prokaryotic population changes to both ecosystems. (author)

Description of the tadpoles of three rare species of megophryid frogs (Amphibia: Anura: Megophryidae) from Gunung Mulu, Sarawak, Malaysia.

Science.gov (United States)

Oberhummer, Evelyne; Barten, Catherin; Schweizer, Manuel; Das, Indraneil; Haas, Alexander; Hertwig, Stefan T

2014-07-09

The megophryid frogs Leptobrachella brevicrus, Leptolalax dringi and Megophrys dringi are species exclusively known  from highly localised areas in isolated mountain ranges on Borneo. The tadpoles and adults in this study were collected at the shared type locality for the three species in Gunung Mulu National Park, Sarawak, Malaysia (Borneo). The species identities of larvae were determined via comparison to syntopic adults using DNA barcoding techniques based on partial 16S rRNA mitochondrial gene sequences. The genetic data supported the status of the three taxa as valid species. Descriptions of colouration in life and after preservation, external morphological features, morphometric measurements and ecological notes in comparison to congeneric species are supplied. The tadpoles of L. brevicrus and L. dringi show similar adaptations to a fossorial lifestyle. These include an elongated, vermiform body, a relatively long tail and small eyes. Both were found in the gravel beds of a small mountain stream. In contrast, the larvae of M. dringi are adapted to occupying and feeding at the surface of pools within the stream. 

Morphological Characteristics and Habitats of Red Seaweed Gracilaria spp. (Gracilariaceae, Rhodophyta) in Santubong and Asajaya, Sarawak, Malaysia.

Science.gov (United States)

Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md

2018-03-01

Red seaweed Gracilaria , one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii , G. blodgettii and G. coronopifolia , attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed ( Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya's mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress.

Morphological Characteristics and Habitats of Red Seaweed Gracilaria spp. (Gracilariaceae, Rhodophyta) in Santubong and Asajaya, Sarawak, Malaysia

Science.gov (United States)

Othman, Muhammad Nur Arif; Hassan, Ruhana; Harith, Mohd Nasarudin; Sah, Amir Shah Ruddin Md

2018-01-01

Red seaweed Gracilaria, one of the largest genus in Division Rhodophyta inhabits Sarawak coastal water. This study was designed to identify the species of Gracilaria using morphological approach and to assess selected water quality parameters in Gracilaria habitats. Three field samplings were carried out in Santubong and Asajaya, Sarawak from November 2013 to December 2014. Overall, three species were identified namely Gracilaria changii, G. blodgettii and G. coronopifolia, attached to net of cage culture in Santubong and root of mangrove trees in Asajaya. In addition, three different taxa of aquatic macroinvertebrates (polychaete, small crab, bivalve) and single species of red seaweed (Acanthophora sp.) were observed in Gracilaria assemblages. An estimate of 37% to 40% of the upper part of the cage net in Santubong was covered by seaweeds and only 16% to 20% in Asajaya’s mangrove. The study had provided better information on identification of Gracilaria and their habitat in Sarawak. Future work involving DNA barcoding of each species is in progress. PMID:29644017

Distribution and taxonomy of Rafflesia R. Br. (Rafflesiaceae) in Peninsular Malaysia

Science.gov (United States)

Wahab, Nor Azilah Abdul; Talip, Noraini; Adam, Jumaat

2018-04-01

Distribution of Rafflesia spesies are only endemic to tropical rainforest in Southeast Asia. Malaysia is among the country that is blessed with Rafflesia species and reported can be found in Peninsular Malaysia, Sabah and Sarawak. Not all state in Peninsular Malaysia are reported to have this magnificent flower. Only states of Perak, Pahang, Kelantan, Terengganu and Kedah that are reported to have the distribution of Rafflesia species in Peninsular Malaysia. There are seven species of Rafflesia that have been reported and daescribed in Peninsular Malaysia, which namely R. cantleyi, R. kerrii, R. azlanii, R. su-meiae, R. sharifah-hapsahiae, R. parvimaculata and R. tuanku-halimii.

Enhancing Visitor Experiences Using Thematic Interpretation in Park Guiding Service in Sarawak National Parks

Directory of Open Access Journals (Sweden)

Amin Victor Luna

2014-01-01

Full Text Available Enhancing visitor experiences is arguably the primary and most important goal for interpretation by many protected area managers and tourism business. However, little research has been conducted in Sarawak, Malaysia to directly quantify the effects of thematic interpretation has on tourist experiences. Drawing on the TORE-model of interpretation and through the inception of Park Guiding Training and Licensing System in Sarawak since 2007, this quantitative study examines the effectiveness of thematic interpretive guided tours delivered by park guides at Bako National Park, Sarawak, with the assumption that it will further enhance visitor experiences. A descriptive analysis and Pearson's product-moment correlation analysis of sub-indicators of the global evaluation of interpretation of site, and sub-indicators of elaboration surveyed from visitors of purposively sampled park guides revealed a strong measurement and correlation coefficients of visitors’ overall quality of thematic intepretive guided tours effecting visitor satisfaction and experiences. These findings provide empirical evidence that good thematic interpretive guided tour makes a positive impacts on visitor experiences, thus making training of tourism businesses' employees as park guides as a good investment. The suggestions for further research in influencing visitor attitude and shaping visitor behaviour are offered.

Setting up home-based palliative care in countries with limited resources: a model from Sarawak, Malaysia.

Science.gov (United States)

Devi, B C R; Tang, T S; Corbex, M

2008-12-01

The provision of palliative care (PC) and opioids is difficult to ensure in remote areas in low- and middle-income countries. We describe here the set up of a home-care program in Sarawak (the Malaysian part of the Borneo Island), where half the population lives in villages that are difficult to access. The establishment of this program, initiated in 1994 by the Department of Radiotherapy of Sarawak General Hospital, consisted of training, empowering nurses, simplifying referral, facilitating access to medication, and increasing awareness among public and health professionals about PC. The program has been sustainable and cost efficient, serving 936 patients in 2006. The total morphine usage in the program increased from 1400 g in 2006. The results show that pain medication can be provided even in remote areas with effective organization and empowerment of nurses, who were the most important determinants for the set up of this program. Education of family was also a key aspect. The authors believe that the experience gained in Sarawak may help other regions with low or middle resources in the set up of their PC program especially for their remote rural population.

Prevalence and spectrum of germline rare variants in BRCA1/2 and PALB2 among breast cancer cases in Sarawak, Malaysia.

Science.gov (United States)

Yang, Xiaohong R; Devi, Beena C R; Sung, Hyuna; Guida, Jennifer; Mucaki, Eliseos J; Xiao, Yanzi; Best, Ana; Garland, Lisa; Xie, Yi; Hu, Nan; Rodriguez-Herrera, Maria; Wang, Chaoyu; Jones, Kristine; Luo, Wen; Hicks, Belynda; Tang, Tieng Swee; Moitra, Karobi; Rogan, Peter K; Dean, Michael

2017-10-01

To characterize the spectrum of germline mutations in BRCA1, BRCA2, and PALB2 in population-based unselected breast cancer cases in an Asian population. Germline DNA from 467 breast cancer patients in Sarawak General Hospital, Malaysia, where 93% of the breast cancer patients in Sarawak are treated, was sequenced for the entire coding region of BRCA1; BRCA2; PALB2; Exons 6, 7, and 8 of TP53; and Exons 7 and 8 of PTEN. Pathogenic variants included known pathogenic variants in ClinVar, loss of function variants, and variants that disrupt splice site. We found 27 pathogenic variants (11 BRCA1, 10 BRCA2, 4 PALB2, and 2 TP53) in 34 patients, which gave a prevalence of germline mutations of 2.8, 3.23, and 0.86% for BRCA1, BRCA2, and PALB2, respectively. Compared to mutation non-carriers, BRCA1 mutation carriers were more likely to have an earlier age at onset, triple-negative subtype, and lower body mass index, whereas BRCA2 mutation carriers were more likely to have a positive family history. Mutation carrier cases had worse survival compared to non-carriers; however, the association was mostly driven by stage and tumor subtype. We also identified 19 variants of unknown significance, and some of them were predicted to alter splicing or transcription factor binding sites. Our data provide insight into the genetics of breast cancer in this understudied group and suggest the need for modifying genetic testing guidelines for this population with a much younger age at diagnosis and more limited resources compared with Caucasian populations.

Introduction to recent systematic studies on amphibians of Sarawak by JRCTS and Forest Research Department Sarawak

OpenAIRE

Eto, Koshiro; Matsui, Masafumi; Nishikawa, Kanto

2016-01-01

This proceeding is a compilation of findings and progress activities of research collaboration between the Forest Department Sarawak (FDS) and the Japan Research Consortium for Tropical Forests in Sarawak (JRCTS). To highlight the research findings, An International Symposium entitled "Frontier in Tropical Forest Research: Progress in Joint Projects between the Forest Department Sarawak and the Japan Research Consortium for Tropical Forests in Sarawak" was ii held in Kuching, Sarawak on 21-22...

Seaweed composition from Bintulu coast of Sarawak, Malaysia.

Science.gov (United States)

Zawawi, Mohd Hafizbillah; Idris, Mohd Hanafi; Kamal, Abu Hena Mustafa; King, Wong Sing

2014-08-01

Species composition of seaweed and distribution were investigated in the coastal waters of Bintulu, Sarawak. The seaweed samples were collected during low tide between May 2011 and May 2012 from the six different stations. In total 54 species of seaweeds were identified from study areas of Bintulu coastal waters. Among them, 23 species were from Rhodophyta with 11 families, 15 species were from Phaeophyta with 2 families and 16 species were from Chlorophyta with 10 families: Seventeen species of seaweeds were recorded from the Tanjung Batu, while 23 species from Pantai Telekom, 14 species from Golden Beach, 26 species from Kuala Similajau, 12 species from Kuala Nyalau and 21 species from Batu Mandi. Seaweeds abundance was high in rocky substrate and Rhodophyta (11 families and 23 species) was the common and highest group of seaweeds in this coastal areas. Present study recorded high diversified seaweed species at the rocky shore area compare to reef area.

Trends in rainfall and rainfall-related extremes in the east coast of peninsular Malaysia

Science.gov (United States)

Mayowa, Olaniya Olusegun; Pour, Sahar Hadi; Shahid, Shamsuddin; Mohsenipour, Morteza; Harun, Sobri Bin; Heryansyah, Arien; Ismail, Tarmizi

2015-12-01

The coastlines have been identified as the most vulnerable regions with respect to hydrological hazards as a result of climate change and variability. The east of peninsular Malaysia is not an exception for this, considering the evidence of heavy rainfall resulting in floods as an annual phenomenon and also water scarcity due to long dry spells in the region. This study examines recent trends in rainfall and rainfall- related extremes such as, maximum daily rainfall, number of rainy days, average rainfall intensity, heavy rainfall days, extreme rainfall days, and precipitation concentration index in the east coast of peninsular Malaysia. Recent 40 years (1971-2010) rainfall records from 54 stations along the east coast of peninsular Malaysia have been analyzed using the non-parametric Mann-Kendall test and the Sen's slope method. The Monte Carlo simulation technique has been used to determine the field significance of the regional trends. The results showed that there was a substantial increase in the annual rainfall as well as the rainfall during the monsoon period. Also, there was an increase in the number of heavy rainfall days during the past four decades.

Drug utilization review of potassium chloride injection formulations available in a private hospital in kuching, sarawak, malaysia.

Science.gov (United States)

Melissa, Mohammad Hirman; Azmi, Sarriff

2013-07-01

The concentrated potassium chloride injection is a high-alert medication and replacing it with a pre-mixed formulation can reduce the risks associated with its use. The aim of this study was to determine the clinical characteristics of patients receiving different potassium chloride formulations available at a private institution. The study also assessed the effectiveness and safety of pre-mixed formulations in the correction of hypokalaemia. This was a retrospective observational study consisting of 296 cases using concentrated and pre-mixed potassium chloride injections in 2011 in a private hospital in Kuching, Sarawak, Malaysia. There were 135 (45.6%) cases that received concentrated potassium chloride, and 161 (54.4%) cases that received pre-mixed formulations. The patients' clinical characteristics that were significantly related to the utilization of the different formulations were diagnosis (P < 0.001), potassium serum blood concentration (P < 0.05), and fluid overload risk (P < 0.05). The difference observed for the cases that achieved or maintained normokalaemia was statistically insignificant (P = 0.172). Infusion-related adverse effects were seen more in pre-mixes compared to concentrated formulations (6.8% versus 2.2%, P < 0.05). This study provides insight into the utilization of potassium chloride injections at this specific institution. The results support current recommendations to use pre-mixed formulations whenever possible.

Aspergillus species isolated from mangrove forests in Borneo Island, Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

J.S.S. Seelan

2009-06-01

Full Text Available A study on the occurrence of Aspergillus spp. on selected mangrove forests in Sarawak was conducted to find out their diversity and distribution. Samples were obtained from mangrove soils and leaf litters at different locations, i.e. Sematan, Lundu, Kampung Bako, Bako in Sarawak. Soil and leaf litter samples were taken randomly at different locations with five replicates from each area. A total of 138 isolates of Aspergillus species were obtained from the soil and leaf litter samples by using direct plating and Warcup method. Based on both macroscopic and microscopic observations, using an identification key, individual isolates were classified within the genus Aspergillus, belonging to three subgenera, four sections and five species. The fungi isolates were identified as A. terreus, A. flavipes, A. carneus, A. fumigatus and A. clavatus. The most frequent isolated species was A. flavipes (63.04%, followed by A. fumigatus (16.7%, A. terreus (13.04%, A. carneus (5.8% and A. clavatus (1.44%. All of the isolated Aspergillus species grew well on MEA and CYA at 25°C. A. carneus produced reddish sclerotia on MEA after seven days and this could be used as an important characteristic in this species identification. A. clavatus from mangrove soil in Kampung Bako has shown long conidiophores (ranging from 3-5 cm with swollen hyphal structures, while A. clavatus from Sematan area has shorter conidiophores (ranging from 2.5-3.5 cm on MEA.

Polycyclic aromatic hydrocarbon (PAH) contamination in the sediments of east coast peninsular Malaysia

International Nuclear Information System (INIS)

Mohd Suhaimi Elias; Abdul Khalik Wood; Zaleha Hashim; Wee Boon Siong; Mohd Suhaimi Hamzah; Shamsiah Abdul Rahman; Nazaratul Ashifa Abdullah Salim; Ariffin Talib

2007-01-01

The polycyclic hydrocarbons (PAHs) are pollutants of concern due to their persistent in the marine ecosystem, thus its can cause long-term adverse effect to the marine life. In this study the concentrations of PAHs in east coast Peninsular Malaysia sediments were determined. About ten stations along the east coast of the coastal area were selected to collect sediments sample using grab sampler. The PAHs from the sediment samples were soxhlet extracted using mixture of hexane and dichloromethane (DCM). Fractionation was done using the silica-alumina column. About 17 compounds of the PAHs were determined using the Gas Chromatography-Mass Spectrometer (GCMS model QP5050A). The Σ PAHs was found in the range between 0.26 μg/ g to 0.59 μg/ g dry weight. The data from the study signified that the main source of PAHs in the sediment of the east coast peninsular Malaysia is originated from the pyrolytic source. (author)

Net ecosystem CO2 exchange of a primary tropical peat swamp forest in Sarawak, Malaysia

Science.gov (United States)

Tang Che Ing, A.; Stoy, P. C.; Melling, L.

2014-12-01

Tropical peat swamp forests are widely recognized as one of the world's most efficient ecosystems for the sequestration and storage of carbon through both their aboveground biomass and underlying thick deposits of peat. As the peat characteristics exhibit high spatial and temporal variability as well as the structural and functional complexity of forests, tropical peat ecosystems can act naturally as both carbon sinks and sources over their life cycles. Nonetheless, few reports of studies on the ecosystem-scale CO2 exchange of tropical peat swamp forests are available to-date and their present roles in the global carbon cycle remain uncertain. To quantify CO2 exchange and unravel the prevailing factors and potential underlying mechanism regulating net CO2 fluxes, an eddy covariance tower was erected in a tropical peat swamp forest in Sarawak, Malaysia. We observed that the diurnal and seasonal patterns of net ecosystem CO2 exchange (NEE) and its components (gross primary productivity (GPP) and ecosystem respiration (RE)) varied between seasons and years. Rates of NEE declined in the wet season relative to the dry season. Conversely, both the gross primary productivity (GPP) and ecosystem respiration (RE) were found to be higher during the wet season than the dry season, in which GPP was strongly negatively correlated with NEE. The average annual NEE was 385 ± 74 g C m-2 yr-1, indicating the primary peat swamp forest functioned as net source of CO2 to the atmosphere over the observation period.

Prevalence, isolation and characterization of Bacillus cereus strains from rice of local cultivators of Sabah, Sarawak, and Peninsular Malaysia

Science.gov (United States)

Sawei, Jelin; Sani, Norrakiah Abdullah

2016-11-01

Bacillus cereus is a spore-forming, facultative anaerobic, motile microorganism that has been identified as a causative agent of two types of gastrointestinal diseases such as emetic and diarrhea. This foodborne pathogen is found in both vegetative cells and endospores form in foods such as rice either raw or cooked. The aim of this study is to investigate and determine the prevalence, characterize and identify the isolation of vegetative cells and endospores of B. cereus in thirty varieties (n=3) of raw rice from Sabah, Sarawak and Peninsular Malaysia. A total of 90 (n=90) raw rice were examined and 84 (93.33%) samples were positive to vegetative cells of B. cereus. However, only 32 (35.56%) samples were positive for endospore cells that able to germinate after samples were heated at 75°C for 15 mins. The mean log cfu/g for vegetative cells were higher range (0.00 - 4.1533) than visible endospores (0.00 - 3.7533 mean log cfu/g). Sample of raw red rice (UKMRC9) had significantly higher contamination by both vegetative cells and endospores at p<0.05, than the other raw rice samples.

Extracting Features of Acacia Plantation and Natural Forest in the Mountainous Region of Sarawak, Malaysia by ALOS/AVNIR2 Image

Science.gov (United States)

Fadaei, H.; Ishii, R.; Suzuki, R.; Kendawang, J.

2013-12-01

The remote sensing technique has provided useful information to detect spatio-temporal changes in the land cover of tropical forests. Land cover characteristics derived from satellite image can be applied to the estimation of ecosystem services and biodiversity over an extensive area, and such land cover information would provide valuable information to global and local people to understand the significance of the tropical ecosystem. This study was conducted in the Acacia plantations and natural forest situated in the mountainous region which has different ecological characteristic from that in flat and low land area in Sarawak, Malaysia. The main objective of this study is to compare extract the characteristic of them by analyzing the ALOS/AVNIR2 images and ground truthing obtained by the forest survey. We implemented a ground-based forest survey at Aacia plantations and natural forest in the mountainous region in Sarawak, Malaysia in June, 2013 and acquired the forest structure data (tree height, diameter at breast height (DBH), crown diameter, tree spacing) and spectral reflectance data at the three sample plots of Acacia plantation that has 10 x 10m area. As for the spectral reflectance data, we measured the spectral reflectance of the end members of forest such as leaves, stems, road surface, and forest floor by the spectro-radiometer. Such forest structure and spectral data were incorporated into the image analysis by support vector machine (SVM) and object-base/texture analysis. Consequently, land covers on the AVNIR2 image were classified into three forest types (natural forest, oil palm plantation and acacia mangium plantation), then the characteristic of each category was examined. We additionally used the tree age data of acacia plantation for the classification. A unique feature was found in vegetation spectral reflectance of Acacia plantations. The curve of the spectral reflectance shows two peaks around 0.3μm and 0.6 - 0.8μm that can be assumed to

Bioconversion of sago residue into value added products

African Journals Online (AJOL)

USER

2010-04-05

Apr 5, 2010 ... In Sarawak, East Malaysia, agro-residues from sago starch processing industries are ... conversion to animal food or fuel ethanol (Species. Profiles for Pacific Island ..... serious contamination of the rivers. Based on study by.

Power sector development in Malaysia and energy concerned policy

Energy Technology Data Exchange (ETDEWEB)

Husin, Z.A. (Tenaga Nasional Berhad, Kuala Lumpur (Malaysia). Connaught Bridge Power Station)

1994-03-01

Discusses privatisation of the Malaysian electric power industry, the role of natural gas and coal in the power sector, and intra-ASEAN power development. At present Malaysia has only one coal-fired power plant - the Sultan Salahuddin Abdul Aziz (SSAA) power station in Kapar - consisting of 2 x 300 MW units. Expansion of the plant by the addition of 2 x 500 MW units is in the final stage of contract awards. Apart from this there are no immediate plans for other coal-fired power plants in Peninsular Malaysia. A number of small capacity coal-fired units are being planned for Sabah and Sarawak, where the bulk of Malaysia's coal resources are located.

Unravelling the stratigraphy and sedimentation history of the uppermost Cretaceous to Eocene sediments of the Kuching Zone in West Sarawak (Malaysia), Borneo

Science.gov (United States)

Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; BouDagher-Fadel, Marcelle K.

2018-07-01

The Kuching Zone in West Sarawak consists of two different sedimentary basins, the Kayan and Ketungau Basins. The sedimentary successions in the basins are part of the Kuching Supergroup that extends into Kalimantan. The uppermost Cretaceous (Maastrichtian) to Lower Eocene Kayan Group forms the sedimentary deposits directly above a major unconformity, the Pedawan Unconformity, which marks the cessation of subduction-related magmatism beneath SW Borneo and the Schwaner Mountains, due to termination of the Paleo-Pacific subduction. The successions consist of the Kayan and Penrissen Sandstones and are dominated by fluvial channels, alluvial fans and floodplain deposits with some deltaic to tidally-influenced sections in the Kayan Sandstone. In the late Early or early Middle Eocene, sedimentation in this basin ceased and a new basin, the Ketungau Basin, developed to the east. This change is marked by the Kayan Unconformity. Sedimentation resumed in the Middle Eocene (Lutetian) with the marginal marine, tidal to deltaic Ngili Sandstone and Silantek Formation. Upsequence, the Silantek Formation is dominated by floodplain and subsidiary fluvial deposits. The Bako-Mintu Sandstone, a potential lateral equivalent of the Silantek Formation, is formed of major fluvial channels. The top of the Ketungau Group in West Sarawak is formed by the fluvially-dominated Tutoop Sandstone. This shows a transition of the Ketungau Group in time towards terrestrial/fluvially-dominated deposits. Paleocurrent measurements show river systems were complex, but reveal a dominant southern source. This suggests uplift of southern Borneo initiated in the region of the present-day Schwaner Mountains from the latest Cretaceous onwards. Additional sources were local sources in the West Borneo province, Mesozoic melanges to the east and potentially the Malay Peninsula. The Ketungau Group also includes reworked deposits of the Kayan Group. The sediments of the Kuching Supergroup are predominantly

Effectiveness of pictorial health warning on cigarette packages: A cross-sectional study in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Md Mizanur Rahman

2015-07-01

Full Text Available Specific health warning placed on the tobacco product packages is considered as an effective and low-cost method for increasing the knowledge and awareness among the community. Thus, a study was conducted to assess the perception of pictorial health warnings (PHWs against smoking among the adult rural population of Sarawak.

IDENTIFYING MOTIVATION FACTOR INVOLVEMENT OF SARAWAK MALAY WOMEN ENTREPRENEUR

Directory of Open Access Journals (Sweden)

Masyantie Mohamad

2016-03-01

Full Text Available Sarawak multilayered cake among Sarawak product signature famous among the local as well as international tourist visiting Sarawak. In fact, Sarawak Malay women entrepreneurs have become very necessary players in the entrepreneurial field specifically in this cottage industries from the early introduction of this business, they have facing various problem in this businesses. Thus, this research aims to build an understanding of motivational factor that encourage Sarawak Malay women entrepreneurial experiences especially in multilayered cake businesses. Using qualitative methods, this research aims to identify the entrepreneurial motivations factors; with regards to start-up motivation by Sarawak Malay women. The finding shows that the motivations that influence Malay women within Kuching, Sarawak areas to start and grow their business are involve self-driven and context driven that motivate them involve in multilayered cakes businesses.

Bleeding events and associated factors in a cohort of adult patients taking warfarin in Sarawak, Malaysia.

Science.gov (United States)

Edwards, Frances; Arkell, Paul; Fong; Roberts, Lesley M; Gendy, David; Wong, Christina Siew-Hie; Ngu, Joanna Chee Yien; Tiong, Lee Len; Bibi, Faridha Mohd Salleh; Lai, Lana Yin Hui; Ong, Tiong Kiam; Abouyannis, Michael

2014-01-01

Evidence is emerging that rates of adverse events in patients taking warfarin may vary with ethnicity. This study investigated the rates of bleeds and thromboembolic events, the international normalised ratio (INR) status and the relationship between INR and bleeding events in Malaysia. Patients attending INR clinic at the Heart Centre, Sarawak General Hospital were enrolled on an ad hoc basis from May 2010 and followed up for 1 year. At each routine visit, INR was recorded and screening for bleeding or thromboembolism occurred. Variables relating to INR control were used as predictors of bleeds in logistic regression models. 125 patients contributed to 140 person-years of follow-up. The rates of major bleed, thromboembolic event and minor bleed per 100 person-years of follow-up were 1.4, 0.75 and 34.3. The median time at target range calculated using the Rosendaal method was 61.6% (IQR 44.6–74.1%). Of the out-of-range readings, 30.0% were below range and 15.4% were above. INR variability, (standard deviation of individuals’ mean INR), was the best predictor of bleeding events, with an odds ratio of 3.21 (95% CI 1.10–9.38). Low rates of both major bleeds and thromboembolic events were recorded, in addition to a substantial number of INR readings under the recommended target range. This may suggest that the recommended INR ranges may not represent the optimal warfarin intensity for this population and that a lower intensity of therapy, as observed in this cohort, could be beneficial in preventing adverse events.

An Investigation of Sustainable Power Generation from Oil Palm Biomass: A Case Study in Sarawak

Directory of Open Access Journals (Sweden)

Nasrin Aghamohammadi

2016-04-01

Full Text Available Sarawak is the largest state in Malaysia, with 22% of the nation's oil palm plantation area, making it the second largest contributor to palm biomass production. Despite the enormous amount of palm biomass in the state, the use of biomass as fuel for power generation remains low. This study is designed to investigate the sustainability of power generation from palm biomass specifically in Sarawak by conducting a survey among the palm oil mill developers. To conduct this investigation, several key sustainability factors were identified: the security of the biomass supply, the efficiency of conversion technology, the existing network system, challenges and future prospects for power generation from palm biomass. These factors were assessed through a set of questionnaires. The returned questionnaires were then analysed using statistical tools. The results of this study demonstrate that Sarawak has biomass in abundance, and that it is ready to be exploited for large scale power generation. The key challenge to achieving the renewable energy target is the inadequate grid infrastructure that inhibits palm oil developers from benefiting from the Feed-in-Tariff payment scheme. One way forward, a strategic partnership between government and industrial players, offers a promising outcome, depending on an economic feasibility study. The decentralization of electricity generation to support rural electrification is another feasible alternative for renewable energy development in the state.

Nutrient intake and nutritional status of newly diagnosed patients with cancer from the East Coast of Peninsular Malaysia.

Science.gov (United States)

Menon, Kavitha; Razak, Shariza Abdul; Ismail, Karami A; Krishna, Bhavaraju Venkata Murali

2014-09-30

Cancer therapy in Malaysia primarily focuses on the clinical management of patients with cancer and malnutrition continues to be one of the major causes of death in these patients. There is a dearth of information on the nutrient intake and status of newly diagnosed patients with cancer prior to the initiation of treatment. The present study aims to assess the nutrient intake and status of newly diagnosed patients with cancer from the East Coast of Peninsular Malaysia. A cross-sectional study was conducted using a convenient sample of newly diagnosed adult patients with cancer (n = 70) attending the Oncology clinic, Hospital Universiti Sains Malaysia in the East Coast of Peninsular Malaysia. Information on socio-demographic characteristics, clinical status, anthropometry, dietary intake and biochemical data including blood samples was obtained. The mean (SD) age, triceps skin fold (TSF), mid upper arm circumference (MUAC) and body mass index (BMI) of participants was 21.1(3.9) years, 17.6(7.9) mm, 24.1(5.5) cm, and 21.1(3.9) Kg/m(2), respectively; 39% participants had BMI cancer were undernourished (i.e. women: MUAC cancer from the East Coast of Peninsular Malaysia were underweight and undernourished. The majority of patients with cancer had poor micronutrient intakes; the older women had a poor macro and micronutrient intakes. Before the initiation of rigorous clinical management of patients with cancer, screening for nutritional status, subsequent nutrition counseling, and interventions are essential to improve their nutritional status; consequently, response to cancer therapy, survival and quality of life.

Trends and outlook of coal energy in Malaysia

Energy Technology Data Exchange (ETDEWEB)

Zainal Abidin Husin (Tenaga Nasional Berhad, Kuala Lumpur (Malaysia). Fuel and Materials Management Dept.)

1993-03-01

Current energy policy in Malaysia is directed towards development of natural gas resources although there is a strategy to diversify energy sources to gas, hydro, coal and oil. By the year 2000, however, coal could emerge as a major energy source. The author advocates the need for a policy direction for the coal industry - for exploration, mine planning, mixing methods, transport and regulations to ensure occupational health and safety. Malaysia has abundant coal resources but most are in Sarawak and Sabah whereas the bulk of energy demand is in the Peninsula Malaysia. A table defines known coal resources in Malaysia and a map shows their location. To ensure successful development of the coal industry, technologies must be developed to meet environmental requirements and global market competition. Several emerging technologies are mentioned: production of process-derived fuel and coal-derived liquid from sub-bituminous coal, coal liquefaction, manufacture of coal water mixture, coal beneficiation, and fluidised bed combustion. 1 fig., 1 tab.

Gender differences in body mass index, body weight perception and weight loss strategies among undergraduates in Universiti Malaysia Sarawak.

Science.gov (United States)

Kuan, P X; Ho, H L; Shuhaili, M S; Siti, A A; Gudum, H R

2011-04-01

This study was carried out among undergraduate students in Universiti Malaysia Sarawak with the objective of examining gender differences in body mass index (BMI), body weight perception, eating attitudes and weightloss strategies. Subjects consisted of 600 undergraduates (300 males and 300 females) recruited from the various faculties between September 2008 until mid-November 2008. The Original Figure Rating Scale: Body Weight Perception, Body Shape Questionnaire (BSQ) and Eating Attitudes Test-26 (EAT-26) were used as assessment tools. Overall, 52.8% of students had normal BMI, with approximately an equal number of both sexes. More males than females were overweight (33.7%), while more females were underweight (25.3%). Males were more likely to perceive themselves as overweight, and fail to see themselves as underweight. More than half of the females preferred their ideal figure to be underweight, whereas about 30% males chose an overweight figure as their ideal model. Females were generally more concerned about body weight, body shape and eating than males. They diet more frequently, had self-induced vomiting, and used laxatives and exercise as their weight-loss strategies. Issues pertaining to body weight perception, eating attitudes and weight-loss strategies exist with differences among male and female undergraduates. Thus, in order to correct misperceptions among young adults, a more tailored intervention programme and more in-depth studies into the various factors involved are required.

Determinant Factors of Poor Visual Outcome After Ocular Trauma: A Retrospective Study in Central Sarawak, Malaysia.

Science.gov (United States)

Yong, Geng-Yi; Pan, Shin-Wei; Humayun Akhter, Faisal; Law, Thomas Ngo-Hieng; Toh, Teck-Hock

2016-01-01

To study the demographic characteristics of ocular trauma in Central Sarawak and identify the determinant factors of poor visual outcome. A retrospective study of ocular trauma cases presenting at the referral hospital in 2013. Patients were identified and recruited from hospital records. Those presenting for follow-up review were excluded. Case records were retrieved and reviewed after recruitment. We studied 168 patients with 179 ocular injuries, of which 44% were work related. Compared with non-work-related cases, work-related cases were more likely to be male [odds ratio (OR), 19.7; 95% confidence interval (CI), 2.6-150.9] and foreign (OR, 18.0; 95% CI, 2.3-142.0). Open globe injuries constituted a higher percentage of impaired visual acuity (VA) during the first visit: 84.6% compared with 18.1% for closed globe injuries (OR, 25.0; 95% CI, 5.3-118.4; P Sarawak were predominantly work related, occurring at industrial premises, and involving males and foreigners. Both open globe injuries and a delay in seeking treatment resulted in significantly poorer visual outcomes.

Development of Tropical Lowland Peat Forest Phasic Community Zonations in the Kota Samarahan-Asajaya area, West Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Mohamad Tarmizi Mohamad

2016-01-01

Full Text Available Logging observations of auger profiles (Tarmizi, 2014 indicate a vertical, downwards, general decrease of peat humification levels with depth in a tropical lowland peat forest in the Kota Samarahan-Asajaya area in the region of West Sarawak (Malaysia. Based on pollen analyses and field observations, the studied peat profiles can be interpreted as part of a progradation deltaic succession. Continued regression of sea levels, gave rise to the development of peat in a transitional mangrove to floodplain/floodbasin environment, followed by a shallow, topogenic peat depositional environment with riparian influence at approximately 2420 ± 30 years B.P. (until present time. The inferred peat vegetational succession reached Phasic Community I at approximately 2380 ± 30 years B.P. and followed by Phasic Community II at approximately 1780 ± 30 years B.P., towards the upper part of the present, ombrogenic, peat profile. Observations of the presence of large, hollow, Shorea type trees, supports that successive vegetational zonation of the tropical lowland peat dome may have reached Phasic Community II. Some pollen types were found that are also known to occur in the inferred vegetational zonation of Phasic Community III and IV or higher. Pollen analyses indicate that estuarine and deltaic, brackish to saline water influence may have gradually ceased at approximately 0.5 m below the lithological boundary between peat and underlying soil (floodplain deposit in the tropical lowland peat basin.

Gender and Racial Differences in the Cardiovascular Risk Factors among Overweight and Obese Rural Adults, Kuching and Samarahan Division, Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Whye Lian Cheah

2016-01-01

Full Text Available Objective. This study aimed to determine whether gender and ethnic differences had an effect on cardiovascular risk factors in overweight and obese rural adults in Sarawak. Design and Setting. This was a cross-sectional study conducted in rural communities in Kuching and Samarahan division, Malaysia. Data was obtained using a set of questionnaire (sociodemographic data and physical activity, measurement of blood pressure, height, weight (body mass index, BMI, body fat percentage, fasting blood sugar, and lipid profile from three ethnic groups—Iban, Malay, and Bidayuh. Analysis of data was done using SPSS version 23.0. Results. A total of 155 respondents participated in the study (81.6% response rate. The levels of physical activity, BMI status, body fat, hypercholesterolemia, and hyperglycemia were similar across the three ethnic groups and both females and males. Iban and Bidayuh had significant higher Atherogenic Index of Plasma (AIP when compared to the Malay (Bidayuh OR = 0.30, 95% CI 0.12, 0.78; Iban OR = 0.29, 95% CI 0.12, 0.69. Conclusions. The relationship between cardiovascular risk factors varied according to ethnic groups and gender. A better understanding of these differences would help in the design and implementation of intervention programme for the prevention of cardiovascular disease.

Gender and Racial Differences in the Cardiovascular Risk Factors among Overweight and Obese Rural Adults, Kuching and Samarahan Division, Sarawak, Malaysia.

Science.gov (United States)

Cheah, Whye Lian; Chang, Ching Thon; Hazmi, Helmy; Wan Muda, Wan Manan

2016-01-01

Objective . This study aimed to determine whether gender and ethnic differences had an effect on cardiovascular risk factors in overweight and obese rural adults in Sarawak. Design and Setting . This was a cross-sectional study conducted in rural communities in Kuching and Samarahan division, Malaysia. Data was obtained using a set of questionnaire (sociodemographic data and physical activity), measurement of blood pressure, height, weight (body mass index, BMI), body fat percentage, fasting blood sugar, and lipid profile from three ethnic groups-Iban, Malay, and Bidayuh. Analysis of data was done using SPSS version 23.0. Results . A total of 155 respondents participated in the study (81.6% response rate). The levels of physical activity, BMI status, body fat, hypercholesterolemia, and hyperglycemia were similar across the three ethnic groups and both females and males. Iban and Bidayuh had significant higher Atherogenic Index of Plasma (AIP) when compared to the Malay (Bidayuh OR = 0.30, 95% CI 0.12, 0.78; Iban OR = 0.29, 95% CI 0.12, 0.69). Conclusions. The relationship between cardiovascular risk factors varied according to ethnic groups and gender. A better understanding of these differences would help in the design and implementation of intervention programme for the prevention of cardiovascular disease.

Assessment Profile of Malaysia: High-Stakes External Examinations Dominate

Science.gov (United States)

Ong, Saw Lan

2010-01-01

Malaysia is a federation of 13 states located in South-east Asia. The country consists of two geographical regions; Peninsular Malaysia (also known as West Malaysia) and Malaysian Borneo (also known as East Malaysia) separated by the South China Sea. The educational administration in Malaysia is highly centralised with four hierarchical levels;…

High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group.

Science.gov (United States)

Tan, Jin-Ai Mary Anne; Lee, Ping-Chin; Wee, Yong-Chui; Tan, Kim-Lian; Mahali, Noor Fadzlin; George, Elizabeth; Chua, Kek-Heng

2010-01-01

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

Effects of light and soil flooding on the growth and photosynthesis of ramin (Gonystylus bancanus) seedlings in Malaysia

NARCIS (Netherlands)

Jans, W.W.P.; Dibor, L.; Verwer, C.C.; Kruijt, B.; Tan, S.; Meer, van der P.J.

2012-01-01

We studied the ecophysiology of ramin (Gonystylus bancanus) seedlings in an experimental set up at the Forest Research Centre in Kuching, Sarawak, Malaysia. Ramin seedlings were grown on flooded and drained peat soil under 100, 76, 46 and 23% sunlight, thus simulating effects of different light

Malaysia (country/area statements).

Science.gov (United States)

1985-09-01

According to this statement presented to the Committee on Population of the UN Economic and Social Commission for Asia and the Pacific, Malaysia by 1984 achieved a crude death rate of 5.3/1000, an infant mortality rate of 17/1000 live births, and a 1983 life expectancy at birth of 67.6 for males and 72.3 for females due primarily to socioeconomic development, better nutrition, and a health system covering 95% of the rural population. Substantial mortality differentials still exist between Peninsular Malaysia, Sabah, and Sarawak, between urban and rural areas, and among ethnic groups. Differences in the coverage and quality of mortality statistics also exist. 83.2% of Malaysia's total population of 15.5 million is in Peninsular Malaysia, 7.3% in Sabah, and 9.5% in Sarawak. In Peninsular Malaysia, 55.1% are Malays, 33.9% Chinese, and 10.3% Indians. About 40% of the population is urban, and 39% is under age 15. The average annual rate of growth declined from 2.6% in the 1960s to 2.3% in the 1970s. The total fertility rate fell from 5.1 children in 1970 to 4.1 in 1980. A rise in age at 1st marriage and reduction in marital fertility have been partly offset by an increase in the proportion of women of childbearing age. The population is projected to grow to about 22 million by the year 2000. Chinese and Indians are expected to approach replacement level fertility by that year, but Malay fertility is expected to remain high for some time. Internal migration, 45% of which is intrarural, increased markedly in the 1970s, probably due to rapid modernization, industrialization, land development, and regional imbalances in economic development. In absolute terms a total of 410,000 persons moved from rural to urban areas during the 1970s. Important progress has been made in regional development programs, but further regional development requires resolution of problems related to internal migration and greater efforts to relocate industries in the less developed areas. The

Malaysia.

Science.gov (United States)

1988-08-01

In this discussion of Malaysia, attention is directed to the following: geography; the people; history; government; political conditions; the economy; defense; foreign relations; and relations between the US and Malaysia. In 1987 Malaysia's population was estimated to be 16.5 million with an annual growth rate of 2.6%. The infant mortality rate is 25/1000 with a life expectancy of 66 years. Peninsular Malaysia borders Thailand in the north and is separated from Singapore in the south by the narrow Johore Strait. About 50% of the area is covered by tropical jungle. The population distribution is uneven, with some 13.5 of the 16.5 million residents concentrated on the Peninsular Malaysia lowlands. The Malays, the largest population group, make up 49%. Nearly 1/3 of the Malaysians are Chinese, and Malaysians of Indian descent comprise slightly over 9% of the population. The early Buddhist Malay kingdom of Srivijaya, based at what currently is Palembang, Sumatra, dominated much of the Malay Peninsula from the 9th to the 13th centuries A.D. Full European control over the sultanates of the Malay Peninsula, Sabah, and Sarawak was not achieved until the latter half of the 19th century. During British control, a well-ordered system of public administration was created, public services were extended, and large-scale rubber and tin production was developed. Colonial rule was interrupted by the Japanese invasion and occupation from 1942-45. Malaysia achieved independence on August 31, 1957, and is a constitutional monarchy, nominally headed by the Yang di-Pertuan Agong, or paramount ruler. The ruler also is the leader of the Islamic faith in Malaysia. Executive power is vested in the Cabinet, led by the prime minister. The Malaysian legal system is based on English common law. The currently ruling Barisan Nasional, formed in 1973, includes 13 parties, among them the chief components of the former Alliance, a coalition of community-based parties. Malaysia's economic record is 1

Duration of detection of anti-BmR1 IgG4 antibodies after mass-drug administration (MDA) in Sarawak, Malaysia.

Science.gov (United States)

Noordin, R; Muhi, J; Md Idris, Z; Arifin, N; Kiyu, A

2012-03-01

The detection rates of brugian filariasis in three regions of Sarawak namely Central, North and South after three courses of mass drug administration (MDA) from year 2004 to 2006 was investigated. A recombinant BmR1 antigen-based IgG4 detection test, named Brugia Rapid and night blood smear for microfilaria (mf) detection were used. All three regions recorded a sharp fall in mf positive rates after a year post-MDA. Meanwhile Brugia Rapid positive rates declined more gradually to 3.8% and 5.6% of the pre-MDA levels in the Central and North regions, respectively. This study showed that in filariasis endemic areas in Sarawak, anti-filarial IgG4 antibodies to BmR1, as detected by the Brugia Rapid test, were positive for one to two years after mf disappearance.

An Exploration Study of RimbaIlmu: A Qualitative Evaluation of Shared Single Display Groupware in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Cheah Waishiang

2015-02-01

Full Text Available Shared single display groupware that enables collaboration among people from different cultures and social practices encourages peer learning and teaching, whilst strengthening communication skills. It has been successfully evaluated in remote schools in China and India. Due to this, the question arises whether it can be deployed in rural schools or semi-urban schools in Sarawak? What are the issues and challenges? What are the impact of this technology among the students and teachers? This paper investigates the deployment of shared single display groupware in rural and semi-urban schools in Sarawak (one of the Malaysian states. We introduce a shared single display application, RimbaIlmu, in one semi-urban school and one rural school and conduct qualitative analysis from the observations among the participants. Observational data has shown that RimbaIlmu is able to stimulate collaboration between different genders; an engaging technology among students; a tool for group and individual assessment; a tool to facilitate leadership skills; fun to play with; allows ease of lab management and control; enabling novices to learn computers; promoting membership in collaboration learning and finally provide environment for task accomplishment with minimum teacher intervention.

Notes on the genus Amorphophallus (Araceae) — 11 New and obsolete species from East Malaysia and continental Southeast Asia

NARCIS (Netherlands)

Hetterscheid, W.L.A.; Ham, van der R.W.J.M.

2001-01-01

Sixteen new Amorphophallus (Araceae) species from East Malaysia, Thailand and Vietnam are described and figured. Moreover, six species, four of which were originally published by the first author, are synonymized.

Factor associated with tobacco use among the adult population in Sarawak, Malaysia: a cross sectional study

Directory of Open Access Journals (Sweden)

Mizanur Rahman

2015-01-01

Full Text Available Introduction: Consumption of tobacco in any form is one of the leading causes of preventable mortality. The World Health Organization recommends that it should be monitored regularly.  This study was designed to estimate the prevalence of tobacco use among the rural adult population in Sarawak and factors associated with it.Methods: This was a cross-sectional study conducted among the adult population in Sarawak. Data were collected from ten villages in Kota Samarahan and Kuching Division by face to face interview using modified Global Adult Tobacco Survey questionnaire. Non-probability sampling method was adopted to select the villages. All the households of the villages were visited and an adult member was selected randomly from each house irrespective of the sex. After missing value imputation, 1000 data were analysed using statistical software SPSS 19.0 version.Results: Analysis showed that 30.9% of the respondents were current tobacco users and 11% were past tobacco users. The mean age (SD at starting tobacco was 18.1 (6.48 years. The frequency of tobacco use was 14 times per day.  Hierarchical Logistic regression analysis revealed that age with male sex (OR=1. 064, 95% CI: 1.052, 1.076, secondary education (OR=-2.712; 95% CI: 1.122, 6.555, higher secondary and above (OR=3. 571; 95% CI: 1.641,7.774, occupation as business (OR=3. 152; 95% CI: 1.732, 5.735 and environmental exposure such as smoking at working place (OR=2. 754;95% CI: 1.895,4.002, coffee house (OR=2. 274;95% CI: 1.32,3.919 and at home (OR=1. 827;95% CI: 1.242,2.687 appeared to be  important predictors of tobacco use (p<0.05.Conclusion: A large proportion of males use tobacco products. Though tobacco use was negligible among females, but they would be potential users. Environmental exposure to tobacco appeared to be important predictors. Tobacco control campaigns should target banning of tobacco use in closed and open areas and also to intensify the monitoring of all forms

Time series analysis of gold production in Malaysia

Science.gov (United States)

Muda, Nora; Hoon, Lee Yuen

2012-05-01

Gold is a soft, malleable, bright yellow metallic element and unaffected by air or most reagents. It is highly valued as an asset or investment commodity and is extensively used in jewellery, industrial application, dentistry and medical applications. In Malaysia, gold mining is limited in several areas such as Pahang, Kelantan, Terengganu, Johor and Sarawak. The main purpose of this case study is to obtain a suitable model for the production of gold in Malaysia. The model can also be used to predict the data of Malaysia's gold production in the future. Box-Jenkins time series method was used to perform time series analysis with the following steps: identification, estimation, diagnostic checking and forecasting. In addition, the accuracy of prediction is tested using mean absolute percentage error (MAPE). From the analysis, the ARIMA (3,1,1) model was found to be the best fitted model with MAPE equals to 3.704%, indicating the prediction is very accurate. Hence, this model can be used for forecasting. This study is expected to help the private and public sectors to understand the gold production scenario and later plan the gold mining activities in Malaysia.

TOURIST ARRIVALS AND ECONOMIC GROWTH IN SARAWAK

OpenAIRE

Lau, Evan; Oh, Swee-Ling; Hu, Sing-Sing

2008-01-01

This study empirically investigates the comovements and the causality relationship between tourist arrivals and economic growth in Sarawak during the period of 1972 to 2004. The empirical evidence clearly shows that the long run causality running from tourist arrivals to economic growth in the estimation period. As one of the income generator for Sarawak, the findings are consistent with economic theory and proffer important policy conclusions.

Optimal configuration assessment of renewable energy in Malaysia

Energy Technology Data Exchange (ETDEWEB)

Haidar, Ahmed M.A.; John, Priscilla N.; Shawal, Mohd [Faculty of Electrical and Electronics Engineering, University Malaysia Pahang, Lebuhraya Tun Razak, 26300 Gambang, Pahang (Malaysia)

2011-02-15

This paper proposes the use of a PV-wind-diesel generator hybrid system in order to determine the optimal configuration of renewable energy in Malaysia and to compare the production cost of solar and wind power with its annual yield relevant to different regions in Malaysia namely, Johor, Sarawak, Penang and Selangor. The configuration of optimal hybrid system is selected based on the best components and sizing with appropriate operating strategy to provide a cheap, efficient, reliable and cost-effective system. The various renewable energy sources and their applicability in terms of cost and performance are analyzed. Moreover, the annual yield and cost of energy production of solar and wind energy are evaluated. The Simulations were carried out using the HOMER program based on data obtained from the Malaysian Meteorological Centre. Results show that, for Malaysia, a PV-diesel generator hybrid system is the most suitable solution in terms of economic performance and pollution. However, the cost of production of solar and wind energy proved to be cheaper and more environmentally friendly than the energy produced from diesel generators. (author)

Genetic Programming for the Downscaling of Extreme Rainfall Events on the East Coast of Peninsular Malaysia

Directory of Open Access Journals (Sweden)

Sahar Hadi Pour

2014-11-01

Full Text Available A genetic programming (GP-based logistic regression method is proposed in the present study for the downscaling of extreme rainfall indices on the east coast of Peninsular Malaysia, which is considered one of the zones in Malaysia most vulnerable to climate change. A National Centre for Environmental Prediction reanalysis dataset at 42 grid points surrounding the study area was used to select the predictors. GP models were developed for the downscaling of three extreme rainfall indices: days with larger than or equal to the 90th percentile of rainfall during the north-east monsoon; consecutive wet days; and consecutive dry days in a year. Daily rainfall data for the time periods 1961–1990 and 1991–2000 were used for the calibration and validation of models, respectively. The results are compared with those obtained using the multilayer perceptron neural network (ANN and linear regression-based statistical downscaling model (SDSM. It was found that models derived using GP can predict both annual and seasonal extreme rainfall indices more accurately compared to ANN and SDSM.

A study on the power generation potential of mini wind turbine in east coast of Peninsular Malaysia

Science.gov (United States)

Basrawi, Firdaus; Ismail, Izwan; Ibrahim, Thamir Khalil; Idris, Daing Mohamad Nafiz Daing; Anuar, Shahrani

2017-03-01

A small-scale wind turbine is an attractive renewable energy source, but its economic viability depends on wind speed. The aim of this study is to determine economic viability of small-scale wind turbine in East Coast of Peninsular Malaysia. The potential energy generated has been determined by wind speed data and power curved of. Hourly wind speed data of Kuantan throughout 2015 was collected as the input. Then, a model of wind turbine was developed based on a commercial a 300W mini wind turbine. It was found that power generation is 3 times higher during northeast monsoon season at 15 m elevation. This proved that the northeast monsoon season has higher potential in generating power by wind turbine in East Coast of Peninsular Malaysia. However, only a total of 153.4 kWh/year of power can be generated at this condition. The power generator utilization factor PGUI or capacity ratio was merely 0.06 and it is not technically viable. By increasing the height of wind turbine to 60 m elevation, power generation amount drastically increased to 344 kWh/year, with PGUI of 0.13. This is about two-thirds of PGUI for photovoltaic technology which is 0.21 at this site. If offshore condition was considered, power generation amount further increased to 1,328 kWh/year with PGUI of 0.51. Thus, for a common use of mini wind turbine that is usually installed on-site at low elevation, it has low power generation potential. But, if high elevation as what large wind turbine needed is implemented, it is technically viable option in East Coast of Peninsular Malaysia.

Malaysia in international regional relationships

International Nuclear Information System (INIS)

Kamarulnizam Abdullah

2010-01-01

The changes in the international system saw the structure and survival issues that grip the country will also change. The main challenge to the nation is how to adapt these changes that running quite rapidly and outside the country's ability to cope alone. Issues and global structural changes also affect the international system of East Asia region that contains two important sub-Southeast Asia and Northeast Asia. Changes inherent in both these sub certainly affect the foreign policy and diplomacy, security and bilateral relations between Malaysia and other countries. Malaysia is not a global power capable of changing the international system. However, Malaysia is an important country in East Asia that has contributed to the prosperity of this region. The big question is how to adapt these changes into the Malaysia international regional policy and bilateral relations? What extent international issues affecting the regional survival of the country? What is the contribution to regional stability of Malaysia? This book explores the impact of selective regional issues to Malaysia, while also discussing the role and response to changes in regional Malaysia since the country gained independence. (author)

Cavernicolous And Terrestrial Decapod Crustacea From Northern Sarawak, Borneo

NARCIS (Netherlands)

Holthuis, L.B.

1979-01-01

During the 1977-1978 Royal Geographical Society Mulu (Sarawak) Expedition a number of Decapod Crustacea was obtained. Some were collected by Mr. Philip Chapman in the course of studies of the invertebrates of the limestone caves in the Gunong Mulu National Park, 4th Division of Sarawak, and the Niah

Evaluation of cadmium bioaccumulation and translocation by Hopea ...

African Journals Online (AJOL)

parisa

2012-04-10

Apr 10, 2012 ... 6Faculty of Resource Science and Technology, Universiti Malaysia Sarawak, Sarawak, Malaysia. Accepted 19 December, 2011. Cadmium (Cd) contamination has an adverse effect on soil productivity and ...... J. Food, Agric.

Behavior and distribution of 226Ra and 228Ra in the east coast of Peninsular Malaysia marine environment

International Nuclear Information System (INIS)

Nurrul Assyikeen Mohd Jaffary; Zal Uyun Wan Mahmood; Zaharudin Ahmad; Yii, Mei Wo; Kamarozaman Ishak

2010-01-01

The present distributions of 226 Ra, 228 Ra and activity ratios of 228 Ra/ 226 Ra covering the east coast of Peninsular Malaysia were studied. Sediment core samples were collected at 10 identified stations with the thickness of water column between 14 - 72 m depth during the cruise conducted in 2008. Activity concentrations of 226 Ra and 228 Ra in sediment cores of the studied area were in the range of 18.95 ±4.25 Bq/ kg to 46.48 ± 6.41 Bq/ kg dry wt. and 35.50 ± 7.50 Bq/ kg to 77.10 ±11.37 Bq/ kg dry wt., respectively. Meanwhile, the calculated activity ratios of 228 Ra/ 226 Ra were varied mostly 1.48 to 2.24. The finding showed that there has relationships between 226 Ra, 228 Ra and oceanographic parameters which are can be attributed for better understanding of its transport processes and behavior in the east coast of Peninsular Malaysia marine environment. (author)

Studies of lagoon ash from Sarawak to assess the impact on the environment

Energy Technology Data Exchange (ETDEWEB)

Prabir Kumar Kolay; Harwant Singh [University Malaysia Sarawak, Sarawak (Malaysia). Dept. of Civil Engineering

2010-02-15

Coal utilization, mainly in thermal power plants, has increased significantly from 4.2 to 13 million tonnes within 2000 to 2005, which resulted in the production of approximately 2 million tonnes of coal ash in Malaysia. Of this only a small percentage is used as a cement ingredient, in concrete industry, as a fill material, etc. and with the rest of the amount being disposed in ash ponds or lagoons. If the lagoons are not properly designed with a landfill liner or if there is spillage from the ash pond, the toxic heavy metal present in coal ash can result in the contamination of the subsurface soil and the ground water. The concentration of heavy metals or trace elements in coal residues depends on the composition of a particular parent coal and the bulk utilization of lagoon ash for various purposes requires a complete characterization of the ash. Hence, this paper analyzes the coal ash for its trace element content and characterizes mainly physical, chemical, mineralogical, morphological and thermal properties of the lagoon ash from a local coal based thermal power plant from Sarawak, Malaysia. The results also indicated that, the concentration of some trace elements is quite high from the environmental perspective in this particular lagoon ash. 43 refs., 4 figs., 4 tabs.

Indo-Pacific Humpback Dolphins in Borneo: A Review of Current Knowledge with Emphasis on Sarawak.

Science.gov (United States)

Minton, Gianna; Zulkifli Poh, Anna Norliza; Peter, Cindy; Porter, Lindsay; Kreb, Danielle

2016-01-01

Indo-Pacific humpback dolphins (Sousa chinensis) are documented from various locations along Borneo's coast, including three sites in Sarawak, Malaysia, three sites in Sabah, Malaysia, three locations in Kalimantan, Indonesia and the limited coastal waters of the Sultanate of Brunei. Observations in all these areas indicate a similar external morphology, which seems to fall somewhere between that documented for Chinese populations known as S. chinensis, and that of Sousa sahulensis in Australia and Papua New Guinea. Sightings occur in shallow nearshore waters, often near estuaries and river mouths, and associations with Irrawaddy dolphins (Orcaella brevirostris) are frequently documented. Population estimates exist for only two locations and sightings information throughout Borneo indicates that frequency of occurrence is rare and group size is usually small. Threats from fisheries by-catch and coastal development are present in many locations and there are concerns over the ability of these small and fragmented populations to survive. The conservation and taxonomic status of humpback dolphins in Borneo remain unclear, and there are intriguing questions as to where these populations fit in our evolving understanding of the taxonomy of the genus. © 2016 Elsevier Ltd. All rights reserved.

A new species of Rock Gecko genus Cnemaspis (Squamata: Gekkonidae) from Western Sarawak, Malaysia.

Science.gov (United States)

Kurita, Takaki; Nishikawa, Kanto; Matsui, Masafumi; Hikida, Tsutomu

2017-05-03

A new species of Asian rock gecko, genus Cnemaspis, is described from Padawan, western Sarawak, Malaysian Borneo. The new species forms a clade with C. paripari and C. nigridia of the C. nigridia group in a mitochondrial DNA phylogeny and is similar to them morphologically in some characters such as caudal scalation. It differs from the other Asian Cnemaspis species in its unique combination of snout-vent length (up to 62.7 mm), 4-9 precloacal pores in males, keeled subcaudals with an enlarged, smooth, median row, presence of ventrolateral caudal tubercles, and coloration (head and upper flanks dark-yellow; anterior portion of tail black; posterior portion of tail white with black, paravertebral blob). Phylogenetic relationships within the C. nigridia group and the distributional ranges of species within the group suggest allopatric speciation by geographic isolation.

Study of Landslide Disaster Prevention System in Malaysia as a Disaster Mitigation Prototype for South East Asia Countries

Science.gov (United States)

Koay, Swee Peng; Fukuoka, Hiroshi; Tien Tay, Lea; Murakami, Satoshi; Koyama, Tomofumi; Chan, Huah Yong; Sakai, Naoki; Hazarika, Hemanta; Jamaludin, Suhaimi; Lateh, Habibah

2016-04-01

Every year, hundreds of landslides occur in Malaysia and other tropical monsoon South East Asia countries. Therefore, prevention casualties and economical losses, by rain induced slope failure, are those countries government most important agenda. In Malaysia, millions of Malaysian Ringgit are allocated for slope monitoring and mitigation in every year budget. Besides monitoring the slopes, here, we propose the IT system which provides hazard map information, landslide historical information, slope failure prediction, knowledge on natural hazard, and information on evacuation centres via internet for user to understand the risk of landslides as well as flood. Moreover, the user can obtain information on rainfall intensity in the monitoring sites to predict the occurrence of the slope failure. Furthermore, we are working with PWD, Malaysia to set the threshold value for the landslide prediction system which will alert the officer if there is a risk of the slope failure in the monitoring sites by calculating rainfall intensity. Although the IT plays a significant role in information dissemination, education is also important in disaster prevention by educating school students to be more alert in natural hazard, and there will be bottom up approach to alert parents on what is natural hazard, by conversion among family members, as most of the parents are busy and may not have time to attend natural hazard workshop. There are many races living in Malaysia as well in most of South East Asia countries. It is not easy to educate them in single education method as the level of living and education are different. We started landslides education workshops in primary schools in rural and urban area, in Malaysia. We found out that we have to use their mother tongue language while conducting natural hazard education for better understanding. We took questionnaires from the students before and after the education workshop. Learning from the questionnaire result, the students are

The final spawning ground of Tachypleus gigas (Muller, 1785) on the east Peninsular Malaysia is at risk: A call for action.

Digital Repository Service at National Institute of Oceanography (India)

Nelson, B.R.; Satyanarayan, B.; Moh, J.H.Z.; Ikhwanuddin, M.; Chatterji, A.; Shaharom, F.

Tanjung Selongor and Pantai Balok (State Pahang) are the only two places known for spawning activity of the Malaysian horseshoe crab - Tachypleus gigas (Muller, 1785) on the east coast of Peninsular Malaysia. While the former beach has been...

A Study on Energy Security for Electricity Generation in Peninsular Malaysia

International Nuclear Information System (INIS)

Fairuz Suzana Mohd Chachuli

2013-01-01

The study was analyzed 12 case studies comprises of energy strategies proposed by the Government for electricity generation in Peninsular Malaysia using the simulation by Model for Energy Supply System Alternatives and their General Environmental Impacts (MESSAGE) software for period of year 2009 until 2030. From this study it was found that the appropriate and efficient case study to overcome the energy security issues in Peninsular Malaysia is integrated energy strategies particularly on nuclear energy, electricity import from Sarawak and the development of renewable energy resources. The total expansion cost for the case study is RM19.489 billion with the increament only 3.27 % compared with reference case. The total CO 2 emission for this scenario is 1.825 M tonne with declination up to 27.16 % compared with reference case. Due to limited time and crucial problem on domestic natural gas supply to the power generation industry, the Government should formulate a comprehensive energy strategy to support the mission of Malaysia to become one of the developed country and high income country by year 2020. (author)

Characterization of the coal derived humic acids from Mukah, Sarawak as soil conditioner

Directory of Open Access Journals (Sweden)

Fong Sim Siong

2006-01-01

Full Text Available In Malaysia, abundant coal resources were found in Sarawak and Sabah. The utilization of coal resources, to date, is emphasized on the energy productions. The non-energy utilization as soil conditioner is unexplored. Therefore, this study attempted to characterize the coal humic acids extracted from Mukah coal and to evaluate its properties as soil conditioner. The coal humic acids from the regenerated sample were also assessed. The results revealed that different extractants and concentrations influenced the properties of humic acids. The extraction with KOH at 0.5 mol L-1 produced humic acids with low ash content and high acidic functional groups, which are substantial as soil conditioner. However, the yield was low. Regeneration of coal sample with 10% nitric acids improved the yield to an average of 83.45%. The acidic functional groups of nitrohumic acids were improved with the ash content remained at a low level.

Emotional and behavioral problems among adolescent smokers and their help-seeking behavior.

Science.gov (United States)

Muthupalaniappen, Leelavathi; Omar, Juslina; Omar, Khairani; Iryani, Tuti; Hamid, Siti Norain

2012-09-01

We carried out a cross sectional study to detect emotional and behavioral problems among adolescents who smoke and their help-seeking behavior. This study was conducted in Sarawak, East Malaysia, between July and September 2006. Emotional and behavioral problems were measured using the Youth Self-Report (YSR/11-18) questionnaire; help seeking behavior was assessed using a help-seeking questionnaire. Three hundred ninety-nine students participated in the study; the smoking prevalence was 32.8%. The mean scores for emotional and behavioral problems were higher among smokers than non-smokers in all domains (internalizing, p = 0.028; externalizing, p = 0.001; other behavior, p = 0.001). The majority of students who smoked (94.7%) did not seek help from a primary health care provider for their emotional or behavioral problems. Common barriers to help-seeking were: the perception their problems were trivial (60.3%) and the preference to solve problems on their own (45.8%). Our findings suggest adolescent smokers in Sarawak, East Malaysia were more likely to break rules, exhibit aggressive behavior and have somatic complaints than non-smoking adolescents. Adolescent smokers preferred to seek help for their problems from informal sources. Physicians treating adolescents should inquire about smoking habits, emotional and behavioral problems and offer counseling if required.

Distribution of naturally occurring radionuclides activity concentration in East Malaysian marine sediment

Energy Technology Data Exchange (ETDEWEB)

Yii, M.W. [Malaysian Nuclear Agency (Nuclear Malaysia), Bangi, 43000 Kajang (Malaysia)], E-mail: yii@nuclearmalaysia.gov.my; Zaharudin, A.; Abdul-Kadir, I. [Malaysian Nuclear Agency (Nuclear Malaysia), Bangi, 43000 Kajang (Malaysia)

2009-04-15

Studies of naturally occurring radioactive materials (NORM) distribution of {sup 226}Ra, {sup 228}Ra and {sup 40}K in East Malaysia were carried out as part of a marine coastal environment project. The results of measurements will serve as baseline data and background reference level for Malaysia coastlines. Sediments from 21 coastal locations and 10 near shore locations were collected for analyses. The samples were dried, finely ground, sealed in a container and stored for a minimum of 30 days to establish secular equilibrium between {sup 226}Ra and {sup 228}Ra and their respective radioactive progenies. They were counted using a high-purity germanium (HPGe) spectrometer covering the respective progeny energy peak. For {sup 40}K, the presence of this was measured directly via its 1460 keV energy peak. The concentration of {sup 226}Ra, {sup 228}Ra and {sup 40}K in samples obtained from coastal Sarawak ranged between 23 and 41 (mean 30{+-}2) Bq/kg, 27 and 45 (mean 39{+-}4) Bq/kg and 142 and 680 (mean 462{+-}59) Bq/kg, respectively. Meanwhile, the concentration of {sup 226}Ra, {sup 228}Ra and {sup 40}K for samples obtained from coastal Sabah ranged between 16 and 30 (mean 23{+-}2) Bq/kg, 23 and 45 (mean 35{+-}4) Bq/kg and 402 and 842 (mean 577{+-}75) Bq/kg, respectively. For the Sarawak near shore stations, the concentration of {sup 226}Ra, {sup 228}Ra and {sup 40}K ranged between 11 and 36 (mean 22{+-}2) Bq/kg, 21 and 65 (mean 39{+-}5) Bq/kg and 149 and 517 (mean 309{+-}41) Bq/kg, respectively. Meanwhile, the concentration of {sup 226}Ra, {sup 228}Ra and {sup 40}K for samples obtained from Sabah ranged between 9 and 31 (mean 14{+-}2) Bq/kg, 10 and 48 (mean 21{+-}3) Bq/kg and 140 and 580 (mean 269{+-}36) Bq/kg, respectively. The calculated external hazard values of between 0.17 and 0.33 (less than unity) showed that there is little risk of external hazard to the workers handling the sediments.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

PAEDIATRIC OCULAR TRAUMA IN KUCHING, SARAWAK, MALAYSIA

Directory of Open Access Journals (Sweden)

INTAN G

2011-01-01

Full Text Available Purpose: To evaluate the demography, aetiology, type and outcome of paediatric ocular trauma in tertiary centre in Malaysia. Method: We retrospectively studied 118 eyes from 117 patients over a period of 36 months (January 2006 to December 2008. All ocular injuries in patients aged 12 and below seen in the Ophthalmology Department for the first time were included in thisstudy. Results: Mean age of patients was 6.1±3.0 years. 68 cases (58.2% occurred in pre-school children, whereas 49 (41.9% in school-aged children. Boys accounted for 65.8% of cases. There was no predilection for either right or the left eye. 47% of cases (56 patients occurred in Malay. Most of the injuries took place at home when the children were alone (p<0.05. Sharp objects were the commonest cause (45 cases, 38.1%. The majority of cases (103, 87.3% were considered preventable. The frequency of open and closed globe injury was similar. Hyphema was more common in closed globe injury compared to open globe injury (p<0.05. Other associated injuries such as cataract, vitreous hemorrhage and retinal hemorrhage are similar between the two groups. Visual outcome is generally poor with only 34 eyes (28.8% had no visual impairment. Conclusion: Ocular trauma in children is an important cause of visual loss. Most cases occurred at home and were preventable. Prevention through education is the best approach.

Distribution of 210Pb activity concentrations in marine surface sediments within East Coast Peninsula Malaysia Exclusive Economic Zone (EEZ)

International Nuclear Information System (INIS)

Ahmad Sanadi Abu Bakar; Zaharudin Ahmad

2010-01-01

A sampling expedition into the East Coast Peninsula Malaysia Exclusive Economic Zone (EEZ) was carried in June 2008. Marine surface sediment samples were taken and the activity concentrations of 210 Pb have been determined. Its distribution was plotted and the findings show that the activity concentrations decline from north to south. On the other hand, the activity concentrations are increasing from west to east right to the edge of the EEZ. The highest activity concentrations were found to be near offshore oil platforms. The 210 Pb activity concentrations were found to be in the range of 18.3 - 123.1 Bq/ kg. (author)

KELAS MENENGAH, UMNO DAN INTELIGENSIA: TENTANGAN DOMINASI POLITIK BUMIPUTERA ISLAM DI SARAWAK (MIDDLE CLASS, UMNO AND INTELLIGENTSIA: CONTESTING THE MUSLIM BUMIPUTERA'S POLITICAL DOMINATION IN SARAWAK

Directory of Open Access Journals (Sweden)

Faisal S. Hazis

2011-01-01

Full Text Available Barisan Nasional mulai mendominasi politik Sarawak setelah pemimpin bumiputera Islam mengambil alih tampuk pemerintahan negeri daripada pemimpin Iban selepas pilihan raya 1970. Di bawah teraju pemimpin bumiputera Islam ini, Barisan Nasional berjaya menguasai setiap pilihan raya negeri dan parlimen yang diadakan sejak tahun 1970 hingga 2008. Walaupun parti pembangkang melancarkan tentangan sengit pada lewat 1970-an dan pertengahan 1980-an, pemimpin bumiputera Islam ini berjaya mengatasinya untuk terus mengekalkan dominasi parti pemerintah di negeri yang mempunyai bilangan kerusi negeri dan parlimen yang terbanyak. Makalah ini menyusuri dominasi politik pemimpin bumiputera Islam Sarawak dan faktor-faktor yang menyumbang kepada kekuatan mereka yang menjangkau lebih empat dekad. Walaupun kuasa politik pemimpin bumiputera Islam masih bertahan sehingga ke hari ini, beberapa sumber baharu mulai muncul untuk memberikan tentangan terhadap kuasa politik golongan minoriti ini. Sumber tentangan baharu yang dimaksudkan ialah golongan kelas menengah, United Malays National Organisation (UMNO dan inteligensia. Makalah ini mengupas tentangan yang diberikan kelompok ini dan impaknya terhadap politik Sarawak khususnya kepimpinan bumiputera Islam.The ruling Barisan Nasional started to dominate Sarawak politics after the Muslim bumiputera took over the state leadership from the Iban after the 1970 elections. Under the stewardship of the Muslim bumiputera, Barisan Nasional had successfully dominated every state and parliamentary elections held since 1970 to 2008. Although the opposition parties launched a strong challenge towards the Muslim bumiputera's dominance in the late 1970s and middle 1980s, the latter was able to fend off this challenge and continued to uphold the ruling party's grip on the state with the largest number of state and parliamentary seats. This article analyses the Muslim bumiputera's dominance in Sarawak politics and the factors that had

Atmospheric 210Pb changes during monsoon in east and west coast of Peninsular Malaysia

International Nuclear Information System (INIS)

Siti Munirah Johari; Che Abdul Rahim Mohamed

2013-01-01

Full-text: 210 Pb is widely used as an atmospheric tracer as its parent, 222 Rn is continuously produced in the atmosphere from soil emanation. This study was conducted to observe the changes of 210 Pb activity based on temporal and spatial factor using PM10 samples. PM10 were sampled by Malaysian Meteorological Department in four station consist of two station from both east and west coast of Peninsular Malaysia in 2007. Activity level of 210 Pb was determined using the Tennelec XLB-5 Gross Alpha-Beta Counter, Canberra, after the ingrowth of 210 Pb by the outgrowth of 210 Bi. Basically, the analysed result showed that three to four significant peaks during northeast monsoon, southwest monsoon and inter monsoon. For east coast which comprises Kuantan and Mersing stations, the highest 210 Pb activity in Kuantan was in April and June with 45.73 ± 3.66 mBq/ kg and 48.20 ± 3.33 mBq/ kg, respectively. While in Mersing, 210 Pb activity showed the highest in April and July with 45.77 ± 2.67 mBq/ kg and 44.21 ± 2.42 mBq/ kg, respectively. As for the west coast, it comprises Setiawan and Chuping stations. Setiawan station showed the highest 210 Pb activity in October and July with 48.90 ± 2.52 mBq/ kg and 44.09 ± 2.34 mBq/ kg, respectively. Chuping showed the highest 210 Pb activity in March and October with 39.96 ± 1.94 mBq/ kg and 14.98 ± 0.80 mBq/ kg, respectively. It shows that 210 Pb activity in Chuping is much lower than in Setiawan because of its location is in a rural area. This study showed that during southwest monsoon from May to September, it clearly showed that 210 Pb activity is higher in west coast than in east coast as wind sources come from southwest of Peninsular Malaysia. (author)

Elevated blood pressure and its predictors among secondary school students in Sarawak: a cross-sectional study.

Science.gov (United States)

Grace Kho, Woei Feng; Cheah, Whye Lian; Hazmi, Helmy

2018-03-01

Hypertension is a health issue affecting adolescents. Accumulating evidence affirms that elevated blood pressure begins in childhood and tracks into adulthood. This cross-sectional study was conducted to determine the prevalence of elevated blood pressure and its predictors among secondary school students in Sarawak, Malaysia. A total of 2,461 secondary school students aged 12-17 years from 19 schools in Sarawak participated in the study. Questionnaire was used to obtain socio-demographic data, parental history of hypertension, and self-reported physical activity. Anthropometric and blood pressure measurements were taken. Data was entered and analysed using SPSS version 23.0. The prevalence of adolescents with elevated blood pressure, overweight, central obesity, and overfat were 30.1%, 24.3%, 13.5%, and 6.7%, respectively. Multivariate logistic regression demonstrated the predictors significantly associated with elevated blood pressure among respondents: overweight (adjusted odds ratio=3.144), being male (adjusted odds ratio=3.073), being Chinese (adjusted odds ratio=2.321) or Iban (adjusted odds ratio=1.578), central obesity (adjusted odds ratio=2.145), being overfat (adjusted odds ratio=1.885), and being an older adolescent (adjusted odds ratio=1.109). Parental history of hypertension, locality, and physical activity showed no significant associations. The obesity epidemic must be tackled at community and school levels by health education and regulation of school canteen foods. Copyright© by the National Institute of Public Health, Prague 2018.

Malaysia: World Oil Report 1991

International Nuclear Information System (INIS)

Khin, J.A.

1991-01-01

This paper reports that the Malaysian government announced tax incentives for fiscal year 1991/92 by cutting export duties on crude oil to encourage companies to develop more oil fields. The export duty exemption on cost recovery oil was increased from the current 20% to 50% on April 1, 1991. Nearly 115,200 sq mi of shallow-water acreage off Malaysia has been awarded to PS contractors, leaving only about five blocks remaining. Therefore, Petronas plans to award deeper water blocks (water depths of 655 ft or more) in the second half of this year, once terms are finalized. It is understood that these areas will be offshore of Sarawak and Sabah, covering in excess of 38,000 sq mi. Petronas the that there would be some improvement in the PSC terms for the deep-water areas

Four Simple Questions: Evaluating the Effectiveness of Half-Day Community Workshops Designed to Increase Awareness of Coastal Cetacean Conservation Issues in Sarawak, Malaysia

Science.gov (United States)

Minton, Gianna; Poh, Anna Norliza Zulkifli; Ngeian, Jenny; Peter, Cindy; Tuen, Andrew Alek

2012-01-01

Community workshops were held in coastal locations in Sarawak to raise awareness of cetacean conservation. Interviews were conducted up to 2 years later in four "workshop communities" as well as four villages where workshops were not conducted. Comparison of responses between respondents who had attended workshops (n = 127) versus those…

An integrated study of geochemistry and mineralogy of the Upper Tukau Formation, Borneo Island (East Malaysia): Sediment provenance, depositional setting and tectonic implications

Science.gov (United States)

Nagarajan, Ramasamy; Roy, Priyadarsi D.; Kessler, Franz L.; Jong, John; Dayong, Vivian; Jonathan, M. P.

2017-08-01

An integrated study using bulk chemical composition, mineralogy and mineral chemistry of sedimentary rocks from the Tukau Formation of Borneo Island (Sarawak, Malaysia) is presented in order to understand the depositional and tectonic settings during the Neogene. Sedimentary rocks are chemically classified as shale, wacke, arkose, litharenite and quartz arenite and consist of quartz, illite, feldspar, rutile and anatase, zircon, tourmaline, chromite and monazite. All of them are highly matured and were derived from a moderate to intensively weathered source. Bulk and mineral chemistries suggest that these rocks were recycled from sedimentary to metasedimentary source regions with some input from granitoids and mafic-ultramafic rocks. The chondrite normalized REE signature indicates the presence of felsic rocks in the source region. Zircon geochronology shows that the samples were of Cretaceous and Triassic age. Comparable ages of zircon from the Tukau Formation sedimentary rocks, granitoids of the Schwaner Mountains (southern Borneo) and Tin Belt of the Malaysia Peninsular suggest that the principal provenance for the Rajang Group were further uplifted and eroded during the Neogene. Additionally, presence of chromian spinels and their chemistry indicate a minor influence of mafic and ultramafic rocks present in the Rajang Group. From a tectonic standpoint, the Tukau Formation sedimentary rocks were deposited in a passive margin with passive collisional and rift settings. Our key geochemical observation on tectonic setting is comparable to the regional geological setting of northwestern Borneo as described in the literature.

Tree Flora of Sabah and Sarawak project – progress and future activities

NARCIS (Netherlands)

Tan, H.S.; Nadiah, I.; Eryani, S.S.

2009-01-01

Tropical forests in Borneo (Brunei Darussalam, Kalimantan, Sabah and Sarawak) are considered as one of the twelve mega biodiversity centres in the world. However, until now, there is no up-to-date or complete documentation on the flora of the island. The Tree Flora of Sabah and Sarawak Project,

Above Ground Biomass-carbon Partitioning, Storage and Sequestration in a Rehabilitated Forest, Bintulu, Sarawak, Malaysia

International Nuclear Information System (INIS)

Kueh, J.H.R.; Majid, N.M.A.; Seca, G.; Ahmed, O.H.

2013-01-01

Forest degradation and deforestation are some of the major global concerns as it can reduce forest carbon storage and sequestration capacity. Forest rehabilitation on degraded forest areas has the potential to improve carbon stock, hence mitigate greenhouse gases emission. However, the carbon storage and sequestration potential in a rehabilitated tropical forest remains unclear due to the lack of information. This paper reports an initiative to estimate biomass-carbon partitioning, storage and sequestration in a rehabilitated forest. The study site was at the UPM-Mitsubishi Corporation Forest Rehabilitation Project, UPM Bintulu Sarawak Campus, Bintulu, Sarawak. A plot of 20 x 20 m 2 was established each in site 1991 (Plot 1991), 1999 (Plot 1999) and 2008 (Plot 2008). An adjacent natural regenerating secondary forest plot (Plot NF) was also established for comparison purposes. The results showed that the contribution of tree component biomass/ carbon to total biomass/ carbon was in the order of main stem > branch > leaf. As most of the trees were concentrated in diameter size class = 10 cm for younger rehabilitated forests, the total above ground biomass/ carbon was from this class. These observations suggest that the forests are in the early successional stage. The total above ground biomass obtained for the rehabilitated forest ranged from 4.3 to 4,192.3 kg compared to natural regenerating secondary forest of 3,942.3 kg while total above ground carbon ranged from 1.9 to 1,927.9 kg and 1,820.4 kg, respectively. The mean total above ground biomass accumulated ranged from 1.3 x 10 -2 to 20.5 kg/ 0.04 ha and mean total carbon storage ranged from 5.9 x 10 -3 to 9.4 kg/ 0.04 ha. The total CO 2 sequestrated in rehabilitated forest ranged from 6.9 to 7,069.1 kg CO 2 / 0.04 ha. After 19 years, the rehabilitated forest had total above ground biomass and carbon storage comparable to the natural regeneration secondary forest. The forest rehabilitated activities have the

Design and Analysis of Photovoltaic (PV) Power Plant at Different Locations in Malaysia

Science.gov (United States)

Islam, M. A.; Hasanuzzaman, M.; Rahim, N. A.

2018-05-01

Power generation from sun oriented vitality through a photovoltaic (PV) system is ended up prevalent over the world due to clean innovation. Geographical location of Malaysia is very favorable for PV power generation system. The Malaysian government has also taken different steps to increase the use of solar energy especially by emphasizing on building integrated PV (BIPV) system. Comparative study on the feasibility of BIPV installation at the different location of Malaysia is rarely found. On the other hand, solar cell temperature has a negative impact on the electricity generation. So in this study cost effectiveness and initial investment cost of building integrated grid connected solar PV power plant in different regions of Malaysia have been carried. The effect of PV solar cell temperature on the payback period (PBP) is also investigated. Highest PBP is 12.38 years at Selangor and lowest PBP is 9.70 years at Sabah (Kota Kinabalu). Solar cell temperature significantly increases the PBP of PV plant and highest 14.64% and lowest 13.20% raise of PBP are encountered at Penang and Sarawak respectively.

Public Perception on Calligraphic Woodcarving Ornamentations of Mosques; a Comparison between East Coast and Southwest of Peninsula Malaysia

Directory of Open Access Journals (Sweden)

Ahmadreza Saberi

2015-12-01

Full Text Available Woodcarving ornamentation is considered as, a national heritage and can be found in many Malaysian mosques. Woodcarvings are mostly displayed in three different motifs, namely floral, geometry and calligraphy. The application of floral and geometry motifs is to convey an abstract meaning of Islamic teachings to the viewers. However, the calligraphic decorations directly express the messages of Allah almighty or the sayings of the prophets to the congregations. Muslims are the main users of mosques as these are places for prayers as well as other religious and community activities. Therefore, the assessment of users’ opinion about this type of decoration needs to be investigated. This paper aims to evaluate the perception of two groups of mosque users on the calligraphic woodcarving ornamentations from two regions, namely the East Coast and Southwest of Peninsula Malaysia. As Arabic is not the primary language in Malaysia, it would be interesting to find out how much of the calligraphic ornamentation is recognised and understood by the mosque users. The quantitative approach and questionnaire survey were adopted to fulfil the objectives of the study through convenient sampling where 420 questionnaire surveys were distributed at eight selected mosques. A total of 408 respondents amongst users completed and returned the survey forms. The mosques were chosen based on the abundance and diversity of calligraphy woodcarving elements found in the prayer hall. The Mann-Whitney U-test was conducted to find out the differences between the two groups of respondents. Ability of reading and understanding the Arabic scripts, the aesthetic values, the function, appropriate location and finally the desirability of scripts were assessed and compared between the participants of North East and Southwest of Peninsula Malaysia. The results showed that respondents of two areas in Malaysia had different opinions about this traditional sacred ornamentation in mosques

The Unified Levelling Network of Sarawak and its Adjustment

Science.gov (United States)

Som, Z. A. M.; Yazid, A. M.; Ming, T. K.; Yazid, N. M.

2016-09-01

The height reference network of Sarawak has seen major improvement in over the past two decades. The most significant improvement was the establishment of extended precise leveling network of which is now able to connect all three major datum points at Pulau Lakei, Original and Bintulu. Datum by following the major accessible routes across Sarawak. This means the leveling network in Sarawak has now been inter-connected and unified. By having such a unified network leads to the possibility of having a common single least squares adjustment been performed for the first time. The least squares adjustment of this unified levelling network was attempted in order to compute the height of all Bench Marks established in the entire levelling network. The adjustment was done by using MoreFix levelling adjustment package developed at FGHT UTM. The computational procedure adopted is linear parametric adjustment by minimum constraint. Since Sarawak has three separate datums therefore three separate adjustments were implemented by utilizing datum at Pulau Lakei, Original Miri and Bintulu Datum respectively. Results of the MoreFix unified adjustment agreed very well with adjustment repeated using Starnet. Further the results were compared with solution given by Jupem and they are in good agreement as well. The difference in height analysed were within 10mm for the case of minimum constraint at Pulau Lakei datum and with much better agreement in the case of Original Miri Datum.

THE UNIFIED LEVELLING NETWORK OF SARAWAK AND ITS ADJUSTMENT

Directory of Open Access Journals (Sweden)

Z. A. M. Som

2016-09-01

Full Text Available The height reference network of Sarawak has seen major improvement in over the past two decades. The most significant improvement was the establishment of extended precise leveling network of which is now able to connect all three major datum points at Pulau Lakei, Original and Bintulu. Datum by following the major accessible routes across Sarawak. This means the leveling network in Sarawak has now been inter-connected and unified. By having such a unified network leads to the possibility of having a common single least squares adjustment been performed for the first time. The least squares adjustment of this unified levelling network was attempted in order to compute the height of all Bench Marks established in the entire levelling network. The adjustment was done by using MoreFix levelling adjustment package developed at FGHT UTM. The computational procedure adopted is linear parametric adjustment by minimum constraint. Since Sarawak has three separate datums therefore three separate adjustments were implemented by utilizing datum at Pulau Lakei, Original Miri and Bintulu Datum respectively. Results of the MoreFix unified adjustment agreed very well with adjustment repeated using Starnet. Further the results were compared with solution given by Jupem and they are in good agreement as well. The difference in height analysed were within 10mm for the case of minimum constraint at Pulau Lakei datum and with much better agreement in the case of Original Miri Datum.

A sociological examination of international placement learning by British social work students in children’s services in Malaysia

Directory of Open Access Journals (Sweden)

Sara Ashencaen Crabtree

2014-06-01

Full Text Available This paper discusses research findings into a study of UK student learning on international social work placements in Malaysia in collaboration with two Malaysian universities: Universiti Sains Malaysia and Universiti Malaysia Sarawak. The discussion focuses on those placements taking place in children’s services: residential care and community-based support programmes. The aim of the study was to explore how social work students adapt to unfamiliar learning situations in new cultural contexts with the goal of increasing cultural competence. Data were drawn from formal but anonymised student learning exercises as a non-assessed requirement of this particular placement. Findings indicated a wide range of responses towards social work practice with vulnerable children in the Malaysian context in terms of student constructions of care and abuse. Subject to an analytical schema, the collision or adaptation of otherwise normative professional and personal values are examined in detail.

Benefits and Issues of Open-Cut Coal Mining on the Socio-Economic Environment - The Iban Community in Mukah, Sarawak, Malaysia

OpenAIRE

Edward Lim

2007-01-01

This paper deals principally with the socio-economic impact on the local Iban community in Mukah Division, Sarawak; with the commencement of the open-cut coal mining industry since 2003. To-date there are no actual studies being carried out by either the public or private sector to truly analyze how the Iban community is coping with the advent of a large influx of cash into their society. The Iban community has traditionally been practicing shifting cultivation and farming of domesticated ani...

Reproductive biology of Nemipterus japonicus (Bloch, 1791) from the coastal waters of Bintulu (South China Sea), Sarawak, Malaysia.

Science.gov (United States)

Nettely, T; Rajaee, A H; Denil, N A; Idris, M H; Nesarul, M H; Amin, S M Nurul; Hena, M K Abu

2016-07-01

Samples of threadfin breams Nemipterus japonicus were collected from a village in Kuala Nyalau and a fish landing centre at Bintulu from April 2013 to March 2014. A total of 360 individuals of N. japonicus (214 male and 146 female) were used in this reproductive study.? The total length (TL) of individuals were measured to the nearest 0.1 cm and body weight (BW) was recorded to the nearest 0.1 g. Month-wise distribution of the sexes was significantly higher for males in September and March, while in the month of May the number of females was significantly higher (X(2) = 6.53; P Sarawak.

Occupational health in sawmills of Sarawak.

Science.gov (United States)

Tan, C C; Cheu, K T; Hardin, S

1991-09-01

A self-administered questionnaire survey was conducted among sawmill managers in Sarawak to explore certain health and safety aspects of workers in this industry. The survey reveals that many sawmills are lacking in the provision of occupational health facilities and activities for their employees.

Combating Smuggling in Persons: A Malaysia Experience

OpenAIRE

Rahim Rohani Abdul; Ahmad Tajuddin Muhammad Afiq bin; Abu Bakar Kamaruddin bin Hj.; Abdul Rahim Mohammad Nizamuddin Bin

2015-01-01

Malaysia continues to face various challenges derived from the widespread of international migratory movement because of various economic reasons. Malaysia strategic geographical location, in the center of the South East Asian region made the country an attractive destination for human smuggling and trafficking in persons activities. Some of the smuggled persons may end up being trafficked victims base on the definition adopted by Malaysian laws on “trafficked victims”. Malaysia Anti-Traffick...

Report of Sarawak Council for Further Education.

Science.gov (United States)

Sarawak Council for Further Education, Kuching (Malaysia).

The 1972 report of the Sarawak Council for Further Education and the minutes of its 31 March 1973 meetings are provided. Information regarding committee memberships, staff, education centers, yearly examinations, and finances is provided. (KM)

Climate Based Predictability of Oil Palm Tree Yield in Malaysia.

Science.gov (United States)

Oettli, Pascal; Behera, Swadhin K; Yamagata, Toshio

2018-02-02

The influence of local conditions and remote climate modes on the interannual variability of oil palm fresh fruit bunches (FFB) total yields in Malaysia and two major regions (Peninsular Malaysia and Sabah/Sarawak) is explored. On a country scale, the state of sea-surface temperatures (SST) in the tropical Pacific Ocean during the previous boreal winter is found to influence the regional climate. When El Niño occurs in the Pacific Ocean, rainfall in Malaysia reduces but air temperature increases, generating a high level of water stress for palm trees. As a result, the yearly production of FFB becomes lower than that of a normal year since the water stress during the boreal spring has an important impact on the total annual yields of FFB. Conversely, La Niña sets favorable conditions for palm trees to produce more FFB by reducing chances of water stress risk. The region of the Leeuwin current also seems to play a secondary role through the Ningaloo Niño/ Niña in the interannual variability of FFB yields. Based on these findings, a linear model is constructed and its ability to reproduce the interannual signal is assessed. This model has shown some skills in predicting the total FFB yield.

Impact of socio-economic class on colorectal cancer patient outcomes in Kuala Lumpur and Kuching, Malaysia.

Science.gov (United States)

Kong, Chee-Kwan; Roslani, April Camilla; Law, Chee-Wei; Law, Suk-Chin Diana; Arumugam, Kulenthran

2010-01-01

Research over the past several decades has indicated that low socioeconomic class has a direct effect on health outcomes. In Malaysia, class distribution may differ with the region. The objective of this study was to compare the presentation and survival of colorectal cancer patients in two dissimilar cities, Kuala Lumpur and Kuching, Sarawak. All patients diagnosed with a malignancy of the colon or rectum in Sarawak General Hospital and University of Malaya Medical Center from 1st Jan 2000-31st Dec 2006 were recruited. Data on presentation, socio-economic class and survival were obtained. The survival duration was categorized into more than three years or three years and less. Testing for significance was performed using the chi-square test, with p values less than 0.05 considered statistically significant. A total of 565 patients in UMMC and 642 patients in SGH had a new diagnosis of colorectal carcinoma. Patients in Kuching had a longer duration of symptoms and more advanced stage at presentation, but this was not statistically significant. Lower socio-economic class was a significant factor for late and more advanced stage at diagnosis, as well as poorer three and five year survival rates. However, survival was lower for patients in Kuching compared to Kuala Lumpur, even after matching for socio-economic class. There is near-zero awareness of colorectal cancer screening in Malaysia. These findings support reaching out to communities of lower socioeconomic backgrounds to improve the colorectal cancer survival rates.

Informal heritage-making at the Sarawak Cultural Village, East Malaysia

NARCIS (Netherlands)

Muzaini, Hamzah

2017-01-01

Scholars have always been fascinated with cultural theme parks as tourism attractions or as vehicles for identity formations. With respect to the latter, the focus has been on how these consumption landscapes also portend spaces of representation that mobilize certain attributes of ethnic groups

Case study of the Sarawak River Basin

African Journals Online (AJOL)

2012-12-20

Dec 20, 2012 ... the high cost of this flood mapping technique has motivated the development of an advanced ..... (2011) Historical flood events recorded in Sarawak from 1946- ... HII CP, PUTUHENA FJ and SAID SB (2009) Adaptive Logical.

Informed Questions on Malaysia

National Research Council Canada - National Science Library

Heng, Lim; Tay, BG

2003-01-01

While Indonesia gets the attention of policy makers on South East (SE) Asia because of its size and population, Malaysia has increasingly been courted as an example of an Islamic country that is moderate and progressive...

All projects related to Malaysia | Page 2 | IDRC - International ...

International Development Research Centre (IDRC) Digital Library (Canada)

... Far East Asia, South Asia, Laos, Malaysia, Mongolia, Nepal, Pakistan, Philippines, Japan ... Telecentre Network Startup : Bangladesh - Mission 2011 ... social and economic development in the Middle East, specifically Jordan, Lebanon, ...

The impact of A. R. Wallace's Sarawak Law paper reassessed.

Science.gov (United States)

van Wyhe, John

2016-12-01

This article examines six main elements in the modern story of the impact of Alfred Russel Wallace's 1855 Sarawak Law paper, particularly in the many accounts of Charles Darwin's life and work. These elements are: Each of these are very frequently repeated as straightforward facts in the popular and scholarly literature. It is here argued that each of these is erroneous and that the role of the Sarawak Law paper in the historiography of Darwin and Wallace needs to be revised. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.

Estimation of exterior vertical daylight for the humid tropic of Kota Kinabalu city in East Malaysia

Energy Technology Data Exchange (ETDEWEB)

Djamila, Harimi; Ming, Chu Chi; Kumaresan, Sivakumar [School of Engineering and Information Technology, Universiti Malaysia Sabah, Locked Bag No. 2073, 88999 Kota Kinabalu, Sabah (Malaysia)

2011-01-15

In tropical regions natural daylight has been a fundamental factor in building design. It is the most efficient way of lighting a building in the daytime and has a great potential for energy conservation in buildings. In Malaysia there are a limited available data of measured illuminance which is the case of several regions in the tropics. Using established models it is possible to predict the luminous efficacy and then estimate the monthly mean hourly exterior illuminance. In this study two different models were chosen. The Perez and Du Mortier-Perraudeau-Page-Littlefair models were selected for the prediction of hourly exterior horizontal illuminance for the city of Kota Kinabalu in East Malaysia. Comparison between the two models were made. The vertical hourly illuminance was predicted also using Perez approach. The potentiality of daylight in four orientations was discussed. This study highlights the importance of Sunpath diagram on daylight illuminance during the conceptual design stage. The results in this study is hoped to contribute further insight into the potentiality of daylighting of tropical sky. (author)

University course timetabling and the requirements: Survey in several universities in the east-coast of Malaysia

Science.gov (United States)

Aziz, Nurul Liyana Abdul; Aizam, Nur Aidya Hanum

2017-08-01

Course timetabling problem receives the highlight at the beginning of every semester. The problem is mainly on assigning courses to timeslot, rooms and lecturers which involving a set of rules and policies constraints. Generally, researchers present different features to signify their own universities' timetable according to the structure and behavior of their institution. However, the gap between theory and real-world applications that can be seen in the resulted timetable is the lacking of acknowledging human preferences. As to overcome this, it is very important to consider all the demands and preferences from timetabling community. This research therefore tries to accommodate the problem by investigating through surveys to several universities in the east coast of Malaysia the demands and preferences of individuals involved directly. Results from the questionnaires will be analyzed by using SPSS and all current issues regarding the demands will be included into our existing general university course timetabling mathematical model. The new university course timetabling mathematical model could best represent universities and be useful, especially in universities in Malaysia.

Health and safety management practices of contractors in South East Asia: A multi country study of Cambodia, Vietnam, and Malaysia

OpenAIRE

Manu, P.; Mahamadu, A.-M. ed; Phung, V. M.; Nguyen, T. T.; Ath, C.; Heng, A. Y. T.; Kit, S. C.

2017-01-01

The construction sector is notorious for accounting for numerous occupational deaths, injuries and illnesses in many countries. In emerging economies this situation could be direr, and health and safety (H&S) management by contractors is important to tackling this. This study investigated the H&S management practices of contractors in three South East Asian countries (Malaysia, Vietnam, and Cambodia) with the view to highlighting implementation issues. A questionnaire instrument containing 40...

Tides and Their Dynamics over the Sunda Shelf of the Southern South China Sea.

Science.gov (United States)

Daryabor, Farshid; Ooi, See Hai; Abu Samah, Azizan; Akbari, Abolghasem

2016-01-01

A three-dimensional Regional Ocean Modelling System is used to study the tidal characteristics and their dynamics in the Sunda Shelf of the southern South China Sea. In this model, the outer domain is set with a 25 km resolution and the inner one, with a 9 km resolution. Calculations are performed on the inner domain. The model is forced at the sea surface by climatological monthly mean wind stress, freshwater (evaporation minus precipitation), and heat fluxes. Momentum and tracers (such as temperature and salinity) are prescribed in addition to the tidal heights and currents extracted from the Oregon State University TOPEX/Poseidon Global Inverse Solution (TPXO7.2) at the open boundaries. The results are validated against observed tidal amplitudes and phases at 19 locations. Results show that the mean average power energy spectrum (in unit m2/s/cph) for diurnal tides at the southern end of the East Coast of Peninsular Malaysia is approximately 43% greater than that in the East Malaysia region located in northern Borneo. In contrast, for the region of northern Borneo the semidiurnal power energy spectrum is approximately 25% greater than that in the East Coast of Peninsular Malaysia. This implies that diurnal tides are dominant along the East Coast of Peninsular Malaysia while both diurnal and semidiurnal tides dominate almost equally in coastal East Malaysia. Furthermore, the diurnal tidal energy flux is found to be 60% greater than that of the semidiurnal tides in the southern South China Sea. Based on these model analyses, the significant tidal mixing frontal areas are located primarily off Sarawak coast as indicated by high chlorophyll-a concentrations in the area.

Behavior and distribution of 239+240Pu and 241Am in the east coast of Peninsular Malaysia marine environment

International Nuclear Information System (INIS)

Zal U'yun Wan Mahmood; Hidayah Shahar; Zaharudin Ahmad; Yii Mei Wo; Ahmad Sanadi Abu Bakar

2010-01-01

The present distributions of 239+240 Pu, 241 Am and activity ratio of 241 Am/ 239+240 Pu in surface seawater of the Peninsular Malaysia east coast were studied. The surface seawater samples were collected at 30 identified stations during the expedition conducted in 2008. 239+240 Pu activity concentrations in surface seawater of the studied area were in the range of 2.33 ± 0.20-7.95 ± 0.68 mBq/m 3 , meanwhile 241 Am activity concentrations ranged from MDA to 1.90 ± 0.23 mBq/m 3 . The calculated activity ratios of 241 Am/ 239+240 Pu were varied and disperse distributed with the ranged of 0.12-0.53. The relationships between anthropogenic radionuclide and oceanographic parameters such as turbidity and salinity were examined. The linearly relationships between 239+240 Pu and oceanographic parameters are important for better understanding of its transport processes and behavior in the east coast of Peninsular Malaysia marine environment. Thus, the differ of distribution of 239+240 Pu, 241 Am and 241 Am/ 239+240 Pu in the studied area mainly due to high affinity of 239+240 Pu to associate with sinking particles, mobility nature of 241 Am, degree of particle reactive of both anthropogenic radionuclides, scavenging and removal process; and others. (author)

The quality of Metroxylon Sago sucker: morphology and uptake of manganese and iron

International Nuclear Information System (INIS)

Nashriyah Mat; Abdul Khalik Wood; Ramli Ishak

2001-01-01

Metroxylon sago or sagopalm is an important source of carbohydrate for the South East Asian countries, apart from rice. In Malaysia, wild sagopalm grows in Sarawak in its natural habitats, the coastal peat swamp. The quality of sucker growing vegetatively on sagopalm was studied at Sungai Talau experimental station, Dalat plantation and Oya/Mukah plantation in Sarawak. The coefficients of variability (C) and Index of similiarity (I) were calculated based on sucker morphology and uptake of manganese and iron, The matrix of hypothetical exact interpoint distances (Indices of Similarity and Dissimilarity) shows that sucker on matured sagopalm at Sungai Talam experimental station was a high quality, sucker on 5 years old sagopalm at Mukah sago plantation was approximately one-third as good, whereas sucker on 1.5 years old sagopalm at Oya/dalat sago plantation was of inferior quality. (Author)

Nepenthes Vogelii (Nepenthaceae): a new species from Sarawak

NARCIS (Netherlands)

Schuiteman, A.; Vogel, de E.F.

2002-01-01

Nepenthes vogelii Schuit. & de Vogel is described as a new species from Sarawak. It is compared with N. fusca Danser, from which it differs e.g. in the much smaller pitchers, of which the lid lacks appendages.

Mapping of Student Sustainable Development Education Knowledge in Malaysia Using Geographical Information System (GIS)

Science.gov (United States)

Mahat, Hanifah; Hashim, Mohmadisa; Nayan, Nasir; Saleh, Yazid; Norkhaidi, Saiyidatina Balkhis

2018-01-01

This article aims to examine the levels of education for sustainable development (ESD) knowledge among students in secondary schools according to zones in Malaysia by using GIS mapping. The five main zones of the study were the north zone, the south zone, the east coast zone, the central zone, and the East Malaysia zone. This quantitative form of…

Solar and wind energy utilization at Sarawak Southern national parks

International Nuclear Information System (INIS)

Abdul Rahman, N.; Kolot, A.

2006-01-01

The intentions of renewable energy utilization in Sarawak national parks were to reduce the environmental impacts to the protected surrounding and to overcome fuel transportation problem, as most national parks in Sarawak are not viable for the state electricity grid connection. The study was conducted at three national parks in southern Sarawak; viz. Samusan, Tanjung Datu and Pulau Talang-Talang Besar National Park. The study focused on the effectiveness of the system implementation, energy load and associated problems. Both Samusan and Tanjung Datu National systems are hybrids, which consist of solar photovoltaic panels, wind turbine and diesel generators, whereas, Pulau Talang-Talang Besar National Park is a stand alone system of solar photovoltaic panels only. In addition, the inefficient energy usage was observed at Samusan National Park. The study have identified that lack of local expertise, spare parts availability, transportation and inefficient energy management as the major problems associated to the solar and wind energy system in all national parks studied. Albeit the problems mentioned, the study discovered that the systems were acceptably reliable and satisfactorily supply fraction of the energy requirements to the national parks communities

Changing State-University Relations: The Experiences of Japan and Lessons for Malaysia

Science.gov (United States)

Sirat, Morshidi; Kaur, Sarjit

2010-01-01

This article investigates the changing state-university relations in Japan and Malaysia. Its main objective is to identify and examine possible lessons for Malaysia, based on the Japanese experience. Notably, since the late 1970s, Malaysia has been looking towards Japan as a model for socio-economic development (the "look-east" Policy)…

Neural tube defects in Malaysia: data from the Malaysian National Neonatal Registry.

Science.gov (United States)

Boo, Nem-Yun; Cheah, Irene G S; Thong, Meow-Keong

2013-10-01

This study aimed to determine the prevalence and early outcome of neural tube defects (NTDs) in Malaysia. This prospective study included all neonates with NTDs (spina bifida, anencephaly, encephalocoele) born in 2009 in 32 Malaysian hospitals in the Malaysian National Neonatal Network. The prevalence of NTDs was 0.42 per 1000 live births, being highest among the indigenous people of Sarawak (1.09 per 1000 live births) and lowest among Malaysians of Chinese descent (0.09 per 1000 live births). The most common type of NTDs was anencephaly (0.19 per 1000 live births), followed by spina bifida (0.11 per 1000 live births) and encephalocoele (0.07 per 1000 live births). Majority of the infants with anencephaly (94.5%, n = 51), 45.8% (n = 11) with encephalocoele and 9.5% (n = 4) with spina bifida died. The median duration of hospital stay was 4 (range: 0-161) days. NTDs were common in Malaysia. Mortality was high. Long-term monitoring of NTD prevalence following folic fortification of food is recommended.

Sarawak Bamboo Craft: Symbolism and Phenomenon

Directory of Open Access Journals (Sweden)

Arshad Mohd Zaihidee

2014-04-01

Full Text Available The relationship between human beings and their environment has stirred reactions between nature and the development of mind and actions that can be discussed using interdisciplinary approaches such as psychology, sociology, anthropology and history, in understanding human thinking and behavior. A psychological approach is intended to evaluate the individual choices and needs in society. A sociological approach details the various patterns in the social organization. An anthropological approach is tied with culture and belief to fulfil human needs which are based on their habitat, while a historical approach looks at the development which is related to the past. Dimensions of experiences, order and logic, selective elaboration and expressions are used to analyze the bamboo craft of Iban, Melanau and Bidayuh societies in Sarawak long-houses. The existence of constitutive, moral, expressive and cognitive symbols has been interpreted based on a theoretical framework that has been developed by Langer Art Theory, Parsons Social Theory and Kaplan Culture Theory. The values and meaning formed are interpreted to understand matters related to the lives of villagers and the finding suggests that bamboo craft expresses the multi-ethnic mind and character in the socio-culture of long- houses in Sarawak.

Malaysia as a Regional Education Hub: A Demand-Side Analysis

Science.gov (United States)

Cheng, Ming Yu; Mahmood, Amir; Yeap, Peik Foong

2013-01-01

Malaysia is becoming an increasingly active player in international education and ranks as the 11th largest exporter of education in the world. Malaysia's recognisable advantages in the international education market include its strategic location between the East and the West, cultural diversity, and a relatively stable socio-economic…

Environmental change in south-east Asia. People, politics and sustainable development

International Nuclear Information System (INIS)

Parnwell, M.J.G.; Bryant, R.L.

1996-01-01

The interaction of politics and ecology in the quest for sustainable development in South East Asia is explored in this book by contributors who provide a broad range of perspectives. In the first of the four main sections, the political context of ecological change is examined. The topics discussed are: Indonesia and Thailand in a globalising pulp and paper industry; environmental organisations and different political contexts in Malaysia, Indonesia and Vietnam; Japan and South East Asia's environment. Some of the processes and forms of human-induced environmental change are illustrated in the second section. These include: the search for sustainable livelihoods in Indonesian transmigration settlements; the 210 MW hydro-power project on the Theun river in Laos which illustrates the tensions between environmental costs and potential economic benefits; forest management in Laos. Discussion of the various methods which strengthen understanding of human-induced environmental change in the region is integrated with further illustrations of its process and context in the third section where the following are considered: environmental change in Malaysian Borneo; the value of remote sensing and geographical information systems in mapping the environment; the weakness of Vietnam's tropical forestry action plan. In the final section, an examination of some of the options for change which are necessary if sustainable development is to become a reality includes: the sustainability of ecotourism in Indonesia; the potential stewardship role of the Bajau people in Indonesia's proposed marine parks; environmental degradation, non-timber forest products and Iban communities in Sarawak; conservation and development in Brunei's rainforests; Philippine community-based forest management. (27 figures; 23 tables; 752 references) (UK)

PREVALENCE OF SMOKING AMONG SECONDARY SCHOOL STUDENTS IN SARAWAK

Directory of Open Access Journals (Sweden)

IRYANI T

2011-01-01

Full Text Available Adolescent smoking is an emerging health concern in the developing countries. A cross-sectional study is conducted to determine the prevalence and smoking behaviour of adolescents in Sarawak. The prevalence of smoking is 32.8% with mean age of initiation at 12.8±1.9 years. Most (67.2% adolescents are experimental smokers and the majority (67.9% did not smoke on adaily basis. Branded cigarettes are preferred (83.1% and the cigarettes are obtained either from friends (49.1% or selfpurchased (43.6%. Students prefer to smoke at their friend’s house (31.0% or at school (25.3%. Smoking prevalence among adolescents in Sarawak is high and begins early. Early intervention on smoking prevention and risk awareness is perhaps more effective if initiated before the age of 12 years.

Private sector financing of projects - implementation of the BAKUN hydroelectric project in Malaysia; Private Projektfinanzierung - Errichtung der Wasserkraftanlage Bakun in Malaysia

Energy Technology Data Exchange (ETDEWEB)

Failer, E. [Lahmeyer International GmbH, Frankfurt am Main (Germany)

1998-07-01

The BAKUN Hydroelectric Power Project in Malaysia represents, alongside the Three Gorges Project in China, one of today's most closely observed hydropower projects. The Bakun Project features a generating capacity of 2 520 MW, a 205 m high concrete face rockfill dam and a 1 320 km long power transmission system from Sarawak (Borneo) to West Malaysia. Implementation costs are estimated at around DM 10 000 million. In December 1996 the concession to construct and operate the Bakun Project for a period of 30 years on a BOT (build-operate-transfer) basis was granted to the Bakun Hydro-Electric Corporation, a private project development company. A US-Dollar million contract was awarded one year prior to this concession, to construct the river diversion works in advance. Completion of the three concrete-lined diversion tunnels, each with an inner diameter of 12 m, is scheduled for the end of 1998. After a brief overview of the Bakun Project, the paper describes a typical structure of the parties involved and the legal framework for BOT project finance. The most important features of the concession agreement, the power purchase agreement (PPA) and the engineering, procurement and construction (EPC) contract are explained. Finally, the paper emphasizes that in future the water resources engineer will have to be more involved with topics such as fixed-price contracts, risk management, turnkey solutions and project finance. (orig.) [German] Mit einer geplanten installierten Leistung von 2 520 MW, einem 205 m hohen Steinschuettdamm mit Betonoberflaechendichtung, einem 1 320 km langen Energieuebertragungssystem von Sarawak (Borneo) nach Westmalaysia und mit Projektkosten von ca. 10 Mrd. DM stellt das BAKUN-Wasserprojekt in Malaysia, neben dem Dreischluchtenprojekt in China, eines der meist beachteten Wasserkraftprojekte der Gegenwart dar. Im Dezember 1996 erhielt die private Projektentwicklungsgesellschaft 'Bakun Hydro-Electric Corporation' die Konzession, das

Impact of the east Asian economic crisis on health and health care: Malaysia's response.

Science.gov (United States)

Suleiman, A B; Lye, M S; Yon, R; Teoh, S C; Alias, M

1998-01-01

In the wake of the east Asian economic crisis, the health budget for the public sector in Malaysia was cut by 12%. The Ministry of Health responded swiftly with a series of broad-based and specific strategies. There was a careful examination of the operating expenditure and where possible measures were taken to minimise the effects of the budget constraints at the service interface. The MOH reprioritised the development of health projects. Important projects such as rural health projects and training facilities, and committed projects, were continued. In public health, population-based preventive and promotive activities were expected to experience some form of curtailment. There is a need to refocus priorities, maximise the utilisation of resources, and increase productivity at all levels and in all sectors, both public and private, in order to minimise the impact of the economic downturn on health.

Genetic data for 15 STR loci in a Kadazan-Dusun population from East Malaysia.

Science.gov (United States)

Kee, B P; Lian, L H; Lee, P C; Lai, T X; Chua, K H

2011-04-26

Allele frequencies of 15 short tandem repeat (STR) loci, namely D5S818, D7S820, D13S317, D16S539, TH01, TPOX, Penta D, Penta E, D3S1358, D8S1179, D18S51, D21S11, CSF1PO, vWA, and FGA, were determined for 154 individuals from the Kadazan-Dusun tribe, an indigenous population of East Malaysia. All loci were amplified by polymerase chain reaction, using the Powerplex 16 system. Alleles were typed using a gene analyzer and the Genemapper ID software. Various statistical parameters were calculated and the combined power of discrimination for the 15 loci in the population was calculated as 0.999999999999999. These loci are thus, informative and can be used effectively in forensic and genetic studies of this indigenous population.

Islam Observed: the Case of Contemporary Malaysia

OpenAIRE

Metzger, Laurent

1998-01-01

The phenomenon of the rise of Islam in Malaysia does not attract much attention of observers when compared with the same phenomenon in the countries of the Middle East, North Africa, Central or South Asia. This paper attempted to review comprehensively the development of Islam in Malaysia since obtaining its independence from Britain in August 1957.Copyright (c) 2014 by SDI. All right reserved.DOI: 10.15408/sdi.v5i2.753

Extreme differences in forest degradation in Borneo: comparing practices in Sarawak, Sabah, and Brunei.

Directory of Open Access Journals (Sweden)

Jane E Bryan

Full Text Available The Malaysian states of Sabah and Sarawak are global hotspots of forest loss and degradation due to timber and oil palm industries; however, the rates and patterns of change have remained poorly measured by conventional field or satellite approaches. Using 30 m resolution optical imagery acquired since 1990, forest cover and logging roads were mapped throughout Malaysian Borneo and Brunei using the Carnegie Landsat Analysis System. We uncovered ∼364,000 km of roads constructed through the forests of this region. We estimated that in 2009 there were at most 45,400 km(2 of intact forest ecosystems in Malaysian Borneo and Brunei. Critically, we found that nearly 80% of the land surface of Sabah and Sarawak was impacted by previously undocumented, high-impact logging or clearing operations from 1990 to 2009. This contrasted strongly with neighbouring Brunei, where 54% of the land area remained covered by unlogged forest. Overall, only 8% and 3% of land area in Sabah and Sarawak, respectively, was covered by intact forests under designated protected areas. Our assessment shows that very few forest ecosystems remain intact in Sabah or Sarawak, but that Brunei, by largely excluding industrial logging from its borders, has been comparatively successful in protecting its forests.

Pattern of suicides in 2009: data from the National Suicide Registry Malaysia.

Science.gov (United States)

Ali, Nor Hayati; Zainun, Khairul Anuar; Bahar, Norharlina; Haniff, Jamaiyah; Hamid, Abdul Muneer; Bujang, Mohamad Adam Hj; Mahmood, Mohd Shah

2014-06-01

The National Suicide Registry Malaysia (NSRM) is a nationwide system that captures data on completed suicides in Malaysia from all forensic departments under the purview of the Ministry of Health Malaysia. This paper examines all suicidal deaths reported to the NSRM from 1 January 2009 to 31 December 2009. The relevant variables were recorded in the paper-based Case Report Form (CRF) and then entered into the online reporting system for analysis. The overall suicide rate for 2009 was 1.18 per 100,000 population (n = 328). The age range was 14-94 years, with a median of 37 (IQR 24) years. There were more men than women, the gender ratio being 2.9:1 (males : females), and the majority (89% or 293/328) were Malaysian citizens. Ethnicity-wise, Indians had the highest suicide rate of 3.67 per 100,000. The Malays and Bumiputera of Sabah and Sarawak had lower rates of 0.32 to 0.37 per 100,000. Mental illness was reported in 22% (72/328) of the cases and physical illnesses in 20.4% (67/328). Previous suicide attempts were reported in 15.5% (51/328) of cases. History of substance abuse was present in 28.7% (83/328). Life events were positive in 41.2% (135/328) of cases. Malaysia is able to generate statistics on suicide by enhancing the collaboration between forensic, psychiatry and clinical research agencies. These trends should be monitored to gain a better understanding of suicide trends. Copyright © 2012 Wiley Publishing Asia Pty Ltd.

A pilot study on the functional performance and acceptability of an innovative female condom (Wondaleaf® in Malaysia

Directory of Open Access Journals (Sweden)

Ting RS

2018-01-01

Full Text Available Rachel Sing-Kiat Ting,1 Ee-Lynn Wong,2 Jessie Koh-Sing Tnay3 1School of Sociology, China University of Political Sciences and Law, Beijing, China; 2InPsych Psychological and Counselling Services, Kuala Lumpur, 3Institute of Borneo Studies, Universiti Malaysia Sarawak, Sarawak, Malaysia Background: Female condom (FC has been available for over 30 years, but it still lacks wide acceptability. To overcome misdirection and invagination occurring in FC and to provide a wider area of protection, Wondaleaf® (WL, a new-generation adhesive FC, was recently invented. This pioneering study sought to assess the acceptability and functional performance of WL among Malaysian women. Methods: A mixed method survey was conducted in three cities of Malaysia, recruiting sexually active heterosexual women, aged 18–50, by snowball sampling method. Participants were provided with WL and initially surveyed to rate its performance in five coital usages over 2 months. After that, the participants underwent a second survey to rate their satisfaction and acceptability toward WL. Descriptive statistics on clinical failure rates were tabulated with correlational analysis performed to identify major variables contributing to WL’s functional performance and acceptability. Results: Out of the 51 enrolled participants, 31 women completed the required surveys. WL’s total clinical failure rate was 2.60% (out of 155 condom uses with above-average ratings of functional performance. The ease of use significantly correlated with ratings of no slippage and no misdirection. The confidence in WL’s safety features significantly correlated with a sense of empowerment and protection. Conclusion: WL has a relatively low risk of clinical failures and an overall favorable acceptability among Malaysian women. However, this study also showed that its future usage largely depends on partner acceptability. It may have the potential of complementing the existing barrier toward

The influence of nuclear energy development in Northeast Asia to Malaysia

International Nuclear Information System (INIS)

Mohamad Faisol Keling

2010-01-01

This chapter discusses how the government Malaysia issues facing nuclear energy development in East Asia. Bombings of Hiroshima and Nagasaki in Japan (1945) and the incident of nuclear reactor in Chernobyl (1986) are also discussed. Increase in world oil prices also influence the government in south East Asia to move towards nuclear energy development, and this includes Malaysia. Plans to use nuclear in this country is not a new issue as it is beginning to emerge since the time of independence but the issues that arise when it is focused on nuclear development for military service. This chapter also warmly debated the issue of nuclear development is Malaysia will be opposed by other countries since there are several countries that blocked due to the internal factors of the country. (author)

Body Weight Determination from Foot Outline Length among the Iban Population in Malaysia

Directory of Open Access Journals (Sweden)

Hairunnisa Bt Mohd Anas K

2017-12-01

Full Text Available Foot impressions form a valuable physical evidence to solve crime. Foot impression measurements provide valuable information in estimating stature, weight, gender and age in crime scene investigation. In Asian countries, many people living in rural places walk without footwear. The aim of this research is to generate regression equations to determine living body weight from foot outline length among the Iban population of Malaysia. The study involved 200 (100 males, 100 females adult Ibans, mostly living in Sarawak, a state in   Malaysia. Following the standard procedure, the foot outlines were collected followed by body weight measurements and were recorded for analysis. The collected data were analysed with PASW 20 computer software. The correlation coefficient (R between the foot outline lengths and body weight was determined for males, females and pooled sample. Based on the foot outline and body weight, 30 regression equations were generated, 10 for males, 10 for females and 10 for pooled samples/unknown gender. The correlation coefficient (R values were positive and statistically significant. It is concluded that the present investigation provided regression equations to determine body weight from foot outline anthropometry. These equations can be used to determine body weight even when partial foot impressions are available at crime scenes.   Keywords: Forensic Science, Body Weight, Foot Outline, Iban Population, Malaysia

A survey of health problems of Nepalese female migrants workers in the Middle-East and Malaysia.

Science.gov (United States)

Simkhada, Padam; van Teijlingen, Edwin; Gurung, Manju; Wasti, Sharada P

2018-01-18

Nepal is a key supplier of labour for countries in the Middle East, India and Malaysia. As many more men than women leave Nepal to work abroad, female migrant workers are a minority and very much under-researched. The aim of the study was to explore the health problems of female Nepalese migrants working in the Middle-East and Malaysia. The study was conducted among 1010 women who were registered as migrant returnees at an organisation called Pourakhi Nepal. Secondary data were extracted from the records of the organisation covering the five-year period of July 2009 to July 2014. The 1010 participants were aged 14 to 51 with a median age of 31 (IQR: 38-25) years. A quarter of respondents (24%) reported having experienced health problems while in the country of employment. Fever, severe illness and accidents were the most common health problems reported. Working for unlimited periods of time and not being able to change one's place of work were independently associated with a greater likelihood of health problems. Logistic regression shows that migrant women who are illiterate [OR = 1.56, 95% CI: 1.02 to 2.38, p = 0.042], who had changed their workplace [OR = 1.63, 95% CI: 1.14 to 2.32, p = 0.007], who worked unlimited periods of time [OR = 1.64, 95% CI: 1.44 to 1.93, p = 0.020], had been severely maltreated or tortured in the workplace [OR = 1.84, 95% CI: 1.15 to 2.92, p = 0.010], were not being paid on time [OR = 2.38, 95% CI: 1.60 to 3.55, p = 0.038] and migrant women who had family problems at home [OR = 3.48, CI 95%: 1.22 to 9.98, p = 0.020] were significantly associated with health problems in their host country in the Middle East. Female migrant workers face various work-related health risks, which are often related to exploitation. The Government of Nepal should initiate awareness campaigns about health risks and rights in relation to health care services in the host countries. Recruiting agencies

River Plumes in Sunglint, Sarawak, Borneo

Science.gov (United States)

1991-01-01

The sunglint pattern along the coast of Sarawak (3.0N, 111.5E) delineates the boundry of fresh water river plumes as they flow into the South China Sea. The fresh water lens (boundry between fresh and sea water) overides the saline and more dense sea water and oils, both natural and man made, collect along the convergence zones and dampen wave action. As a result, the smoother sea surface appears bright in the sunglint pattern.

Immobilised Sarawak Malaysia yeast cells for production of bioethanol.

Science.gov (United States)

Zain, Masniroszaime Mohd; Kofli, Noorhisham Tan; Rozaimah, Siti; Abdullah, Sheikh

2011-05-01

Bioethanol production using yeast has become a popular topic due to worrying depleting worldwide fuel reserve. The aim of the study was to investigate the capability of Malaysia yeast strains isolated from starter culture used in traditional fermented food and alcoholic beverages in producing Bioethanol using alginate beads entrapment method. The starter yeast consists of groups of microbes, thus the yeasts were grown in Sabouraud agar to obtain single colony called ST1 (tuak) and ST3 (tapai). The growth in Yeast Potatoes Dextrose (YPD) resulted in specific growth of ST1 at micro = 0.396 h-1 and ST3 at micro = 0.38 h-1, with maximum ethanol production of 7.36 g L-1 observed using ST1 strain. The two strains were then immobilized using calcium alginate entrapment method producing average alginate beads size of 0.51 cm and were grown in different substrates; YPD medium and Local Brown Sugar (LBS) for 8 h in flask. The maximum ethanol concentration measured after 7 h were at 6.63 and 6.59 g L-1 in YPD media and 1.54 and 1.39 g L-1in LBS media for ST1 and ST3, respectively. The use of LBS as carbon source showed higher yield of product (Yp/s), 0.59 g g-1 compared to YPD, 0.25 g g-1 in ST1 and (Yp/s), 0.54 g g-1 compared to YPD, 0.24 g g-1 in ST3 . This study indicated the possibility of using local strains (STI and ST3) to produce bioethanol via immobilization technique with local materials as substrate.

Moving in a hierarchized landscape Changing border regimes in Central Kalimantan

Directory of Open Access Journals (Sweden)

Dave Lumenta

2011-04-01

Full Text Available Transnational mobility is a common feature among borderland communities. Central Borneo has been a relatively fluid and open riverine-based socio-cultural and economic space since the arrival of colonial states, without much interference from the establishment of international boundaries on local cross-border mobility practices. This applies to the Kenyah, a cluster of related ethnic groups occupying the Apokayan plateau in East Kalimantan (Indonesia, who are historically an integral part of the socio-cultural and economic fabric throughout the major riverine systems of Sarawak (Malaysia. Despite the relative absence of states, Central Borneo has not escaped the onslaught of social differentiation embedded in nation-state identities. The penetration of Sarawak’s logging industry has brought the terrestrial re-ordering of the Bornean landscape away from the relative egalitarian social order of river basins into hierarchical social relations embedded in capitalistic modes of production. This has brought about the construction of the Kenyah’s visibility as an “Indonesian underclass“ inside Sarawak.

Mapania sapuaniana (Cyperaceae), a new sedge species from Sarawak

NARCIS (Netherlands)

Shabdin, Z.; Culham, A.; Simpson, D.A.; Meekiong, K.

2013-01-01

Mapania sapuaniana, a spectacular new sedge species from Lanjak Entimau, Sarawak, is described and illustrated. It is closely related to M. richardsii and M. borneensis but differs in having broad leaves with a distinct pseudopetiole, reddish purple or maroon coloration on the underside of the leaf

The Communicative Ability of Universiti Teknologi MARA Sarawak's Graduates

Science.gov (United States)

Hassan, Sharifah Zakiah Wan; Hakim, Simon Faizal; Rahim, Mahdalela; Noyem, John Francis; Ibrahim, Sueb; Ahmad, Johnny; Jusoff, Kamaruzaman

2009-01-01

This study explores Universiti Teknologi MARA (UiTM) Sarawak graduating students' oral proficiency, focusing on grammatical accuracy. Oral proficiency in English has always been the benchmark of language proficiency, and in the context of UiTM's language teaching curriculum, efforts to enhance students' oral proficiency are implemented through…

Consumption of fruits and vegetables in Malaysia: profiling the daily and nondaily consumers.

Science.gov (United States)

Yen, Steven T; Tan, Andrew K G; Feisul, Mustapha I

2015-03-01

This study examines the sociodemographic factors associated with daily fruit and vegetable (FV) consumption in Malaysia. Based on a cross-sectional sample of 2447 individuals from the Malaysia Non-Communicable Disease Surveillance-1, a multivariate sample selection system is developed and estimated, to accommodate high frequencies of daily FV consumption and the days of servings among nondaily consumers. Results indicate that the authors' attempt to account for endogenous sample selectivity and cross-equation correlations is justified. There exist positive correlations between FV consumption likelihoods and longer work hours, higher levels of education, high income, female gender, nonsmoking status, and being from East Malaysia. Among nondaily consumers, those with longer work hours, singles, and people with diabetes are less inclined to eat fruits on more days. Overall, higher-educated, affluent people, nonsmokers, and East Malaysians display more days of FV consumption. Based on these outcomes, several policy implications are recommended vis-à-vis FV consumption patterns in Malaysia. © 2012 APJPH.

Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

Science.gov (United States)

Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

2011-04-12

Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

Liquid hydrocarbon generation potential from Tertiary Nyalau Formation coals in the onshore Sarawak, Eastern Malaysia

Science.gov (United States)

Hakimi, Mohammed Hail; Abdullah, Wan Hasiah

2013-01-01

Tertiary coals exposed in the north-central part of onshore Sarawak are evaluated, and their depositional environments are interpreted. Total organic carbon contents (TOC) of the coals range from 58.1 to 80.9 wt. % and yield hydrogen index values ranging from 282 to 510 mg HC/g TOC with low oxygen index values, consistent with Type II and mixed Type II-III kerogens. The coal samples have vitrinite reflectance values in the range of 0.47-0.67 Ro %, indicating immature to early mature (initial oil window). T max values range from 428 to 436 °C, which are good in agreement with vitrinite reflectance data. The Tertiary coals are humic and generally dominated by vitrinite, with significant amounts of liptinite and low amounts of inertinite macerals. Good liquid hydrocarbons generation potential can be expected from the coals with rich liptinitic content (>35 %). This is supported by their high hydrogen index of up to 300 mg HC/g TOC and Py-GC ( S 2) pyrograms with n-alkane/alkene doublets extending beyond C30. The Tertiary coals are characterised by dominant odd carbon numbered n-alkanes ( n-C23 to n-C33), high Pr/Ph ratio (6-8), high T m / T s ratio (8-16), and predominant regular sterane C29. All biomarkers parameters clearly indicate that the organic matter was derived from terrestrial inputs and the deposited under oxic condition.

Genomic structure of the native inhabitants of Peninsular Malaysia and North Borneo suggests complex human population history in Southeast Asia.

Science.gov (United States)

Yew, Chee-Wei; Lu, Dongsheng; Deng, Lian; Wong, Lai-Ping; Ong, Rick Twee-Hee; Lu, Yan; Wang, Xiaoji; Yunus, Yushimah; Aghakhanian, Farhang; Mokhtar, Siti Shuhada; Hoque, Mohammad Zahirul; Voo, Christopher Lok-Yung; Abdul Rahman, Thuhairah; Bhak, Jong; Phipps, Maude E; Xu, Shuhua; Teo, Yik-Ying; Kumar, Subbiah Vijay; Hoh, Boon-Peng

2018-02-01

Southeast Asia (SEA) is enriched with a complex history of peopling. Malaysia, which is located at the crossroads of SEA, has been recognized as one of the hubs for early human migration. To unravel the genomic complexity of the native inhabitants of Malaysia, we sequenced 12 samples from 3 indigenous populations from Peninsular Malaysia and 4 native populations from North Borneo to a high coverage of 28-37×. We showed that the Negritos from Peninsular Malaysia shared a common ancestor with the East Asians, but exhibited some level of gene flow from South Asia, while the North Borneo populations exhibited closer genetic affinity towards East Asians than the Malays. The analysis of time of divergence suggested that ancestors of Negrito were the earliest settlers in the Malay Peninsula, whom first separated from the Papuans ~ 50-33 thousand years ago (kya), followed by East Asian (~ 40-15 kya), while the divergence time frame between North Borneo and East Asia populations predates the Austronesian expansion period implies a possible pre-Neolithic colonization. Substantial Neanderthal ancestry was confirmed in our genomes, as was observed in other East Asians. However, no significant difference was observed, in terms of the proportion of Denisovan gene flow into these native inhabitants from Malaysia. Judging from the similar amount of introgression in the Southeast Asians and East Asians, our findings suggest that the Denisovan gene flow may have occurred before the divergence of these populations and that the shared similarities are likely an ancestral component.

Modeling of Flood Mitigation Structures for Sarawak River Sub-basin Using Info Works River Simulation (RS)

OpenAIRE

Rosmina Bustami; Charles Bong; Darrien Mah; Afnie Hamzah; Marina Patrick

2009-01-01

The distressing flood scenarios that occur in recent years at the surrounding areas of Sarawak River have left damages of properties and indirectly caused disruptions of productive activities. This study is meant to reconstruct a 100-year flood event that took place in this river basin. Sarawak River Subbasin was chosen and modeled using the one-dimensional hydrodynamic modeling approach using InfoWorks River Simulation (RS), in combination with Geographical Information S...

Pipelines to power South East Asia

Energy Technology Data Exchange (ETDEWEB)

Scholes, W

1994-07-01

European, North American and Australian pipeline companies are busy building pipelines to transport natural gas to power stations throughout South East Asia. Many countries, such as Thailand, Malaysia, Singapore and Indonesia, have economies expanding at more than eight percent a year. Cambodia and Laos are awaiting energy development. Myanmar will not only benefit from the global economic expansion but from the flourishing economies of nearby Thailand and Malaysia which are now investing in neighbouring countries, while their national petroleum companies are starting to operate worldwide. It is the ever expanding rush of industrialisation, urbanisation and the move to raise living standards throughout the region that is accelerating the need for more power stations, both gas and coal-fired, throughout South East Asia. (author)

Pipelines to power South East Asia

International Nuclear Information System (INIS)

Scholes, W.

1994-01-01

European, North American and Australian pipeline companies are busy building pipelines to transport natural gas to power stations throughout South East Asia. Many countries, such as Thailand, Malaysia, Singapore and Indonesia, have economies expanding at more than eight percent a year. Cambodia and Laos are awaiting energy development. Myanmar will not only benefit from the global economic expansion but from the flourishing economies of nearby Thailand and Malaysia which are now investing in neighbouring countries, while their national petroleum companies are starting to operate worldwide. It is the ever expanding rush of industrialisation, urbanisation and the move to raise living standards throughout the region that is accelerating the need for more power stations, both gas and coal-fired, throughout South East Asia. (author)

Determinants of capital structure in small and medium sized enterprises in Malaysia

OpenAIRE

Mat Nawi, Hafizah

2015-01-01

This thesis was submitted for the award of Doctor of Philosophy and was awarded by Brunel University London This study aims to investigate the determinants of capital structure in small and medium-sized enterprises (SMEs) in Malaysia and their effect on firms’ performance. The study addresses the following primary question: What are the factors that influence the capital structure of SMEs in Malaysia? The sample of this research is SMEs in the east coast region of Malaysia. Adopting a posi...

East Asian Regional Architecture: New Economic and Security Arrangements and U.S. Policy

Science.gov (United States)

2006-09-18

objections by the United States to a proposed East Asian Economic Caucus (EAEC) propounded primarily by Malaysia under former Prime Minister Mahathir Mohamad...proposed in 1990 by former Prime Minister Mahathir Mohamad of Malaysia. At the time, the United States opposed such an exclusive East Asian grouping...proposed by Malaysian Prime Minister Mahathir Mohamad in 1990, the U.S. strategy took two tracks. The first was to oppose its founding through

Technical note Flood map development by coupling satellite maps ...

African Journals Online (AJOL)

Flood maps are important for local authorities in designing mitigation plans to minimise damage and loss due to flooding. In recent years, flood events in the Sarawak River Basin, Malaysia have caused damage to property, loss of life and disruption of productive activities. Currently, the available flood map for Sarawak River ...

Burkholderia pseudomallei isolates from Sarawak, Malaysian Borneo, are predominantly susceptible to aminoglycosides and macrolides.

Science.gov (United States)

Podin, Yuwana; Sarovich, Derek S; Price, Erin P; Kaestli, Mirjam; Mayo, Mark; Hii, KingChing; Ngian, Hieung; Wong, SeeChang; Wong, IngTien; Wong, JinShyan; Mohan, Anand; Ooi, MongHow; Fam, TemLom; Wong, Jack; Tuanyok, Apichai; Keim, Paul; Giffard, Philip M; Currie, Bart J

2014-01-01

Melioidosis is a potentially fatal disease caused by the saprophytic bacterium Burkholderia pseudomallei. Resistance to gentamicin is generally a hallmark of B. pseudomallei, and gentamicin is a selective agent in media used for diagnosis of melioidosis. In this study, we determined the prevalence and mechanism of gentamicin susceptibility found in B. pseudomallei isolates from Sarawak, Malaysian Borneo. We performed multilocus sequence typing and antibiotic susceptibility testing on 44 B. pseudomallei clinical isolates from melioidosis patients in Sarawak district hospitals. Whole-genome sequencing was used to identify the mechanism of gentamicin susceptibility. A novel allelic-specific PCR was designed to differentiate gentamicin-sensitive isolates from wild-type B. pseudomallei. A reversion assay was performed to confirm the involvement of this mechanism in gentamicin susceptibility. A substantial proportion (86%) of B. pseudomallei clinical isolates in Sarawak, Malaysian Borneo, were found to be susceptible to the aminoglycoside gentamicin, a rare occurrence in other regions where B. pseudomallei is endemic. Gentamicin sensitivity was restricted to genetically related strains belonging to sequence type 881 or its single-locus variant, sequence type 997. Whole-genome sequencing identified a novel nonsynonymous mutation within amrB, encoding an essential component of the AmrAB-OprA multidrug efflux pump. We confirmed the role of this mutation in conferring aminoglycoside and macrolide sensitivity by reversion of this mutation to the wild-type sequence. Our study demonstrates that alternative B. pseudomallei selective media without gentamicin are needed for accurate melioidosis laboratory diagnosis in Sarawak. This finding may also have implications for environmental sampling of other locations to test for B. pseudomallei endemicity.

Effects of crude humin and compost produced from selected waste ...

African Journals Online (AJOL)

PALANIVELL PERUMAL

2013-03-27

Mar 27, 2013 ... the economic growth of Malaysia and it contributed in national gross ..... structure by loosening it and increase the porosity for aeration (Celik et al., .... Ammonium and Nitrate Recovery in an Acid Soil of Sarawak,. Malaysia.

Standardized morbidity ratio for leptospirosis mapping in Malaysia

Science.gov (United States)

Awang, Aznida Che; Samat, Nor Azah

2017-05-01

Leptospirosis is a worldwide zoonotic disease that affects human health in many parts of the world including Malaysia. Leptospirosis is a disease caused by the infection of pathogenic Leptospira genus called Spirochaetes. Leptospirosis can be transmitted directly or indirectly from rats to human. The human infection is usually caused by human contact with urine or tissues of infected animal. This disease can be spread through mucus membrane such as mouth, nose and eyes, ingestion of contaminated food and water and also exposed injured skin to contaminated water or soil. There is still no vaccine currently available for the prevention or treatment of leptospirosis disease but this disease can be treated if it is diagnosed early. Therefore, the aim of this study is to estimate the relative risk for leptospirosis disease based initially on the most common statistic used in the study of disease mapping called Standardized Morbidity Ratio (SMR). We then apply SMR to leptospirosis data obtained in Malaysia. The results show that the states of Melaka have very high risk areas. The states of Kedah, Terengganu and Kelantan are identified as high risk areas. The states of Perak, Perlis, Sabah and Sarawak showed medium risk areas. This is followed by low risk by other states except Pahang, Johor and Labuan with very low risk areas. In conclusion, SMR method is the best method for mapping leptospirosis because by referring to the relative risk maps, the states that deserve closer look and disease prevention can be identified.

Far East Asia | Page 185 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

In Multinationals and East Asian Integration, leading Asian economists examine the role of foreign private-sector firms, especially from Japan and the United States, in the recent and rapid economic growth and integration in East Asia. With examples from China, Hong Kong, Indonesia, Malaysia, the Philippines, Singapore, ...

Far East Asia | Page 184 | IDRC - International Development ...

International Development Research Centre (IDRC) Digital Library (Canada)

In Multinationals and East Asian Integration, leading Asian economists examine the role of foreign private-sector firms, especially from Japan and the United States, in the recent and rapid economic growth and integration in East Asia. With examples from China, Hong Kong, Indonesia, Malaysia, the Philippines, Singapore, ...

Morphological indicators of growth stages in carbonates platform evolution: comparison between present-day and Miocene platforms of Northern Borneo, Malaysia.

Science.gov (United States)

Pierson, B.; Menier, D.; Ting, K. K.; Chalabi, A.

2012-04-01

Satellite images of present-day reefs and carbonate platforms of the Celebes Sea, east of Sabah, Malaysia, exhibit large-scale features indicative of the recent evolution of the platforms. These include: (1) multiple, sub-parallel reef rims at the windward margin, suggestive of back-stepping of the platform margin; (2) contraction of the platform, possibly as a result of recent sea level fluctuations; (3) colonization of the internal lagoons by polygonal reef structures and (4) fragmentation of the platforms and creation of deep channels separating platforms that used to be part of a single entity. These features are analogue to what has been observed on seismic attribute maps of Miocene carbonate platforms of Sarawak. An analysis of several growth stages of a large Miocene platform, referred to as the Megaplatform, shows that the platform evolves in function of syn-depositional tectonic movements and sea level fluctuations that result in back-stepping of the margin, illustrated by multiple reef rims, contraction of the platform, the development of polygonal structures currently interpreted as karstic in origin and fragmentation of the megaplatform in 3 sub-entities separated by deep channels that precedes the final demise of the whole platform. Comparing similar features on present-day to platforms and Miocene platforms leads to a better understanding of the growth history of Miocene platforms and to a refined predictability of reservoir and non-reservoir facies distribution.

Distribution and origin sources of Polycyclic Aromatic Hydrocarbons (PAHs) pollution in sediment of Sarawak coastal area

International Nuclear Information System (INIS)

Mohd Shuhaimi Elias; Abdul Khalik Wood; Zaleha Hashim; Mohd Suhaimi Hamzah; Shamsiah Abdul Rahman; Nazaratul Ashifa Abdullah Salim

2010-01-01

Alkyl and parent Polycyclic Aromatic Hydrocarbons (PAHs) compounds in marine sediment sample collected from ten locations along Sarawak coastal areas were extracted and analyzed by using gas chromatography-mass spectrometry. The source identification of PAH pollution in marine sediment of Sarawak coastal areas were identify by ratios technique of An/ An+phen, Fl/ Fl +Py, B[a]A/ (B[a]A+Chry) and total Methyl Phen/ Phen. The total alkyl and parent PAHs concentration varies from 36.5 - 277.4 ng/ g dry weight (d.w.) with a mean concentration of 138.2 ng/ g d.w. The ratio values of PAHs pollution in marine sediment of Sarawak coastal areas are clearly indicating the PAHs pollutions are originated from petroleum (petrogenic) and petroleum combustion (pyrolytic). However, the origin sources of PAHs pollution in a few stations were uncertain due to mixing sources of PAHs. (author)

The Malaysia-Indonesia Remittance Corridor : Making Formal Transfers the Best Option for Women and Undocumented Migrants

OpenAIRE

Hernández-Coss, Raúl; Brown, Gillian; Buchori, Chitrawati; Endo, Isaku; Todoroki, Emiko; Naovalitha, Tita; Noor, Wameek; Mar, Cynthia

2008-01-01

The corridor between Malaysia and Indonesia is the second largest remittance outflow for Malaysia and the largest remittance inflow for Indonesia. In the East Asia and Pacific Region, Indonesia is the second largest supplier of labor migration with 680,000 overseas worker contracts concluded in 2006 alone. Since 2003, the number of contracts has more than doubled. Malaysia, in general, is ...

232-Th and 238-U radioactive contaminations of sediments along the South China Sea of East Coast Peninsular Malaysia by INAA

International Nuclear Information System (INIS)

Khadijeh Rezaee Ebrahim Saraee; Elias Saion; Naghavi, K.

2009-01-01

The concentrations of 232 Th and 238 U were determined in 30 sediment samples, collected from the South China Sea bed of the east coast peninsular Malaysia. The samples were dried in an oven for 10 days at 65 C and stored in polyethylene bottles for future analysis. INAA used to analyse surficial sediments. The 232 Th and 238 U activities in surficial sediments determined. These activities increased from 14.02 to 30.17 Bq Kg -1 and from 47.49 to 113.69 Bq Kg -1 for 232 Th and 238 U , respectively. Results show diffuse distribution of 232 Th and 238 U actinides in studied area. The Th/Sc and U/Sc ratios of the suricial sediments have same distribution and the highest their values are in station EC12. The radioactive contamination of the investigated sector is compared with the results obtained of other coastal sediments of Malaysia. Results show activity contamination in coastal sediments of the South China Sea is lower than the Straits of Malacca and is the same with the Straits of Johor. (Author)

Long term strategy for electricity generation in Peninsular Malaysia – Analysis of cost and carbon footprint using MESSAGE

International Nuclear Information System (INIS)

Fairuz, S.M.C.; Sulaiman, M.Y.; Lim, C.H.; Mat, S.; Ali, B.; Saadatian, O.; Ruslan, M.H.; Salleh, E.; Sopian, K.

2013-01-01

Malaysia envisages becoming a developed nation by 2020. To sustain industrial expansion and attract investments Malaysia must introduce new energy strategies. These strategies should also moderate carbon footprint. The new energy strategies introduced by the government are (i) installation of nuclear power plant by 2021, (ii) import of Sarawak hydropower from 2015 and (iii) enhancement of use of renewable energy from 2015. In this paper we analyze the cost and resulting carbon footprint of energy expansion for 12 energy scenes (inclusive of new strategies) to produce electricity for Peninsular Malaysia for the period 2009–2030. We use a computer model MESSAGE to provide optimization. The best strategy is for the following accumulated percentage of energy resource in the fuel mix: 49.3% (natural gas), 28.4% (coal), 4.06% (nuclear), 2.98% (hydropower), 4.45% (renewable), 10.82% (import hydropower). The minimum cost of expanding this strategy from 2009 until 2030 is USD6.090B. The CO 2 emission index of this strategy is 0.329 t/MWh. The accumulated carbon dioxide emission for this period is 1825.96 Mton CO 2 eq. -- Highlights: •We analyzed the cost of energy expansion and resulting carbon emission using software MESSAGE. •We studied the energy situation for the next 20 years beginning 2009 for Peninsular Malaysia. •We maintained the present energy resources of natural gas, coal and internal hydropower. •We included nuclear, hydropower import and renewable energy as new strategies

Causes and predictors of mortality in hospitalized lupus patient in Sarawak General Hospital, Malaysia.

Science.gov (United States)

Teh, C L; Ling, G R

2013-01-01

Systemic lupus erythematosus (SLE) is a serious autoimmune disease that can be life threatening and fatal if left untreated. Causes and prognostic indicators of death in SLE have been well studied in developed countries but lacking in developing countries. We aimed to investigate the causes of mortality in hospitalized patients with SLE and determine the prognostic indicators of mortality during hospitalization in our center. All SLE patients who were admitted to Sarawak General Hospital from January 1, 2006 to December 31, 2010, were followed up in a prospective study using a standard protocol. Demographic data, clinical features, disease activities and damage indices were collected. Logistic regression and Cox regression analysis were used to determine the prognostic indicators of mortality in our patients. There were a total of 251 patients in our study, with the female to male ratio 10 to 1. Our study patients were of multiethnic origins. They had a mean age of 30.5 ± 12.2 years and a mean duration of illness of 36.5 ± 51.6 months. The main involvements were hematologic (73.3%), renal (70.9%) and mucocutaneous (67.3%). There were 26 deaths (10.4%), with the main causes being: infection and flare (50%), infection alone (19%), flare alone (19%) and others (12%). Independent predictors of mortality in our cohort of SLE patients were the presence of both infection and flare of disease (hazard ratio (HR) 5.56) and high damage indices at the time of admission (HR 1.91). Infection and flare were the main causes of death in hospitalized Asian patients with SLE. The presence of infection with flare and high damage indices at the time of admission were independent prognostic indicators of mortality.

Effectiveness of pictorial health warning on cigarette packages: A cross-sectional study in Sarawak, Malaysia.

Science.gov (United States)

Rahman, M M; Arif, M T; Abd, Razak Mf; Suhaili, M R; Tambi, Z; Akoi, C; Gabriel Bain, M; Hussain, H

2015-01-01

Specific health warning placed on the tobacco product packages is considered as an effective and low-cost method for increasing the knowledge and awareness among the community. Thus, a study was conducted to assess the perception of pictorial health warnings (PHWs) against smoking among the adult rural population of Sarawak. Cross-sectional data were collected from 10 villages in Kota Samarahan and Kuching Division by face to face interview using modified Global Adult Tobacco Survey questionnaire. Nonprobability sampling method was adopted to select the villages. All the households of the selected villages were visited and an adult member was selected randomly from each house irrespective of the sex. After missing value imputation, 1000 data were analysed using statistical software IBM SPSS 20.0 version. Analysis showed that 28.8% of the respondents were current smokers, 7.8% were past smokers and the rest were non-smokers. Six items of pictorial health warnings were evaluated with five point Likert's scales for attractiveness, fearfulness and adequacy of the information. Analysis revealed that the majority of the respondents had perceived awareness on PHWs, but the smokers believed that this was not adequate to make them quit smoking. Only one-fifth (19.7%) of them reported that current pictorial health warnings were sufficient to motivate people to quit smoking. Though the PHWs on cigarette packages are appealing, it is not sufficient as a reason to stop smoking. Thus, an approach using an integrated anti-tobacco public health programme should be focused into the specific targeted community.

International Proceedings 2013 of Malaysia-Japan Academic Scholar Conference

CERN Document Server

Ono, Osamu; Bostamam, Anas; Ling, Amy

2015-01-01

The selected papers included in this proceedings on Malaysia-Japan Academic Scholar Conference (MJASC) 2013, are related to nano-science engineering, mechanical engineering, electrical and electronic engineering, computer science, information technology etc. This proceedings will be a source of research findings for Malaysia and Japan specifically, and other countries in general, especially among researchers, industry sectors and government policy makers. It will be served as a resourceful reference and platform to reflect the significant of the Look East Policy outcomes and products.

Documenting pain as the fifth vital sign: a feasibility study in an oncology ward in Sarawak, Malaysia.

Science.gov (United States)

Devi, B C R; Tang, T S

2008-01-01

Monitoring acute postoperative pain as the fifth vital sign is currently practiced in many developed countries. In Sarawak, pain is an important symptom as 70% of cancer patients present with advanced disease. As the existing validated pain assessment tools were found to be difficult to use, we studied the feasibility of modifying the use of a pain assessment tool, consisting of the short form of the Brief Pain Inventory and the Wong-Baker Faces Scale. This tool was used to document pain in all 169 patients who were admitted for pain control to the oncology ward between July 2000 and June 2001. Nurses were trained in the use of the modified scale before the start of the study. The method was easy to use, and the mean number of days to reduce pain was found to be 3.1 days (SD: 2.9; median: 2 days; range: 1-31 days). At discharge, none in the group with initially mild pain had pain, and the severity of pain for 98% of patients with moderate pain and 61% with severe pain was downgraded to mild pain. The staff found that the tool allowed continuous pain assessment in an objective manner. Copyright 2008 S. Karger AG, Basel.

How does the rise of China affect Malaysia's electronic and electrical sector?

OpenAIRE

Ting, Onn

2016-01-01

After joining the WTO in 2001, China’s total exports grew by 19.3% per annum up to 2013 and the country emerged as the world’s biggest exporter of manufactured electronics. China’s rise has had an impact on developing countries such as Malaysia, a major exporter of electronic and electrical (E&E) goods. Malaysia aims to be a high-income economy by 2020, and upgrading its E&E value chain is critical to this goal. Malaysia is part of the East Asian production network and China imports intermedi...

Reducing by half the percentage of late-stage presentation for breast and cervix cancer over 4 years: a pilot study of clinical downstaging in Sarawak, Malaysia.

Science.gov (United States)

Devi, B C R; Tang, T S; Corbex, M

2007-07-01

The registry of the Oncology Departmental in Sarawak General Hospital showed that 79% of nasopharyngeal, 77% of breast and 70% of cervix cancer patients were diagnosed at an advanced stage (stages III and IV) for year 1993. Hence, a low cost Early Cancer Surveillance Program was started in 1994, with the intent of downstaging these three most common cancers in Sarawak. The program consisted of (i) training health staff in hospital and rural clinics to improve their skills in early cancer detection, (ii) raising public awareness through pamphlets, posters and sensitization by health staff. Data analysis revealed that the program achieved downstaging in two of the cancers. Breast cancer in stage III and IV was reduced from 60% (1994) to 35% (1998) (P < 0.0001) and cervical cancer in stage III and IV from 60% (1994) to 26% (1998) (P < 0.0001). No reduction was observed for nasopharyngeal cancer at 88% (1994) to 91% (1998). The overall cost of this program was

Impacts of Horticultural Mineral Oils and Two Insecticide Practices on Population Fluctuation of Diaphorina citri and Spread of Huanglongbing in a Citrus Orchard in Sarawak

Directory of Open Access Journals (Sweden)

Stephen Chan Teck Leong

2012-01-01

Full Text Available Aspects of the incidence and spread of the citrus disease huanglongbing (HLB in relation to the vector Diaphorina citri population fluctuation were studied from January 1999 to December 2001 seasons in a 0.8 ha citrus orchard at Jemukan (1° 33′N, 110° 41′E, Southwest Sarawak in Malaysia. In relation to insecticide and horticultural mineral oils (HMOs use, levels of HLB infection rose quite rapidly over the next 3 years in the unsprayed control and less rapidly in the other treatments such as imidacloprid, nC24HMO, and triazophos/cypermethrin/chlorpyrifos. Levels of HLB as determined by Polymerase Chain Reaction (PCR were 42.2%, 9.4%, 11.4%, and 22.7%, respectively. The effects of nC24HMO and conventional pesticides on the citrus psyllid population and parasitoids in citrus orchard were also determined.

6th COSTAM/SFRR (ASEAN/Malaysia) International Workshop on Micronutrients, Oxidative Stress, and the Environment.

Science.gov (United States)

Nesaretnam, Kalanithi; Sies, Helmut

2006-01-01

The 6(th) COSTAM/SFRR (ASEAN/Malaysia) workshop, "Micronutrients, Oxidative Stress, and the Environment," was held from June 29 to July 2 at Holiday Inn Damai Beach Resort in Kuching, Sarawak. Two hundred twenty participants from 17 countries presented recent advances on natural antioxidants in the area of oxidative stress and molecular aspects of nutrition. Natural products and research are an important program in academic institutions and are experiencing unprecedented interest and growth by the scientific community and public health authorities. Progress is being driven by better understanding of the molecular mechanisms of the relation between oxidative stress and micronutrient action. The gathering of scientists from around the world was fruitful, and we hope that future work will be developed by the formal and informal interactions that took place in this beautiful tropical setting.

Prevalence of musculoskeletal injuries among young squash ...

African Journals Online (AJOL)

The aim of the study was to investigate the prevalence of musculoskeletal injuries sustained by young squash players in Malaysia. This study was conducted retrospectively by using. Standardized Nordic Questionnaire (NSQ) during SUKMA 2016 at Kuching, Sarawak, Malaysia. The questionnaires were distributed to the ...

Tsunami run-up and inundation along the coast of Sabah and Sarawak, Malaysia due to a potential Brunei submarine mass failure.

Science.gov (United States)

Tan, Wai Kiat; Teh, Su Yean; Koh, Hock Lye

2017-07-01

Submarine landslides, also known as submarine mass failures (SMFs), are major natural marine disasters that could critically damage coastal facilities such as nuclear power plants and oil and gas platforms. It is therefore essential to investigate submarine landslides for potential tsunami hazard assessment. Three-dimensional seismic data from offshore Brunei have revealed a giant seabed mass deposited by a previous SMF. The submarine mass extends over 120 km from the continental slope of the Baram Canyon at 200 m water depth to the deep basin floor of the Northwest Borneo Trough. A suite of in-house two-dimensional depth-averaged tsunami simulation model TUNA (Tsunami-tracking Utilities and Application) is developed to assess the vulnerability of coastal communities in Sabah and Sarawak subject to potential SMF tsunami. The submarine slide is modeled as a rigid body moving along a planar slope with the center of mass motion parallel to the planar slope and subject to external forces due to added mass, gravity, and dissipation. The nonlinear shallow water equations are utilized to simulate tsunami propagation from deepwater up to the shallow offshore areas. A wetting-drying algorithm is used when a tsunami wave reaches the shoreline to compute run up of tsunami along the shoreline. Run-up wave height and inundation maps are provided for seven densely populated locations in Sabah and Sarawak to highlight potential risks at each location, subject to two scenarios of slide slopes: 2° and 4°. The first wave may arrive at Kudat as early as 0.4 h after the SMF, giving local communities little time to evacuate. Over a small area, maximum inundated depths reaching 20.3 m at Kudat, 26.1 m at Kota Kinabalu, and 15.5 m at Miri are projected, while the maximum inundation distance of 4.86 km is expected at Miri due to its low-lying coast. In view of the vulnerability of some locations to the SMF tsunami, it is important to develop and implement community resilience

Possible conservation units of the sun bear (Helarctos malayanus) in Sarawak based on variation of mtDNA control region.

Science.gov (United States)

Onuma, Manabu; Suzuki, Masatsugu; Ohtaishi, Noriyuki

2006-11-01

The mitochondrial DNA control region of the sun bear (Helarctos malayanus) was sequenced using 21 DNA samples collected from confiscated sun bears to identify conservation units, such as evolutionarily significant units and management units, in Sarawak, Borneo Island. A total of 10 haplotypes were observed, indicating the presence of at least two lineages in the sun bear population in Sarawak. Presumably, these two lineages could represent evolutionarily significant units. However, the geographical distributions of the two lineages remained unknown due to the lack of information regarding the exact capture locations of the confiscated sun bears. It is essential to elucidate the geographical distributions of these lineages in order to create a proper conservation plan for the sun bears in Sarawak. Therefore, further studies examining the haplotype distributions using DNA samples from known localities are essential.

Initial observation of upwelling along east coast of Peninsular Malaysia musica-gratis.softonic.it/ >musica gratis

Science.gov (United States)

Akhir, M.; Tanggang, F.

2013-12-01

There is no published evidence of upwelling in coastal area along the east coast of Peninsular Malaysia. However numbers of recent cruise data collected during the southwest monsoon found features of thermocline lifting and isolated cooler temperature water along the coast, These sign was observed along the 104°E from numbers of parallel transects. To confirm the presence of upwelling, satellite remote sensing data was used, and numerical model experiments were conducted. Cooler sea-surface temperature along the coast was observed from both in-situ and satellite data, while upward movement in the vertical profiles agreed with the location of upwelling from both in-situ and satellite data. Moreover, these data also show that the upwelled water band along the 104°E longitude stretch approximately 650 km long. Initially, southwesterly wind during this season is believed to be the important mechanism that contributed to this wind-induced Ekman upwelling. musica-gratis.softonic.it/ >musica gratis

 Masquerade of a Silent Killer

Directory of Open Access Journals (Sweden)

Padmini Venkataramani

2011-09-01

Full Text Available   Congenital long QT syndrome (LQTS, referred to as a ticking time-bomb is a cause of sudden death in young infants, children and adults.1 Its prevalence is estimated to be 1 in 2500 to 1 in 10,000 individuals internationally, with no racial predilection.2 It should be viewed as an unrecognized rather than a rare condition.1 This is a descriptive report of eight children diagnosed to have congenital LQTS from 2000 to 2007 (Table 1, in Sarawak General Hospital, Kuching, Sarawak, Malaysia, the main tertiary referral hospital for Sarawak. The population of Sarawak (2006 Census was 2,357,500 and that of Kuching, 435,000.

Sea level rise and variability around Peninsular Malaysia

Science.gov (United States)

Tkalich, Pavel; Luu, Quang-Hung; Tay, Tze-Wei

2014-05-01

Peninsular Malaysia is bounded from the west by Malacca Strait and the Andaman Sea, both connected to the Indian Ocean, and from the east by South China Sea being largest marginal sea in the Pacific Basin. As a result, sea level along Peninsular Malaysia coast is assumed to be governed by various regional phenomena associated with the adjacent parts of the Indian and Pacific Oceans. At annual scale, sea level anomalies (SLAs) are generated by the Asian monsoon; interannual sea level variability is determined by the El Niño-Southern Oscillation (ENSO) and the Indian Ocean Dipole (IOD); whilst long term sea level trend is coordinated by the global climate change. To quantify the relative impacts of these multi-scale phenomena on sea level trend and variability surrounding the Peninsular Malaysia, long-term tide gauge record and satellite altimetry are used. During 1984-2011, relative sea level rise (SLR) rates in waters of Malacca Strait and eastern Peninsular Malaysia are found to be 2.4 ± 0.8 mm/yr and 2.7 ± 0.6 mm/yr, respectively. Discounting for their vertical land movements (0.8 ± 2.6 mm/yr and 0.9 ± 2.2 mm/yr, respectively), their pure SLR rates are 1.6 ± 3.4 mm/yr and 1.8 ± 2.8 mm/yr, respectively, which are lower than the global tendency. At interannual scale, ENSO affects sea level over the Malaysian east coast in the range of ± 5 cm with very high correlation coefficient. Meanwhile, IOD modulates sea level anomalies in the Malacca Strait in the range of ± 2 cm with high correlation coefficient. Interannual regional sea level drops are associated with El Niño events and positive phases of the IOD index; while the rises are correlated with La Niña episodes and the negative periods of the IOD index. Seasonally, SLAs are mainly monsoon-driven, in the order of 10-25 cm. Geographically, sea level responds differently to the monsoon: two cycles per year are observed in the Malacca Strait, presumably due to South Asian - Indian Monsoon; while single

Factors affecting satisfaction on antenatal care services in Sarawak, Malaysia: evidence from a cross sectional study.

Science.gov (United States)

Rahman, Md Mizanur; Ngadan, Deburra Peak; Arif, Mohammad Taha

2016-01-01

High levels of satisfaction among women with the antenatal care services will increase the compliance of antenatal visits during pregnancy. Thus, this study was done to assess the level of satisfaction among women on the quality of antenatal care received and the factors influencing thereof. This was a cross-sectional study conducted in the three zones of Sarawak. Women aged 18 years and above, irrespective of ethnic groups, having children aged 3 years and below were included in the study. Data was collected by face-to-face interview using interview schedule. A validated Patient Satisfaction Questionnaire (PSQ-18) was used to assess the satisfaction with antenatal care. A total of 1236 data was analysed using IBM SPSS version 22.0. A p value <0.05 was considered as statistically significant. A multinomial logistic regression analysis revealed that Bidayuh 17.4 % was less likely to be highly satisfied with antenatal care. Similarly, respondents with secondary level of education 29.9 % were less likely to be highly satisfied, whereas, respondents having primary level of education, 1.6 % were less likely to be highly satisfied. However, those who did not spend any money as out of pocket expenses were 1.935 times more likely to be highly satisfied with antenatal care. Overall the studied women were satisfied with the antenatal care services. Ethnicity, level of education and out of pocket expenses appeared to be important predictors of satisfaction with antenatal care. The finding recommends the community-based and language-specific interventions should be implemented to sustain the satisfaction of maternal care.

Social Welfare in East and West – A Tranquilizer for Dialogue

DEFF Research Database (Denmark)

Juego, Bonn; Schmidt, Johannes Dragsbæk

Policies in Southeast Asia (Thailand and Indonesia in particular, but also Malaysia and the Philippines) in a comparative perspective with the East Asian experience (Japan, Korea and Taiwan - excl. labor), and the Scandinavian experience with corporatism (incl. labor). Are there lessons to be lea......Policies in Southeast Asia (Thailand and Indonesia in particular, but also Malaysia and the Philippines) in a comparative perspective with the East Asian experience (Japan, Korea and Taiwan - excl. labor), and the Scandinavian experience with corporatism (incl. labor). Are there lessons...... definite conclusions or policy prescriptions. As a matter of fact, in terms of social welfare, equity and labor market policies the pre-crisis model of East Asia might offer lessons for the West and vice versa. Mutual learning and dialogue must be the key for future understanding and cooperation....

Human and Animal Pentastomiasis in Malaysia : Review

Directory of Open Access Journals (Sweden)

Bahaa Mohamed Abdul Latif

2016-05-01

Full Text Available Pentastomiasis is a zoonotic parasitic disease induced by the larval stages of pentasomes. The disease has been reported in Africa, the Middle East and Southeast Asia and caused by the nymphs of the two genera:  Linguatula  and Armillifer and the two species L. serrata and A. armillatus regard for more than 90% of human cases. The definitive hosts of Armillifer spp. are snakes, lizards and other reptiles. The parasites live in the upper respiratory tracts and lay eggs that are passed out through respiratory secretions, saliva or faeces. Intermediate hosts are  humans, rodents and other mammals. Humans incidentally acquire the infestation by the consumption of uncooked infested snake meat or by drinking water contaminated with ova of the pentastomes. In the intestinal tract, the larvae hatch from the ova, penetrate the intestinal wall and migrate to organs in which the liver is the most common site. Human pentastomiasis was reported among aborigines in West and East Malaysia. Armillifer moniliformis was identified  in wild animals and carnivores with infection rate 1.8% and 20.7% respectively. The adults of pentostomes (A. moniliformis were recovered from two out of six snakes Python reticulates. Recently a case of human pentastomiasis was reported in Sabah, East Malaysia, caused by nymph of Armillifer moniliformis.

Malaysia : tous les projets | Page 2 | CRDI - Centre de recherches ...

International Development Research Centre (IDRC) Digital Library (Canada)

Sujet: DISTANCE STUDY, ADULT EDUCATION, TEACHING AIDS, EDUCATIONAL RADIO, INFORMATION TECHNOLOGY. Région: Central Asia, Far East Asia, South Asia, Cambodia, Indonesia, Laos, Malaysia, Mongolia, Nepal, Pakistan, Philippines, Japan. Programme: Économies en réseaux. Financement total : CA$ ...

Partial least square method for modelling ergonomic risks factors on express bus accidents in the east coast of peninsular west Malaysia

International Nuclear Information System (INIS)

Hashim, Yusof bin; Taha, Zahari bin

2015-01-01

Public, stake holders and authorities in Malaysian government show great concern towards high numbers of passenger’s injuries and passengers fatalities in express bus accident. This paper studies the underlying factors involved in determining ergonomics risk factors towards human error as the reasons in express bus accidents in order to develop an integrated analytical framework. Reliable information about drivers towards bus accident should lead to the design of strategies intended to make the public feel safe in public transport services. In addition there is an analysis of ergonomics risk factors to determine highly ergonomic risk factors which led to accidents. The research was performed in east coast of peninsular Malaysia using variance-based structural equation modeling namely the Partial Least Squares (PLS) regression techniques. A questionnaire survey was carried out at random among 65 express bus drivers operating from the city of Kuantan in Pahang and among 49 express bus drivers operating from the city of Kuala Terengganu in Terengganu to all towns in the east coast of peninsular west Malaysia. The ergonomic risks factors questionnaire is based on demographic information, occupational information, organizational safety climate, ergonomic workplace, physiological factors, stress at workplace, physical fatigue and near miss accidents. The correlation and significant values between latent constructs (near miss accident) were analyzed using SEM SmartPLS, 3M. The finding shows that the correlated ergonomic risks factors (occupational information, t=2.04, stress at workplace, t = 2.81, physiological factor, t=2.08) are significant to physical fatigue and as the mediator to near miss accident at t = 2.14 at p<0.05and T-statistics, t>1.96. The results shows that the effects of physical fatigue due to ergonomic risks factors influence the human error as the reasons in express bus accidents

Partial least square method for modelling ergonomic risks factors on express bus accidents in the east coast of peninsular west Malaysia

Energy Technology Data Exchange (ETDEWEB)

Hashim, Yusof bin [Faculty of Industrial Sciences and Technology, Universiti Malaysia Pahang, Gambang 26300 Kuantan, Pahang (Malaysia); Taha, Zahari bin [Faculty of Manufacturing Engineering, Malaysia Pahang, 26600 Pekan, Pahang (Malaysia)

2015-02-03

Public, stake holders and authorities in Malaysian government show great concern towards high numbers of passenger’s injuries and passengers fatalities in express bus accident. This paper studies the underlying factors involved in determining ergonomics risk factors towards human error as the reasons in express bus accidents in order to develop an integrated analytical framework. Reliable information about drivers towards bus accident should lead to the design of strategies intended to make the public feel safe in public transport services. In addition there is an analysis of ergonomics risk factors to determine highly ergonomic risk factors which led to accidents. The research was performed in east coast of peninsular Malaysia using variance-based structural equation modeling namely the Partial Least Squares (PLS) regression techniques. A questionnaire survey was carried out at random among 65 express bus drivers operating from the city of Kuantan in Pahang and among 49 express bus drivers operating from the city of Kuala Terengganu in Terengganu to all towns in the east coast of peninsular west Malaysia. The ergonomic risks factors questionnaire is based on demographic information, occupational information, organizational safety climate, ergonomic workplace, physiological factors, stress at workplace, physical fatigue and near miss accidents. The correlation and significant values between latent constructs (near miss accident) were analyzed using SEM SmartPLS, 3M. The finding shows that the correlated ergonomic risks factors (occupational information, t=2.04, stress at workplace, t = 2.81, physiological factor, t=2.08) are significant to physical fatigue and as the mediator to near miss accident at t = 2.14 at p<0.05and T-statistics, t>1.96. The results shows that the effects of physical fatigue due to ergonomic risks factors influence the human error as the reasons in express bus accidents.

Partial least square method for modelling ergonomic risks factors on express bus accidents in the east coast of peninsular west Malaysia

Science.gov (United States)

Hashim, Yusof bin; Taha, Zahari bin

2015-02-01

Public, stake holders and authorities in Malaysian government show great concern towards high numbers of passenger's injuries and passengers fatalities in express bus accident. This paper studies the underlying factors involved in determining ergonomics risk factors towards human error as the reasons in express bus accidents in order to develop an integrated analytical framework. Reliable information about drivers towards bus accident should lead to the design of strategies intended to make the public feel safe in public transport services. In addition there is an analysis of ergonomics risk factors to determine highly ergonomic risk factors which led to accidents. The research was performed in east coast of peninsular Malaysia using variance-based structural equation modeling namely the Partial Least Squares (PLS) regression techniques. A questionnaire survey was carried out at random among 65 express bus drivers operating from the city of Kuantan in Pahang and among 49 express bus drivers operating from the city of Kuala Terengganu in Terengganu to all towns in the east coast of peninsular west Malaysia. The ergonomic risks factors questionnaire is based on demographic information, occupational information, organizational safety climate, ergonomic workplace, physiological factors, stress at workplace, physical fatigue and near miss accidents. The correlation and significant values between latent constructs (near miss accident) were analyzed using SEM SmartPLS, 3M. The finding shows that the correlated ergonomic risks factors (occupational information, t=2.04, stress at workplace, t = 2.81, physiological factor, t=2.08) are significant to physical fatigue and as the mediator to near miss accident at t = 2.14 at p1.96. The results shows that the effects of physical fatigue due to ergonomic risks factors influence the human error as the reasons in express bus accidents.

Stable isotope stratigraphy and larger benthic foraminiferal extinctions in the Melinau Limestone, Sarawak

Science.gov (United States)

Cotton, Laura J.; Pearson, Paul N.; Renema, Willem

2014-01-01

Important long-ranging groups of larger benthic foraminifera (LBF) are known to have become extinct during a period of global cooling and climate disruption at the Eocene-Oligocene transition (EOT) but the precise timing and mechanisms are uncertain. Recent study showed unexpectedly that the LBF extinction in Tanzania occurs very close to the Eocene/Oligocene boundary, as recognised by the extinction of the planktonic foraminiferal Family Hantkeninidae, rather than at the later period of maximum global ice growth and sea-level fall, as previously thought. Here we investigate the same phase of extinction in the Melinau Limestone of Sarawak, on the island of Borneo, Malaysia one of the most complete carbonate successions spanning the Eocene to Lower Miocene. Assemblages of LBF from the Melinau Limestone were studied extensively by Geoffrey Adams during the 1960s-80s, confirming a major extinction during the EOT, but the section lacked independent means of correlation. By analysing rock samples originally studied by Adams and now in the Natural History Museum, London, we provide new bulk stable isotope (δ13C and δ18O) records. This enables us to identify, albeit tentatively, the level of maximum stable isotope excursion and show that the LBF extinction event in the Melinau Limestone occurs below this isotope excursion, supporting the results from Tanzania and indicating that the extinction of LBF close to the Eocene/Oligocene boundary may be a global phenomenon.

Radioactivity in the Exclusive Economic Zone of east coast Peninsular Malaysia. Distribution trends of 137Cs in surface seawater

International Nuclear Information System (INIS)

Zaharudin Ahmad; Zal U'yun Wan Mahmood; Hidayah Shahar; Mei Wo Yii; Ahmad Sanadi Abu Bakar

2011-01-01

Large volumes of surface seawater samples were collected from thirty locations in the Exclusive Economic Zone (EEZ) of the east coast Peninsular Malaysia on June 2008 to study the activity concentrations of 137 Cs. The results will serve as additional information to the existing baseline data and is very useful for monitoring fresh input of anthropogenic radionuclide into Malaysian marine environment. In this study, the activity concentrations of 137 Cs were determined using co-precipitation technique, followed by Gamma Spectrometry measurement. The mean activity concentration of 137 Cs ranged between 3.40 and 5.89 Bq/m 3 . Higher activity concentrations were observed at the coastal and towards the south of Peninsular Malaysia and were aligned with the high turbidity. These may due to the rapid diffusion of 137 Cs from suspended particulates and fine sediments into surface seawater. The activity concentrations of 137 Cs observed in this study were slightly higher than the concentrations reported in seawater at the Straits of Malacca, Vietnam and Philippines. This might be because the study area received more input of 137 Cs that originated from global fallout and then deposited on land which later being transported subsequently into the coastal zone due to siltation and erosion processes. It could also be attributed to the intrusion of river waters containing higher concentrations of 137 Cs. (author)

Sea level trend and variability around the Peninsular Malaysia

Science.gov (United States)

Luu, Q. H.; Tkalich, P.; Tay, T. W.

2014-06-01

Peninsular Malaysia is bounded from the west by Malacca Strait and the Andaman Sea both connected to the Indian Ocean, and from the east by South China Sea being largest marginal sea in the Pacific Basin. Resulting sea level along Peninsular Malaysia coast is assumed to be governed by various regional phenomena associated with the adjacent parts of the Indian and Pacific Oceans. At annual scale, sea level anomalies (SLAs) are generated by the Asian monsoon; interannual sea level variability is determined by the El Niño-Southern Oscillation (ENSO) and the Indian Ocean Dipole (IOD); while long-term sea level trend is related to global climate change. To quantify the relative impacts of these multi-scale phenomena on sea level trend and variability around the Peninsular Malaysia, long-term tide gauge record and satellite altimetry are used. During 1984-2011, relative sea level rise (SLR) rates in waters of Malacca Strait and eastern Peninsular Malaysia are found to be 2.4 ± 1.6 mm yr-1 and 2.7 ± 1.0 mm yr-1, respectively. Allowing for corresponding vertical land movements (VLM; 0.8 ± 2.6 mm yr-1 and 0.9 ± 2.2 mm yr-1), their absolute SLR rates are 3.2 ± 4.2 mm yr-1 and 3.6 ± 3.2 mm yr-1, respectively. For the common period 1993-2009, absolute SLR rates obtained from both tide gauge and satellite altimetry in Peninsular Malaysia are similar; and they are slightly higher than the global tendency. It further underlines that VLM should be taken into account to get better estimates of SLR observations. At interannual scale, ENSO affects sea level over the Malaysian coast in the range of ±5 cm with a very high correlation. Meanwhile, IOD modulates sea level anomalies mainly in the Malacca Strait in the range of ±2 cm with a high correlation coefficient. Interannual regional sea level drops are associated with El Niño events and positive phases of the IOD index; while the rises are correlated with La Niña episodes and the negative periods of the IOD index

Soil Fungal Community Associated with Peat in Sarawak Identified Using 18S rDNA Marker

International Nuclear Information System (INIS)

Siti Ramlah Ahmad Ali; Sakinah Safari; Mohd Shawal Thakib; Shamsilawani Ahamed Bakeri; Nur Aziemah Ab Ghani

2016-01-01

Fungi are principal decomposing microorganisms in acidic environment of peat lands. A useful tool for molecular screening of soil fungal communities using the 18S ribosomal DNA primer has been proven capable of identifying a broad range of fungi species within Ascomycota, Basidiomycota, Zygomycota and Chytridiomycota. Currently, very little information is available on fungal communities in deep peat of Sarawak, Malaysia. In this study, we have isolated the fungi from soil samples taken in deep peat forests and oil palm cultivated areas. The fungal identity was undertaken using 18S ribosomal DNA primer which is EF4-F/ fung5-R. The microscopic structures were conducted to confirm the identity of the isolates. Based on this study, the fungal division most commonly found in deep peat is the Ascomycota. Aspergillus fumigatus was the most common species and more dominant in oil palm cultivated areas and logged-over forest than in primary forest. In the primary forest, the dominant species was the A. flavus, while Hypocrea atroviridis was commonly associated with oil palm cultivated areas and logged-over forest. Other species of fungi isolated in peat primary forests were Penicillium chrysogenum, Trichoderma sp., Phanerochaete sp., Mortierella chlamydospora, A. niger, A. alliaceus, etc. The in-depth difference in the fungal communities for the different sites will be further investigated using the next generation sequencing technology. (author)

Accumulation of Settling Particles in Some Coral Reef Areas of Peninsular Malaysia

International Nuclear Information System (INIS)

Lee, J.N.; Che Abdul Rahim Mohamed

2011-01-01

The aim of this study was to determine the accumulation of settling particles in coral reefs of Peninsular Malaysia. Settling particles were collected from the coral reefs of Port Dickson, Pulau Langkawi, Pulau Tioman, Pulau Redang and Pulau Tinggi from 2005 to 2008. The average total settling particles in Pulau Langkawi and Port Dickson was 49.8 mg/ cm 2 / day, while for Pulau Tioman, Pulau Redang, and Pulau Tinggi was 3.5 mg/ cm 2 / day. The results showed that accumulations rate in west coast were higher than east coast of Peninsular Malaysia. However, Pulau Tioman in the east coast received high accumulations rate of settling particles in certain times of the year due to sediment resuspension at shallow reefs caused by high energy seasonal yearly wave and monsoon. (author)

Three new species of Merizocotyle Cerfontaine, 1894 (Monogenea: Monocotylidae) from the nasal tissues of dasyatid rays collected off Malaysian and Indonesian Borneo.

Science.gov (United States)

Chisholm, Leslie A; Whittington, Ian D

2012-06-01

Three new species of Merizocotyle Cerfontaine, 1894 (Monogenea: Monocotylidae) are described from the nasal tissues of stingrays collected off Borneo. Merizocotyle macrostrobus n. sp. is described from the dwarf whipray Himantura walga (Müller & Henle) collected in shallow waters off Sematan, Sarawak, Malaysia. This species can be distinguished from the other members of the genus by the morphology of the sclerotised male copulatory organ, which is long with many twists and loops. The vaginae of this species are also long and looped. Merizocotyle papillae n. sp. is described from the roughnose stingray Pastinachus solocirostris Last, Manjaji & Yearsley collected off Sematan and Mukah, Sarawak, Malaysia. It is distinguished from the other species of Merizocotyle by the morphology of the male copulatory organ, which is a sclerotised tube that expands slightly and then tapers at the distal end, and by the presence of papillae on the dorsal edge of the haptor. Merizocotyle rhadinopeos n. sp. is described from the whitenose whip ray Himantura uarnacoides (Bleeker) collected off Manggar, East Kalimantan, Indonesia. It can be differentiated by the male copulatory organ, which is a short, narrow, curved, sclerotised tube tapering distally, and the path of the ovary, which runs anteriorly to the base of the oötype. We also provide details of new host and/or locality records for M. australensis (Beverley-Burton & Williams, 1989) Chisholm, Wheeler & Beverley-Burton, 1995, M. icopae Beverley-Burton & Williams, 1989 and M. pseudodasybatis (Hargis, 1955) Chisholm, Wheeler & Beverley-Burton, 1995.

A Triassic to Cretaceous Sundaland-Pacific subduction margin in West Sarawak, Borneo

Science.gov (United States)

Breitfeld, H. Tim; Hall, Robert; Galin, Thomson; Forster, Margaret A.; BouDagher-Fadel, Marcelle K.

2017-01-01

Metamorphic rocks in West Sarawak are poorly exposed and studied. They were previously assumed to be pre-Carboniferous basement but had never been dated. New 40Ar/39Ar ages from white mica in quartz-mica schists reveal metamorphism between c. 216 to 220 Ma. The metamorphic rocks are associated with Triassic acid and basic igneous rocks, which indicate widespread magmatism. New U-Pb dating of zircons from the Jagoi Granodiorite indicates Triassic magmatism at c. 208 Ma and c. 240 Ma. U-Pb dating of zircons from volcaniclastic sediments of the Sadong and Kuching Formations confirms contemporaneous volcanism. The magmatic activity is interpreted to represent a Triassic subduction margin in westernmost West Sarawak with sediments deposited in a forearc basin derived from the magmatic arc at the Sundaland-Pacific margin. West Sarawak and NW Kalimantan are underlain by continental crust that was already part of Sundaland or accreted to Sundaland in the Triassic. One metabasite sample, also previously assumed to be pre-Carboniferous basement, yielded Early Cretaceous 40Ar/39Ar ages. They are interpreted to indicate resumption of subduction which led to deposition of volcaniclastic sediments and widespread magmatism. U-Pb ages from detrital zircons in the Cretaceous Pedawan Formation are similar to those from the Schwaner granites of NW Kalimantan, and the Pedawan Formation is interpreted as part of a Cretaceous forearc basin containing material eroded from a magmatic arc that extended from Vietnam to west Borneo. The youngest U-Pb ages from zircons in a tuff layer from the uppermost part of the Pedawan Formation indicate that volcanic activity continued until c. 86 to 88 Ma when subduction terminated.

Correlation Dynamics in East Asian Financial Markets

NARCIS (Netherlands)

Kuper, Gerard; Lestano, L

2014-01-01

This paper examines the dynamic relationship between stock returns and exchange rate changes using daily data from January 3, 1994 - September 27, 2013 for six East Asian countries: Indonesia, Malaysia, the Philippines, Singapore, South Korea and Thailand. We estimate conditional correlations using

INFORMATION BEHAVIOR AND TECHNOLOGY AFFINITY AMONG HIGHER INSTITUTION LEARNERS IN BORNEO

OpenAIRE

Johari, Nurul Muizzah

2016-01-01

This study aims to provide an understanding of information behavior with technology based on gender. It also to investigate the relationship between information behavior and degree of technology affinity. This research has been conducted quantitatively and using survey to gain data from participants.  Participant are selected randomly across Universiti Malaysia Sarawak, Sarawak. The instrument are adopted from Mills, Knezek, and Wakefield (2013) which taking interest into information behavior...

Beyond hydrology in the sustainability assessment of dams: A planners perspective - The Sarawak experience

Science.gov (United States)

Andre, Edward

2012-01-01

SummaryThere is increasing concern about the availability of water supplies in developing countries to provide clean drinking water and sanitation as well as providing for irrigation for food security. This has led to hydrologically led investigation to establish the feasibility and storage capacity of potentially new dam sites. This task has become more difficult for hydrologists and others with the uncertainties created by climate change and the measurement of the hydrological, geographical and ecological footprint of new dams. The questions asked by hydrologists are increasingly likely to be required to be cast in terms of the four pillars of sustainability; environmental, economic, social and institutional. Similarly, regional planners have to be more cognisant of the social outcomes of dam development while understanding the wider hydrological context at a watershed and basin level. The paper defines the concept of sustainability assessment in the context of resettlement and analyses its implications for the Bakun Hydro-electric project in Sarawak, Malaysia. Specifically it attempts to address the question of what social sustainability would really mean in the context of communities affected by dam projects, and their catchments using hermeneutics, tradeoffs and offsets. The findings of this question were presented at a hydrological conference held in Santiago in October 2010, based on the outcome of specific questionnaire responses received from indigenous peoples affected by the Bakun Dam hydroelectric project. The paper also offers some insights pertaining to the social sustainability assessment aspects of dams and their catchments.

Nucleocapsid gene analysis from an imported case of Middle East respiratory syndrome coronavirus, Malaysia

Directory of Open Access Journals (Sweden)

Nor-Aziyah Mat-Rahim

2015-07-01

Full Text Available Objective: To describe the complete nucleocapsid (N gene region of Middle East respiratory syndrome coronavirus (MERS-CoV from imported case in Malaysia and the relations with human- and camel-derived MERS-CoV. Methods: Combination of throat and nasal swab specimens was subjected to viral RNA extraction. For screening, the extracted RNA was subjected to real-time RT-PCR targeting upstream of E gene, open reading frame 1b and open reading frame 1a. For confirmation, the RNA was subjected to RT-PCR targeting partial part of the RNA-dependent RNA polymerase and nucleocapsid, followed by amplification of complete N gene region. Nucleotide sequencing of the first Malaysian case of MERS-CoV was performed following the confirmation with real-time RT-PCR detection. Results: Initial analysis of partial RNA-dependent RNA polymerase and N gene revealed that the nucleotides had high similarity to Jeddah_1_2013 strain. Analysis of complete N gene region (1 242 nucleotides from the case showed high similarity and yet distinct to the nucleotide sequences of camel-derived MERS-CoV. Conclusions: From the finding, there are possibilities that the patient acquired the infection from zoonotic transmission from dromedary camels.

Reversed fortunes in the south : a comparison of the role of FDI in industrial development in Kenya and Malaysia

NARCIS (Netherlands)

Kinuthia, Bethuel Kinyanjui

2013-01-01

This book examines the causes of observed reversal of fortunes between Sub-Saharan Africa and South East Asia in the last 50 years. Specifically, it compares Kenya and Malaysia which 50 years ago were arguably at similar levels of development. Today, Malaysia is an industrialised country while Kenya

PREFACE: 8th International Symposium of the Digital Earth (ISDE8)

Science.gov (United States)

2014-02-01

Proceedings of the 8th International Symposium of Digital Earth (8th ISDE) 2013 Kuching, Sarawak, Malaysia, 26th-29th August, 2013 Conference logo This proceedings consists of the peer-reviewed papers from 8th International Symposium for Digital Earth (ISDE) held in Kuching, Sarawak, Malaysia during 26th-29th August, 2013. The 8th ISDE was a successful event in the Symposium Series of the International Society of Digital Earth, that was previously held in China (1999), Canada (2001), Czech Republic (2003), Japan (2005), the United States (2007), China (2009), and Australia (2011). The 8th ISDE, with the theme 'Transforming Knowledge into Sustainable Practice' aims to enable digital earth scientists, experts and professionals related to the field of geospatial science and technology to provide a brand new opportunity to share their ideas and insights on how we share knowledge and act together globally. In addition, the ISDE symposium series has been providing a venue for researchers and industry practitioners to discuss new ideas, collaborate to solve complex solutions to various complex problems, and importantly, pave new ways in digital earth environment. This 8th ISDE included 20 technical sessions, workshops and student sessions in various areas of digital earth; ranging from digital earth vision & innovation; earth observation technologies; ICT technologies (including spatial data infrastructures); empowering the community and engaging society; applications and innovation of digital earth for environmental applications such as hazard, pollution, flood, air quality, disaster and health, biodiversity, sustainability, forestry, early warning and emergency management, national security, natural resource management and agriculture; mining, energy and resources development; transformation towards sustainable low carbon society; digital city and green cities: towards urban sustainability; and managing water environment for sustainable development. The success of the 8

Forensic timber identification: a case study of a CITES listed species, Gonystylus bancanus (Thymelaeaceae).

Science.gov (United States)

Ng, Kevin Kit Siong; Lee, Soon Leong; Tnah, Lee Hong; Nurul-Farhanah, Zakaria; Ng, Chin Hong; Lee, Chai Ting; Tani, Naoki; Diway, Bibian; Lai, Pei Sing; Khoo, Eyen

2016-07-01

Illegal logging and smuggling of Gonystylus bancanus (Thymelaeaceae) poses a serious threat to this fragile valuable peat swamp timber species. Using G. bancanus as a case study, DNA markers were used to develop identification databases at the species, population and individual level. The species level database for Gonystylus comprised of an rDNA (ITS2) and two cpDNA (trnH-psbA and trnL) markers based on a 20 Gonystylus species database. When concatenated, taxonomic species recognition was achieved with a resolution of 90% (18 out of the 20 species). In addition, based on 17 natural populations of G. bancanus throughout West (Peninsular Malaysia) and East (Sabah and Sarawak) Malaysia, population and individual identification databases were developed using cpDNA and STR markers respectively. A haplotype distribution map for Malaysia was generated using six cpDNA markers, resulting in 12 unique multilocus haplotypes, from 24 informative intraspecific variable sites. These unique haplotypes suggest a clear genetic structuring of West and East regions. A simulation procedure based on the composition of the samples was used to test whether a suspected sample conformed to a given regional origin. Overall, the observed type I and II errors of the databases showed good concordance with the predicted 5% threshold which indicates that the databases were useful in revealing provenance and establishing conformity of samples from West and East Malaysia. Sixteen STRs were used to develop the DNA profiling databases for individual identification. Bayesian clustering analyses divided the 17 populations into two main genetic clusters, corresponding to the regions of West and East Malaysia. Population substructuring (K=2) was observed within each region. After removal of bias resulting from sampling effects and population subdivision, conservativeness tests showed that the West and East Malaysia databases were conservative. This suggests that both databases can be used independently

Prevalence of potentially pathogenic Vibrio species in the seafood marketed in Malaysia.

Science.gov (United States)

Elhadi, Nasreldin; Radu, Son; Chen, Chien-Hsien; Nishibuchi, Mitsuaki

2004-07-01

Seafood samples obtained in seafood markets and supermarkets at 11 sites selected from four states in Malaysia were examined for the presence of nine potentially pathogenic species from the genus Vibrio between July 1998 and June 1999. We examined 768 sample sets that included shrimp, squid, crab, cockles, and mussels. We extensively examined shrimp samples from Selangor State to determine seasonal variation of Vibrio populations. Eight potentially pathogenic Vibrio species were detected, with overall incidence in the samples at 4.6% for V. cholerae, 4.7% for V. parahaemolyticus, 6.0% for V. vulnificus, 11% for V. alginolyticus, 9.9% for V. metschnikovii, 1.3% for V. mimicus, 13% for V. damsela, 7.6% for V. fluvialis, and 52% for a combined population of all of the above. As many as eight Vibrio species were detected in shrimp and only four in squid and peel mussels. The overall percent incidence of any of the eight vibrios was highest (82%) in cockles (Anadara granosa) among the seafoods examined and was highest (100%) in Kuching, Sarawak State, and lowest (25%) in Penang, Pulau Penang State, among the sampling sites. Of 97 strains of V. cholerae isolated, one strain belonged to the O1 serotype and 14 to the O139 serotype. The results indicate that the various seafood markets in Malaysia are contaminated with potentially pathogenic Vibrio species regardless of the season and suggest that there is a need for adequate consumer protection measures.

CULTURAL TOURISM IN MALAYSIA IN THE PERSPECTIVE OF INDIAN TOURISTS: A STUDY

OpenAIRE

Kiran Sarkar SUDIPTA; Lenka SARAT; George P. BABU

2010-01-01

Malaysia is one of the economic superpowers in South East Asia, prospering at a fast pace as tourism is becoming one of the most important sectors of its economy. Areas like entertainment; beach and island tourism has become some of the major determinants of Malaysia’s phenomenal progress in tourism in the last few years. Yet one area that seems to get less attention is its cultural resources. Recently, Malaysia has turned out as one of the major destinations for the Indian Outbound Tourism m...

Situation Report--Hong Kong, Malawi, Pakistan, Panama, Philippines, Ryukyu Islands (Okinawa), Sabah, Sarawak.

Science.gov (United States)

International Planned Parenthood Federation, London (England).

Data relating to population and family planning in eight foreign countries are presented in these situation reports. Countries included are Hong Kong, Malawi, Pakistan, Panama, Philippines, Ryukyu Islands (Okinawa), Sabah, and Sarawak. Information is provided where appropriate and available, under two topics, general background and family planning…

A Survey on the Usage of Biomass Wastes from Palm Oil Mills on Sustainable Development of Oil Palm Plantations in Sarawak

Science.gov (United States)

Phang, K. Y.; Lau, S. W.

2017-06-01

As one of the world’s largest palm oil producers and exporters, Malaysia is committed to sustainable management of this industry to address the emerging environmental challenges. This descriptive study aims to evaluate the oil palm planters’ opinions regarding the usage of biomass wastes from palm oil mills and its impact on sustainable development of oil palm plantations in Sarawak. 253 planters across Sarawak were approached for their opinions about the usage of empty fruit bunch (EFB), palm oil mill effluent (POME), mesocarp fibre (MF), and palm kernel shell (PKS). This study revealed that the planters had generally higher agreement on the beneficial application of EFB and POME in oil palm plantations. This could be seen from the higher means of agreement rating of 3.64 - 4.22 for EFB and POME, compared with the rating of 3.19 - 3.41 for MF and PKS in the 5-point Likert scale (with 5 being the strongest agreement). Besides, 94.7 percent of the planters’ companies were found to comply with the Environmental Impact Assessment (EIA) requirements where nearly 38 percent carried out the EIA practice twice a year. Therefore high means of agreement were correlated to the compliance of environmental regulations, recording a Likert rating of 3.89 to 4.31. Lastly, the usage of EFB and POME also gained higher Likert scale point of 3.76 to 4.17 against MF and PKS of 3.34 to 3.49 in the evaluation of the impact of sustainability in oil palm plantations. The planters agreed that the usage of EFB and POME has reduced the environmental impact and improved the sustainable development, and its application has been improved and increased by research and development. However the planters were uncertain of the impact of usage of biomass wastes with respect to the contribution to social responsibility and company image in terms of transparency in waste management.

GROWTH AFTER THE ASIAN CRISIS: WHAT REMAINS OF THE EAST ASIAN MODEL?

OpenAIRE

JOMO K.S.

2001-01-01

This paper focuses on the prospects for sustained development in the four East Asian economies most adversely affected by the crises of 1997/98. These include all three second-tier South-East Asian newly industrializing countries (NICs) – Indonesia, Malaysia and Thailand – as well as the Republic of Korea, the most adversely affected of the first-generation newly industrialized economies (NIEs). The first section critically examines the East Asian model presented by the World Bank’s “East Asi...

Grænsestrategier og transnationale relationer

DEFF Research Database (Denmark)

Eilenberg, Michael

2006-01-01

I denne artikel ønsker jeg at undersøge betydningen af transnationale etniske relationer for den indonesiske ibanske befolkning, der er bosat i grænselandet, mellem den malaysiske delstat, Sarawak og den indonesiske provins, Vest Kalimantan. Jeg vil diskutere hvordan transnationale etniske...... disse processer, som de kommer til udtryk i form af bl.a. arbejdsmigration på tværs af den internationale grænse til Sarawak, Malaysia. Udgivelsesdato: Juli...

Alcohol consumption and risky drinking patterns in Malaysia: findings from NHMS 2011.

Science.gov (United States)

Mutalip, Mohd Hatta B Abdul; Kamarudin, Rozanim Bt; Manickam, Mala; Abd Hamid, Hamizatul Akmal Bt; Saari, Riyanti Bt

2014-01-01

To identify the characteristics of current drinker and risky alcohol-drinking pattern by profiles in Malaysia. We analyzed data from the National Health and Morbidity Survey 2011. It was a cross-sectional population-based with two stages stratified random sampling design. A validated Alcohol Use Disorder Identification Test Malay questionnaire was used to assess the alcohol consumption and its alcohol related harms. Analysis of complex survey data using Stata Version 12 was done for descriptive analysis on alcohol use and risky drinking by socio-demography profiles. Logistic regression analysis was used to measure the association of risky drinking status with the socio-demography characteristics. The prevalence of current alcohol use was 11.6% [95% confidence interval (CI): 10.5, 12.7], among them 23.6% (95% CI: 21.0, 26.4) practiced risky drinking. The onset for alcohol drinking was 21 years old (standard deviation 7.44) and majority preferred Beer. Males significantly consumed more alcohol and practiced risky drinking. Current alcohol use was more prevalent among urbanites, Chinese, those with high household income, and high education. Conversely, risky drinking was more prevalent among rural drinkers, Bumiputera Sabah and Sarawak, low education and low household income. The estimated odds of risky drinking increased by a factor of 3.5 among Males while a factor of 2.7 among Bumiputera Sabah and Sarawak. Education status and household income was not a significant predictor to risky drinking. There was an inverse drinking pattern between current drinker and risky drinking by the socio-demography profiles. Initiating early screening and focused intervention might avert further alcohol related harms and dependence among the risky drinkers. © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

Educational Transition of East Malaysian Distance Learners.

Science.gov (United States)

Saw, K. G.; Awang, M. N.; Idrus, R. M.; Atan, H.; Azli, N. A.; Jaafar, I.; Rahman, Z. A.; Latiff, Z. A.

1999-01-01

Describes results of a study of the changing perceptions of East Malaysian distance learners studying at the Universiti Sains Malaysia. Highlights include students' perceptions of their study skills; and the impact of their studies on other areas of their life, including social obligations, recreation, families, health, finances, work, and…

Comparison of access to medicines between Klang Valley and East ...

African Journals Online (AJOL)

income of USD1/person/day) between urbanised Klang Valley and rural East Coast of Peninsular Malaysia. Methods: A semi-structured interview was conducted with caregivers to determine demographics, access to medicines, knowledge, ...

Characteristic of root decomposition in a tropical rainforest in Sarawak, Malaysi

Science.gov (United States)

Ohashi, Mizue; Makita, Naoki; Katayam, Ayumi; Kume, Tomonori; Matsumoto, Kazuho; Khoon Kho, L.

2016-04-01

Woody roots play a significant role in forest carbon cycling, as up to 60 percent of tree photosynthetic production can be allocated to belowground. Root decay is one of the main processes of soil C dynamics and potentially relates to soil C sequestration. However, much less attention has been paid for root litter decomposition compared to the studies of leaf litter because roots are hidden from view. Previous studies have revealed that physico-chemical quality of roots, climate, and soil organisms affect root decomposition significantly. However, patterns and mechanisms of root decomposition are still poorly understood because of the high variability of root properties, field environment and potential decomposers. For example, root size would be a factor controlling decomposition rates, but general understanding of the difference between coarse and fine root decompositions is still lacking. Also, it is known that root decomposition is performed by soil animals, fungi and bacteria, but their relative importance is poorly understood. In this study, therefore, we aimed to characterize the root decomposition in a tropical rainforest in Sarawak, Malaysia, and clarify the impact of soil living organisms and root sizes on root litter decomposition. We buried soil cores with fine and coarse root litter bags in soil in Lambir Hills National Park. Three different types of soil cores that are covered by 1.5 cm plastic mesh, root-impermeable sheet (50um) and fungi-impermeable sheet (1um) were prepared. The soil cores were buried in February 2013 and collected 4 times, 134 days, 226 days, 786 days and 1151 days after the installation. We found that nearly 80 percent of the coarse root litter was decomposed after two years, whereas only 60 percent of the fine root litter was decomposed. Our results also showed significantly different ratio of decomposition between different cores, suggesting the different contribution of soil living organisms to decomposition process.

Foliar diagnosis, nutrition and yield stability of black pepper (Piper nigrum L.) in Sarawak

NARCIS (Netherlands)

Waard, de P.W.F.

1969-01-01

Until 1942 cultivation of pepper P. nigrum L. in Sarawak produced relatively small but regular yields. High demands after 1945 and restricted use of "burnt earth" compelled farmers to abandon the application of this traditional fertilizer. Instead, "fool proof" manufactured fertilizers

Une Cyathura cavernicole nouvelle de Sarawak – Kalimantan du Nord (Isopoda, Anthuridae)

NARCIS (Netherlands)

Andreev, Stoitze

1982-01-01

A l’occasion d’une expédition spéléologique effectuée en 1978 à Sarawak et organisée par la Royal Geographical Society, le biospéléologue anglais Dr. Ph. Chapman a recueilli quelques exemplaires d’un Isopode des eaux douces souterraines, appartenant à une nouvelle espèce du genre Cyathura. La

Drepanosticta adenani sp. nov., from the Lanjak Entimau Wildlife Sanctuary in Sarawak (Odonata: Zygoptera: Platystictidae).

Science.gov (United States)

Dow, Rory A; Reels, Graham T

2018-02-15

Drepanosticta adenani sp. nov. (holotype ♂, from a tributary of Sungai Jela, Nanga Segerak area, Lanjak Entimau Wildlife Sanctuary, Sri Aman Division, Sarawak, Malaysian Borneo, 18 vii 2016, deposited in the Natural History Museum, London) is described from both sexes.

The Statecraft of Lee Kuan Yew, Visionary and Opportunist

National Research Council Canada - National Science Library

Thomas, David

1996-01-01

...." "Not so," replied the passenger, Lee Kuan Yew, "Singapore intends to continue to ride along as part of the federation created with Malaysia, Sarawak, and Sabah -- we have no plans for getting off...

Study on the Tribe Ochyromerini (Coleoptera, Curculionidae) from East Asia I, Descriptions of New Species of the Genera Endaeus and Endaenidius

OpenAIRE

Kojima, Hiroaki; Morimoto, Katsura

1995-01-01

This is the first part of our systematic study on the tribe Ochyromerini (=Endaeini) from East Asia with descriptions of 28 new species of the weevils in the genera Endaeus Schoenherr and Endaenidius Morimoto as follows: Endaeus albolineatus sp. nov. (E. Malaysia), Endaeus niger sp. nov. (E. Malaysia), Endaeus zonatus sp. nov. (E. Malaysia), Endaeus robustus sp. nov. (Thailand), Endaeus longipes sp. nov. (E. Malaysia), Endaeus formosanus sp. nov. (Taiwan), Endaeus elongatus sp. nov. (Taiwan),...

Travelers' Health: Japanese Encephalitis

Science.gov (United States)

... a 2-dose primary series of Ixiaro. VACCINE SAFETY AND ADVERSE REACTIONS Local symptoms of pain and ... human cases in north, central, and southern Laos Malaysia Endemic in Sarawak; sporadic cases reported from all ...

Baseline trace metals in water and sediment of the Baleh River-a tropical river in Sarawak, Malaysia.

Science.gov (United States)

Sim, Siong Fong; Chai, Hui Ping; Nyanti, Lee; Ling, Teck Yee; Grinang, Jongkar

2016-09-01

Quantitative indices are classically employed to evaluate the contamination status of metals with reference to the baseline concentrations. The baselines vary considerably across different geographical zones. It is imperative to determine the local geochemical baseline to evaluate the contamination status. No study has been done to establish the background concentrations in tropical rivers of this region. This paper reports the background concentrations of metals in water and sediment of the Baleh River, Sarawak, derived based on the statistical methods where the areas possibly disturbed are distinguished from the undisturbed area. The baseline levels of six elements in water determined were Al (0.34 mg/L), Fe (0.51 mg/L), Mn (0.12 mg/L), Cu (0.01 mg/L), Pb (0.03 mg/L), and Zn (0.05 mg/L). Arsenic and selenium were below the detection limit. For sediment, the background values were established according to statistical methods including (mean + 2σ), iterative 2σ, cumulative distribution frequency, interquartile, and calculation distribution function. The background values derived using the iterative 2σ algorithm and calculated distribution function were relatively lower. The baseline levels calculated were within the range reported in the literatures mainly from tropical and sub-tropical regions. The upper limits proposed for nine elements in sediment were Al (100,879 mg/kg), Cr (75.45 mg/kg), Cu (34.59 mg/kg), Fe (37,823 mg/kg), Mn (793 mg/kg), Ni (22.88 mg/kg), Pb (27.26 mg/kg), Zn (70.64 mg/kg), and Hg (0.33 mg/kg). Quantitative indices calculated suggest low risk of contamination at the Baleh River.

Prevalence of snake bites in Kangar District Hospital, Perlis, west Malaysia: a retrospective study (January 1999-December 2000).

Science.gov (United States)

Jamaiah, I; Rohela, M; Roshalina, R; Undan, R C

2004-12-01

The records of 284 snake bite cases presenting to the Kangar District Hospital, Perlis, west Malaysia, from January 1999 till December 2000 were carefully reviewed. Data on prevalence and types of snake bites, were recorded. The majority of the cases were among Malays (60.2%), followed by Chinese (16.9%), Indians (13%), and others which include Thai nationals, army personnel from Sabah and Sarawak, and foreign tourists (9.8%). A higher incidence was found in males (60.2%) and most cases were seen in the age group of 10-19 years (33%). Snake bites were more common between 2 PM and 9 PM (47.6%) and from 7 AM to 2 PM (33.4%). The snakes were positively identified in 68 cases, of which 50 were common cobras (Naja naja) (73%), 16 were Malayan pit vipers (Agkistrodon rhodostoma) (24%) and two were sea-snakes (3%).

A Review of Field Technologies for Long-Term Monitoring of Ordnance-Related Compounds in Groundwater

National Research Council Canada - National Science Library

MacMillan, Denise K; Splichal, David E

2005-01-01

... information over tropical rainforest canopy. Here our research site is Lambir Hills national park, covered by lowland mixed Dipterocarp forests as one of the typical tropical rain forests, Sarawak, Malaysia and the used measurement platform...

The contributions of construction material waste to project cost ...

African Journals Online (AJOL)

countries experience overruns exceeding 100% of the initial budget. (Memon .... The approximate conversion rates used as at the period of data collection were: Nigerian ..... Majestic Hotel, 7-8 July 2010, Kuching, Sarawak, Malaysia. Imam, A.

The biotechnology and bioeconomy landscape in Malaysia.

Science.gov (United States)

Arujanan, Mahaletchumy; Singaram, Muthu

2018-01-25

Since 1990s Malaysia aspired to make biotechnology and bioeconomy as her engines of economic growth to utlise the abundance of natural resources and biodiversity. The public sector plays an integral role in developing the sector and various incentives are in place for the private sector to be actively involved and to forge collaboration with the public sector. The country launched its National Biotechnology Policy in 2005 and later launched its National Bioeconomy Programme in 2010 to become the first country in South East Asia and second in Asia after China to have such an initiative. Malaysia is also very proactive in its biosafety law and regulations and has most of the related legal instrument in place. A lot of success has been recorded since the inception of the National Biotechnology Policy in terms of job creation, contribution to GDP through biobusinesses and investment from foreign companies, but the sector is not spared from challenges too. Due to the nature of the discipline that is multidisciplinary and that requires huge amount of investment, expertise and political will, there are a lot of barriers before the country emerges as a bioeconomy player. This paper discusses the public policies, initiatives and funding mechanisms in place in Malaysia that drive its research, development and commercialisation in the area of biotechnology and bioeconomy. The authors also discuss the challenges faced in Malaysia in implementing the policies. Copyright © 2017 Elsevier B.V. All rights reserved.

CULTURAL TOURISM IN MALAYSIA IN THE PERSPECTIVE OF INDIAN TOURISTS: A STUDY

Directory of Open Access Journals (Sweden)

George P. BABU

2010-12-01

Full Text Available Malaysia is one of the economic superpowers in South East Asia, prospering at a fast pace as tourism is becoming one of the most important sectors of its economy. Areas like entertainment; beach and island tourism has become some of the major determinants of Malaysia’s phenomenal progress in tourism in the last few years. Yet one area that seems to get less attention is its cultural resources. Recently, Malaysia has turned out as one of the major destinations for the Indian Outbound Tourism market. This study looks into the situation that prevails in the area of cultural tourism in Malaysia and how are cultural as well as historical attractions of Malaysia viewed from the perspective of international tourists from India. With the help of descriptive analysis the study probes into the significance of Malaysia’s historical tourism and the awareness and perception about it among Indian visitors. Based on the study it is revealed that Malaysia’s cultural tourism resources are not promoted to the extent to which it becomes a significant part of the nation’s destination image. Lack of promotion and information available makes international visitors unaware about the potential of Malaysia as a cultural tourism destination. However, most of the tourists were satisfied with the cultural sites/attractions and think Malaysia is a reasonably good cultural destination.

The ecology and forest types of the peat swamp forests of Sarawak and Brunei

NARCIS (Netherlands)

Anderson, J.A.R.

1961-01-01

The following is an author’s summary of the (as yet unpublished) thesis by Dr. J.A.R. Anderson of Kuching, Sarawak (see III. Personal news). Both the author and botanical science are to be congratulated with the completion of this important work, which we hope before long to see in print. The thesis

Bioactive compounds and antioxidant activity analysis of Malaysian pineapple cultivars

Science.gov (United States)

Chiet, Chong Hang; Zulkifli, Razauden Mohamed; Hidayat, Topik; Yaakob, Harisun

2014-03-01

Pineapple industry is one of the important agricultural sectors in Malaysia with 76 cultivars planted throughout the country. This study aims to generate useful nutritional information as well as evaluating antioxidant properties of different pineapple commercial cultivars in Malaysia. The bioactive compound content and antioxidant capacity of `Josapine', `Morris' and `Sarawak' pineapple (Ananas comosus) were studied. The pineapple varieties were collected at commercial maturity stage (20-40% yellowish of fruit peel) and the edible portion of the fruit was used as sample for evaluation. The bioactive compound of the fruit extracts were evaluated by total phenolic and tannin content assay while the antioxidant capacity was determined by ferric reducing antioxidant power (FRAP). From the results obtained, total phenolic and tannin content was highest for `Josapine' followed by `Morris' and `Sarawak'. With respect to FRAP, `Josapine' showed highest reducing capacity, followed by `Morris' and then `Sarawak' having the least value. The bioactive compounds content are positively correlated with the antioxidant capacities of the pineapple extracts. This result indicates that the total phenolics and tannin content present in the pineapples may contribute to the antioxidant capacity of the pineapples.

Water quality monitoring: A comparative case study of municipal and Curtin Sarawak's lake samples

Science.gov (United States)

Anand Kumar, A.; Jaison, J.; Prabakaran, K.; Nagarajan, R.; Chan, Y. S.

2016-03-01

In this study, particle size distribution and zeta potential of the suspended particles in municipal water and lake surface water of Curtin Sarawak's lake were compared and the samples were analysed using dynamic light scattering method. High concentration of suspended particles affects the water quality as well as suppresses the aquatic photosynthetic systems. A new approach has been carried out in the current work to determine the particle size distribution and zeta potential of the suspended particles present in the water samples. The results for the lake samples showed that the particle size ranges from 180nm to 1345nm and the zeta potential values ranges from -8.58 mV to -26.1 mV. High zeta potential value was observed in the surface water samples of Curtin Sarawak's lake compared to the municipal water. The zeta potential values represent that the suspended particles are stable and chances of agglomeration is lower in lake water samples. Moreover, the effects of physico-chemical parameters on zeta potential of the water samples were also discussed.

Research Productivity of Returnees from Study Abroad in Korea, Hong Kong, and Malaysia

Science.gov (United States)

Shin, Jung Cheol; Jung, Jisun; Postiglione, Gerard A.; Azman, Norzaini

2014-01-01

This study analyzes whether academics with advanced degrees from foreign universities are more research productive than their domestic counterparts in the three selected East Asian higher education systems--Korea, Hong Kong, and Malaysia. The three systems have relatively large proportions of foreign degree holders among their professoriates. The…

Behind an ambitious megaproject in Asia: The history and implications of the Bakun hydroelectric dam in Borneo

International Nuclear Information System (INIS)

Sovacool, Benjamin K.; Bulan, L.C.

2011-01-01

Using a case-study, inductive, narrative approach, this article explores the history, drivers, benefits, and barriers to the Bakun Hydroelectric Project in East Malaysia. Situated on the island of Borneo, Bakun Dam is a 204 m high concrete face, rock filled dam on the Balui River in the Upper Rajang Basin in the rainforests of Sarawak. Bakun Dam and its affiliated infrastructure could be the single largest and most expensive energy project ever undertaken in Southeast Asia. Based on data collected through site visits, original field research in Sarawak, and more than 80 research interviews, the article begins by teasing out the complex history and drivers behind the Bakun project before identifying a set of potential social, political, and economic benefits the project could deliver. It then delves into six sets of barriers in the technical, economic, political, legal and regulatory, social, and environmental realms. We find that Bakun illustrates how centralized energy megaprojects, while ostensibly championed for reasons of economies of scale and the ability to bring about transformational change in the shortest period of time, often fail to address broader development goals such as fighting energy poverty and improving the livelihoods of the local communities they are supposed to serve. - Highlights: → Bakun Dam is concrete face, rock filled dam on the Balui River in the Upper Rajang Basin in the rainforests of Sarawak. → The project faces technical, economic, political, legal and regulatory, social, and environmental barriers. → We conclude the project will fail to fight energy poverty or improve the livelihoods of local populations.

Behind an ambitious megaproject in Asia: The history and implications of the Bakun hydroelectric dam in Borneo

Energy Technology Data Exchange (ETDEWEB)

Sovacool, Benjamin K., E-mail: bsovacool@nus.edu.sg [Lee Kuan Yew School of Public Policy, National University of Singapore, Oei Tiong Ham Building, 469C Bukit Timah Road, Singapore 259772 (Singapore); Bulan, L.C. [Lee Kuan Yew School of Public Policy, National University of Singapore, Oei Tiong Ham Building, 469C Bukit Timah Road, Singapore 259772 (Singapore)

2011-09-15

Using a case-study, inductive, narrative approach, this article explores the history, drivers, benefits, and barriers to the Bakun Hydroelectric Project in East Malaysia. Situated on the island of Borneo, Bakun Dam is a 204 m high concrete face, rock filled dam on the Balui River in the Upper Rajang Basin in the rainforests of Sarawak. Bakun Dam and its affiliated infrastructure could be the single largest and most expensive energy project ever undertaken in Southeast Asia. Based on data collected through site visits, original field research in Sarawak, and more than 80 research interviews, the article begins by teasing out the complex history and drivers behind the Bakun project before identifying a set of potential social, political, and economic benefits the project could deliver. It then delves into six sets of barriers in the technical, economic, political, legal and regulatory, social, and environmental realms. We find that Bakun illustrates how centralized energy megaprojects, while ostensibly championed for reasons of economies of scale and the ability to bring about transformational change in the shortest period of time, often fail to address broader development goals such as fighting energy poverty and improving the livelihoods of the local communities they are supposed to serve. - Highlights: > Bakun Dam is concrete face, rock filled dam on the Balui River in the Upper Rajang Basin in the rainforests of Sarawak. > The project faces technical, economic, political, legal and regulatory, social, and environmental barriers. > We conclude the project will fail to fight energy poverty or improve the livelihoods of local populations.

A new cavernicolous freshwater crab, Thelphusula styx sp. nov. (Crustacea: Decapoda: Brachyura: Gecarcinucidae), from Gunong Mulu, Sarawak, Borneo

NARCIS (Netherlands)

Ng, P.K.L.

1989-01-01

A new species of gecarcinucid freshwater crab, Thelphusula styx spec. nov., is described from Gunong Mulu National Park in Sarawak, Borneo. This is the third species of Thelphusula reported from the area.

Disordered eating and body image issues and their associated factors among adolescents in urban secondary schools in Sarawak, Malaysia.

Science.gov (United States)

Cheah, Whye Lian; Hazmi, Helmy; Chang, Ching Thon

2017-04-01

Eating disorders are common health issues among the adolescents. The objective of this study was to determine the prevalence of eating disorders and their relationship with body mass index, body part satisfaction and perception on body weight among urban secondary school children. It was a cross-sectional study conducted in Kuching, Sarawak. Data was collected using a self-administered questionnaire that consist of the Eating Attitude Test-26 (EAT-26), perception on body part satisfaction and body weight, and anthropometric measurement. Data was entered and analysed using SPSS version 22. A total of 329 respondents participated in this study with 59% females and 60.5% Malays. There were 14.3% of the respondents overweight and obese, with higher percentage among males (19.3%). About 18.5% of the respondents were found to be at risk of eating disorders with higher prevalence among males (19.3%). More females reported to have higher prevalence of body part dissatisfaction (46.9%) and body weight (37.6%) compared to males (40%, 28.1%). The statistical results indicated there were significant associations between EAT-26 and body mass index (BMI) (p=0.039), body part satisfaction (p=0.004), and perception of body weight (p=0.038). Eating disorders are becoming more prevalent amongst adolescents, particularly among males. As eating disorder are strongly associated with adolescent mental and physical health, intervention programme on their developmental challenges and issues for both males and females should be in place particularly in the school education syllabus.

Estimated harvesting on jellyfish in Sarawak

Science.gov (United States)

Bujang, Noriham; Hassan, Aimi Nuraida Ali

2017-04-01

There are three species of jellyfish recorded in Sarawak which are the Lobonema smithii (white jellyfish), Rhopilema esculenta (red jellyfish) and Mastigias papua. This study focused on two particular species which are L.smithii and R.esculenta. This study was done to estimate the highest carrying capacity and the population growth rate of both species by using logistic growth model. The maximum sustainable yield for the harvesting of this species was also determined. The unknown parameters in the logistic model were estimated using center finite different method. As for the results, it was found that the carrying capacity for L.smithii and R.esculenta were 4594.9246456819 tons and 5855.9894242086 tons respectively. Whereas, the population growth rate for both L.smithii and R.esculenta were estimated at 2.1800463754 and 1.144864086 respectively. Hence, the estimated maximum sustainable yield for harvesting for L.smithii and R.esculenta were 2504.2872047638 tons and 1676.0779949431 tons per year.

Upaya Sekuritisasi Pemerintah Malaysia Dalam Menangani Masalah Perdagangan Manusia Di Kawasan Asia Tenggara Tahun 2010-2014

OpenAIRE

", Afrizal; Fajar, Satria Putra

2016-01-01

This research describes the securitization aspect Government of Malaysia to anticipation of human trafficking in South East Asia in 2010-2014. Nowdays human trafficking are one of criminalization form, and South East Asia regions are the region that has increase of human trafficking. The research method used was a qualitative with descriptive as a technic of the research. Writer collects data from books, encyclopedia, journal, mass media and websites to analyze the securitization aspect Gover...

Review of ear, nose and throat foreign bodies in Sarawak General Hospital. A five year experience.

Science.gov (United States)

Chiun, Kian Chai; Tang, Ing Ping; Tan, Tee Yong; Jong, Doris Evelyn Yah Hui

2012-02-01

Ear, nose and throat foreign bodies are common in ENT clinical practice. This study was designed to establish the local data of otorhinolaryngeal foreign bodies in term of prevalence among paediatric and adult groups, the clinical features, types of foreign body at different sites, and laterality of foreign bodies. This study was carried out at ENT department, Sarawak General Hospital, Malaysia, from 1st January 2005 to 31st December 2009. A total of 1084 cases were included and statistically analyzed. Ear foreign bodies showed the highest incidence which was consisted of 480 (44.3%) cases, followed by nose in 270 (24.9%) cases, pharynx in 251 (23.2%) cases, esophagus in 57 (5.3%) cases and laryngo-tracheobronchial tree in 26 (2.4%) cases. Otorhinolaryngeal foreign bodies occurred more frequently in 0-10 year old age group which constituted 651 (60.1%) cases. The descending order of frequency for foreign body sites in adult was pharynx (17.2%), ear (12.8%), esophagus (3.1%), nose (1.7%) and laryngo-tracheobronchial tree (1.1%). The type of foreign bodies varies with age group and site of foreign body lodgement. In general, common foreign bodies in both adult and children were food related, with the additional of small objects such as plastic toy in paediatric group. Otorhinolaryngeal foreign bodies were found more frequently in children. The types of foreign body were different from age group and sites of foreign body lodgement. The local food constituted the highest incidence of ear, nose, and throat foreign bodies with additional of plastic toys in paediatric group.

Chinese medicine in Malaysia and Singapore: the business of healing.

Science.gov (United States)

Ooi, G L

1993-01-01

Traditional Chinese medicine as it persists in several East and Southeast Asian countries, has undergone major changes. Such changes have reinforced the trading aspects of traditional Chinese medical practice with relatively little advantage for the medical care component. This paper examines the nature of changes in contemporary ethnic Chinese medical practice in Malaysia and Singapore with the aim of understanding their implications for the persistence of this medical tradition.

Forecasting Palm Oil Price Movements In Malaysia: Empirical Evidence from the Malaysian Palm Oil Futures Market.

OpenAIRE

Amran, Zulfathi

2010-01-01

The palm oil industry is one of the main commodity industries in South East Asia. This is the case for the two main producers and exporters of crude palm oil in the world, Malaysia and Indonesia, and thus there is an importance placed on the trading of the commodity in Malaysia, especially for hedging purposes for the producers. This is because; the main use of the product is for exporting purposes rather than for consumption, and thus it is important if there is a tool that the producers or ...

The Semantic Network of Flood Hydrological Data for Kelantan, Malaysia

Science.gov (United States)

Yusoff, Aziyati; Din, Norashidah Md; Yussof, Salman; Ullah Khan, Samee

2016-03-01

Every year, authorities in Malaysia are putting efforts on disaster management mechanisms including the flood incidence that might hit the east coast of Peninsular Malaysia. This includes the state of Kelantan of which it was reported that flood is just a normal event occurred annually. However, the aftermath was always unmanageable and had left the state to struggle for its own recoveries. Though it was expected that flood occurred every year, among the worst were in 1967, 1974, 1982 and recently in December 2014. This study is proposing a semantic network as an approach to the method of utilising big data analytics in analysing the huge data from the state’s flood reading stations. It is expected that by using current computing edge can also facilitate mitigating this particular disaster.

Radioactivity distribution of thorium in sediment core of the Sabah-Sarawak coast

International Nuclear Information System (INIS)

Zal U'yun Wan Mahmood; Zaharudin Ahmad; Adziz, M.I.A.; Abdul Kadir Ishak; Che Abd Rahim Mohamed

2010-01-01

Thorium activity concentrations were measured in seven marine sediment cores taken from Sabah-Sarawak coast on 2004 by using a gravity box corer. Collected sediments were generally homogenous mud which contained much more mixture of silt and clay compared to sand and relatively low content of organic carbon (i.e. less than 5% at all sampling stations). The results found that activity concentrations of 230 Th, 232 Th and ratios of 230 Th/ 232 Th were ranged from 6.5-20.4 Bq/kg dry wt., 6.8-27.8 Bq/kg dry wt. and 0.69-0.92, respectively. It seem that, 232 Th activity concentrations are slightly higher than 230 Th at all sampling stations and both radionuclides were generally high at Sabah compared to Sarawak coastal waters. 230 Th activity concentrations in sediment core appear to be correlated with the activity concentrations of 232 Th at some sampling station. These indicating both radionuclides were supplied from the same of environment and source origin of detrital from terrestrial and shallower water. The low 230 Th/ 232 Th activity ratio which is less than unity suggesting that 232 Th was actively and rapidly regenerated compared to 230 Th from 234 U. It also can be attributed to less efficiently scavenge of 230 Th onto particles prior deposited at the marine sediment bed. (author)

Childhood obesity, self-esteem and health-related quality of life among urban primary schools children in Kuching, Sarawak, Malaysia.

Science.gov (United States)

Lee, P Y; Cheah, W l; Chang, C T; Siti Raudzah, G

2012-08-01

There is limited data on childhood obesity and its impact on children from diverse cultural backgrounds. This study is aimed at determining the association between obesity, self-esteem and health-related quality of life (HRQOL) among Malaysian urban primary school children of different ethnicity. A cross-sectional study was conducted involving 311 children aged 11-13 years from primary schools in Kuching, Sarawak. Self-esteem and health-related quality of life (HRQOL) were measured using the Lawrence Self-esteem Questionnaire (LAWSEQ) questionnaire and the Paediatric Quality of Life Inventory (PedsQL), respectively. Body weight and height were taken and body mass index for age calculated. The prevalence of overweight and obesity among the children were 18.2% and 15.2% respectively. Parent-proxy and child self-reported PedsQL scores were higher for normal weight children compared to thin and obese children, but lower than overweight children. At the subscale level, only parent-proxy PedsQL scores in psychosocial health and emotional component were significantly different between overweight and obese children (p=0.019, p=0.02). The Self-esteem score was significantly correlated with parent and child PedsQL scores. Although obesity was associated with lower HRQOL among children, both parent and child PedsQL scores among the overweight group were higher than that for the normal weight group. Overweight and obesity did affect quality of life and self-esteem of children in this study, particularly in the areas of psychosocial and emotional health. Policy makers and programme managers should take into consideration the impact of obesity on children and parents in designing intervention programmes.

April 2009 “Tri-elections” in Malaysia: Maintaining the Status Quo

Directory of Open Access Journals (Sweden)

Tunku Mohar Mokhtar

2009-06-01

Full Text Available By-elections held after the 12th general elections held on March 8, 2008 are of special significance as they indicate the level of support gained by the opposition as well as the receding popularity of the ruling coalition. The three by-elections (hence called tri-elections, one parliamentary and two state assemblies, held in April 2009 show that the composition of the federal parliament and the state assembly of Kedah and Sarawak remained the same. The PR garnered multiethnic support in the peninsula while BN remains strong in Sarawak.

Malaysia mental health country profile.

Science.gov (United States)

Parameshvara Deva, M

2004-01-01

Malaysia is a tropical country in the heart of south east Asia with a population of 24 million people of diverse ethnic, cultural and religious backgrounds living in harmony in 330,000 km(2) of land on the Asian mainland and Borneo. Malaysia, which lies on the crossroads of trade between east and west Asia, has an ancient history as a centre of trading attracting commerce between Europe, west Asia, India and China. It has had influences from major powers that dominated the region throughout its history. Today the country, after independence in 1957, has embarked on an ambitious development project to make it a developed country by 2020. In this effort the economy has changed from one producing raw material to one manufacturing consumer goods and services and the colonial health system has been overhauled and social systems strengthened to provide better services for its people. The per capita income, which was under 1,000 US dollars at independence, has now passed 4,000 US dollars and continues to grow, with the economy largely based on strong exports that amount to over 100 billion US dollars. The mental health system that was based on institutional care in four mental hospitals at independence from British colonial rule in 1957 with no Malaysian psychiatrists is today largely based on over 30 general hospital psychiatric units spread throughout the country. With three local postgraduate training programmes in psychiatry and 12 undergraduate departments of psychiatry in the country--all started after independence--there is now a healthy development of mental health services. This is being supplemented by a newly established primary care mental health service that covers community mental health by integrating mental health into primary health care. Mental health care at the level of psychiatrists rests with about 140 psychiatrists most of whom had undertaken a four-year masters course in postgraduate psychiatry in Malaysia since 1973. However, there continues to be

Characterization of alkanes, hopanes, and polycyclic aromatic hydrocarbons (PAHs) in tar-balls collected from the East Coast of Peninsular Malaysia.

Science.gov (United States)

Chandru, Kuhan; Zakaria, Mohamad Pauzi; Anita, Sofia; Shahbazi, Azadeh; Sakari, Mahyar; Bahry, Pourya Shahpoury; Mohamed, Che Abd Rahim

2008-05-01

The East Coast of Peninsular Malaysia faces the South China Sea and is vulnerable to oil pollution because of intense petroleum production activities in the area. The South China Sea is also a favored route for supertankers carrying crude oil to the Far East. Consequently, oil spills can occur, causing pollution and contamination in the surrounding areas. Residual oil spills stranded on coastal beaches usually end up as tar-balls. Elucidating the sources of tar-balls using a molecular marker approach is essential in assessing environmental impacts and perhaps settling legal liabilities for affected parties. This study utilizes a multimodal molecular marker approach through the use of diagnostic ratios of alkanes, hopanes, and polycyclic aromatic hydrocarbons (PAHs) to determine the source, distribution and weathering of tar-balls. Hopane ratios (e.g., C29/C30, and summation C31-C35/C30 ratios) were used to identify the sources of tar-balls. The weathering effects were distinguished by using alkanes, namely the unresolved complex mixture (UCM) and low molecular weight/high molecular weight (L/H) ratios. Similarly, PAHs were also used for the determination of weathering processes undergone by the tar-balls. This multimodal molecular marker gave a very strong indication of the sources of tar-balls in this study. For example, 16 out of 17 samples originated from South East Asian Crude Oil (SEACO) with one sample from Merang, Terengganu originating from North Sea Oil (Troll). The TRME-2 sample may have come from a supertanker's ballast water discharge. The second possibility is that the tar-ball may have been transported via oceanographic currents. All 'weathered' sample characterizations were based on the presence of UCM and other ratios. The multimodal molecular marker approach applied in this study has enabled us to partially understand the transport behavior of tar-balls in the marine environment and has revealed insights into the weathering process of tar-balls.

Urban Recreational Riverfronts: Successful Revitalisation Elements

Directory of Open Access Journals (Sweden)

Ha zreena Hussein

2006-12-01

Full Text Available This research identifies characteristics, which are the Theme, Identity, Functions and Authenticity of some current riverfront developments, mainly focusing in urban areas. The study began with the evolution of an urban riverfront', including understanding how early settlements were established along the rivers, later forming the town, leading to the present day cities and their inherent traditional urban culture value. Case studies selected were from South East Asia within Singapore and Sarawak in Malaysia. These examples will then be compared with London and Boston, USA. Much attention will be given to paying high respect to the cities' character and to acknowledging the historical and cultural background of the city where they are set by scrutinising their characteristics. The conclusion will be systematically analysed on design elements and careful considerations through design planning and sensitive approaches.

Bleeding outcome during a dengue outbreak in 2005 in the East-coast region of Peninsular Malaysia: a prospective study.

Science.gov (United States)

Fariz-Safhan, M N; Tee, H P; Abu Dzarr, G A; Sapari, S; Lee, Y Y

2014-06-01

During a dengue outbreak in 2005 in the East-coast region of Peninsular Malaysia, one of the worst hit areas in the country at that time, we undertook a prospective study. We aimed to describe the bleeding outcome and changes in the liver and hematologic profiles that were associated with major bleeding outcome during the outbreak. All suspected cases of dengue admitted into the only referral hospital in the region during the outbreak were screened for WHO 2002 criteria and serology. Liver function, hematologic profile and severity of bleeding outcome were carefully documented. The association between symptoms, liver and hematologic impairments with the type of dengue infection (classical vs. hemorrhagic) and bleeding outcome (major vs. non-major) was tested. Dengue fever was confirmed in 183 cases (12.5/100,000 population) and 144 cases were analysed. 59.7% were dengue hemorrhagic fever, 3.5% were dengue shock syndrome and there were 3 in-hospital deaths. Major bleeding outcome (gastrointestinal bleeding, intracranial bleeding or haemoptysis) was present in 14.6%. Elevated AST, ALT and bilirubin were associated with increasing severity of bleeding outcome (all P profiles was seen in major bleeding outcome.

Research Article Special Issue

African Journals Online (AJOL)

pc

2018-04-16

Apr 16, 2018 ... 2Faculty of Cognitive Science and Human Development Universiti Malaysia. Sarawak ... research explained the relationship of emotion-focused coping and problem-focused ... Thus, the entrepreneurs become stress and affect their quality of life. .... skill acquisition, job satisfaction, and work motivation [26].

STOCK PRICES OF DOMESTIC BANKING SECTOR AND EXTERNAL SHOCKS IN EAST ASIA

OpenAIRE

Masahiro Inoguchi

2011-01-01

This paper examines the impact of price fluctuations in foreign stock markets on the stock prices of domestic banks’ stocks to explore if and how external shocks have affected the banking system in Korea, Malaysia, Singapore, and Thailand during the 2000s. Some researchers insist that domestic banks in East Asia were less affected by the 2007–2009 global financial crisis. However, few previous articles have investigated how the banking sector in East Asia has been affected by external shocks....

Nonlinear and Asymmetric Adjustment to Purchasing Power Parity in East-Asian Countries

OpenAIRE

Wen-Chi Liu

2014-01-01

This study applies a simple and powerful nonlinear unit root test to test the validity of long-run purchasing power parity (PPP) in a sample of 10 East-Asian countries (i.e., China, Hong Kong, Indonesia, Japan, Korea, Malaysia, Philippines, Singapore, Taiwan and Thailand) over the period of March 1985 to September 2008. The empirical results indicate that PPP holds true for half of these 10 East-Asian countries under study, and the adjustment toward PPP is found to be nonlinear and in ...

Water quality monitoring: A comparative case study of municipal and Curtin Sarawak's lake samples

International Nuclear Information System (INIS)

Kumar, A Anand; Prabakaran, K; Nagarajan, R; Jaison, J; Chan, Y S

2016-01-01

In this study, particle size distribution and zeta potential of the suspended particles in municipal water and lake surface water of Curtin Sarawak's lake were compared and the samples were analysed using dynamic light scattering method. High concentration of suspended particles affects the water quality as well as suppresses the aquatic photosynthetic systems. A new approach has been carried out in the current work to determine the particle size distribution and zeta potential of the suspended particles present in the water samples. The results for the lake samples showed that the particle size ranges from 180nm to 1345nm and the zeta potential values ranges from -8.58 mV to -26.1 mV. High zeta potential value was observed in the surface water samples of Curtin Sarawak's lake compared to the municipal water. The zeta potential values represent that the suspended particles are stable and chances of agglomeration is lower in lake water samples. Moreover, the effects of physico-chemical parameters on zeta potential of the water samples were also discussed. (paper)

A comparative study of road traffic accidents in West Malaysia.

Science.gov (United States)

Silva, J F

1978-11-01

The problem of road traffic accidents in developing countries is now becoming a cause for concern. This is more so as preventive measures have not kept pace with economic progress and development. This paper reviews the present situation in West Malaysia, one of the better developed countries of the East, during the period 1970 to 1975. A comparative study has been made between the United States and Malaysia. To enable the urgency of the problem in developing countries to be appreciated the increases in the country's population and in the number of vehicles in use and their relation to the lesser increase in road mileage over the period of study have been discussed. The study has considered every aspect of the causative factors leading to traffic accidents, such as the effects of weather, seasonal variation, and road and lighting conditions. The common human errors leading to accidents have been discussed. Other factors, such as the ethnic distribution in Malaysia, and their relation to road accidents have shown the effect of the social structure on the problems. The data evaluated in this study make it clear that preventive measures are very necessary in underdeveloped as well as in developed countries.

Childhood drowning in Malaysia.

Science.gov (United States)

Hss, Amar-Singh; Tan, Pui San; Hashim, Lina

2014-01-01

This study aimed to collate data on childhood drowning in Malaysia and review existing drowning prevention measures. This study used secondary data from governmental and non-governmental agencies. All reported fatal drownings from 2000 to 2007 and all reported non-fatal drownings from 2000 to 2008 were included. Data were analysed to provide understanding of the epidemiology of drowning incidents, risk factors and available preventive efforts. On average 286 (range 248-344) children died yearly due to drowning with a death rate of 3.05 per 100,000 annually. An additional average of 207 children drowned but survived annually (1.99 per 100,000). The estimated burden of drowning in children (death and non-death) is 5 per 100,000. There was no reduction in annual drowning fatalities over time. Most drowning took place in east coast regions during the annual monsoon season. It was 3.52 (2.80-4.41) times more common in boys and most prevalent among 10-14 years. Most prevalent sites of all-age drowning were seas and rivers. Limited water safety regulations are currently available in the country. This is the first comprehensive national study in Malaysia on paediatric drowning and highlights the magnitude of the problem. It calls for concerted effort to devise effective national drowning prevention measures.

Russian Golf Profile with the Perspective of Golf Tourism in South East Asia

OpenAIRE

Nikiforova, Tatiana

2010-01-01

The aim of the study was to formulate Russian golf profile and evaluate it from the perspective of golf tourism in South East Asian countries concentrating on five countries: Indonesia, Malaysia, Thailand, the Philippines and Singapore. The research discovered and analyzed the factors that accelerate and prevent Russian golf players from traveling to South East Asia region with golf and tourism purposes. In the theoretical part of the study the main issue was to describe the current situation...

Cancer Control Programs in East Asia: Evidence From the International Literature

Directory of Open Access Journals (Sweden)

Malcolm A. Moore

2014-07-01

Full Text Available Cancer is a major cause of mortality and morbidity throughout the world, including the countries of North-East and South-East Asia. Assessment of burden through cancer registration, determination of risk and protective factors, early detection and screening, clinical practice, interventions for example in vaccination, tobacco cessation efforts and palliative care all should be included in comprehensive cancer control programs. The degree to which this is possible naturally depends on the resources available at local, national and international levels. The present review concerns elements of cancer control programs established in China, Taiwan, Korea, and Japan in North-East Asia, Viet Nam, Thailand, Malaysia, and Indonesia as representative larger countries of South-East Asia for comparison, using the published literature as a guide. While major advances have been made, there are still areas which need more attention, especially in South-East Asia, and international cooperation is essential if standard guidelines are to be generated to allow effective cancer control efforts throughout the Far East.

New record of a phoretic flea associated with earwigs (Dermaptera, Arixeniidae) and a redescription of the bat flea Lagaropsylla signata (Siphonaptera, Ischnopsyllidae)

OpenAIRE

Hastriter,Michael; Miller,Kelly; Svenson,Gavin; Whiting,Michael F.; Whiting,Michael

2017-01-01

Abstract Lagaropsylla signata (Wahlgren, 1903), previously known only from the Island of Java, Indonesia is redescribed and reported for the first time in Deer Cave, Gunung Mulu National Park, Sarawak, Malaysia (west coast of Borneo). Many were found clinging to the earwig Arixenia esau Jordan, 1909. A similar account of a phoretic flea ( Lagaropsylla turba Smit, 1958) on the same species of cave-dwelling earwig has been reported in peninsular Malaysia in a well-documented association with th...

Public awareness in promotion of tissue transplantation in Malaysia

International Nuclear Information System (INIS)

Abd Rani Samsudin; Hasim Mohammad

1999-01-01

Malaysia is a developing country in South East Asia with a population of 21 million. The population is multiracial, multicultural and multireligion and it is one of the few countries in the world which possess a multicomplexity way of life among its ethnic groups. The health care system in Malaysia is divided into two main system, i.e. government based or public service and private based health care practice. The idea about organ donation and transplant science has a rise in Malaysia some 30 years ago, and the first historical event of a kidney transplant from a cadaveric donor took place in 1976. 22 years down the line, the first heart transplant was performed in Malaysia. Over the last 22 years between 1976 and 1998 many programmes promoting the idea of organ and tissue transplantation has been came out throughout the country led by government based bodies and non governmental Organisation. In terms of government funding, supporting a transplant programme is not a cheap exercise and this aspect of health care financial burden must be given due consideration by government and non governmental bodies for success of the programme. Besides financial burden, there are the common dilemma of culture and religious barrier for the success of the programme, but this problem has been tackled extremely well by the government. The setting up of two tissue banks in Malaysia in 1991 has further enhanced the idea of organ and tissue transplantation in this country, and the establishment of the national transplant resource centre based at Hospital Kuala Lumpur provides a national coordination service system for both organ and tissue procurement services for the whole country. Organ and tissue donation programme-ne and finally the success of a national transplant programme will certainly depend on the health status and health priorities of the country, the standard of general education, the quality of life style while cultural and religious factors in Malaysia will play a minor

Inoculation Expedition of Agar wood

International Nuclear Information System (INIS)

Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

2015-01-01

Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

Higher Education and Development in South-East Asia. Volume II, Country Profiles.

Science.gov (United States)

Hayden, Howard; And Others

This document, the second of three volumes concerned with the role of institutions of higher education in the development of countries in South-East Asia, presents country profiles for Burma, Thailand, Laos, Cambodia, Viet-Nam, Malaysia, Singapore, Indonesia, and the Philippines. The profile emphasizes background, higher education, educational…

Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

Science.gov (United States)

Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

2014-01-01

Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

Dive tourism, communities and small islands: lessons from Malaysia and Indonesia

OpenAIRE

Hampton, Mark P.; Jeyacheya, Julia

2014-01-01

Coastal tourism is growing rapidly across South-East Asia, especially in small islands. Islands and coastal areas face significant issues of how to manage the rapid growth of tourism whilst retaining economic benefits for the local host community. First, the paper sets the context and charts the scale and significance of international dive tourism, especially in less developed countries. The paper draws upon extensive fieldwork in small island destinations in Malaysia and Indonesia and explor...

The Headmaster-as-a-mentor: a Mentoring Model for Rural Primary School of Sarawak

OpenAIRE

Tuah, Adi Badiozaman

2015-01-01

: This paper attempts to present an alternative approach to training and improving the quality of teachers serving in rural schools of Sarawak. Based on the understanding that teacher training places are quite limited and that there are limited opportunities for meaningful interaction between school personnel and the central office or the teacher training institutions, it is argued that the overall quality of the teaching learning processes can be achieved through a systematic and properly st...

Hospitalization of childhood rotavirus infection from Kuala Lumpur, Malaysia.

Science.gov (United States)

Lee, W S; Veerasingam, P D; Goh, A Y T; Chua, K B

2003-01-01

To determine the epidemiology of rotavirus gastroenteritis in children admitted to an urban hospital in a developing country from South-East Asia. Retrospective review of cases of acute gastroenteritis admitted to the children's ward of the University of Malaya Medical Centre, Kuala Lumpur, Malaysia, between 1996 and 1999. During the study period, 333 cases (24%) of 1362 stool samples, obtained from children admitted with acute diarrhoea, were positive for rotavirus. Acute gastroenteritis constituted 8.2%, and rotavirus infection 1.6% of all the paediatric admissions each year. Of the 271 cases analysed, 72% of the affected population were less than 2 years of age. Peak incidence of admissions was between January to March, and September to October. Dehydration was common (92%) but electrolyte disturbances, lactose intolerance (5.2%), prolonged diarrhoea (2.6%) and cow's milk protein intolerance was uncommon. No deaths were recorded. Rotavirus infection was a common cause of childhood diarrhoea that required hospital admission in an urban setting in Malaysia.

Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia.

Science.gov (United States)

Fong, Mun-Yik; Rashdi, Sarah A A; Yusof, Ruhani; Lau, Yee-Ling

2015-02-21

Plasmodium knowlesi is one of the monkey malaria parasites that can cause human malaria. The Duffy binding protein of P. knowlesi (PkDBPαII) is essential for the parasite's invasion into human and monkey erythrocytes. A previous study on P. knowlesi clinical isolates from Peninsular Malaysia reported high level of genetic diversity in the PkDBPαII. Furthermore, 36 amino acid haplotypes were identified and these haplotypes could be separated into allele group I and allele group II. In the present study, the PkDBPαII of clinical isolates from the Malaysian states of Sarawak and Sabah in North Borneo was investigated, and compared with the PkDBPαII of Peninsular Malaysia isolates. Blood samples from 28 knowlesi malaria patients were used. These samples were collected between 2011 and 2013 from hospitals in North Borneo. The PkDBPαII region of the isolates was amplified by PCR, cloned into Escherichia coli, and sequenced. The genetic diversity, natural selection and phylogenetics of PkDBPαII haplotypes were analysed using MEGA5 and DnaSP ver. 5.10.00 programmes. Forty-nine PkDBPαII sequences were obtained. Comparison at the nucleotide level against P. knowlesi strain H as reference sequence revealed 58 synonymous and 102 non-synonymous mutations. Analysis on these mutations showed that PkDBPαII was under purifying (negative) selection. At the amino acid level, 38 different PkDBPαII haplotypes were identified. Twelve of the 28 blood samples had mixed haplotype infections. Phylogenetic analysis revealed that all the haplotypes were in allele group I, but they formed a sub-group that was distinct from those of Peninsular Malaysia. Wright's FST fixation index indicated high genetic differentiation between the North Borneo and Peninsular Malaysia haplotypes. This study is the first to report the genetic diversity and natural selection of PkDBPαII of P. knowlesi from Borneo Island. The PkDBPαII haplotypes found in this study were distinct from those from

Remote community electrification in Sarawak, Malaysia

Energy Technology Data Exchange (ETDEWEB)

Anyi, Martin; Kirke, Brian [Sustainable Energy Centre, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, South Australia 5095 (Australia); Ali, Sam [School of Electrical and Information Engineering, University of South Australia, Mawson Lakes Boulevard, Mawson Lakes, South Australia 5095 (Australia)

2010-07-15

It is usually uneconomic to provide mains power to small remote communities even when high voltage lines pass by a village. Local authorities normally resort to diesel-powered generators which require expensive fuel which is difficult to bring into remote areas. Furthermore they are noisy and require frequent maintenance which is often neglected in remote areas due to limited resources and know-how. Neither wind nor sun provides reliable power in humid tropical regions where there is a lot of still and overcast weather. Towers are found to attract lightning strikes which can destroy electronic controls, fungus grows on solar panels, and the multiple electrical connections on photovoltaic arrays corrode away in hot, humid climates. Micro hydro is an attractive option in mountainous areas, and a 30 kW high head and a 3 kW low head plant have been built, using village labour and surplus and discarded materials. Both are operating satisfactorily. However conventional micro hydro is not possible in flat country where there is little elevation, and work is now in progress to evaluate suitable hydrokinetic turbines on rivers in the humid tropics. Numerous companies around the world are now developing hydrokinetic turbines to harvest tidal and river flows, but a major problem with most designs is clogging by floating debris, especially in tropical rivers. (author)

Occupational rehabilitation in Singapore and Malaysia.

Science.gov (United States)

Chan, Kay-Fei; Tan, Charlie W C; Yeo, Doreen S C; Tan, Heidi S K; Tan, F L; Tan, E W; Szeto, Grace P Y; Cheng, Andy S K

2011-03-01

Asia is the new and favored magnet of economic attention and foreign investments after it made an almost uneventful rebound from the depths of financial crisis of 2008/2009. Not many Western observers fully understand the diversity that is Asia other than perhaps its 2 growing economic giants of China and India. Indeed many smaller countries like Singapore and Malaysia in South East Asia along with Australia and Hong Kong (a Special Administrative Region within China) look to symbiotic relationships with these two economic giants. The purpose of this discussion paper is to examine the current issues related to the development and provision of occupational rehabilitation services in Singapore and Malaysia with a forward-looking view of how Asia's different developing societies could potentially benefit from better alignment of occupational rehabilitation practices and sharing of expertise through international collaboration and dialogue platforms. Seven therapists and one physician who are frequently involved in occupational rehabilitation services in their home countries critically reviewed the current issues in Singapore and Malaysia which included analysis of the prevalence and cost of occupational injury; overview of workers' compensation system; current practices, obstacles, and challenges in providing occupational rehabilitation and return to work practices. They also offered opinions about how to improve the occupational rehabilitation programs of their two home countries. Even though Malaysia and Singapore are two different countries, in many ways their current provision of occupational rehabilitation services and the problems they face with are very similar. There is a lot of room for systemic improvements that require government support and action. Most prominently, the training of more healthcare professionals in the assessment and rehabilitation of the injured worker should be encouraged. There could be better liaison between the many stakeholders and

Review

NARCIS (Netherlands)

Nooteboom, H.P.

1990-01-01

The first three chapters deal with the conservation status of Malaysian Palms in respectively Peninsular Malaysia (by R. Kiew), Sabah (by J. Dransfield & D. Johnson), and Sarawak (by K. Pearce). R. KIEW gives a geographic description of the region, a very short account of the palm flora, a paragraph

Sarawakodendron, a new genus of Celastraceae

NARCIS (Netherlands)

Hou, Ding

1967-01-01

During my trip to Malaysia in 1966, sponsored by the Netherlands Foundation for the Advancement of Tropical Research (WOTRO), for doing field work on Anacardiaceae, a new tree genus was found in Sarawak belonging to the family Celastraceae which I have revised for the Flora Malesiana series I,

Multi-Ethnicity in the Malaysian Workplace: The Net Balance of 35 Years of Affirmative Policies as Observed by a Foreign Visitor

Science.gov (United States)

Montesino, Max U.

2007-01-01

This paper looks at the net societal balance of post-independence affirmative action policies in Malaysia. Social imbalances prompted the country to implement affirmative policies to uplift the majority natives (Malays, Indigenous people of Sabah and Sarawak, etc.). These policies were reluctantly accepted by the immigrant communities (Chinese,…

Human-Oriented Leadership and Organizational Commitment in US Subsidiary Company Based in Sarawak

Directory of Open Access Journals (Sweden)

Azman Ismail

2016-11-01

Full Text Available This article was conducted to examine the relationship between human-oriented leadership (HOL and organizational commitment. A survey method was employed to obtain data from the employees of one US subsidiary companybased in Sarawak. Results of the Partial Least Squares (SmartPLS model analysis confirmed that participative leadership, supportive leadership, and empowerment act as important antecedents of organizational commitment.These findings reveal that the capability of managers practicing HOL styles (supportive, participative, and empowerment has enhanced employees’ commitment to the organization.

Geochemistry of Coal Ash in the Equatorial Wet Disposal System Environment

OpenAIRE

Kolay P. K.; Singh H.

2013-01-01

The coal utilization in thermal power plants in Malaysia has increased significantly which produces an enormous amount of coal combustion by-product (CCBP) or coal ash and poses severe disposal problem. As each coal ash is distinct, this study presents the geochemistry of the coal ash, in particular fly ash, produced from the combustion of local coal from Kuching Sarawak, Malaysia. The geochemical composition of the ash showed a high amount of silica, alumina, iron oxides and alkalies which w...

Disclosure of Traditional and Complementary Medicine Use and Its Associated Factors to Medical Doctor in Primary Care Clinics in Kuching Division, Sarawak, Malaysia.

Science.gov (United States)

Johny, Anak Kelak; Cheah, Whye Lian; Razitasham, Safii

2017-01-01

The decision by the patients to disclose traditional and complementary medicine (TCM) use to their doctor is an important area to be explored. This study aimed to determine the disclosure of TCM use and its associated factors to medical doctor among primary care clinic attendees in Kuching Division, Sarawak. It was a cross-sectional study using questionnaire, interviewer administered questionnaire. A total of 1130 patients were screened with 80.2% reporting using TCM. Logistic regression analysis revealed that being female (AOR = 3.219, 95% CI: 1.385, 7.481), perceived benefits that TCM can prevent complication of illness (AOR = 3.999, 95% CI: 1.850, 8.644) and that TCM is more gentle and safer (AOR = 4.537, 95% CI: 2.332, 8.828), perceived barriers of not having enough knowledge about TCM (AOR = 0.530, 95% CI: 0.309, 0.910), patient dissatisfaction towards healthcare providers being too business-like and impersonal (AOR = 0.365, 95% CI: 0.199, 0.669) and paying more for healthcare than one can afford (AOR = 0.413, 95% CI: 0.250, 0.680), and accessibility of doctors (AOR = 3.971, 95% CI: 2.245, 7.023) are the predictors of disclosure of TCM use. An open communication between patients and doctor is important to ensure safe implementation and integration of both TCM and medical treatment.

Solar power for energy sustainability and environmental friendliness of Curtin University Sarawak

Science.gov (United States)

Palanichamy, C.; Goh, Alvin

2016-03-01

The demand on electrical energy is rapidly increasing. Everything around us requires electrical energy either during its production or usage stage. Sustainability has become the main concern nowadays as the availability of fossil fuels is limited. As renewable energy is the path-way to energy sustainability and environmental friendly environment, this paper proposes a solar power system for Curtin University Sarawak to reduce its electricity consumption and greenhouse gas emissions. The proposed 208 kW solar system saves an energy consumption of more than 380,000 kWh per year, and a CO2 offset by 285 Tons per year

Solar power for energy sustainability and environmental friendliness of Curtin University Sarawak

International Nuclear Information System (INIS)

Palanichamy, C; Goh, Alvin

2016-01-01

The demand on electrical energy is rapidly increasing. Everything around us requires electrical energy either during its production or usage stage. Sustainability has become the main concern nowadays as the availability of fossil fuels is limited. As renewable energy is the path-way to energy sustainability and environmental friendly environment, this paper proposes a solar power system for Curtin University Sarawak to reduce its electricity consumption and greenhouse gas emissions. The proposed 208 kW solar system saves an energy consumption of more than 380,000 kWh per year, and a CO 2 offset by 285 Tons per year (paper)

FACTORS AFFECTING COST PERFORMANCE IN CONSTRUCTION PROJECTS WITHIN KELANTAN STATE IN MALAYSIA

OpenAIRE

ABDELNASER OMRAN; SITI NORHYDAYATON BINTI MAMAT

2011-01-01

This study investigates the factors affecting cost performance of construction projects in Kelantan State located in the east-coast part of Malaysia. It draws on relevant previous research in the theory of work on cost performance. Thirty-three contractors companies with different working grades in the state of Kelantan were participated in the study. Data were collected from the contractors using a questionnaire survey. The results indicated that the success factors affecting the cost perfor...

Seasonal and inter-annual variability of sea surface temperature at the east coast fishing area off Peninsular Malaysia

Science.gov (United States)

Nurul Ridani, S.; Mustapha, M. A.; Lihan, T.; Ku Kassim, K. Y.; Raja Bidin, R. H.

2015-09-01

Empirical orthogonal function (EOF) analysis was used to study a time-series of the aqua MODIS data imageries in the exclusive economic zone of east coast off Peninsular Malaysia. Temporal and spatial characteristics were examined to determine the dominant pattern of sea surface temperature (SST) variability from January 2003 to December 2011.The data were analysed from daily Level 1A (1km spatial resolution) to monthly composites Level 3 data using SeaDAS and ERDAS imagine software. Four modes was obtained from the analysis with the highest variance (7.9%) represented by mode 1 which explained the seasonal cycle. Mode 2 (5.11 % of total variance) showed positive and negative peak signal during March and April and in October and November with variability near the Kelantan and Pahang waters that indicated the inter monsoon. Mode 3 (3.8 % of variance) shows variability near the Terengganu, Kelantan and Johor waters to the open sea during July and August and in May and June representing the Southwest monsoon. Mode 4 (3.36 %) showed positive signal during November and December with strong signal near Pahang and Kelantan waters while weak signal was detected near Terengganu and Kelantan's open sea representing the Northeast monsoon. The SST variability was influenced by the monsoonal system which originated by the wind forcing condition that influences circulation in the study area.

Socio-economic variations in tobacco consumption, intention to quit and self-efficacy to quit among male smokers in Thailand and Malaysia: results from the International Tobacco Control-South-East Asia (ITC-SEA) survey.

Science.gov (United States)

Siahpush, Mohammad; Borland, Ron; Yong, Hua-Hie; Kin, Foong; Sirirassamee, Buppha

2008-03-01

Aim To examine the association of socio-economic position (education, income and employment status) with cigarette consumption, intention to quit and self-efficacy to quit among male smokers in Thailand and Malaysia. Design and setting The data were based on a survey of adult smokers conducted in early 2005 in Thailand and Malaysia as part of the International Tobacco Control-South-East Asia (ITC-SEA) project. Participants A total of 1846 men in Thailand and 1906 men in Malaysia. Measurement Participants were asked questions on daily cigarette consumption, intention to quit and self-efficacy to quit in face-to-face interviews. Findings Analyses were based on multivariate regression models that adjusted for all three socio-economic indicators. In Thailand, higher level of education was associated strongly with not having self-efficacy, associated weakly with having an intention to quit and was not associated with cigarette consumption. Higher income was associated strongly with having self-efficacy, associated weakly with high cigarette consumption and was not associated with having an intention to quit. Being employed was associated strongly with having an intention to quit and was not associated with cigarette consumption or self-efficacy. In Malaysia, higher level of education was not associated with any of the outcomes. Higher income was associated strongly with having self-efficacy, and was not associated with the other outcomes. Being employed was associated moderately with higher cigarette consumption and was not associated with the other outcomes. Conclusion Socio-economic and cultural conditions, as well as tobacco control policies and tobacco industry activities, shape the determinants of smoking behaviour and beliefs. Existing knowledge from high-income countries about disparities in smoking should not be generalized readily to other countries.

Studies in Family Planning, Volume 5 Number 5. East Asia Review, 1973.

Science.gov (United States)

Keeny, S. M., Ed.

An annual review, third in a series, covers developments in the field of population and family planning in East Asia. For each of the 10 countries involved (Hong Kong, Indonesia, South Korea, Laos, Malaysia, Phillipines, Singapore, Taiwan, Thailand, and South Vietnam) there is an article written by the agent responsible for the family planning…

Three new species of Begonia (Begoniaceae from Limestone Hills in southwestern Sarawak, Borneo

Directory of Open Access Journals (Sweden)

Che-Wei Lin

2017-04-01

Full Text Available Most species of Begonia in Borneo, like those of other areas, are narrowly distributed and site-specific. In this study we report three new species of Begonia, namely B. felis C. W. Lin & C.-I Peng, B. kuchingensis C. W. Lin & C.-I Peng (sect. Petermannia and B. serianensis C. W. Lin & C.-I Peng (sect. Reichenheimia from the Padawan-Serian limestone hills in southwestern Sarawak. In addition to the taxonomic account, color plates, line drawings, a distribution map, and comparisons with phenetically similar species are provided to aid in identification.

Unveiling topographical changes using LiDAR mapping capability: case study of Belaga in Sarawak, East-Malaysia

Science.gov (United States)

Ganendra, T. R.; Khan, N. M.; Razak, W. J.; Kouame, Y.; Mobarakeh, E. T.

2016-06-01

The use of Light Detection and Ranging (LiDAR) remote sensing technology to scan and map landscapes has proven to be one of the most popular techniques to accurately map topography. Thus, LiDAR technology is the ultimate method of unveiling the surface feature under dense vegetation, and, this paper intends to emphasize the diverse techniques that can be utilized to elucidate topographical changes over the study area, using multi-temporal airborne full waveform LiDAR datasets collected in 2012 and 2014. Full waveform LiDAR data offers access to an almost unlimited number of returns per shot, which enables the user to explore in detail topographical changes, such as vegetation growth measurement. The study also found out topography changes at the study area due to earthwork activities contributing to soil consolidation, soil erosion and runoff, requiring cautious monitoring. The implications of this study not only concurs with numerous investigations undertaken by prominent researchers to improve decision making, but also corroborates once again that investigations employing multi-temporal LiDAR data to unveil topography changes in vegetated terrains, produce more detailed and accurate results than most other remote sensing data.

A Study of Logistics Development In The Malaysia Eastern Region: A Descriptive Analysis

Directory of Open Access Journals (Sweden)

Abdul Aziz Zuraimi

2013-07-01

Full Text Available This study investigated the current logistics development in The East Coast Region of Pennisular Malaysia. Logistics development is paramount important to the country in supporting economic and growth and enhancing competitiveness. Malaysia as well as many developing countries are still at the moderate stage in developing logistics systems and often face considerable challenges and constraints to provide efficient and effective logistics service. The respondents were from the different logistics players and there were 41 usable questionnaires were analyzed. This study found that the existing logistics infrastructures at the average level in this region. Amongst the constraints and challenges were professionalism in supporting the development, skill of manpower and financial issues in organization. Albeit all the constraints, most respondents were satisfied with the services rendered by logistics service providers.

Sustainable management of peat swamp forest of Sarawak with special reference to ramin (Gonystylus bancanus); development of a monitoring system

NARCIS (Netherlands)

Wijdeven, S.M.J.; Meer, van der P.J.; Chai, F.Y.C.; Tan, S.; Mohizah, M.; Liam, D.

2004-01-01

Peat swamp forests in Sarawak are valuable in terms of timber and biodiversity, but heavily degraded. In order to assess the current status, potential developments and possible management interventions, an adequate monitoring system is necessary. In this study a new monitoring system is proposed,

Assessment of atmospheric impacts of biomass open burning in Kalimantan, Borneo during 2004

Science.gov (United States)

Mahmud, Mastura

2013-10-01

Biomass burning from the combustion of agricultural wastes and forest materials is one of the major sources of air pollution. The objective of the study is to investigate the major contribution of the biomass open burning events in the island of Borneo, Indonesia to the degradation of air quality in equatorial Southeast Asia. A total of 10173 active fire counts were detected by the MODIS Aqua satellite during August 2004, and consequently, elevated the PM10 concentration levels at six air quality stations in the state of Sarawak, in east Malaysia, which is located in northwestern Borneo. The PM10 concentrations measured on a daily basis were above the 50 μg m-3 criteria as stipulated by the World Health Organization Air Quality Guidelines for most of the month, and exceeded the 24-h Recommended Malaysian Air Quality Guidelines of 150 μg m-3 on three separate periods from the 13th to the 30th August 2004. The average correlation between the ground level PM10 concentrations and the satellite derived aerosol optical depth (AOD) of 0.3 at several ground level air quality stations, implied the moderate relationship between the aerosols over the depth of the entire column of atmosphere and the ground level suspended particulate matter. Multiple regression for meteorological parameters such as rainfall, windspeed, visibility, mean temperature, relative humidity at two stations in Sarawak and active fire counts that were located near the centre of fire activities were only able to explain for 61% of the total variation in the AOD. The trajectory analysis of the low level mesoscale meteorological conditions simulated by the TAPM model illustrated the influence of the sea and land breezes within the lowest part of the planetary boundary layer, embedded within the prevailing monsoonal southwesterlies, in circulating the aged and new air particles within Sarawak.

Quality of life of community-based chronic schizophrenia patients in Penang, Malaysia.

Science.gov (United States)

Mubarak, A R; Baba, Ismail; Chin, Low Heng; Hoe, Quah Soon

2003-10-01

This is a study of the quality of life (QOL) of 174 community-based chronic schizophrenia patients in Penang, Malaysia. The study samples were selected from the Out Patient Department, Department of Psychiatry, Penang General Hospital, Malaysia. The data was collected through personal interviews with the respondents. A questionnaire prepared by the research team was used to collect data on background characteristics. Lehman's (1988) Quality of Life Interview was used to collect data on patients' QOL. Equal number of males and females participated in the study. The interviews on QOL indicated problems in the areas of life in general, place of living, daily activities, social relations, finance, work and general health. The results also revealed that community-based schizophrenia patients had acute poverty and experienced social isolation, discrimination and exploitation in the workplace. Implications of these results on the implementation process of National Mental Health Policy in Malaysia are discussed. The research paper also discusses the negative impacts of limited rehabilitation facilities available in the community and its implications on the QOL of severely mentally ill patients. The need for immediate research attention on QOL of such patients in the South-east Asian region has been highlighted.

The final spawning ground of Tachypleus gigas (Müller, 1785) on the east Peninsular Malaysia is at risk: a call for action.

Science.gov (United States)

Nelson, Bryan Raveen; Satyanarayana, Behara; Moh, Julia Hwei Zhong; Ikhwanuddin, Mhd; Chatterji, Anil; Shaharom, Faizah

2016-01-01

Tanjung Selongor and Pantai Balok (State Pahang) are the only two places known for spawning activity of the Malaysian horseshoe crab - Tachypleus gigas (Müller, 1785) on the east coast of Peninsular Malaysia. While the former beach has been disturbed by several anthropogenic activities that ultimately brought an end to the spawning activity of T. gigas, the status of the latter remains uncertain. In the present study, the spawning behavior of T. gigas at Pantai Balok (Sites I-III) was observed over a period of thirty six months, in three phases, between 2009 and 2013. Every year, the crab's nesting activity was found to be high during Southwest monsoon (May-September) followed by Northeast (November-March) and Inter monsoon (April and October) periods. In the meantime, the number of female T. gigas in 2009-2010 (Phase-1) was higher (38 crabs) than in 2010-2011 (Phase-2: 7 crabs) and 2012-2013 (Phase-3: 9 crabs) for which both increased overexploitation (for edible and fishmeal preparations) as well as anthropogenic disturbances in the vicinity (sand mining since 2009, land reclamation for wave breaker/parking lot constructions in 2011 and fishing jetty construction in 2013) are responsible. In this context, the physical infrastructure developments have altered the sediment close to nesting sites to be dominated by fine sand (2.5Xφ ) with moderately-well sorted (0.6-0.7σφ), very-coarse skewed (-2.4SKφ), and extremely leptokurtic (12.6Kφ) properties. Also, increased concentrations of Cadmium (from 4.2 to 13.6 mg kg(-1)) and Selenium (from 11.5 to 23.3 mg kg(-1)) in the sediment, and Sulphide (from 21 to 28 µg l(-1)) in the water were observed. In relation to the monsoonal changes affecting sheltered beach topography and sediment flux, the spawning crabs have shown a seasonal nest shifting behaviour in-between Sites I-III during 2009-2011. However, in 2012-2013, the crabs were mostly restricted to the areas (i.e., Sites I and II) with high oxygen (5.5-8.0 mg l

The final spawning ground of Tachypleus gigas (Müller, 1785 on the east Peninsular Malaysia is at risk: a call for action

Directory of Open Access Journals (Sweden)

Bryan Raveen Nelson

2016-07-01

Full Text Available Tanjung Selongor and Pantai Balok (State Pahang are the only two places known for spawning activity of the Malaysian horseshoe crab - Tachypleus gigas (Müller, 1785 on the east coast of Peninsular Malaysia. While the former beach has been disturbed by several anthropogenic activities that ultimately brought an end to the spawning activity of T. gigas, the status of the latter remains uncertain. In the present study, the spawning behavior of T. gigas at Pantai Balok (Sites I-III was observed over a period of thirty six months, in three phases, between 2009 and 2013. Every year, the crab’s nesting activity was found to be high during Southwest monsoon (May–September followed by Northeast (November–March and Inter monsoon (April and October periods. In the meantime, the number of female T. gigas in 2009–2010 (Phase-1 was higher (38 crabs than in 2010–2011 (Phase-2: 7 crabs and 2012–2013 (Phase-3: 9 crabs for which both increased overexploitation (for edible and fishmeal preparations as well as anthropogenic disturbances in the vicinity (sand mining since 2009, land reclamation for wave breaker/parking lot constructions in 2011 and fishing jetty construction in 2013 are responsible. In this context, the physical infrastructure developments have altered the sediment close to nesting sites to be dominated by fine sand (2.5Xφ with moderately-well sorted (0.6–0.7σφ, very-coarse skewed (−2.4SKφ, and extremely leptokurtic (12.6Kφ properties. Also, increased concentrations of Cadmium (from 4.2 to 13.6 mg kg−1 and Selenium (from 11.5 to 23.3 mg kg−1 in the sediment, and Sulphide (from 21 to 28 µg l−1 in the water were observed. In relation to the monsoonal changes affecting sheltered beach topography and sediment flux, the spawning crabs have shown a seasonal nest shifting behaviour in-between Sites I-III during 2009–2011. However, in 2012–2013, the crabs were mostly restricted to the areas (i.e., Sites I and II with high

Study on Flexible Pavement Failures in Soft Soil Tropical Regions

Science.gov (United States)

Jayakumar, M.; Chee Soon, Lee

2015-04-01

Road network system experienced rapid upgrowth since ages ago and it started developing in Malaysia during the colonization of British due to its significant impacts in transportation field. Flexible pavement, the major road network in Malaysia, has been deteriorating by various types of distresses which cause descending serviceability of the pavement structure. This paper discusses the pavement condition assessment carried out in Sarawak and Sabah, Malaysia to have design solutions for flexible pavement failures. Field tests were conducted to examine the subgrade strength of existing roads in Sarawak at various failure locations, to assess the impact of subgrade strength on pavement failures. Research outcomes from field condition assessment and subgrade testing showed that the critical causes of pavement failures are inadequate design and maintenance of drainage system and shoulder cross fall, along with inadequate pavement thickness provided by may be assuming the conservative value of soil strength at optimum moisture content, whereas the exiting and expected subgrade strengths at equilibrium moisture content are far below. Our further research shows that stabilized existing recycled asphalt and base materials to use as a sub-base along with bitumen stabilized open graded base in the pavement composition may be a viable solution for pavement failures.

Situation Report--Australia, Burundi, Cambodia, Mexico, Montserrat, Nicaragua, Papua & New Guinea, Republic of Vietnam, Sabah, Sarawak, Sierra Leone, Tahiti, Tonga.

Science.gov (United States)

International Planned Parenthood Federation, London (England).

Data relating to population and family planning in fourteen foreign countries are presented in these situation reports. Countries included are Australia, Burundi, Cambodia, Mexico, Montserrat, Nicaragua, Papua and New Guines, Republic of Vietnam, Sabah, Sarawak, Sierra Leone, Tahiti (French Polynesia), and Tonga. Information is provided under two…

The Local Agenda 21 Planning Guide

International Development Research Centre (IDRC) Digital Library (Canada)

These “Local Agenda 21” action plans translate the principles and mandates of .... contract arrangements, and other practices must be adjusted to allow for the ..... US $70,000 and 40 percent of revenues from the taxes on mining operations. ...... in progress in the Sarawak of Malaysia and other Southeast Asian nations.

Consumption intention toward ethnic food: determinants of Dayak food choice by Malaysians

Directory of Open Access Journals (Sweden)

Hiram Ting

2017-03-01

Conclusion: Hence, it is imperative that Dayak food is promoted among the local people first. Only when Dayak food is appreciated and accepted by the local people could the food be further promoted to the tourists. This would have a positive impact on the food business and tourism industry in Sarawak and Malaysia.

Radio Astronomy in Malaysia: Current Status and Outreach Activities

Science.gov (United States)

Hashim, N.; Abidin, Z. Z.; Ibrahim, U. F. S. U.; Umar, R.; Hassan, M. S. R.; Rosli, Z.; Hamidi, Z. S.; Ibrahim, Z. A.

2011-12-01

In this paper, we will present the current status of radio astronomical research and outreach in Malaysia. We will also present a short history of our research group, which is currently the only radio astronomical facility in Malaysia. Our group is called the Radio Cosmology Research Lab and was established in 2005 by Dr Zamri Zainal Abidin and Prof Dr Zainol Abidin Ibrahim. We will discuss the future plans for this group including our keen interest in being part of a more global network of radio astronomers. We are already an active member of the South-East Asia Astronomy Network (SEAAN) and aims to have a radio astronomical facility in order to join the Global Very Long Baseline Interferometer (VLBI) as well becoming a research hub for the future Square Kilometer Array (SKA) project. We will also present some of the scientific goals of our group including providing a platform for radio astronomers to be able to do observations of weak and high red-shifted radio objects such as galaxy clusters and supernovae.

Assessment of metals pollution in sediment cores from the Sabah-Sarawak coastal waters

International Nuclear Information System (INIS)

Zal Uyun Wan Mahmood; Zaharudin Ahmad; Che Abdul Rahim Mohamed; Abdul Kadir Ishak; Norfaizal Mohammed

2011-01-01

The distribution, enrichment and pollution status of metals in sediment cores from the Sabah-Sarawak coastal waters were studied. Seven sediment cores were taken in July 2004 using a gravity box corer. The metals of Cu, Zn and Pb were analyzed by ICP-MS to assess the pollution status of the sediments. The sediment fine fraction and organic carbon content was also analyzed. Enrichment Factor (EF), Geo accumulation Index (Igeo) and Pollution Load Index (PLI) was calculated as criteria of possible contamination. The results showed that collected sediments were composed with clay, silt and sand as 12 - 74 %, 27 - 72 % and 0 - 20 %, respectively. Meanwhile, organic carbon contents were relatively low and constant over time, based on sediment depth profiles, and it did not exceed 5 % at any sampling station. The average metal concentrations in sediment cores at all sampling station were distributed in the ranges of 1.66 ± 1.36 - 6.61 ± 0.12 μgg -1 for Cu, 26.55 ± 1.04 - 57.94 ± 1.58 μgg -1 for Zn and 3.99 ± 0.10 - 14.48 ± 0.32 μgg -1 for Pb. According to calculations of EF, I geo and PLI, it can be concluded that concentrations of Cu, Zn and Pb were not significantly affected by pollution from anthropogenic sources at the seven sampling locations. Thus, the metal content of Cu, Zn and Pb in sediment should not cause pollution problem to the marine environment of Sabah-Sarawak coastal waters and further response measures are not needed. (author)

Salinity and temperature variations around Peninsula Malaysia coastal waters

International Nuclear Information System (INIS)

Abdul Kadir Ishak; Jeremy Andy Anak Dominic; Nazrul Hizam Yusof; Mohd Rafaei Murtadza

2004-01-01

Vertical profiles of salinity and temperature were measured at several offshore stations along east and west coast of Peninsula Malaysia coastal waters. The measurements which covered South China Sea and Straits of Malacca were made during sampling cruises for Marine Database Project for Peninsula Malaysia, and during an IAEA regional training course for Marine Pollution Project. The results show that the water temperature is highest at the surface and minimum at bottom, while the salinity is lowest at the surface and highest at the bottom. In Malacca Straits, the highest surface water temperature was 30.6 degree C and the lowest bottom water temperature was 20.4 degree C, recorded at a station located in Andaman Sea. The same station also recorded the highest surface and bottom salinity i.e. 31.3 ppt and 34.4 ppt, respectively. For South China Sea, the maximum surface water temperature was 30.4 degree C and the minimum bottom temperature was 25.9 degree C, while the highest surface salinity was 33.2 ppt and the highest bottom salinity was 34.1 ppt. The water in South China Sea also showed some degrees of stratifications with thermocline zones located between 10-40 m water depths. In Malacca Straits, stronger thermocline develops at higher latitude, while at lower latitude the water is more readily mixed. Beside the spatial variations, the seawater temperature and salinity around Peninsula Malaysia also subjected to temporal variation as seawater. (Author)

Effect of K-N-humates on dry matter production and nutrient use efficiency of maize in Sarawak, Malaysia.

Science.gov (United States)

Petrus, Auldry Chaddy; Ahmed, Osumanu Haruna; Muhamad, Ab Majid Nik; Nasir, Hassan Mohammad; Jiwan, Make

2010-07-06

Agricultural waste, such as sago waste (SW), is one of the sources of pollution to streams and rivers in Sarawak, particularly those situated near sago processing plants. In addition, unbalanced and excessive use of chemical fertilizers can cause soil and water pollution. Humic substances can be used as organic fertilizers, which reduce pollution. The objectives of this study were to produce K- and ammonium-based organic fertilizer from composted SW and to determine the efficiency of the organic-based fertilizer produced. Humic substances were isolated using standard procedures. Liquid fertilizers were formulated except for T2 (NPK fertilizer), which was in solid form. There were six treatments with three replications. Organic fertilizers were applied to soil in pots on the 10th day after sowing (DAS), but on the 28th DAS, only plants of T2 were fertilized. The plant samples were harvested on the 57th DAS during the tassel stage. The dry matter of plant parts (leaves, stems, and roots) were determined and analyzed for N, P, and K using standard procedures. Soil of every treatment was also analyzed for exchangeable K, Ca, Mg, and Na, organic matter, organic carbon, available P, pH, total N, P, nitrate and ammonium contents using standard procedures. Treatments with humin (T5 and T6) showed remarkable results on dry matter production; N, P, and K contents; their uptake; as well as their use efficiency by maize. The inclusion of humin might have loosened the soil and increased the soil porosity, hence the better growth of the plants. Humin plus inorganic fertilizer provided additional nutrients for the plants. The addition of inorganic fertilizer into compost is a combination of quick and slow release sources, which supplies N throughout the crop growth period. Common fertilization by surface application of T2 without any additives (acidic and high CEC materials) causes N and K to be easily lost. High Ca in the soil may have reacted with phosphate from fertilizer to

Effect of K-N-Humates on Dry Matter Production and Nutrient Use Efficiency of Maize in Sarawak, Malaysia

Directory of Open Access Journals (Sweden)

Auldry Chaddy Petrus

2010-01-01

Full Text Available Agricultural waste, such as sago waste (SW, is one of the sources of pollution to streams and rivers in Sarawak, particularly those situated near sago processing plants. In addition, unbalanced and excessive use of chemical fertilizers can cause soil and water pollution. Humic substances can be used as organic fertilizers, which reduce pollution. The objectives of this study were to produce K- and ammonium-based organic fertilizer from composted SW and to determine the efficiency of the organic-based fertilizer produced. Humic substances were isolated using standard procedures. Liquid fertilizers were formulated except for T2 (NPK fertilizer, which was in solid form. There were six treatments with three replications. Organic fertilizers were applied to soil in pots on the 10th day after sowing (DAS, but on the 28th DAS, only plants of T2 were fertilized. The plant samples were harvested on the 57th DAS during the tassel stage. The dry matter of plant parts (leaves, stems, and roots were determined and analyzed for N, P, and K using standard procedures. Soil of every treatment was also analyzed for exchangeable K, Ca, Mg, and Na, organic matter, organic carbon, available P, pH, total N, P, nitrate and ammonium contents using standard procedures. Treatments with humin (T5 and T6 showed remarkable results on dry matter production; N, P, and K contents; their uptake; as well as their use efficiency by maize. The inclusion of humin might have loosened the soil and increased the soil porosity, hence the better growth of the plants. Humin plus inorganic fertilizer provided additional nutrients for the plants. The addition of inorganic fertilizer into compost is a combination of quick and slow release sources, which supplies N throughout the crop growth period. Common fertilization by surface application of T2 without any additives (acidic and high CEC materials causes N and K to be easily lost. High Ca in the soil may have reacted with phosphate from

The nuclear power development program of south-east asian countries

International Nuclear Information System (INIS)

Yang, Maeng Ho; Lee, Tae Jun; Lee, Byung Jun

1996-08-01

The objective of this study is to investigate the status of nuclear policy environments and nuclear power programmes of South-east Asian countries which are emerging as major markets in the international nuclear industry. To do this, the study investigated seven South-east Asian countries which are especially expected to strengthen nuclear cooperation with our country : China, Indonesia, Thailand, Malaysia, Vietnam, India and the Philippines. Considering the above, the study concentrated upon the status and the environment of nuclear development, as well as its planning and regulatory structure including energy resource environments, energy development policy and planning, and the major problems in nuclear power development encountered by those counties. This study could be used to develop the national policy of nuclear technological cooperation and nuclear business with South-east Asian countries, which will be expected to develop active nuclear power programmes int eh future. 41 tabs., 9 figs., 49 refs. (Author)

The nuclear power development program of south-east asian countries

Energy Technology Data Exchange (ETDEWEB)

Yang, Maeng Ho; Lee, Tae Jun; Lee, Byung Jun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1996-08-01

The objective of this study is to investigate the status of nuclear policy environments and nuclear power programmes of South-east Asian countries which are emerging as major markets in the international nuclear industry. To do this, the study investigated seven South-east Asian countries which are especially expected to strengthen nuclear cooperation with our country : China, Indonesia, Thailand, Malaysia, Vietnam, India and the Philippines. Considering the above, the study concentrated upon the status and the environment of nuclear development, as well as its planning and regulatory structure including energy resource environments, energy development policy and planning, and the major problems in nuclear power development encountered by those counties. This study could be used to develop the national policy of nuclear technological cooperation and nuclear business with South-east Asian countries, which will be expected to develop active nuclear power programmes int eh future. 41 tabs., 9 figs., 49 refs. (Author).

Physical Activity Pattern of Malaysian Preschoolers: Environment, Barriers, and Motivators for Active Play.

Science.gov (United States)

Lee, Shoo Thien; Wong, Jyh Eiin; Ong, Wei Wen; Ismail, Mohd Noor; Deurenberg, Paul; Poh, Bee Koon

2016-07-01

Children's physical activity has been correlated with child characteristics and social or physical environment. This study aimed to compare preschoolers' physical activity among various sociodemographic characteristics and to determine barriers, motivators, and environmental factors for active play. A total of 835 preschoolers were included in this analysis. Time spent on active play, quiet play, and screen time was reported by parents. Boys spent significantly more time on active play and screen time than girls. Time spent on quiet play was highest in East Coast Peninsular Malaysia and lowest in Sarawak. Some 40% of children achieved active play recommendation while 27% exceeded daily screen time recommendation. Most parents reported that their child played actively in the house area; and that the main barrier and motivator to active play were safety and child's enjoyment, respectively. These findings demonstrate that sociodemographic characteristics and environment should be considered in designing physical activity intervention programs. © 2016 APJPH.

Purchasing power parity theory in three East Asian economies: New evidence

OpenAIRE

Ahmad, Mahyudin; Marwan, Nur Fakhzan

2012-01-01

To an otherwise extensive literature with yet mixed findings on the long run Purchasing Power Parity (PPP) theory, this paper extends the evidence against the PPP hypothesis in three East Asian economies namely Indonesia, Malaysia, and Thailand based on quarterly data spanning forty years (1968:Q1-2008:Q1). The testing of PPP hypothesis in this study employs two methods namely Engle-Granger procedure and Johansen multivariate cointegration method.

Regional air pollution over Malaysia

Science.gov (United States)

Krysztofiak, G.; Catoire, V.; Dorf, M.; Grossmann, K.; Hamer, P. D.; Marécal, V.; Reiter, A.; Schlager, H.; Eckhardt, S.; Jurkat, T.; Oram, D.; Quack, B.; Atlas, E.; Pfeilsticker, K.

2012-12-01

, indicating possible volcanic emissions from the Indonesian islands to the South and East and the Philippines to the North East. The regional pollution seems to be influenced by emissions from Singapore, Philippines, Indonesia and Peninsula Malaysia, and on occasion by anthropogenic emissions from Thailand, Vietnam, Australia, and China.

East Asian Financial Cycles: Asian vs. Global Financial Crises

OpenAIRE

Akira Kohsaka; Jun-ichi Shinkai

2014-01-01

We examine the role of financial shocks in business cycles in general and in financial crises in particular in East Asia (Indonesia, Korea, Malaysia and Thailand) since the 1990s. Estimating a Financial Conditions Index, we found that financial shocks explain most of business downturns in all the economies in the Asian Financial Crisis (AFC) in 1997-98, but that the effects of financial shocks are diverse across economies in the Global Financial Crisis (GFC) in 2008-09. In the GFC, the financ...

Forecasting of Currency Crises in East Asia

Directory of Open Access Journals (Sweden)

Chi-Young Song

2005-06-01

Full Text Available In this paper, we have developed a forecasting system for currency crisis in East Asia based on a signaling approach. Our system uses 15 monthly indicators of five East Asian countries including Indonesia, Korea, Malaysia, the Philippines and Thailand that were severely hit by the currency crisis in 1997. We investigate the performance of the system through deploying out-of-sample forecasting for the periods both before and after the 1997 East Asian currency crisis. Unlike the existing research based on the signaling approach, our out-of-sample forecasting does not fix the in-sample period. The out-of-sample forecasting between July 1995 and June 1997 shows that prior to breakout of the crisis, several indicators including real exchange rates and exports sent frequent warnings to all crisis-hit East Asian countries except the Philippines. This may indicate that a signaling-based early warning system for currency crisis could have been an useful method of forecasting the East Asian crisis. On the other hand, we also find that our forecasting system often generates warning signals during the out-of-sample period between July 1999 and June 2001. Since we have not observed any currency crisis in this region after 1998, these are all false alarms, indicating that our system may be seriously exposed to the type II error. We can, however, mitigate this problem if we adjust the optimal critical values of indicators depending on the preferences of forecasting system manager.

Dataset of Fourier transform-infrared coupled with chemometric analysis used to distinguish accessions of Garcinia mangostana L. in Peninsular Malaysia

Directory of Open Access Journals (Sweden)

Sri A’jilah Samsir

2016-09-01

Full Text Available In this dataset, we distinguish 15 accessions of Garcinia mangostana from Peninsular Malaysia using Fourier transform-infrared spectroscopy coupled with chemometric analysis. We found that the position and intensity of characteristic peaks at 3600–3100 cm−1 in IR spectra allowed discrimination of G. mangostana from different locations. Further principal component analysis (PCA of all the accessions suggests the two main clusters were formed: samples from Johor, Melaka, and Negeri Sembilan (South were clustered together in one group while samples from Perak, Kedah, Penang, Selangor, Kelantan, and Terengganu (North and East Coast were in another clustered group. Keywords: Apomictic, Mangosteen, Fourier Transformed-Infrared, Peninsular Malaysia

COUNTRY OF ORIGIN, BRAND IMAGE AND HIGH INVOLVEMENT PRODUCT TOWARDS CUSTOMER PURCHASE INTENTION: EMPIRICAL EVIDENCE OF EAST MALAYSIAN CONSUMER

Directory of Open Access Journals (Sweden)

Mohd Amirul Adenan

2018-03-01

Full Text Available This research strives to understand East Malaysian consumers’ purchase intention when being exposed to the effects of brand image and country of origin (COO image in the case of high involvement pro­ducts. Self-administered questionnaires were collected from 225 consumers in East Malaysia. The result of this study shows that East Malaysian consumers’ put a large importance on brand and country of origin image in high involvement products as they are more involved in information searching and decision ma­king when purchases these products. Implication and future research also discussed.

Malaysia and forced migration

Directory of Open Access Journals (Sweden)

Arzura Idris

2012-06-01

Full Text Available This paper analyzes the phenomenon of “forced migration” in Malaysia. It examines the nature of forced migration, the challenges faced by Malaysia, the policy responses and their impact on the country and upon the forced migrants. It considers forced migration as an event hosting multifaceted issues related and relevant to forced migrants and suggests that Malaysia has been preoccupied with the issue of forced migration movements. This is largely seen in various responses invoked from Malaysia due to “south-south forced migration movements.” These responses are, however, inadequate in terms of commitment to the international refugee regime. While Malaysia did respond to economic and migration challenges, the paper asserts that such efforts are futile if she ignores issues critical to forced migrants.

Prevalence of a koinobiont endoparasitoid Misotermes mindeni (Diptera: Phoridae) in colonies of the fungus-growing termite Macrotermes gilvus (Blattodea: Termitidae) in Malaysia.

Science.gov (United States)

Foo, Foong-Kuan; Singham, G Veera; Othman, Ahmad Sofiman; Lee, Chow-Yang

2011-10-01

A survey of the infestation rate of colonies of Macrotermes gilvus (Hagen) (Termitidae: Macrotermitinae) with the koinobiont endoparasitoid Misotermes mindeni Disney & Neoh (Diptera: Phoridae) was conducted in Malaysia from September 2009 to January 2011 in the states of Kedah, Penang, Perak, Selangor, Kuala Lumpur, Johor, Terengganu, and Sarawak. Of the 1,125 M. gilvus mounds surveyed, 12.4% contained termites parasitized by M. mindeni and these mounds occurred only in the states of Penang and Perak. High frequencies of mounds containing parasitized termites were found at sites in Penang: Bayan Lepas (21.1%), Minden Campus of Universiti Sains Malaysia ([USM]; 24.5%), Teluk Bahang (28.0%), and Bukit Mertajam (35.0%); the lowest frequency (4.0%) was recorded from Gelugor. The parasitized colonies at all sites were classified as healthy, with exception of several from the Minden Campus of USM (96.4% healthy) and Ayer Itam (87.5% healthy). Most parasitized colonies (71.2%) had a low level of M. mindeni infestation. Only 16.7 and 12.1% of the infested colonies had moderate or high parasite infestation levels, respectively. The height of infected mounds was significantly higher than that of the healthy mounds, but there was no difference between the mound diameters of infested and uninfested mounds. Parasite infestation level was not significantly correlated with mound height or mound diameter. The ambient light intensity at sites with infested mounds was significantly lower than that of uninfested mounds. There was also a significant negative relationship between light intensity and degree of parasitism.

MIGRASI INTERNASIONAL PERILAKU PEKERJA MIGRAN DI MALAYSIA DAN PEREMPUAN DITINGGAL MIGRASI DI LOMBOK TIMUR

OpenAIRE

Hadi Sabari Yunus, dan Sri Rum Giyarsih, Lalu Tajuddin, R. Rijanta,

2016-01-01

The goal of the research is to examine the behavior of migrant workers and PADMI. The research is located in Eastern Malaysia and East Lombok Regency by using case study method to explore the objects deeply, detailed and complete. Data were collected through observation and in-depth interview with the migrant workers and PADMI. The research showed that Ringgit or Malaysian currency contribute significant influence to the migrant workers’ behavior, which showed by the change of the...

Regional Business Cycles in East Asia: Synchronization and its Determinants

OpenAIRE

Young-Joon Park

2013-01-01

This paper analyzes the dynamics and nature of regional business cycle synchronization for East Asian countries in the period of 2000:Q1-2011:Q4. Estimating a dynamic two-factor model extracts the common factor and the nation- specific factor from both the macroeconomic aggregates and plausible driving forces of regional business cycles. Evidence for regional business cycle synchronization is particularly strong for Korea, Malaysia and the Philippines, while Japan shows weak evidence of regio...

Awareness, knowledge and attitudes towards epilepsy among rural populations in East Coast Peninsular Malaysia: a preliminary exploration.

Science.gov (United States)

Neni, Selamat Widiasmoro; Latif, Ahmad Zubaidi Abdul; Wong, Sok Yee; Lua, Pei Lin

2010-06-01

This study was carried out to gauge the preliminary insight regarding epilepsy among the rural society. The purposes of this study were: (1) to determine general level of awareness, knowledge and attitudes (AKA) towards epilepsy among rural communities, (2) to compare the AKA level based on socio-demographic characteristics and (3) to investigate rural cohort's perception of the best epilepsy treatment, preference for epilepsy information delivery and preference for mode of transportation to seek medical treatment. This prospective, cross sectional study included a sample of 615 rural residents enrolled via cluster sampling in East Coast region of Peninsular Malaysia (mean age=41.6+/-18.02, female=56.6%, married=65.5%, Malay=94.0%, monthly income 0.05). However, respondents with higher education significantly possessed better attitudes and higher Total AKA level compared to those with lower education level (p<0.001). Employed respondents reported significantly more favourable attitudes than unemployed respondents (p=0.011). Additionally, higher income rural cohorts possessed both significantly better attitudes and better AKA. These rural communities perceived modern medicine as the best epilepsy treatment (56.60%), preferred to obtain direct epilepsy-related information from health personnel (60.4%) and chose to use their own car to seek medical treatment in hospital (76.30%). The outcomes of this preliminary study signified the need to devise a dedicated epilepsy education program for implementation among rural residents. Increased AKA level in the society could enhance the people's acceptance, reduce stigmatisation and improve health-related quality of life (HRQoL) for epilepsy patients and their family. Copyright 2010 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Continental Shelf Sediments of Sarawak, Malaysian Borneo

Science.gov (United States)

Masron, Tarmiji; Rumpet, Richard; Musel, Jamil

2017-01-01

Sediment distributions in deep sea influence the benthic community structure and thus play an important role in shaping the marine ecosystem. Several studies on sediment characteristics had been conducted in South China Sea (SCS), but only limited to coastal areas of regions within SCS territories. Therefore, this study was carried out to analyze the benthic sediment profile in an area beyond 12 nautical miles off the coast of Sarawak, southern SCS. Sediment samples were collected from 31 stations, comprising three depth ranges: (I) 20–50 m, (II) 50–100 m, and (III) 100–200 m. The total organic matter (TOM) contents were determined and subjected to dry and wet sieving methods for particle size analysis. TOM contents in the deep area (>50 m) were significantly higher (p = 0.05) and positively correlated (r = 0.73) with silt-clay fraction. About 55% and 82% of stations in strata II and III, respectively, were dominated by silt-clay fractions (50 m) tend to be poorly sorted, very fine skewed, and platykurtic. Unlike data obtained 20 years ago which reported high content of silt-clay (58%), this study recorded a lower content (35%); therefore, changes in sediment load had been observed in southern SCS. PMID:29075660

Rates of treated schizophrenia and its clinical and cultural features in the population isolate of the Iban of Sarawak: a tri-diagnostic approach.

Science.gov (United States)

Barrett, Robert; Loa, Peter; Jerah, Edward; Nancarrow, Derek; Chant, David; Mowry, Bryan

2005-02-01

We present results of a study of treated rates of schizophrenia among the Iban of Sarawak, Malaysia. Most Iban live in longhouses, each comprising a kindred group of up to 300 individuals. Cultural practices such as minimal intermarriage with members of adjacent ethnic groups and in-depth genealogical knowledge make them a population suitable for genetic investigation. Iban culture is conducive to a focus on symptoms and illness, and to patterns of treatment-seeking behaviour that are enthusiastic and persistent. We identified all known cases of psychotic disorder within a defined catchment area based on an exhaustive survey of available medical records. From corresponding Malaysian census data (91,056 persons), we report rates of treated schizophrenia in the Iban population, using three diagnostic systems, as well as the demographic and clinical characteristics of these individuals. The most frequent presenting complaints were insomnia and aggression. We found higher treated rates for narrowly defined schizophrenia among males, but no significant gender difference for age of onset. Estimates of treated rates to age 55 years (per 10,000) for narrow schizophrenia were 41.9 (ICD-10), 56.5 (DSM-IV), and 83 (RDC), while the rates for broad schizophrenia were 105.5, 103.2, and 107.5 respectively. Treated rates of schizophrenia were higher than the reported prevalence for many populations at risk, including many small-scale societies, although different methodological approaches may partly explain these findings. Given the cultural patterns of Iban treatment-seeking behaviour, treated rates of schizophrenia reported here may closely approximate the population prevalence of this disorder.

Competition Law In Malaysia

OpenAIRE

Hussein, Safinaz Mohd

2012-01-01

Meningkatnya kesadaran akan pentingnya persaingan usaha menimbulkan munculnya regulasi tertentu di tingkat nasional dan hal inilah yang terjadi di Malaysia, yakni dengan berlakunya Undang-Undang Persaingan Usaha Malaysia 2010. Disahkannya hukum persaingan umum seperti Undang-Undang Persaingan Usaha Malaysia 2010 pasti akan berdampak pada undang-undang sektoral seperti ketentuan dalam Peraturan Ekonomi CMA 1998. Biasanya hukum persaingan usaha memang di atas undangundang sektoral, kecuali j...

Malaysia; Financial Sector Stability Assessment

OpenAIRE

International Monetary Fund

2013-01-01

This assessment is a review of the financial environment of Malaysia. Like many other Asian countries, Malaysia experienced financial distress in the late 1990s, but the country’s policy reforms have moved it to a successful economy. A ten-year financial plan (2001–10) by Bank Negara Malaysia restructured the financial sector. Banks were well capitalized, household debts were strengthened, and securities and insurances were developed. Malaysia thus became the global center for Islamic finance...

Fluvial organic carbon losses from oil palm plantations on tropical peat, Sarawak, Southeast Asia

Science.gov (United States)

Cook, Sarah; Page, Susan; Evans, Chris; Whelan, Mick; Gauci, Vincent; Lip Khoon, Kho

2017-04-01

Tropical peatlands are valuable stores of carbon. However, tropical peat swamp forests (TPSFs) in Southeast Asia have increasingly been converted to other land-uses. For example, more than 25% of TPSFs are now under oil palm plantations. This conversion - requiring felling and burning of trees and drainage of the peat - can enhance carbon mineralization, dissolved organic carbon (DOC) losses and can contribute significantly to global anthropogenic greenhouse gas emissions, changing these natural carbon sinks into carbon sources. At present, relatively few scientifically sound studies provide dependable estimates of gaseous and fluvial carbon losses from oil palm plantations or from drained tropical peat in general. Here we present an annual (54 week) estimate of the export of dissolved and particulate organic carbon in water draining two oil palm estates and nearby stands of TPSF in Sarawak, Malaysia, subjected to varying degrees of past anthropogenic disturbance. Spectrophotometric techniques including SUVA254 (Specific Ultra-Violet Absorption) were used to gain insight into the aromaticity and subsequent bioavailability of the exported DOC. Water draining plantation and deforested land had a higher proportion of labile carbon compared to water draining forested areas. Preliminary data suggest a total fluvial DOC flux from plantations of ca. 190 g C m-2 year-1; nearly three times estimates from intact TPSFs (63 g C m-2 year-1). DOC accounted for between 86 % - 94 % of the total organic carbon lost (most of which was bioavailable). Wit et al. (2015) estimates that an average of 53 % of peat-derived DOC is decomposed and emitted as CO2, on a monthly basis. Based on these estimates our data suggests an additional 101 g CO2 m-2 may be emitted indirectly from fluvial organic carbon in degraded TPSFs per year. Overall, these findings emphasize the importance of including fluvial organic carbon fluxes when quantifying the impact of anthropogenic disturbance on the

Skin color variation in Orang Asli tribes of Peninsular Malaysia.

Directory of Open Access Journals (Sweden)

Khai C Ang

Full Text Available Pigmentation is a readily scorable and quantitative human phenotype, making it an excellent model for studying multifactorial traits and diseases. Convergent human evolution from the ancestral state, darker skin, towards lighter skin colors involved divergent genetic mechanisms in people of European vs. East Asian ancestry. It is striking that the European mechanisms result in a 10-20-fold increase in skin cancer susceptibility while the East Asian mechanisms do not. Towards the mapping of genes that contribute to East Asian pigmentation there is need for one or more populations that are admixed for ancestral and East Asian ancestry, but with minimal European contribution. This requirement is fulfilled by the Senoi, one of three indigenous tribes of Peninsular Malaysia collectively known as the Orang Asli. The Senoi are thought to be an admixture of the Negrito, an ancestral dark-skinned population representing the second of three Orang Asli tribes, and regional Mongoloid populations of Indo-China such as the Proto-Malay, the third Orang Asli tribe. We have calculated skin reflectance-based melanin indices in 492 Orang Asli, which ranged from 28 (lightest to 75 (darkest; both extremes were represented in the Senoi. Population averages were 56 for Negrito, 42 for Proto-Malay, and 46 for Senoi. The derived allele frequencies for SLC24A5 and SLC45A2 in the Senoi were 0.04 and 0.02, respectively, consistent with greater South Asian than European admixture. Females and individuals with the A111T mutation had significantly lighter skin (p = 0.001 and 0.0039, respectively. Individuals with these derived alleles were found across the spectrum of skin color, indicating an overriding effect of strong skin lightening alleles of East Asian origin. These results suggest that the Senoi are suitable for mapping East Asian skin color genes.

DSM-IV "criterion A" schizophrenia symptoms across ethnically different populations: evidence for differing psychotic symptom content or structural organization?

Science.gov (United States)

McLean, Duncan; Thara, Rangaswamy; John, Sujit; Barrett, Robert; Loa, Peter; McGrath, John; Mowry, Bryan

2014-09-01

There is significant variation in the expression of schizophrenia across ethnically different populations, and the optimal structural and diagnostic representation of schizophrenia are contested. We contrasted both lifetime frequencies of DSM-IV criterion A (the core symptom criterion of the internationally recognized DSM classification system) symptoms and types/content of delusions and hallucinations in transethnic schizophrenia populations from Australia (n = 776), India (n = 504) and Sarawak, Malaysia (n = 259), to elucidate clinical heterogeneity. Differences in both criterion A symptom composition and symptom content were apparent. Indian individuals with schizophrenia reported negative symptoms more frequently than other sites, whereas individuals from Sarawak reported disorganized symptoms more frequently. Delusions of control and thought broadcast, insertion, or withdrawal were less frequent in Sarawak than Australia. Curiously, a subgroup of 20 Indian individuals with schizophrenia reported no lifetime delusions or hallucinations. These findings potentially challenge the long-held view in psychiatry that schizophrenia is fundamentally similar across cultural groups, with differences in only the content of psychotic symptoms, but equivalence in structural form.

Overview of the Sustainable Uses of Peat Soil in Malaysia with Some Relevant Geotechnical Assessments

OpenAIRE

Rashidah Adon; Ismail Bakar; Devapriya Chitral Wijeyesekera; Adnan Zainorabidin

2013-01-01

Peat soil is an important ecosystem that provides a significant contribution to the global climate stability. In Malaysia, peat soils are considered as a soil with little economic benefit, apart from it being used for agricultural activity. The total world coverage of peat soil is about thirty million hectares with Canada and Russia having the largest distribution of peat (Zainorabiddin,2010). More than sixty percent of the world’s tropical peat lands are found in South-East Asia (Lette,2006...

Prevalence and correlates of roll-your-own smoking in Thailand and Malaysia: Findings of the ITC-South East Asia Survey.

Science.gov (United States)

Young, David; Yong, Hua-Hie; Borland, Ron; Ross, Hana; Sirirassamee, Buppha; Kin, Foong; Hammond, David; O'Connor, Richard; Fong, Geoffrey T

2008-05-01

Roll-your-own (RYO) cigarette use has been subject to relatively limited research, particularly in developing countries. This paper seeks to describe RYO use in Thailand and Malaysia and relate RYO use to smokers' knowledge of the harmfulness of tobacco. Data come from face-to-face surveys with 4,004 adult smokers from Malaysia (N = 2,004) and Thailand (N = 2000), collected between January and March 2005. The prevalence of any use of RYO cigarettes varied greatly between Malaysia (17%) and Thailand (58%). In both countries, any RYO use was associated with living in rural areas, older average age, lower level of education, male gender, not being in paid work, slightly lower consumption of cigarettes, higher social acceptability of smoking, and positive attitudes toward tobacco regulation. Among RYO users, exclusive use of RYO cigarettes (compared with mixed use) was associated with older age, female gender (relatively), thinking about the enjoyment of smoking, and not making a special effort to buy cheaper cigarettes if the price goes up. Finally, exclusive RYO smokers were less aware of health warnings (RYO tobacco carries no health warnings), but even so, knowledge of the health effects of tobacco was equivalent.

Oil Shocks and Stock Prices of Airlines - An East Asia Perspective

OpenAIRE

Lee, Pau Boon

2005-01-01

The aim of this dissertation is to study and analyse the impact of oil price shock on the share prices of airline companies in East Asia, in particular international air carriers from Japan, Hong Kong, South Korea, Singapore and Malaysia by looking at how the companies‘ share prices respond to the news of oil shocks. The companies involved in this study were Japan Airlines ("JAL"), All Nippon Airways ("ANA"), Cathay Pacific Airways ("Cathay"), Korean Air ("KAL"), Malaysian Airlines ("MAS") an...

Population trends in Malaysia: 1970-2010

Science.gov (United States)

Rashid, Saharani Abdul; Ghani, Puzziawati Ab; Daud, Noorizam

2014-12-01

The size of population in Malaysia had reached 28.3 million in 2010 and is expected to increase to 38.6 million in the next 30 years. This demographic milestone that is causing renewed attention to the challenges caused by population growth. This paper looks at the last 40 years of changes in Malaysia population structure due to the changes in demographic phenomenon using data obtained from the Department of Statistics Malaysia. The principal finding of this research indicates that population structure in Malaysia had changed dramatically from the year 1970 to 2010. At the same time, Malaysia has completed its demographic transition in less than four decades. The fall in fertility and mortality rates have led to an improvement in the life expectancy of the population which has resulted an ageing population in Malaysia.

Spotlight: Malaysia.

Science.gov (United States)

Patriquin, W

1988-03-01

Focus is on Malaysia -- its population and land area, its total fertility rate and mortality rate, economic development, contraceptive usage, and population policy. In 1987 Malaysia's population was estimated to be 16.1 million with births 31/1000 population and deaths 7/1000 population. The rate of natural increase is 2.4%, the total fertility rate 3.9 children/woman, and the infant mortality rate 30/1000 live births. Ethnically, Malaysia is made up of several distinct groups. Indigenous Malays are the most numerous -- about 50% of the population. Their unique characteristics include that they are Moslem, rural, and usually of lower economic status. Chinese make up the 2nd largest group of Malaysians, nearly 1/3 of the population. This group is active in trade, business, and finance and possesses considerable economic power. About 10% of the population is of Indian descent. Malaysia has experienced much economic growth. Traditional exports grew in volume and value during the 1970; the petroleum sector expanded so rapidly it accounts for 1/4 of all exports. One reason for Malaysia's rapid economic growth is the government's promotion of industrialization and foreign investment. According to the 1982 contraceptive prevalence survey, 42% of currently married women 15-44 years were using contraception. The government considers the current rate of national increase to be satisfactory, but in 1984 it adopted a population policy to more than quadruple its population in 2100 to 70 million. It intends to accomplish this by instituting pronatalist incentives to help the fall in the national growth rate. The government's rationale for more population growth is that a larger domestic population could better support industrial growth that otherwise might be stymied by "protectionist policies practiced by developed countries." Incentives to encourage fertility include income-tax deductions and maternity benefits for women who have up to 5 children.

Politico-Islamic Issues in Malaysia in 1999

OpenAIRE

Abubakar, Ibrahim

2001-01-01

Tulisan ini merupakan kajian singkat sekitar isu politik Islam di Malaysia tahun 1999. Pada November 1999, Malaysia menyelenggarakan pemilihan Federal dan Negara Bagian yang ke-10. Titik berat tulisan ini ada pada beberapa isu politik Islam yang dipublikasikan di koran-koran Malaysia yang dilihat dari perspektif partai-partai politik serta para pendukmgnya. Partai politik di Malaysia cukup banyak, dan disini diangkat empat partai politik yaitu: Organisasi Nasional Malaysia Bersatu (UMNO), Aso...

Pore Type Classification on Carbonate Reservoir in Offshore Sarawak using Rock Physics Model and Rock Digital Images

International Nuclear Information System (INIS)

Lubis, L A; Harith, Z Z T

2014-01-01

It has been recognized that carbonate reservoirs are one of the biggest sources of hydrocarbon. Clearly, the evaluation of these reservoirs is important and critical. For rigorous reservoir characterization and performance prediction from geophysical measurements, the exact interpretation of geophysical response of different carbonate pore types is crucial. Yet, the characterization of carbonate reservoir rocks is difficult due to their complex pore systems. The significant diagenesis process and complex depositional environment makes pore systems in carbonates far more complicated than in clastics. Therefore, it is difficult to establish rock physics model for carbonate rock type. In this paper, we evaluate the possible rock physics model of 20 core plugs of a Miocene carbonate platform in Central Luconia, Sarawak. The published laboratory data of this area were used as an input to create the carbonate rock physics models. The elastic properties were analyzed to examine the validity of an existing analytical carbonate rock physics model. We integrate the Xu-Payne Differential Effective Medium (DEM) Model and the elastic modulus which was simulated from a digital carbonate rock image using Finite Element Modeling. The results of this integration matched well for the separation of carbonate pore types and sonic P-wave velocity obtained from laboratory measurement. Thus, the results of this study show that the integration of rock digital image and theoretical rock physics might improve the elastic properties prediction and useful for more advance geophysical techniques (e.g. Seismic Inversion) of carbonate reservoir in Sarawak

Malaysian perceptions of China

Directory of Open Access Journals (Sweden)

Ibrahim Abu Bakar

2009-11-01

Full Text Available Malasia que consistía en Malaya, Sabah, Sarawak y Singapur ganó su independencia de los Británicos el 16 de septiembre de 1963. Malaya ganó su independencia de los británicos el 31 de agosto de 1957. En 1965 Singapur era independiente de Malasia. Malasia es una democracia parlamentaria y capitalista. Por otra parte, es una nación multi-religiosa y multirracial. Malasia ha sido poblada por los Malays, los Chinos, los Indios y otros. Los Malays son musulmanes y el Islam es la religión de la federación de Malasia. La nación tiene una larga historia con China pero esa nunca colonizó ningún área en Malasia. Los estados occidentales, fundamentalmente Portugueses y Olandeses colonizaron ciertas áreas en Malasia y luego los Británicos colonizaron la entera región. La percepción malasiana de China está influenciada por muchos factores internos y externos tales como el factor ideologico-político, el desarrollo económico así como las relaciones y la diplomacia nacionales, regionales e internacionales. Este breve artículo presenta la percepción malasiana de China desde un punto de vista cultural, político y económico._____________ABSTRACT:Malaysia consisting of Malaya, Sabah, Sarawak and Singapore gained her independence from the British on 16 September 1963. Malaya gained her independence from the British on 31 August 1957. In 1965 Singapore was independent from Malaysia. Malaysia is a parliamentary democratic and capitalistic nation. Moreover, Malaysia is a multi-religious and multiracial nation. Malaysia has been populated by the Malays, Chinese, Indians and others. The Malays are Muslims and Islam is the religion of the Federation of Malaysia. Malaysia has a very long history with China but China never colonized any area in Malaysia. The Western nations namely the Portuguese and the Dutch colonized certain areas in Malaysia and then the British colonized the whole Malaysia. Malaysian perceptions of China are influenced by many

Different techniques of excess 210Pb for sedimentation rate estimation in the Sarawak and Sabah coastal waters

International Nuclear Information System (INIS)

Zal Uyun Wan Mahmood; Zaharudin Ahmad; Abdul Kadir Ishak; Che Abdul Rahim Mohamed

2010-01-01

Sediment core samples were collected at eight stations in the Sarawak and Sabah coastal waters using a gravity box corer to estimate sedimentation rates based on the activity of excess 210 Pb. The sedimentation rates derived from four mathematical models of CIC, Shukla-CIC, CRS and ADE were generally shown in good agreement with similar or comparable value at all stations. However, based on statistical analysis of independent sample t-test indicated that Shukla-CIC model was the most accurate, reliable and suitable technique to determine the sedimentation rate in the study area. (author)

ANTARA BENCI DAN RINDU: HUBUNGAN INDONESIA-MALAYSIA DAN ISU TENAGA KERJA ILEGAL DI MALAYSIA

OpenAIRE

Maiwan, Mohammad

2012-01-01

The objective of this research is to get adeguate explanation and understanding to Indonesia-Malaysia relation in related to solving problem of the illegal workers. The method was using descriptive and qualitative. This study shows, that illegal workers was a serious problem which give impact to the Indonesia-Malaysia relations. In Malaysia contexs, its can be impact to the economy, social, security and etc. Nevertheless, Indonesian government must be take integrative and comprehensive progra...

Malaysia

International Nuclear Information System (INIS)

2007-01-01

Full text: Malaysia's transition from a production-based economy to a knowledge-based economy is a vital step towards achieving a developed nation status by the year 2020. A large pool of skilled labor force including those with tertiary level education is critical for Malaysia's transition to a knowledge-based economy. Malaysia's policies related to education and training emphasize the need to address the shortage and to enhance the quality of human resources, in particular human resources in science and technology. In this regard, a target has been set for a ratio of 60:40 science to arts students at the secondary school and tertiary level education institutions. The total number of post-graduate enrollment in universities will be increased to 25 per cent of total enrollment by the year 2010. Human resource with tertiary level education, especially at the post-graduate level is essential for upgrading capability in research and development (R and D). The target is to enlarge the pool of researchers from 15.6 researchers per 10,000 labor force in the year 2000 to 60 researchers per 10,000 labor force by the year 2010. The Malaysian Institute for Nuclear Technology Research (MINT), previously known as the Tun Ismail Atomic Research Centre (PUSPATI) was established in 1972 to promote nuclear science and technology development and application. Since nuclear energy is not included as one of Malaysia's energy options, MINT's programs focus on the development and application of nuclear science and technology in medicine, agriculture, industry and environment. MINT operates a 1 MW TRIGA MKII research reactor and several radiation facilities. As the largest employer of nuclear science and technology graduates, MINT has a major role in ensuring the sustainable supply of nuclear workforce and the preservation of nuclear knowledge. In this connection, MINT collaborates with institutions of higher education in the development of human resource in nuclear science and

The Relationship between Gender Type in Mentorship and Mentees’ Advancement: An Empirical Study in Malaysia

Directory of Open Access Journals (Sweden)

Azman ISMAIL

2011-04-01

Full Text Available The aim of this study is to examine the relationship between gender type in mentorship and mentees’ advancement using 153 usable questionnaires gathered from employees who worked in a public university in East Malaysia, Malaysia. The results of exploratory factor analysis confirmed that the measurement scales used in this study satisfactorily meet the standards of validity and reliability analyses. Next, the outcomes of stepwise regression analysis showed four important findings: firstly, interaction between same-gender positively and significantly correlated with mentees’ career. Secondly, interaction between cross-gender positively and signifycantly correlated with mentees’ career. Thirdly, interaction between same-gender positively and significantly correlated with mentees’ psychosocial. Fourthly, interaction between cross-gender positively and significantly correlated with mentees’ psychosocial.Further, this result demonstrates that gender type does act as an important antecedent of mentees’ career and psychosocial in the mentoring programme model of the organizational sample. In addition, discussion, implications and conclusion are elaborated.

Estimation of Stature from Footprint Anthropometry Using Regression Analysis: A Study on the Bidayuh Population of East Malaysia

Directory of Open Access Journals (Sweden)

T. Nataraja Moorthy

2015-05-01

Full Text Available The human foot has been studied for a variety of reasons, i.e., for forensic as well as non-forensic purposes by anatomists, forensic scientists, anthropologists, physicians, podiatrists, and numerous other groups. An aspect of human identification that has received scant attention from forensic anthropologists is the study of human feet and the footprints made by the feet. The present study, conducted during 2013-2014, aimed to derive population specific regression equations to estimate stature from the footprint anthropometry of indigenous adult Bidayuhs in the east of Malaysia. The study sample consisted of 480 bilateral footprints collected using a footprint kit from 240 Bidayuhs (120 males and 120 females, who consented to taking part in the study. Their ages ranged from 18 to 70 years. Stature was measured using a portable body meter device (SECA model 206. The data were analyzed using PASW Statistics version 20. In this investigation, better results were obtained in terms of correlation coefficient (R between stature and various footprint measurements and regression analysis in estimating the stature. The (R values showed a positive and statistically significant (p < 0.001 relationship between the two parameters. The correlation coefficients in the pooled sample (0.861–0.882 were comparatively higher than those of an individual male (0.762-0.795 and female (0.722-0.765. This study provided regression equations to estimate stature from footprints in the Bidayuh population. The result showed that the regression equations without sex indicators performed significantly better than models with gender indications. The regression equations derived for a pooled sample can be used to estimate stature, even when the sex of the footprint is unknown, as in real crime scenes.

Abundance and distribution of sylvatic dengue virus vectors in three different land cover types in Sarawak, Malaysian Borneo.

Science.gov (United States)

Young, Katherine I; Mundis, Stephanie; Widen, Steven G; Wood, Thomas G; Tesh, Robert B; Cardosa, Jane; Vasilakis, Nikos; Perera, David; Hanley, Kathryn A

2017-08-31

Mosquito-borne dengue virus (DENV) is maintained in a sylvatic, enzootic cycle of transmission between canopy-dwelling non-human primates and Aedes mosquitoes in Borneo. Sylvatic DENV can spill over into humans living in proximity to forest foci of transmission, in some cases resulting in severe dengue disease. The most likely vectors of such spillover (bridge vectors) in Borneo are Ae. albopictus and Ae. niveus. Borneo is currently experiencing extensive forest clearance. To gauge the effect of this change in forest cover on the likelihood of sylvatic DENV spillover, it is first necessary to characterize the distribution of bridge vectors in different land cover types. In the current study, we hypothesized that Ae. niveus and Ae. albopictus would show significantly different distributions in different land cover types; specifically, we predicted that Ae. niveus would be most abundant in forests whereas Ae. albopictus would have a more even distribution in the landscape. Mosquitoes were collected from a total of 15 sites using gravid traps and a backpack aspirator around Kampong Puruh Karu, Sarawak, Malaysian Borneo, where sylvatic DENV spillover has been documented. A total of 2447 mosquitoes comprising 10 genera and 4 species of Aedes, were collected over the three years, 2013, 2014 and 2016, in the three major land cover types in the area, homestead, agriculture and forest. Mosquitoes were identified morphologically, pooled by species and gender, homogenized, and subject to DNA barcoding of each Aedes species and to arbovirus screening. As predicted, Ae. niveus was found almost exclusively in forests whereas Ae. albopictus was collected in all land cover types. Aedes albopictus was significantly (P = 0.04) more abundant in agricultural fields than forests. Sylvatic DENV was not detected in any Aedes mosquito pools, however genomes of 14 viruses were detected using next generation sequencing. Land cover type affects the abundance and distribution of the most

Promotion of Nuclear Non-proliferation in East Asia

International Nuclear Information System (INIS)

Hwang, Yong Soo

2009-07-01

KAERI has jointly worked with Sandia National Laboratories for Nuclear Energy Non-proliferation in East Asia for the last five years. This project aims at support activities in this joint project between two states. The annual meetings were held during the project period, the 4th one in 2008 and the 5th one in 2009. In addition code comparison between KAERI and SNL's codes for assessing the back-end fuel cycle options was carried out. This project strongly enhances the close tie for the non-proliferation, transparency and safeguards among Korea Japan China Taiwan the United States Russia Malaysia Singapore Indonesia Thailand Vietnam and others for the project period

Balance of Payments of East Asian Countries: Impact of the Coordinated Monetary Policy

Directory of Open Access Journals (Sweden)

Yana Valeryevna Dyomina

2014-03-01

Full Text Available The paper examines the equilibrium state of balance of payments of East Asian countries by means of the monetary policy instruments. For this purpose the author determines the value of the equilibrium exchange rate of AMU (Asian Monetary Unit against the U.S. dollar. The equilibrium exchange rate is the one that smoothes values of net merchandise exports and net capital exports. The author employs panel data regression analysis (using statistics of trade and capital (foreign direct investment flows between East Asian countries and the United States to obtain quantitative estimation of trade and investment effects of the coordinated monetary policy. The paper shows that transition of East Asian region (China, Japan, Republic of Korea, Indonesia, Malaysia, Vietnam, the Philippines and Thailand to the single currency (AMU will have a negative effect on the balance of payments of the studied countries: this will increase the mismatch between commodity and capital flows

Malaysia: oil, gas, petrochemicals

International Nuclear Information System (INIS)

1990-01-01

Petronas or Petroliam Nasional Berhad was established on 17 August 1974 as the national petroleum corporation of Malaysia. The Petroleum Development Act, passed by the Malaysian Parliament in October of that same year, vested in Petronas the entire ownership of all oil and natural gas resources in the country. These resources are considerable and Malaysia is poised to become one of the major petrochemical producers in the region. This report outlines the extent of oil, gas and petrochemicals production in Malaysia, lists companies holding licences and contracts from Petronas and provides a directory of the Malaysian oil industry. (Author)

“Malaysia-China Friendship Evening 2009”Held

Institute of Scientific and Technical Information of China (English)

Our Staff Reporter

2009-01-01

<正>The CPAFFC, the Embassy of Malaysia in China, the Malaysia-China Friendship Association and the Malaysia-China Business Council jointly hosted the "Malaysia-China Friendship Evening 2009"at the Conference Hall of the Chi-

Haplotypes frequencies of CYP2B6 in Malaysia

Directory of Open Access Journals (Sweden)

N Musa

2012-01-01

Full Text Available Background: Drugs with complex pharmacology are used in the management of drug use disorder (DUD and HIV/AIDS in Malaysia and in parts of South-East Asia. Their multiethnic populations suggest complexity due to the genetic polymorphism, such as CYP2B6 that metabolizes methadone and anti-retroviral. Aims: Our aim was to explore the genetic polymorphism of CYP2B6 among Malays, Chinese, Indians, and opiate-dependent individuals in Malaysia. Settings and Design: The study utilized DNA from our previous studies on CYPs and new recruitments from opiate-dependent individuals. Materials and Methods: For the new recruitment, after obtaining consent and baseline demography, 5 ml blood was obtained from patients attending methadone maintenance therapy (MMT Clinics. Genomic DNA was extracted using standard methods. 10 nucleotide changes associated with CYP2B6FNx0110, CYP2B6FNx012, CYP2B6FNx0117, CYP2B6FNx0111, CYP2B6FNx018, CYP2B6FNx0114, CYP2B6FNx019, CYP2B6FNx014, CYP2B6FNx016, CYP2B6FNx0127, and CYP2B6FNx0120 were determined using multiplex nested allele-specific PCR. Statistical Analysis: Descriptive statistics were used to summarize demographic data. Differences in allele frequencies between populations were tested using Chi-squared test and were corrected using the Bonferroni test. Results: CYP2B6 polymorphism in Malaysia is variable with trends that suggest an ethnic difference. Reduced activity CYP2B6FNx016 occurred in 13% to 26% among Malays, Chinese, Indians and opiate-dependent individuals. Another ′reduced activity′, CYP2B6FNx012 allele, was found at much lower percentages in the groups. Conclusions: The relative commonness of reduced-activity CYP2B6 alleles in our study called for attention in terms of dosage requirements for MMT and ARV in Malaysia. It also implored follow-up association studies to determine its relevance and consequences in personalized medicine for drug use disorder and HIV/AIDS.

JOB STRESS AS A PREDICTOR OF EMPLOYEE HEALTH

OpenAIRE

AZMAN Ismail; NORHAFIZAH Abu Hasan; YU-FEI (Melissa) Chin; YUSOF Ismail; AINON JAUHARIAH Abu Samah

2013-01-01

This study was conducted to measure the relationship between job stress and employee health. A survey method was employed to collect self-administered questionnaires from employees in established universities in Sarawak, Malaysia. The outcomes of SmartPLS path model revealed three important findings: first, role ambiguity was positively and significantly related to employee health. Second, role conflict was positively and significantly related to employee health. Third, role overload was posi...

Is Economic Development Promoting Monetary Integration in East Asia?

Directory of Open Access Journals (Sweden)

Kentaro Kawasaki

2015-10-01

Full Text Available This paper tries to investigate whether there exist international integrated markets among East Asian economies, by employing the Generalized Purchasing Power Parity (G-PPP model, then, it would help to suggest whether the East Asian region is the Optimum Currency Area (OCA or not. The empirical results in this paper suggest that holding the G-PPP among nine Asian countries (China, Indonesia, Japan, Korea, Malaysia, the Philippines, Singapore, Thailand and Vietnam becomes more applicable in 2000–2013 than of that in 1984–1997. In the period of “globalization,” which is characterized by expansion of world trade, increase of international capital flows, and development of information and communications technologies, Asian economic development has been promoting not only economic integrations but also constructing the stable linkages of real exchange rates. Therefore, it would help to adopt regional coordination for monetary policies to assure the feasibility of a possible monetary union.

Factors Affecting Purchase Intention of South East Asian (SEA Young Adults towards Global Smartphone Brands

Directory of Open Access Journals (Sweden)

Wahid Zahid

2016-06-01

Full Text Available The study aims to probe the effect of perceived price, perceived quality, brand awareness, and social influence on purchase intention of South East Asian (SEA Young Adults towards global smartphone brands. This explanatory research uses quantitative empirical data collected from 200 SEA Young Adults studying in one of the public universities in Malaysia. Stratified random sampling is used while ensuring fair representation of SEA countries, viz., Singapore, Malaysia, Philippines, Thailand, Indonesia, Vietnam, and Cambodia. Correlation and regression analysis were carried out using SPSS 20.0. The study resulted in the finding that social influence has the highest level of linear relationship and so is the most influential factor among four. The findings provide guidelines to global smartphone brands for developing value proposition and better promotion mix for smartphones promotion.

Seismicity and seismic hazard in Sabah, East Malaysia from earthquake and geodetic data

Science.gov (United States)

Gilligan, A.; Rawlinson, N.; Tongkul, F.; Stephenson, R.

2017-12-01

While the levels of seismicity are low in most of Malaysia, the state of Sabah in northern Borneo has moderate levels of seismicity. Notable earthquakes in the region include the 1976 M6.2 Lahad Datu earthquake and the 2015 M6 Ranau earthquake. The recent Ranau earthquake resulted in the deaths of 18 people on Mt Kinabalu, an estimated 100 million RM ( US$23 million) damage to buildings, roads, and infrastructure from shaking, and flooding, reduced water quality, and damage to farms from landslides. Over the last 40 years the population of Sabah has increased to over four times what it was in 1976, yet seismic hazard in Sabah remains poorly understood. Using seismic and geodetic data we hope to better quantify the hazards posed by earthquakes in Sabah, and thus help to minimize risk. In order to do this we need to know about the locations of earthquakes, types of earthquakes that occur, and faults that are generating them. We use data from 15 MetMalaysia seismic stations currently operating in Sabah to develop a region-specific velocity model from receiver functions and a pre-existing surface wave model. We use this new velocity model to (re)locate earthquakes that occurred in Sabah from 2005-2016, including a large number of aftershocks from the 2015 Ranau earthquake. We use a probabilistic nonlinear earthquake location program to locate the earthquakes and then refine their relative locations using a double difference method. The recorded waveforms are further used to obtain moment tensor solutions for these earthquakes. Earthquake locations and moment tensor solutions are then compared with the locations of faults throughout Sabah. Faults are identified from high-resolution IFSAR images and subsequent fieldwork, with a particular focus on the Lahad Datau and Ranau areas. Used together, these seismic and geodetic data can help us to develop a new seismic hazard model for Sabah, as well as aiding in the delivery of outreach activities regarding seismic hazard

Sprouting Buds of Zebrafish Research in Malaysia: First Malaysia Zebrafish Disease Model Workshop.

Science.gov (United States)

Okuda, Kazuhide Shaun; Tan, Pei Jean; Patel, Vyomesh

2016-04-01

Zebrafish is gaining prominence as an important vertebrate model for investigating various human diseases. Zebrafish provides unique advantages such as optical clarity of embryos, high fecundity rate, and low cost of maintenance, making it a perfect complement to the murine model equivalent in biomedical research. Due to these advantages, researchers in Malaysia are starting to take notice and incorporate the zebrafish model into their research activities. However, zebrafish research in Malaysia is still in its infancy stage and many researchers still remain unaware of the full potential of the zebrafish model or have limited access to related tools and techniques that are widely utilized in many zebrafish laboratories worldwide. To overcome this, we organized the First Malaysia Zebrafish Disease Model Workshop in Malaysia that took place on 11th and 12th of November 2015. In this workshop, we showcased how the zebrafish model is being utilized in the biomedical field in international settings as well as in Malaysia. For this, notable international speakers and those from local universities known to be carrying out impactful research using zebrafish were invited to share some of the cutting edge techniques that are used in their laboratories that may one day be incorporated in the Malaysian scientific community.

Diversity in Education Using Blended Learning in Sarawak

Science.gov (United States)

Ling, Siew-Eng; Ariffin, Siti Rahayah Bt; Rahman, Saemah Bt; Lai, Kim-Leong

2010-01-01

One of the objectives of Malaysia Ministry of Education is to provide educational opportunities for all Malaysians. Are education opportunities given fairly to all Malaysians who come from two big regions and divided by the South China Sea? The web infancy era, where the World Wide Web (WWW) is blooming fast, has changed the new millennium…

MOVING UP ON SOLAR INDUSTRY VALUE CHAIN: A RESPOND TO WORLD BANK’S PRESCRIPTION FOR MALAYSIA

OpenAIRE

B. Bakhtyar; Ch. Lim; Y. Ibrahim; R. Islam; K. Sopian

2014-01-01

The pressure due to the changes in supplying energy and its price in the international community is in such an extent that it encourages industrialized and developing countries in seeking self-sufficiency in energy production. As one of the leading in countries South East Asia Nations (ASEAN), Malaysia has taken planning and specific investment for the Solar Industry into consideration, besides paying attention to a variety of new and renewable energies. Given the diversity of processes in wo...

Problem Etnisitas India Dalam Cerita Pendek Malaysia

OpenAIRE

M. Shoim Anwar

2015-01-01

Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998), terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara histori...

Sea level trend and variability around Peninsular Malaysia

Science.gov (United States)

Luu, Q. H.; Tkalich, P.; Tay, T. W.

2015-08-01

Sea level rise due to climate change is non-uniform globally, necessitating regional estimates. Peninsular Malaysia is located in the middle of Southeast Asia, bounded from the west by the Malacca Strait, from the east by the South China Sea (SCS), and from the south by the Singapore Strait. The sea level along the peninsula may be influenced by various regional phenomena native to the adjacent parts of the Indian and Pacific oceans. To examine the variability and trend of sea level around the peninsula, tide gauge records and satellite altimetry are analyzed taking into account vertical land movements (VLMs). At annual scale, sea level anomalies (SLAs) around Peninsular Malaysia on the order of 5-25 cm are mainly monsoon driven. Sea levels at eastern and western coasts respond differently to the Asian monsoon: two peaks per year in the Malacca Strait due to South Asian-Indian monsoon; an annual cycle in the remaining region mostly due to the East Asian-western Pacific monsoon. At interannual scale, regional sea level variability in the range of ±6 cm is correlated with El Nino-Southern Oscillation (ENSO). SLAs in the Malacca Strait side are further correlated with the Indian Ocean Dipole (IOD) in the range of ±5 cm. Interannual regional sea level falls are associated with El Nino events and positive phases of IOD, whilst rises are correlated with La Nina episodes and negative values of the IOD index. At seasonal to interannual scales, we observe the separation of the sea level patterns in the Singapore Strait, between the Raffles Lighthouse and Tanjong Pagar tide stations, likely caused by a dynamic constriction in the narrowest part. During the observation period 1986-2013, average relative rates of sea level rise derived from tide gauges in Malacca Strait and along the east coast of the peninsula are 3.6±1.6 and 3.7±1.1 mm yr-1, respectively. Correcting for respective VLMs (0.8±2.6 and 0.9±2.2 mm yr-1), their corresponding geocentric sea level rise rates

Corporate Governance Disclosure in Malaysia

OpenAIRE

ONG, Wei Jiin

2006-01-01

This research provides evidence on corporate governance disclosure in Malaysia based on a sample of 25 Malaysian public listed companies on the Kuala Lumpur Composite Index (KLCI) in the year 1998 and 2005 that are listed on the Bursa Malaysia. The purpose of this dissertation is to examine whether after the launch of the Malaysian Code on Corporate Governance (HLFC, 2000) following the 1997/98 financial crisis, corporate governance in Malaysia has improved in terms of disclosure information ...

Food irradiation in Malaysia

International Nuclear Information System (INIS)

Mohd Ghazali Hj Abd Rahman.

1985-01-01

Food irradiation has recently been visited as a technology that can contribute to the solution of problems associated with food preservation of Malaysia's agriculture produce and products thereby improving the economic status of the rural sector. However, the history of food irradiation in Malaysia is very recent. Research carried out on food irradiation only began in 1974 as a result of the installation of a 60 Co facility (initially 10,000 Ci) at the National University of Malaysia. Since its installation several studies have been carried out pertaining to the food irradiation. Presently its development has been slow. Research in this area has been confined to laboratory scale and purely academic. This limitation is due to a number of reasons, among others are: a) limited number of facilities; b) lack of expertise to conduct its research; c) other preservation methods can be improved with lower capital output. An important step towards its development was made when Malaysia actively participated in the RCA/IAEA food irradiation project, viz. the irradiation of pepper which was carried out at the National University of Malaysia in the 80's. As a result of this venture, research and development activities in food irradiation have been geared toward semi-plot scale with the view ot commercialization in the future. In 1982, a group of researchers was formed to conduct feasibility studies using irradiation techniques in trying to overcome several problems associated with our local paddy and rice. Another group is being organized by the National University of Malaysia to look into the problems associated with the preservation of frozen shrimps. (author)

Green commercial building insurance in Malaysia

Science.gov (United States)

Yang, Yu Xin Ou; Chew, Boon Cheong; Loo, Heoy Shin; Tan, Lay Hong

2017-03-01

Green building construction is growing tremendously globally even in Malaysia. Currently, there are approximate 636 buildings have registered and to be certified with Green Building Index. Among these buildings, 45 buildings have already fulfilled the requirements and fully certified. The other buildings still under provisional certification stage. Malaysia had adopted Green Building Index in 2009 to support a move to promote green building concept. Malaysia starts to move towards green building because Malaysian construction and building industry realizes that both energy consumed and waste produced are reduced without irreversible impacts to ecosystems. Consequently, insurance companies such as Fireman's Fund from America has started the green building insurance policies for their green building in the year of 2006, while Malaysia still remain the coverage for green buildings using conventional property insurance. There are lacks of efforts to be seen from insurance companies to propose green building insurance for these green buildings. There are a few factors which can take into consideration for insurance companies to start the very first green building insurance in Malaysia. Although there are challenges, some efficient strategies have been identified to overcome the problems. The methods used in this research topic is qualitative research. The results obtained shows that green commercial building insurance has a huge business opportunity in Malaysia because the number of green commercial buildings are increasing tremendously in Malaysia. It is a favor to implement green building insurance in Malaysia. Furthermore, insurance companies can consider to add in extra coverage in standard building policy to provide extra protection for non-certified green buildings which have the intention to rebuilt in green when damage happens. Generally, it is very important to introduce green commercial buildings insurance into Malaysia so that all of the green commercial

Metadiscourse in Academic Writing of Pre-University Arab Students at the International Islamic University Malaysia (IIUM

Directory of Open Access Journals (Sweden)

Khairul Zakaria Muhamad

2018-01-01

Full Text Available There is lack of studies on the use of metadiscourse markers; especially amongst international students studying in Malaysia and Malaysia are receiving scores of international students particularly from the Middle East annually. This study involves a textual analysis of students’ academic writing where the metadiscourse markers in 50 Arab IIUM students’ academic texts were identified and analyzed. The findings of this study indicated that Arab writers had a greater inclination for the deployment of the interactive markers (Total counts = 919 than interactional ones (Total counts = 592 as there was a higher percentage of interactive metadiscourse (60.8% usage than the interactional ones (39.2%. It might be useful for English language teachers to integrate cultural considerations within their syllabus with regard to metadiscourse markers in order to prepare relevant materials based on their students’ needs as well as to develop the students’ awareness of the importance of these linguistic features.

Economic stability and health status: evidence from East Asia before and after the 1990s economic crisis.

Science.gov (United States)

Hopkins, Sandra

2006-02-01

The East Asian economies of Indonesia, Malaysia and Thailand suffered declines in their economic growth rates in 1997. The Indonesian and Thai government followed the World Bank prescription for adjustment, which included a cut-back in government spending at a time when there were significant job losses. Malaysia chose its own path to adjustment. Evidence presented in this paper shows that although the declines were short-lived that there was an impact on the health status measured by mortality rates for the populations of Indonesia and Thailand. There was little apparent impact on the health status of Malaysians. The lessons for other developing economies include the importance of social safety nets and the maintenance of government expenditure in minimising the impact of economic shocks on health.

Age, Gender, and Fine-Grained Ethnicity Prediction using Convolutional Neural Networks for the East Asian Face Dataset

Energy Technology Data Exchange (ETDEWEB)

Srinivas, Nisha [ORNL; Rose, Derek C [ORNL; Bolme, David S [ORNL; Mahalingam, Gayathri [ORNL; Atwal, Harleen [ORNL; Ricanek, Karl [ORNL

2017-01-01

This paper examines the difficulty associated with performing machine-based automatic demographic prediction on a sub-population of Asian faces. We introduce the Wild East Asian Face dataset (WEAFD), a new and unique dataset to the research community. This dataset consists primarily of labeled face images of individuals from East Asian countries, including Vietnam, Burma, Thailand, China, Korea, Japan, Indonesia, and Malaysia. East Asian turk annotators were uniquely used to judge the age and fine grain ethnicity attributes to reduce the impact of the other race effect and improve quality of annotations. We focus on predicting age, gender and fine-grained ethnicity of an individual by providing baseline results with a convolutional neural network (CNN). Finegrained ethnicity prediction refers to predicting ethnicity of an individual by country or sub-region (Chinese, Japanese, Korean, etc.) of the East Asian continent. Performance for two CNN architectures is presented, highlighting the difficulty of these tasks and showcasing potential design considerations that ease network optimization by promoting region based feature extraction.

Bakun - Where should all the power go?

Energy Technology Data Exchange (ETDEWEB)

Oh, Tick Hui; Chua, Shing Chyi [Faculty of Engineering and Technology, Malaysia Multimedia University (MMU), 75450 Bukit Beruang, Malacca (Malaysia); Goh, Wei Wei [Foundation Studies and Extension Education, Malaysia Multimedia University (MMU), 75450 Bukit Beruang, Malacca (Malaysia)

2011-02-15

Deem as one of the few mega projects of such scale in this part of the world, the largest hydroelectric dam in the Southeast Asia region, Bakun in Sarawak, is expected to complete by end of 2010. The project first initiated back in 1980s is finally near fruition more than two decades later after much controversies and obstacles. With power generation expected to start in July 2011, there are much debates on how to deal with its 2400 MW maximum capacity now that the preliminary undersea transmission cable project to transfer 1600 MW to Peninsular Malaysia is called off and all that hydropower will be contained within Sarawak. On top of that, Murum dam will add another 944 MW to the grid by end of 2013 and several other dams are reportedly afoot for construction, all within the state of Sarawak. This will result in excessive energy generation in the state while Peninsular is projected to face power shortage by 2015 with the submarine cable project scrapped. This paper presents the numerous issues related to the Bakun project that have surfaced over the years. (author)

ACCESSIBLE BUILT ENVIRONMENT FOR THE ELDERLY AND DISABLED IN MALAYSIA: HOTELS AS CASE STUDIES

Directory of Open Access Journals (Sweden)

Asiah Abdul Rahim

2010-12-01

Full Text Available In Malaysia, it has become of increasing importance to study ways to improve the level of accessibility in buildings for the elderly and disabled people in the built environment, especially in hotels and resorts. The methods used in this study to identify areas to improve are access audits, table research and interviews. The data from these studies are analysed using a descriptive analysis based on access audits, observations, plan analysis, photographs and questionnaires. Access audits were carried out in two hotels and resorts in July and November 2007 in selected areas of East Malaysia. The selected hotels and resorts were constructed in the 1980s; one is located at the countryside and the other in the city centre. The findings will allow the building provider to upgrade existing facilities in order to accommodate accessible built environment for the elderly and disabled people. This will allow the elderly and disabled people to move freely, safely and being more easily integrated with the society in areas of public building and public spaces.

Building a discovery partnership with Sarawak Biodiversity Centre: a gateway to access natural products from the rainforests.

Science.gov (United States)

Yeo, Tiong Chia; Naming, Margarita; Manurung, Rita

2014-03-01

The Sarawak Biodiversity Centre (SBC) is a state government agency which regulates research and promotes the sustainable use of biodiversity. It has a program on documentation of traditional knowledge (TK) and is well-equipped with facilities for natural product research. SBC maintains a Natural Product Library (NPL) consisting of local plant and microbial extracts for bioprospecting. The NPL is a core discovery platform for screening of bioactive compounds by researchers through a formal agreement with clear benefit sharing obligations. SBC aims to develop partnerships with leading institutions and the industries to explore the benefits of biodiversity.

Terrestrial Gamma Radiation Dose Rate of West Sarawak

Science.gov (United States)

Izham, A.; Ramli, A. T.; Saridan Wan Hassan, W. M.; Idris, H. N.; Basri, N. A.

2017-10-01

A study of terrestrial gamma radiation (TGR) dose rate was conducted in west of Sarawak, covering Kuching, Samarahan, Serian, Sri Aman, and Betong divisions to construct a baseline TGR dose rate level data of the areas. The total area covered was 20,259.2 km2, where in-situ measurements of TGR dose rate were taken using NaI(Tl) scintillation detector Ludlum 19 micro R meter NaI(Tl) approximately 1 meter above ground level. Twenty-nine soil samples were taken across the 5 divisions covering 26 pairings of 9 geological formations and 7 soil types. A hyperpure Germanium detector was then used to find the samples' 238U, 232Th, and 40K radionuclides concentrations producing a correction factor Cf = 0.544. A total of239 measured data were corrected with Cf resulting in a mean Dm of 47 ± 1 nGy h-1, with a range between 5 nGy h-1 - 103 nGy h-1. A multiple regression analysis was conducted between geological means and soil types means against the corrected TGR dose rate Dm, generating Dg,s= 0.847Dg+ 0.637Ds- 22.313 prediction model with a normalized Beta equation of Dg,s= 0.605Dg+ 0.395Ds. The model has an 84.6% acceptance of Whitney- Mann test null hypothesis when tested against the corrected TGR dose rates.

Traditional Belief and Practice on Postpartum Recovery among Mothers in East Coast of Peninsular Malaysia

Directory of Open Access Journals (Sweden)

Abdul Ghani Radiah

2018-01-01

Full Text Available Postpartum care is highly important to prevent maternal and infant morbidity. In Malaysia, there are several traditional postpartum care practices by mothers. Different states adopted different ways to perform those practices. In spite of long and established practices in Malaysia, its effect and safety profile is not well understood. This study aims to gain an understanding of the traditional practices that Malay women follow in relation to postpartum care and the rationales underpinning such practices. A cross sectional study (n=100 was conducted using self-administered questionnaire consists of demographic information, practice of postpartum care and knowledge of postpartum care. Data was analyzed using Statistical Package Social Software (2.0. The findings shown that, there was no significant association of socio-demographic data with confinement period (p>0.05. For postpartum dietary practice, there were only association between age and encourage more water intake (p=0.047, p<0.05 and also between number of children and prohibit greasy food (p=0.032, p<0.05. For association between socio-demographic data and postpartum physical practice, there was only association between age and body scrub (p=0.046, p<0.05. The most significant factor that influenced postpartum care practice and its knowledge was family tradition with 83% and 97%, respectively. Traditional postpartum care practice is still significant and dominant among mothers in Kuantan, Pahang. This information is important for health care professional to educate women and provide strategies to help them to integrate their beliefs and the practices recommended in contemporary health care practice.

Mitochondrial DNA analyses reveal low genetic diversity in Culex quinquefasciatus from residential areas in Malaysia.

Science.gov (United States)

Low, V L; Lim, P E; Chen, C D; Lim, Y A L; Tan, T K; Norma-Rashid, Y; Lee, H L; Sofian-Azirun, M

2014-06-01

The present study explored the intraspecific genetic diversity, dispersal patterns and phylogeographic relationships of Culex quinquefasciatus Say (Diptera: Culicidae) in Malaysia using reference data available in GenBank in order to reveal this species' phylogenetic relationships. A statistical parsimony network of 70 taxa aligned as 624 characters of the cytochrome c oxidase subunit I (COI) gene and 685 characters of the cytochrome c oxidase subunit II (COII) gene revealed three haplotypes (A1-A3) and four haplotypes (B1-B4), respectively. The concatenated sequences of both COI and COII genes with a total of 1309 characters revealed seven haplotypes (AB1-AB7). Analysis using tcs indicated that haplotype AB1 was the common ancestor and the most widespread haplotype in Malaysia. The genetic distance based on concatenated sequences of both COI and COII genes ranged from 0.00076 to 0.00229. Sequence alignment of Cx. quinquefasciatus from Malaysia and other countries revealed four haplotypes (AA1-AA4) by the COI gene and nine haplotypes (BB1-BB9) by the COII gene. Phylogenetic analyses demonstrated that Malaysian Cx. quinquefasciatus share the same genetic lineage as East African and Asian Cx. quinquefasciatus. This study has inferred the genetic lineages, dispersal patterns and hypothetical ancestral genotypes of Cx. quinquefasciatus. © 2013 The Royal Entomological Society.

Wave power potential in Malaysian territorial waters

Science.gov (United States)

Asmida Mohd Nasir, Nor; Maulud, Khairul Nizam Abdul

2016-06-01

Up until today, Malaysia has used renewable energy technology such as biomass, solar and hydro energy for power generation and co-generation in palm oil industries and also for the generation of electricity, yet, we are still far behind other countries which have started to optimize waves for similar production. Wave power is a renewable energy (RE) transported by ocean waves. It is very eco-friendly and is easily reachable. This paper presents an assessment of wave power potential in Malaysian territorial waters including waters of Sabah and Sarawak. In this research, data from Malaysia Meteorology Department (MetMalaysia) is used and is supported by a satellite imaginary obtained from National Aeronautics and Space Administration (NASA) and Malaysia Remote Sensing Agency (ARSM) within the time range of the year 1992 until 2007. There were two types of analyses conducted which were mask analysis and comparative analysis. Mask analysis of a research area is the analysis conducted to filter restricted and sensitive areas. Meanwhile, comparative analysis is an analysis conducted to determine the most potential area for wave power generation. Four comparative analyses which have been carried out were wave power analysis, comparative analysis of wave energy power with the sea topography, hot-spot area analysis and comparative analysis of wave energy with the wind speed. These four analyses underwent clipping processes using Geographic Information System (GIS) to obtain the final result. At the end of this research, the most suitable area to develop a wave energy converter was found, which is in the waters of Terengganu and Sarawak. Besides that, it was concluded that the average potential energy that can be generated in Malaysian territorial waters is between 2.8kW/m to 8.6kW/m.

Heavy metal concentrations in the razor clams (Solen spp.) from Muara Tebas, Sarawak

International Nuclear Information System (INIS)

Devagi Kanakaraju; Connie Jios; Shabdin Mohd Long

2008-01-01

The razor clams (Solen spp) or locally known as ambal in Sarawak collected from Muara Tebas were studied for their heavy metals contents in tissues and shells. Sediment samples were also tested for their metal contents. Concentrations of Pb, Fe, Zn, Cu, Cd and Mn were determined by using Flame Atomic Absorption Spectrophotometer (FAAS). Tissues of razor clams showed highest concentrations of Fe and Zn, while shells accumulated highest concentrations of Pb and Mn. The lowest metal concentrations found were Cu and Cd. In general, the levels of metals in ambal were within the permissible limit recommended by international standard, the Food and Agricultural Organization (FAO). However, the study revealed that the sediments at Muara Tebas fall under the category of slightly polluted (for Pb) when compared to the guidelines suggested by United States Environment Protection Agency (USEPA). (author)

Reintroduction of Orangutans: A New Approach. A Study on the Behaviour and Ecology of Reintroduced Orangutans in the Sungai Wain Nature Reserve, East Kalimantan Indonesia

NARCIS (Netherlands)

Fredriksson, Gabriella

1995-01-01

The reintroduction of ex-captive orangutans Pongo pygmaeus) is part of a comprehensive conservation program to preserve this species and it’s habitat. During the last decades the orangutan has been under severe threat throughout it’s range- Northern Sumatra, Kalimantan and East Malaysia- due to

New species of Cylindrocladiella from plantation soils in South-East Asia

Directory of Open Access Journals (Sweden)

Nam Q. Pham

2018-03-01

Full Text Available Cylindrocladiella spp. are widely distributed especially in tropical and sub-tropical regions, where they are mainly known as saprobes although some species are plant pathogens. Very little is known about these fungi in South-East Asia. The aim of this study was to identify a collection of Cylindrocladiella isolates from soils collected in forest nurseries and plantations in Vietnam and Malaysia. This was achieved using DNA sequence comparisons and morphological observations. The study revealed two previously described species, Cy. lageniformis and Cy. peruviana as well as five novel taxa, described here as Cy. arbusta sp. nov., Cy. malesiana sp. nov., Cy. obpyriformis sp. nov., Cy. parvispora sp. nov. and Cy. solicola sp. nov. A relatively small collection of isolates from a limited geographic sampling revealed an unexpectedly high level of Cylindrocladiella diversity suggesting that many more species in this genus await discovery in South-East Asia.

HIZBUT TAHRIR MALAYSIA: the Emergence of a New Transnational Islamist Movement in Malaysia

Directory of Open Access Journals (Sweden)

Mohamed Nawab Mohamed Osman

2009-02-01

Full Text Available This paper looks at the Hizbut Tahrir of Malaysia and places it in the context of the wider and deeper development of Muslim politics and mass mobilisation across Asia and the world at large. While much has been written about the Hizbut Tahrir of Indonesia (HTI, little is known about the HTM. This paper traces the initial arrival of the HT to Malaysia, via the network of Malaysian students and activists who were educated abroad and who have managed to build their own inter-personal networks and relationships outside the parameters of mainstream political Islam and the state apparatus in the country. Furthermore it is interesting to note that HTM in Malaysia takes its own unique stand on Islamic issues with relation to the mainstream Islamic party PAS and the Malay-Muslim UMNO party. The paper therefore attempts to locate the ideological positioning of the HTM in the wider context of Islamist politics in contemporary Malaysia and to analyse its relationship to the wider currents of ethno-communal as well as religious politics in the country as a whole. 

Overview of the Malaysian mineral industry

Energy Technology Data Exchange (ETDEWEB)

Dahan, A.R.B. (Department of Mines (Malaysia))

1992-08-01

The article describes the status of the mining industry in Malaysia. Tin dominated the industry until a price fall caused closure of many mines in 1987-1990. Other minerals mined include copper, gold, iron ore, bauxite, barite, kaolin, limestone, clays, sand and gravel. Coal production in Malaysia resumed when an opencast mine was opened in July 1988 in Sarawak. Another started operation in early 1989 by the underground method. At the end of 1990 there was a total of 53 exploration rights granted for gold, coal, base metals and industrial minerals. A few coalfields have been identified. Generally the industry has suffered a decline because of lack of new investment. 1 fig.

A survey of schoolchildren's exposure to secondhand smoke in Malaysia

Directory of Open Access Journals (Sweden)

Turner Stephen W

2011-08-01

Full Text Available Abstract Background There is a lack of data describing the exposure of Malaysian schoolchildren to Secondhand Smoke (SHS. The aim of this study is to identify factors influencing schoolchildren's exposures to SHS in Malaysia. Method This cross-sectional study was carried out to measure salivary cotinine concentrations among 1064 schoolchildren (10-11 years attending 24 schools in Malaysia following recent partial smoke-free restrictions. Parents completed questionnaires and schoolchildren provided saliva samples for cotinine assay. Results The geometric mean (GM salivary cotinine concentrations for 947 non-smoking schoolchildren stratified by household residents' smoking behaviour were: for children living with non-smoking parents 0.32 ng/ml (95% CI 0.28-0.37 (n = 446; for children living with a smoker father 0.65 ng/ml (95% CI 0.57-0.72 (n = 432; for children living with two smoking parents 1.12 ng/ml (95% CI 0.29-4.40 (n = 3; for children who live with an extended family member who smokes 0.62 ng/ml (95% CI 0.42-0.89 (n = 33 and for children living with two smokers (father and extended family member 0.71 ng/ml (95% CI 0.40-0.97 (n = 44. Parental-reported SHS exposures showed poor agreement with children's self-reported SHS exposures. Multiple linear regression demonstrated that cotinine levels were positively associated with living with one or more smokers, urban residence, occupation of father (Armed forces, parental-reported exposure to SHS and education of the father (Diploma/Technical certificate. Conclusions This is the first study to characterise exposures to SHS using salivary cotinine concentrations among schoolchildren in Malaysia and also the first study documenting SHS exposure using salivary cotinine as a biomarker in a South-East Asian population of schoolchildren. Compared to other populations of similarly aged schoolchildren, Malaysian children have higher salivary cotinine concentrations. The partial nature of smoke

Absence of Plasmodium inui and Plasmodium cynomolgi, but detection of Plasmodium knowlesi and Plasmodium vivax infections in asymptomatic humans in the Betong division of Sarawak, Malaysian Borneo.

Science.gov (United States)

Siner, Angela; Liew, Sze-Tze; Kadir, Khamisah Abdul; Mohamad, Dayang Shuaisah Awang; Thomas, Felicia Kavita; Zulkarnaen, Mohammad; Singh, Balbir

2017-10-17

Plasmodium knowlesi, a simian malaria parasite, has become the main cause of malaria in Sarawak, Malaysian Borneo. Epidemiological data on malaria for Sarawak has been derived solely from hospitalized patients, and more accurate epidemiological data on malaria is necessary. Therefore, a longitudinal study of communities affected by knowlesi malaria was undertaken. A total of 3002 blood samples on filter paper were collected from 555 inhabitants of 8 longhouses with recently reported knowlesi malaria cases in the Betong Division of Sarawak, Malaysian Borneo. Each longhouse was visited bimonthly for a total of 10 times during a 21-month study period (Jan 2014-Oct 2015). DNA extracted from blood spots were examined by a nested PCR assay for Plasmodium and positive samples were then examined by nested PCR assays for Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, Plasmodium knowlesi, Plasmodium cynomolgi and Plasmodium inui. Blood films of samples positive by PCR were also examined by microscopy. Genus-specific PCR assay detected Plasmodium DNA in 9 out of 3002 samples. Species-specific PCR identified 7 P. knowlesi and one P. vivax. Malaria parasites were observed in 5 thick blood films of the PCR positive samples. No parasites were observed in blood films from one knowlesi-, one vivax- and the genus-positive samples. Only one of 7 P. knowlesi-infected individual was febrile and had sought medical treatment at Betong Hospital the day after sampling. The 6 knowlesi-, one vivax- and one Plasmodium-infected individuals were afebrile and did not seek any medical treatment. Asymptomatic human P. knowlesi and P. vivax malaria infections, but not P. cynomolgi and P. inui infections, are occurring within communities affected with malaria.

Geochemical characterization of Neogene sediments from onshore West Baram Delta Province, Sarawak: paleoenvironment, source input and thermal maturity

Science.gov (United States)

Togunwa, Olayinka S.; Abdullah, Wan H.

2017-08-01

The Neogene strata of the onshore West Baram Province of NW Borneo contain organic rich rock formations particularly within the Sarawak basin. This basin is a proven prolific oil and gas province, thus has been a subject of great interest to characterise the nature of the organic source input and depositional environment conditions as well as thermal maturation. This study is performed on outcrop samples of Lambir, Miri and Tukau formations, which are of stratigraphic equivalence to the petroleum bearing cycles of the offshore West Baram delta province in Sarawak. The investigated mudstone samples are organic rich with a total organic carbon (TOC) content of more than 1.0 wt.%. The integration of elemental and molecular analyses indicates that there is no significant variation in the source input between these formations. The investigated biomarkers parameters achieved from acyclic isoprenoids, terpanes and steranes biomarkers of a saturated hydrocarbon biomarkers revealed that these sediments contain high contribution of land plants with minor marine organic matter input that was deposited and preserved under relatively oxic to suboxic conditions. This is further supported by low total sulphur (TS), high TOC/TN ratios, source and redox sensitive trace elements (V, Ni, Cr, Co and Mo) concentrations and their ratios, which suggest terrigenous source input deposited under oxic to suboxic conditions. Based on the analysed biomarker thermal maturity indicators, it may be deduced that the studied sediments are yet to enter the maturity stage for hydrocarbon generation, which is also supported by measured vitrinite reflectance values of 0.39-0.48% Ro.

Geochemical characterization of Neogene sediments from onshore West Baram Delta Province, Sarawak: paleoenvironment, source input and thermal maturity

Directory of Open Access Journals (Sweden)

Togunwa Olayinka S.

2017-08-01

Full Text Available The Neogene strata of the onshore West Baram Province of NW Borneo contain organic rich rock formations particularly within the Sarawak basin. This basin is a proven prolific oil and gas province, thus has been a subject of great interest to characterise the nature of the organic source input and depositional environment conditions as well as thermal maturation. This study is performed on outcrop samples of Lambir, Miri and Tukau formations, which are of stratigraphic equivalence to the petroleum bearing cycles of the offshore West Baram delta province in Sarawak. The investigated mudstone samples are organic rich with a total organic carbon (TOC content of more than 1.0 wt.%. The integration of elemental and molecular analyses indicates that there is no significant variation in the source input between these formations. The investigated biomarkers parameters achieved from acyclic isoprenoids, terpanes and steranes biomarkers of a saturated hydrocarbon biomarkers revealed that these sediments contain high contribution of land plants with minor marine organic matter input that was deposited and preserved under relatively oxic to suboxic conditions. This is further supported by low total sulphur (TS, high TOC/TN ratios, source and redox sensitive trace elements (V, Ni, Cr, Co and Mo concentrations and their ratios, which suggest terrigenous source input deposited under oxic to suboxic conditions. Based on the analysed biomarker thermal maturity indicators, it may be deduced that the studied sediments are yet to enter the maturity stage for hydrocarbon generation, which is also supported by measured vitrinite reflectance values of 0.39-0.48% Ro.

Malaysia Economic Monitor, June 2016 : Leveraging Trade Agreements

OpenAIRE

World Bank

2016-01-01

The MEM is the World Bank's biannual flagship publication on Malaysia. It provides analysis of recent economic developments and the near-term outlook for Malaysia. Each publication also focuses on a special topic related to Malaysia's transformation into a high-income economy. Malaysia is at the forefront of a "new generation" of trade agreements that will shape trade and investment over t...

The Determinants of Participation in Physical Activity in Malaysia

Science.gov (United States)

Cheah, Yong Kang; Poh, Bee Koon

2014-01-01

Objectives In light of the importance of physical activity, the aim of the present study is to examine the factors affecting participation in physical activity among adults in Malaysia. Methods A logistic regression model and the Third National Health and Morbidity Survey consisting of 30,992 respondents were used. Results Age, income, gender, education, marital status, region, house locality, job characteristics, and medical conditions are significantly associated with participation in physical activity. In particular, old individuals, high income earners, females, the well-educated, widowed or divorced individuals, East Malaysians, urban dwellers, the unemployed, and individuals who are not diagnosed with hypercholesterolemia are less likely to be physically active than others. Conclusion Because sociodemographic and health factors play an important role in determining physical activity, the government should take them into account when formulating policy. PMID:24955308

Intercomparison of techniques for estimation of sedimentation rate in the Sabah and Sarawak coastal waters

International Nuclear Information System (INIS)

Zal U'yun Wan Mahmood; Zaharudin Ahmad; Abdul Kadir Ishak; Che Abd Rahim Mohamed

2011-01-01

A total of eight sediment cores with 50 cm length were taken in the Sabah and Sarawak coastal waters using a gravity corer in 2004 to estimate sedimentation rates using four mathematical models of CIC, Shukla-CIC, CRS and ADE. The average of sedimentation rate ranged from 0.24 to 0.48 cm year -1 , which is calculated based on the vertical profile of 210 Pbex in sediment core. The finding also showed that the sedimentation rates derived from four models were generally shown in good agreement with similar or comparable value at some stations. However, based on statistical analysis of paired sample t-test indicated that CIC model was the most accurate, reliable and suitable technique to determine the sedimentation rate in the coastal area. (author)

Extrabudgetary programme on the safety of nuclear installations in South East Asia Pacific and Far East countries. Report of the consultative meeting

International Nuclear Information System (INIS)

1997-07-01

Based on the good experience with the rapid expansion of nuclear utilization in Japan and South Korea, China is planning to significantly expand its nuclear programme, and other countries in the region are likely to follow this example in order to meet their expected high electricity demand growth. The building of NPPs is being considered in Indonesia, Malaysia, the Philippines, Thailand, and Vietnam. It is however recognized that countries in the region are in different stages of nuclear power programme, and that their needs for assistance in nuclear safety will be substantially different. In this situation it would be advantageous for all countries to establish regional co-operation on nuclear safety to learn from each other, use the experience accumulated in the world, and to commonly assess the progress made in nuclear safety matters. The objective of this Consultative Meeting was to discuss co-operation and the needs for assistance by Member States in South-East Asia, Pacific and Far East to strengthen the safety of their nuclear installations. Refs, figs, tabs

A review of depression research in malaysia.

Science.gov (United States)

Ng, C G

2014-08-01

Depression is a debilitating illness and has become a leading cause of morbidity globally. We aim to summarise the evidence available in regard to the prevalence, type of assessment tools used and treatment options for depression in Malaysia. Two hundred and forty seven articles related to depression were found in a search through a database dedicated to indexing all original data relevant to medicine published in Malaysia between the years 2000-2013. Fifty seven articles were selected and reviewed on the basis of clinical relevance and future research implications. Findings were summarised, categorised and presented according to prevalence of depression, depression in women, depression in clinical condition, assessment tools, and treatment of depression. The prevalence of depression in Malaysia was estimated to be between 8 and 12%. The figures were higher among women of low socio-economic background or those with comorbid medical condition. The common assessment tools used in Malaysia include Beck Depression Inventory (BDI), Depression, Anxiety and Stress Scale (DASS), Patient Health Questionnaire 9 (PHQ-9) and Hospital Anxiety and Depression Scale (HADS). They were translated into the Malay language and their psychometric properties were established. Both pharmacological treatment and psychotherapy were commonly used in Malaysia, and were highly recommended in local clinical practice guidelines. There are discrepancies in the reported rates of depression in Malaysia and this needs to be addressed. There were lack of studies looking into the depression among subgroups in Malaysia especially in the male population. There were several instruments available for assessment of depression in Malaysia but their suitability for the local setting need further research. Both pharmacotherapy and psychotherapy were recommended in the local treatment guideline in Malaysia. With the emergence of generic medication, we need to compare their clinical efficacy and tolerability

International Atomic Energy Agency: activities in Malaysia

Energy Technology Data Exchange (ETDEWEB)

Hayati, Ainul [Nuclear Energy Unit, Bangi, Selangor (Malaysia)

1994-12-31

The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989.

International Atomic Energy Agency: activities in Malaysia

International Nuclear Information System (INIS)

Ainul Hayati

1994-01-01

The two main IAEA activities participated by Malaysia - technical cooperation programme (TC) and regional cooperative agreement programme (RCA/IAEA AND IAEA/RCA/UNDP). This article highlighted some of the IAEA technical cooperation activities in Malaysia (i.e. Medicine, Agriculture, Industry, Strategic, Social Science), assistance, funding and contribution made by Malaysia to the IAEA since 1989

Feed-in tariff outlook in Malaysia

International Nuclear Information System (INIS)

Chua, Shing Chyi; Oh, Tick Hui; Goh, Wei Wei

2011-01-01

This paper aims to present the feed-in tariff (FiT) outlook in Malaysia, which is in the process of being enacted through a Renewable Energy (RE) Policy by the Government of Malaysia (GoM). A brief in policies leading towards the RE policy and the potential of each RE sources under FiT mechanism have been discussed. The successful utilisation of RE source in electricity generation and the FiT implementation globally are positive indicators to implement FiT in Malaysia. Potentials of FiT on biomass, biogas and solid waste energy are currently very promising in Malaysia, but it is solar energy which is predicted to be the main RE of the future, surpassing all other REs. (author)

Comparison of GPM IMERG, TMPA 3B42 and PERSIANN-CDR satellite precipitation products over Malaysia

Science.gov (United States)

Tan, Mou Leong; Santo, Harrif

2018-04-01

The launch of the Global Precipitation Measurement (GPM) mission has prompted the assessment of the newly released satellite precipitation products (SPPs) in different parts of the world. This study performed an initial comparison of three GPM IMERG products (IMERG_E, IMERG_L and IMERG_F) with its predecessor, the TMPA 3B42 and 3B42RT products, and a long-term PERSIANN-CDR product over Malaysia. The performance of six SPPs was evaluated using 501 precipitation gauges from 12 March 2014 to 29 February 2016. The annual, seasonal, monthly and daily precipitation measurements were validated using three widely used statistical metrics (CC, RMSE and RB). The precipitation detection capability (POD, FAR and CSI), probability density function (PDF) and the 2014-2015 flood event analysis were also considered in this assessment. The results show that all the SPPs perform well in annual and monthly precipitation measurements. The spatial variability of the total annual precipitation in 2015 is well captured by all six SPPs, with high precipitation amount in southern East Malaysia, and low precipitation amount in the middle part of Peninsular Malaysia. In contrast, all the SPPs show moderate correlation at daily precipitation estimations, with better performance during the northeast monsoon season. The performance of all the SPPs is better in eastern Peninsular Malaysia, but poorer in northern Peninsular Malaysia. All the SPPs have good precipitation detection ability, except the PERSIANN-CDR. All the SPPs underestimate the light (0-1 mm/day) and violent (> 50 mm/day) precipitation classes, but overestimate moderate and heavy (1-50 mm/day) precipitation classes. The IMERG is shown to have a better capability in detecting light precipitation (0-1 mm/day) compared to the other SPPs. The PERSIANN-CDR has the worst performance in capturing all the precipitation classes, with significant underestimation of light precipitation (0-1 mm/day) class and overestimation of moderate and

Composition of dissolved organic nitrogen in rivers associated with wetlands.

Science.gov (United States)

Watanabe, Akira; Tsutsuki, Kiyoshi; Inoue, Yudzuru; Maie, Nagamitsu; Melling, Lulie; Jaffé, Rudolf

2014-09-15

As basic information for assessing reactivity and functionality of wetland-associated dissolved organic matter (DOM) based on their composition and structural properties, chemical characteristics of N in ultrafiltered DOM (UDON; >1 kD) isolated from wetland-associated rivers in three climates (cool-temperate, Hokkaido, Japan; sub-tropical, Florida, USA; tropical, Sarawak, Malaysia) were investigated. The UDON was isolated during dry and wet seasons, or during spring, summer, and autumn. The proportion of UDON present as humic substances, which was estimated as the DAX-8 adsorbed fraction, ranged from 47 to 91%, with larger values in the Sarawak than at the other sites. The yield of hydrolyzable amino acid N ranged 1.24 to 7.01 mg g(-1), which correlated positively to the total N content of UDOM and tended to be larger in the order of Florida>Hokkaido>Sarawak samples. X-ray photoelectron N1s spectra of UDON showed a strong negative correlation between the relative abundances of amide/peptide N and primary amine N. The relative abundances of amide/peptide N and primary amine N in the Sarawak samples were smaller (70-76%) and larger (20-23%) respectively compared to those (80-88% and 4-9%) in the Florida and Hokkaido samples. Assuming terminal amino groups and amide N of peptides as major constituents of primary amine N and amide/peptide N, respectively, the average molecular weight of peptides was smaller in the Sarawak samples than that in the Florida and Hokkaido samples. Seasonal variations in UDON composition were scarce in the Sarawak and Florida samples, whereas the distribution of humic substance-N and nonhumic substance-N and compositions of amino acids and N functional groups showed a clear seasonality in the Hokkaido samples. While aromatic N increased from spring to autumn, contributions from fresh proteinaceous materials were also enhanced during autumn, resulting in the highest N content of UDOM for this season. Copyright © 2014 Elsevier B.V. All rights

DESKRIPSI TIPOLOGI, KLASIFIKASI DAN ANALISIS PERANCANGAN MASJID DI MALAYSIA

Directory of Open Access Journals (Sweden)

Mohamad Tajuddin Mohamad Rasdi

2011-10-01

Full Text Available As one of the countries with the largest muslim communities in Southeast Asia, the study of Islamic architecture, especially the architecture of  modern mosques in Malaysia, has not yet been done intensively. Most of the  studies and documentation carried out were more focused in the study of old  mosques which were considered as more valuable historically with a more unique  traditional architecture. This paper will attempt to describe the typology of form  and visual style of the mosques (as the main building of Islamic architecture  developed in Malaysia, ranging from traditional mosques in the area of  remote villages to modern mosques in urban areas. This study is very  important in  recognizing aspects of morphology, the influence, and the development of mosque  design in Malaysia which will become a reference in designing the mosque,  especially in this country in the future. The discussion itself will consists of the Traditional Vernacular Mosque Architecture of Malaysia, a Sino Eclectic Mosques in Malaysia, the European Classical Mosque in Malaysia, the  North Indian Mosque in Malaysia, the Malaysia’s Vernacular Mo  dern Mosque, the Modern Expressionism Revivalism Mosque in Malaysia and the Post-Modern Mosque in Malaysia. It is expected that this  study would give an idea of the various approaches and the development  of mosque design in Malaysia in order to recognize the ideas and thoughts of Islamic architecture in Malaysia.

RU’YAT AL-HILĀL DENGAN TEKNOLOGI : Telaah Pelaksanaan Ru’yat al-Hilāl di Baitul Hilal Teluk Kemang Malaysia

Directory of Open Access Journals (Sweden)

Dito Alif Pratama

2016-10-01

Full Text Available Baitul Hilal Teluk Kemang which is located at coordinate latitude 2 ° 26 '44' in the North and longitude 101° 51'21' in the East, is one of the good record crescent sighting observation center in Malaysia. The result of the study is as follows, firstly, the method of crescent observation at Baitul Hilal seems quite effective since it is located in a strategic and suitable place for crescent observation activity. Baitul Hilal is also supported by some sophisticated technology such as telescope and DSLR camera operated by some crescent observers who are officially certified by the Malaysian government. Secondly, Baitul Hilal has contributed to crescent observation development in Malaysia. Baitul Hilal also provides with the astronomical data based on monthly crescent activity as an additional data for crescent researcher to analyze the imkᾱn al-rukyah criterion.

Malaysia.

Science.gov (United States)

Van Niel, Eloise Smith; Schelander, Bjorn

This book provides an overview of Malaysia's history and culture. The book begins with a prehistoric times and continues through nationhood. Each chapter provides background information along with student activities and project suggestions. Chapters include: (1) "Introduction"; (2) "Early Trade and Civilization"; (3) "The…

Developing a Malaysia flood model

Science.gov (United States)

Haseldine, Lucy; Baxter, Stephen; Wheeler, Phil; Thomson, Tina

2014-05-01

Faced with growing exposures in Malaysia, insurers have a need for models to help them assess their exposure to flood losses. The need for an improved management of flood risks has been further highlighted by the 2011 floods in Thailand and recent events in Malaysia. The increasing demand for loss accumulation tools in Malaysia has lead to the development of the first nationwide probabilistic Malaysia flood model, which we present here. The model is multi-peril, including river flooding for thousands of kilometres of river and rainfall-driven surface water flooding in major cities, which may cause losses equivalent to river flood in some high-density urban areas. The underlying hazard maps are based on a 30m digital surface model (DSM) and 1D/2D hydraulic modelling in JFlow and RFlow. Key mitigation schemes such as the SMART tunnel and drainage capacities are also considered in the model. The probabilistic element of the model is driven by a stochastic event set based on rainfall data, hence enabling per-event and annual figures to be calculated for a specific insurance portfolio and a range of return periods. Losses are estimated via depth-damage vulnerability functions which link the insured damage to water depths for different property types in Malaysia. The model provides a unique insight into Malaysian flood risk profiles and provides insurers with return period estimates of flood damage and loss to property portfolios through loss exceedance curve outputs. It has been successfully validated against historic flood events in Malaysia and is now being successfully used by insurance companies in the Malaysian market to obtain reinsurance cover.

COUNTRY OF ORIGIN EFFECT ON ORGANIZATIONAL INNOVATION IN MALAYSIA: THE MEDIATING ROLE OF STRUCTURE

Directory of Open Access Journals (Sweden)

Aizzat Mohd. Nasurdin

2004-01-01

Full Text Available The two main objectives of this study are: first, to determine whether the level of innovation (technological and process, product and administrative varies by country of origin, and second, to investigate the influence of country of origin on organizational innovation (technological and process, product and administrative via the mediating role played by organizational structure (formalization and centralization, among firms operating in Malaysia. Statistical analyses of the 80 multinational corporations and 43 locally-owned firms and joint-ventures using ANOVA revealed that significant differences do exist in terms of their innovation levels. Firms from the West (American multinationals and European multinationals had higher levels of technological and process innovation compared to firms from the East (Eastern multinationals plus local companies and joint-ventures. Regarding product innovation, American multinationals were found to be more innovative compared to European multinationals and firms from the East (Eastern multinationals plus local firms and joint-ventures. In terms of administrative innovation, American multinationals were found to be most innovative followed by European multinationals, and lastly, firms from the East (Eastern multinationals plus local companies and joint-ventures. Additionally, country of origin had no indirect effect on the three forms of innovation via structure. Implications and suggestions for future research are discussed.

Malaysia commercial energy flow: status and structure

International Nuclear Information System (INIS)

Ridzuan Abdul Mutalib; Maragatham Kumar; Nik Arlina Nik Ali; Abi Muttaqin Jalal Bayar; Aisya Raihan Abdul Kadir; Muhammed Zulfakar Zolkaffly; Azlinda Aziz; Jamal Khaer Ibrahim

2008-08-01

With further growth of Malaysia economy, future development of the energy sector in Malaysia is vital to ensure targeted growth. Commercial Energy continues to play a major role in ensuring a balanced energy mix for power generation due to a potential increase in energy demand from various sectors, especially the industrial sector. This paper presents the status and structure of Malaysia Commercial Energy Flow, which gives an overview of the flow of all types of energy sources from primary energy supply to final energy use, and also the potential for nuclear power in electricity generation in Malaysia. (Author)

Porpoises Among the Whales: Small Navies in Asia and the Pacific

Science.gov (United States)

1994-03-01

Maverick 14 miles 300 lbs. 800+ mph Air-to-surface vessels) may decide the outcome. (U.S.) Military analysts generally maintain Silkworm 59-93 miles...Sarawak with Malaysia,* and, despite the fact into the newly formed Malaysian federation. that the two countries are ASEAN ISee also Morgan and Fryer 1985...4its constabulary and coastal-defense Fast-attack hydrofoils 5 6 Large patrol craft 18 1 roles. The Malaysian navy is only Coastal patrol craft 18

Malaysia : the lucky man of Asia?

OpenAIRE

Kind, Hans Jarle; Ismail, Mohd Nazari

2001-01-01

Malaysia has been labelled the Lucky Man of Asia due to its wealth of natural resources, such as tin, rubber, palm oil, pepper, tropical timber, petroleum and a very fertile soil. There is no doubt that this richness has helped Malaysia to achieve impressive growth rates over the last decades, but history has taught us that large endowments of natural resources by far are sufficient to generate development. Since the early 1970s Malaysia has led a relatively successful racial integration poli...

Problem Etnisitas India Dalam Cerita Pendek Malaysia

Directory of Open Access Journals (Sweden)

M. Shoim Anwar

2015-12-01

Full Text Available Karya sastra adalah dokumen kemanusiaan dan kebudayaan. Kumpulan cerita pendek Menara 7 (1998, terutama enam cerpen yang ditulis oleh pengarang Malaysia beretnis India, memberi gambaran problem kehidupan etnis India di Malaysia. Dengan meminjam teori etnisitas sebagai landasan, tulisan ini bertujuan mengungkap problem etnisitas India di Malaysia. Problem etnis India terkait dengan kemiskinan, pendidikan, gender, religi, budaya, dan persatuan. Keberadaan etnis India di Malaysia secara historis merupakan bagian dari kolonialisme Inggris di masa lampau. Residu kolonialisme menciptakan jejak hitam kemanusiaan yang mendalam. Sebagai pendatang, tersirat ada ketegangan sosial-budaya yang dialami etnis India, tetapi bukan konflik. Problem etnis India dalam cerpen Malaysia adalah sarana untuk becermin bagi masyarakat dalam negara yang multietnis. Abstract: Literature is a document of humanity and culture. A collection of short stories Menara 7 (1998, especially five short stories written by Malaysian Indian, gives an overview of Indian ethnic problems in Malaysia. Using postcolonial theory as an anchor, their problems are poverty, education, gender, religion, culture, and unity. The existence Malaysian Indian was British colonial legacy. The leftover of colonialism deeply creates dark footprints of humanity. As a newcomer, it’s implied there was social-cultural tension, but not conflict, experienced by Malaysian Indian. The problems in Malaysia short stories are a tool of reflection in a multiethnic society. Key Words: problem, ethnic, ethnicity, short story

Distribution network connection pricing framework and methodology: identification of areas of improvement for Sarawak Energy Berhad Connection Charges Guidelines through modified delphi method

Science.gov (United States)

Tan, J. K.; Abas, N.

2017-07-01

Complaints on issues and matters related to connection charges have been very common for electricity supply utility companies around the world including Sarawak Energy Berhad. In order to identify the areas that can be improved, a mixed method of exploratory research involving qualitative and quantitative methods have been designed and undertaken rather than a single method of survey. This will ensure a more comprehensive and detailed understanding of the issues from various target groups. The method is designed under three phases, employing Modified Delphi Technique for phase 1 through a series of stake holder engagements, online and offline survey questionnaires to be filled by internal wiring contractors for phase 2 whilst under phase 3, case studies shall be carried out on the issues identified from phase 1 and phase 2 of the study. This paper presented the findings from the Modified Delphi Technique. The findings revealed that there are areas of improvement for Sarawak Energy Berhad connection guidelines in term of differentiation of dedicated and shared assets which leads to unfairness to the connecting customers, inconsistency and non-transparent in charging. The findings of Modified Delphi Technique shall be used for implementation of phase 2 and phase 3 of the study.

Contributions of humic substances to the dissolved organic carbon pool in wetlands from different climates.

Science.gov (United States)

Watanabe, Akira; Moroi, Kunio; Sato, Hiromu; Tsutsuki, Kiyoshi; Maie, Nagamitsu; Melling, Lulie; Jaffé, Rudolf

2012-08-01

Wetlands are an important source of DOM. However, the quantity and quality of wetlands' DOM from various climatic regions have not been studied comprehensively. The relationship between the concentrations of DOM (DOC), humic substances (HS) and non-humic substances (NHS) in wetland associated sloughs, streams and rivers, in cool temperate (Hokkaido, Japan), sub-tropical (Florida, USA), and tropical (Sarawak, Malaysia) regions was investigated. The DOC ranged from 1.0 to 15.6 mg CL(-1) in Hokkaido, 6.0-24.4 mg CL(-1) in Florida, and 18.9-75.3 mg CL(-1) in Sarawak, respectively. The relationship between DOC and HS concentrations for the whole sample set was regressed to a primary function with y-intercept of zero (Pwetland soils, whereas the rate of the increase in the NHS supply has an upper limit which may be controlled by primary productivity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Situation Report--Austria, Cameroon, Canada, Czechoslovakia, Denmark, Egypt, France, German Federal Republic, Greece, Hungary, Irish Republic, Jamaica, Malta, Norway, Sabah, Sarawak, Spain, Tahiti (French Polynesia), Tonga, Turkey, and United Kingdom.

Science.gov (United States)

International Planned Parenthood Federation, London (England).

Data relating to population and family planning in 21 foreign countries are presented in these situation reports. Countries included are Austria, Cameroon, Canada, Czechoslovakia, Denmark, Egypt, France, German Federal Republic, Greece, Hungary, Irish Republic, Jamaica, Malta, Norway, Sabah, Sarawak, Spain, Tahiti, Tonga, Turkey, and United…

Biosimilars in Developed and Developing East and Southeast Asian Countries: Japan, South Korea, and Malaysia-Overview, Evolution, and Regulations Assessment.

Science.gov (United States)

Bas, Tomas Gabriel; Oliu Castillo, Carolina

2016-01-01

The development of biological products has experienced continuous growth over the past three decades. The expiration of patent protection for many biological medicines has led to the development of biosimilars in many countries around the world. This paper reviews the literature on biosimilar drugs and covers their therapeutic status, clinical trials, approved biosimilars, and regulatory guidelines in Japan, South Korea, and Malaysia. The literature suggests that biosimilars are comparable but not identical to the reference product. They are not a generic version of an innovative product and do not ensure therapeutic equivalence. Biosimilars present more challenges than conventional generics and their marketing approval is also much more complicated. Guidelines for biosimilars were published in Japan in July 2009 by the Ministry of Health, Labour and Welfare (MHLW), in South Korea in March 2009 by the Ministry of Food and Drug Safety (MFDS), and in Malaysia in July 2008 by the National Pharmaceutical Control Bureau (NPCB).

Biowaste fuels South-East Asian COGEN schemes

International Nuclear Information System (INIS)

Pennington, M.

1998-01-01

This article reports on the COGEN Programme of the European Commission in association with the Association of South East Asian Nations (ASEAN), and considers the benefits of using biowaste for the production of energy using cogeneration with the corresponding reduction in the emission of greenhouse gases. The substitution of rice husks for the fuel in a cogeneration plant at a Thai rice mill, and the combustion of wood in the cogeneration plant at the Homet Raya plant in Malaysia are described, and details are given of the backgrounds to the projects, locations, the technologies used, and the process economics. The next phase of the COGEN programme due to start in 1998 which will see the programme expanded to include coal-fired and gas-fired cogeneration projects is discussed

Health Information in Malay (Bahasa Malaysia)

Science.gov (United States)

... You Are Here: Home → Multiple Languages → Malay (Bahasa Malaysia) URL of this page: https://medlineplus.gov/languages/malay.html Health Information in Malay (Bahasa Malaysia) To use the sharing features on this page, ...