WorldWideScience

Sample records for samarium 157

  1. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  2. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  3. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  4. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  5. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  6. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  7. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  8. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  9. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  10. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  11. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  13. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  14. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  15. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  16. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  17. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  18. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  19. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  20. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  1. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  2. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  3. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  5. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  6. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  7. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  9. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  10. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  11. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  12. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  13. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  14. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  15. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  16. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  17. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  18. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  19. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  20. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  1. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  2. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  3. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  4. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  5. 40 CFR 157.34 - Certification.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Certification. 157.34 Section 157.34... REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.34 Certification. (a) General. (1) The... that the package meets the standards of § 157.32. (2) Certification must be submitted with each...

  6. 33 CFR 157.128 - Stripping system.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Stripping system. 157.128 Section... Crude Oil Washing (COW) System on Tank Vessels Design, Equipment, and Installation § 157.128 Stripping system. (a) Each tank vessel having a COW system under § 157.10(e), § 157.10a(a)(2), or § 157.10c(b)(2...

  7. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  8. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  9. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  10. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  11. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  12. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  13. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  14. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  15. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  16. 36 CFR 1192.157 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Lighting. 1192.157 Section 1192.157 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS COMPLIANCE BOARD... Buses and Systems § 1192.157 Lighting. (a) Any stepwell or doorway immediately adjacent to the driver...

  17. 43 CFR 15.7 - Fishing.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Fishing. 15.7 Section 15.7 Public Lands: Interior Office of the Secretary of the Interior KEY LARGO CORAL REEF PRESERVE § 15.7 Fishing. (a) Spear fishing within the boundaries or confines of this Preserve is prohibited. (b) The use of poisons, electric...

  18. 33 CFR 157.166 - Hydrocarbon emissions.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Hydrocarbon emissions. 157.166... Crude Oil Washing (COW) System on Tank Vessels Cow Operations § 157.166 Hydrocarbon emissions. If the... ballasted in that port the hydrocarbon vapors in each tank are contained by a means under § 157.132. Note...

  19. 49 CFR 38.157 - Lighting.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Lighting. 38.157 Section 38.157 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Over-the-Road Buses and Systems § 38.157 Lighting. (a) Any stepwell or...

  20. 40 CFR 205.157 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 205.157 Section 205.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.157 Requirements. ...

  1. 14 CFR 61.157 - Flight proficiency.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Flight proficiency. 61.157 Section 61.157... CERTIFICATION: PILOTS, FLIGHT INSTRUCTORS, AND GROUND INSTRUCTORS Airline Transport Pilots § 61.157 Flight... and log ground and flight training from an authorized instructor on the areas of operation under this...

  2. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  3. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  4. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  5. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  6. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  7. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  8. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  9. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Dicty_cDB: VHP157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP157 (Link to dictyBase) - - - Contig-U16260-1 VHP157P (Link to Original site) VHP...157F 617 VHP157Z 723 VHP157P 1320 - - Show VHP157 Library VH (Link to library) Clone ID VHP...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-C/VHP157Q.Seq.d/ Representative seq. ID VHP...157P (Link to Original site) Representative DNA sequence >VHP157 (VHP157Q) /CSM/VH/VHP1-C/VHP...h*r--- ---prmg*k*chehlvfrsrr*rcqsprqchqrcsife*n*rffrwcfpmghqrrccl** kherypfqsl*chpph*chpqrwwsnhpncssctlcc*in

  11. Dicty_cDB: SLB157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB157 (Link to dictyBase) - - - - SLB157Z (Link to Original site) - - SLB...157Z 700 - - - - Show SLB157 Library SL (Link to library) Clone ID SLB157 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-C/SLB...157Q.Seq.d/ Representative seq. ID SLB157Z (Link to Original site) R...epresentative DNA sequence >SLB157 (SLB157Q) /CSM/SL/SLB1-C/SLB157Q.Seq.d/ XXXXXXXXXXCGTGATCTTACTGATTACATGAT

  12. BPC 157 and blood vessels.

    Science.gov (United States)

    Seiwerth, Sven; Brcic, Luka; Vuletic, Lovorka Batelja; Kolenc, Danijela; Aralica, Gorana; Misic, Marija; Zenko, Anita; Drmic, Domagoj; Rucman, Rudolf; Sikiric, Predrag

    2014-01-01

    This review focuses on the described effects of BPC 157 on blood vessels after different types of damage, and elucidate by investigating different aspects of vascular response to injury (endothelium damage, clotting, thrombosis, vasoconstriction, vasodilatation, vasculoneogenesis and edema formation) especially in connection to the healing processes. In this respect, BPC 157 was concluded to be the most potent angiomodulatory agent, acting through different vasoactive pathways and systems (e.g. NO, VEGF, FAK) and leading to optimization of the vascular response followed, as it has to be expected, by optimization of the healing process. Formation of new blood vessels involves two main, partly overlapping mechanisms, angiogenesis and vasculogenesis. The additional mechanism of arteriogenesis is involved in the formation of collaterals. In conjunction with blood vessel function, we at least have to consider leakage of fluid/proteins/plasma, resulting in edema/exudate formation as well as thrombogenesis. Blood vessels are also strongly involved in tumor biology. In this aspect, we have neoangiogenesis resulting in pathological vascularization, vascular invasion resulting in release of metastatic cells and the phenomenon of homing resulting in formation of secondary tumors--metastases.

  13. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  14. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  15. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  16. Dicty_cDB: CHF157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF157 (Link to dictyBase) - - - Contig-U15817-1 CHF157P (Link to Original site) CHF1...57F 676 CHF157Z 644 CHF157P 1300 - - Show CHF157 Library CH (Link to library) Clone ID CHF1...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-C/CHF157Q.Seq.d/ Representative seq. ID CHF1...57P (Link to Original site) Representative DNA sequence >CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF1...s producing significant alignments: (bits) Value CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF157Q.Seq.d/ 2272 0.0 VHC

  17. 18 CFR 157.53 - Testing.

    Science.gov (United States)

    2010-04-01

    ... 157.53 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES OF PUBLIC CONVENIENCE AND... Exemption of Natural Gas Service for Drilling, Testing, or Purging from Certificate Requirements § 157.53...

  18. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming bids...

  19. 42 CFR 422.157 - Accreditation organizations.

    Science.gov (United States)

    2010-10-01

    ... (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Quality Improvement § 422.157 Accreditation... accreditation no longer provides assurance that the Medicare requirements are met or exceeded. (3) Onsite... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 422.157 Section 422...

  20. Prevalence of Escherichia coli O157

    NARCIS (Netherlands)

    Abdissa, Rosa; Haile, Woynshet; Fite, Akafete Teklu; Beyi, Ashenafi Feyisa; Agga, Getahun E.; Edao, Bedaso Mammo; Tadesse, Fanos; Korsa, Mesula Geloye; Beyene, Takele; Beyene, Tariku Jibat; Zutter, De Lieven; Cox, Eric; Goddeeris, Bruno Maria

    2017-01-01

    Background: There is paucity of information regarding the epidemiology of Escherichia coli O157: H7 in developing countries. In this study, we investigated the occurrence of E. coli O157: H7 associated with beef cattle at processing plants and at retail shops in Ethiopia. Methods: Various samples

  1. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  2. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  3. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  4. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  5. Dicty_cDB: VHB157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available to library) VHB157 (Link to dictyBase) - - - Contig-U11741-1 - (Link to Original site) VHB157F 687 - -...- - - - - Show VHB157 Library VH (Link to library) Clone ID VHB157 (Link to dictyBase) Atlas ID - NBRP...URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHB1-C/VHB157Q.Seq.d/ Representative seq. ID - (Link to Original...site) Representative DNA sequence >VHB157 (VHB157Q) /CSM/VH/VHB1-C/VHB157Q.Seq.d/ CCAAGTACCACTCATTACCAA...significant alignments: (bits) Value VHB157 (VHB157Q) /CSM/VH/VHB1-C/VHB157Q.Seq.d/ 1342 0.0 VHE292 (VHE292Q)

  6. Stable gastric pentadecapeptide BPC 157 and bupivacaine.

    Science.gov (United States)

    Zivanovic-Posilovic, Gordana; Balenovic, Diana; Barisic, Ivan; Strinic, Dean; Stambolija, Vasilije; Udovicic, Mario; Uzun, Sandra; Drmic, Domagoj; Vlainic, Josipa; Bencic, Martina Lovric; Sindic, Aleksandra; Seiwerth, Sven; Sikiric, Predrag

    2016-12-15

    Bupivacaine toxicity following accidental overdose still lacks therapeutic solution. However, there are major arguments for testing BPC 157 against bupivacaine toxicity in vivo in rats, in particular, and then finally, in vitro. These are: the lack of any known BPC 157 toxicity, a lifesaving effect via the mitigation of arrhythmias in rats underwent hyperkalemia or digitalis toxicity, the elimination of hyperkalemia and arrhythmias in rats underwent succinylcholine toxicity and finally, the reduction of potassium-induced depolarization in vitro (in HEK293 cells) in severe hyperkalemia. Most importantly, BPC 157 successfully prevents and counteracts bupivacaine cardiotoxicity; BPC 157 is effective even against the worst outcomes such as a severely prolonged QRS complex. Here, rats injected with bupivacaine (100mg/kg IP) exhibited bradycardia, AV-block, ventricular ectopies, ventricular tachycardia, T-wave elevation and asystole. All of the fatalities had developed T-wave elevation, high-degree AV-block, respiratory arrest and asystole. These were largely counteracted by BPC 157 administration (50µg/kg, 10µg/kg, 10ng/kg, or 10pg/kg IP) given 30min before or 1min after the bupivacaine injection. When BPC 157 was given 6min after bupivacaine administration, and after the development of prolonged QRS intervals (20ms), the fatal outcome was markedly postponed. Additionally, the effect of bupivacaine on cell membrane depolarization was explored by measuring membrane voltages (Vm) in HEK293 cells. Bupivacaine (1mM) alone caused depolarization of the cells, while in combination with BPC 157 (1µm), the bupivacaine-induced depolarization was inhibited. Together, these findings suggest that the stable gastric pentadecapeptide BPC 157 should be a potential antidote for bupivacaine cardiotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. E.coli O157:H7

    Directory of Open Access Journals (Sweden)

    Treor Francis Fernandez

    2008-06-01

    Full Text Available The serious nature of the symptoms of haemorrhagic colitis and HUS and the apparent low infectious dose (<100 cells of E.coli O157:H7 places this food borne pathogen a most serious of known food borne pathogens. Persuasive evidence suggests that healthy cattle are a reservoir of O157 and they can enter the food chain to provide a source of exposure for humans. A possible route of transmission of O157 VTEC may involve infections initially in calves that shed their organism into faecal slurry that may be used on grazing grass. This provides potential for infection of other animals from which the organism may contaminate milk or carcasses at slaughter. Possible sources of VTEC in healthy animals other E.coli O157:H7 than cattle and a wider range of foodstuffs require further investigation. Many features of E.coli O157:H7 strains remain poorly understood. It includes: (i Role of virulent genes in the animal, (ii Mechanism of evolution of the organism, (iii The progress of individual cases of E.coli O157:H7 infection, and (iv The difference in incidence of infection in different geographical areas. [Veterinary World 2008; 1(3.000: 83-87

  8. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  9. Isolation and genomic characterization of Escherichia coli O157:NM ...

    African Journals Online (AJOL)

    Human diseases caused by Escherichia coli O157:NM and E. coli O157:H7 strains have been reported throughout the world. In developed countries, serotype O157:H7 represents the major cause of human diseases; however, there have been increasing reports of non-O157 Shiga toxin (Stx)-producing E. coli strains ...

  10. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  11. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  12. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  13. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  14. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  15. 33 CFR 157.126 - Pumps.

    Science.gov (United States)

    2010-07-01

    ... Washing (COW) System on Tank Vessels Design, Equipment, and Installation § 157.126 Pumps. (a) Crude oil must be supplied to the COW machines by COW system pumps or cargo pumps. (b) The pumps under paragraph...) A sufficient pressure and flow is supplied to allow the simultaneous operation of those COW machines...

  16. 49 CFR 15.7 - Covered persons.

    Science.gov (United States)

    2010-10-01

    ... including a person formerly in such position. (l) Each person for which a vulnerability assessment has been... assessment that will be provided to DOT or DHS in support of a Federal security program. (m) Each person... Office of the Secretary of Transportation PROTECTION OF SENSITIVE SECURITY INFORMATION § 15.7 Covered...

  17. 7 CFR 3560.157 - Occupancy rules.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.157 Occupancy... access. A copy of these rules must be attached to the tenant's lease upon initial occupancy. At a minimum... office locations, hours, and emergency telephone numbers; (8) The restrictions on storage and...

  18. Detection of Escherichia coli O157 and non-O157 Serogroups in ...

    African Journals Online (AJOL)

    Of the 21 (5.5%) diarrhoeagenic Escherichia coli strains recovered E. coli O157 accounted for 5 (1.3%), 6 (1.6%) and 9 (2.4%) respectively. The rate of isolation of E. coli O157 in cattle faeces and raw cow milk was 1.5% each while, water was 6.3%. The frequency of isolation of E. coli O118, O111 and O26 serotypes from ...

  19. Presence of Escherichia coli O157 and O157:H7 in raw milk and Van herby cheese

    Directory of Open Access Journals (Sweden)

    Sancak Yakup Can

    2015-12-01

    Full Text Available The Shiga toxin-producing Escherichia coli (STEC strains are currently considered important emerging pathogens threatening public health. Among Shiga toxin-producing Escherichia coli, E. coli O157:H7 strains have emerged as important human pathogens. This study was conducted to determine the presence of Escherichia coli O157 and O157:H7 in raw milk samples and Van herby cheese samples. For this purpose, 100 samples of raw milk were collected and 100 samples of herby cheese sold for consumption in Van province in Turkey were obtained from grocers and markets in order to detect the presence of Escherichia coli O157 and O157:H7. The method of E. coli O157 and O157:H7 isolation proposed by the Food and Drug Administration (FDA was used. E. coli O157 in raw milk and herby cheese samples was found in 11% and 6% of samples respectively, and E. coli O157:H7 was found in 2% of herby cheese samples. No E. coli O157:H7 was detected in raw milk samples. This study showed that raw milk was contaminated with E. coli O157 and herby cheese was contaminated with both E. coli O157 and E. coli O157:H7; therefore, herby cheese poses a serious risk to public health.

  20. 46 CFR 45.157 - Scuppers and gravity drains.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from spaces...

  1. 33 CFR 157.120 - Waiver of required documents.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Waiver of required documents. 157.120 Section 157.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... documents. The Coast Guard waives the requirement for the letter under § 157.116(b), if a U.S. tank vessel...

  2. 14 CFR 157.2 - Definition of terms.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Definition of terms. 157.2 Section 157.2... NOTICE OF CONSTRUCTION, ALTERATION, ACTIVATION, AND DEACTIVATION OF AIRPORTS § 157.2 Definition of terms..., seaplane base, ultralight flightpark, manned balloon launching facility, or other aircraft landing or...

  3. Immunomagnetic separation of Escherichia coli O157:H7 from ...

    African Journals Online (AJOL)

    Standard immunoassay kits specific for the O157 and H7 antigen and a biochemical indole test were used for further E. coli O157:H7 confirmation. Three colonies from one sewage sample (1.1 % of all sewage samples) agglutinated with anti-E. coli O157 and H7 antiserum and contained the genes coding for Stx2, eaeA ...

  4. 33 CFR 157.158 - COW operations: Changed characteristics.

    Science.gov (United States)

    2010-07-01

    ... characteristics. 157.158 Section 157.158 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND...: Changed characteristics. The COW system may be operated with characteristics that do not meet those... changed characteristics; (b) The changed characteristics used to pass the inspections under § 157.140 are...

  5. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent but...

  6. 33 CFR 157.440 - Autopilot alarm or indicator.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Autopilot alarm or indicator. 157.440 Section 157.440 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... § 157.440 Autopilot alarm or indicator. (a) A tankship owner or operator shall ensure that each...

  7. TRUPACT-II 157 Examination Report

    Energy Technology Data Exchange (ETDEWEB)

    Barry H. O& #39; Brien; Jeffrey M. Lacy; Kip E. Archibald

    2003-12-01

    This report presents the results of examination and recovery activities performed on the TRUPACT-II 157 shipping container. The container was part of a contact-handled transuranic waste shipment being transported on a truck to the Waste Isolation Pilot Plant in New Mexico when an accident occurred. Although the transport vehicle sustained only minor damage, airborne transuranic contamination was detected in air samples extracted from inside TRUPACT-II 157 at the Waste Isolation Pilot Plant. Consequently, the shipping container was rejected, resealed, and returned to the Idaho National Engineering and Environmental Laboratory where the payload was disassembled, examined, and recovered for subsequent reshipment to the Waste Isolation Pilot Plant. This report documents the results of those activities.

  8. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  9. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  10. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  11. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  12. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  13. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  14. Escherichia coli O157:H7 and rectoanal junction cell interactome

    Science.gov (United States)

    Introduction. Cattle are the primary E. coli O157 (O157) reservoir and principal source of human infection. The anatomical site of O157 persistence is the bovine recto-anal (RAJ) junction; hence, an in-depth understanding of O157-RAJ interactions will help develop novel modalities to limit O157 in c...

  15. 29 CFR 1952.157 - Changes to approved plan.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Changes to approved plan. 1952.157 Section 1952.157 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... approved plan. (a) Legislation. (1) On March 29, 1994, the Assistant Secretary approved North Carolina's...

  16. Search for Enterohaemorrhagic Escherichia coli O157:H7 and ...

    African Journals Online (AJOL)

    Enterohaemorrhagic Escherichia coli (EHEC) O157:H7 and Salmonella enterica are important zoonotic bacteria responsible for enteric infections in humans. The present study investigated the possible role of kittens in the zoonotic transmission of antimicrobial resistant EHEC O157 and Salmonella enterica to human using ...

  17. 33 CFR 157.500 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... Vegetable Oil § 157.500 Purpose and applicability. (a) The purpose of this subpart is to establish mandatory... fat or vegetable oil. (b) This subpart applies to each tank vessel specified in § 157.01 of this part that— (1) Is 5,000 gross tons or more; (2) Carries animal fat or vegetable oil in bulk as cargo or...

  18. 33 CFR 157.132 - Cargo tanks: Hydrocarbon vapor emissions.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo tanks: Hydrocarbon vapor... § 157.132 Cargo tanks: Hydrocarbon vapor emissions. Each tank vessel having a COW system under § 157.10a... must have— (a) A means to discharge hydrocarbon vapors from each cargo tank that is ballasted to a...

  19. 33 CFR 157.08 - Applicability of subpart B.

    Science.gov (United States)

    2010-07-01

    ... OIL IN BULK Design, Equipment, and Installation § 157.08 Applicability of subpart B. Note: An “oil... retains oily mixtures on board and discharges them to a reception facility. (f) Sections 157.11 (a... cohesive and adhesive characteristics, that inhibit effective product/water separation and monitoring. (g...

  20. 7 CFR 1900.157-1900.200 - [Reserved

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false 1900.157-1900.200 Section 1900.157-1900.200 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE SERVICE, RURAL UTILITIES SERVICE, AND FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE PROGRAM...

  1. 29 CFR 2570.157 - Allocation of burden of proof.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Allocation of burden of proof. 2570.157 Section 2570.157 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR ADMINISTRATION AND ENFORCEMENT UNDER THE EMPLOYEE RETIREMENT INCOME SECURITY ACT OF 1974...

  2. 40 CFR 98.157 - Records that must be retained.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.157 Section 98.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... that must be retained. (a) In addition to the data required by § 98.3(g), HCFC-22 production facilities...

  3. 18 CFR 157.16 - Exhibits relating to acquisitions.

    Science.gov (United States)

    2010-04-01

    ..., if the acquisition involved is by purchase of capital stock and liquidation of the acquired company. (8) A pro forma consolidating balance sheet, as of the date of the merger if the acquisition is by... acquisitions. 157.16 Section 157.16 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY...

  4. Escherichia coli O157 infections and unpasteurised milk

    NARCIS (Netherlands)

    Allerberger, F; Wagner, M; Schweiger, P; Rammer, H P; Resch, A; Dierich, M P; Friedrich, A W; Karch, H

    2001-01-01

    We report on two children with Escherichia coli O157 infection, one of whom developed haemolytic uraemic syndrome (HUS). Both had drunk raw cows or goats milk in the week before their illness. Molecular subtyping identified a sorbitol fermenting Escherichia coli O157:H isolate from a dairy cow. This

  5. Prevalence and antibiogram of Escherichia coli O157 isolated from ...

    African Journals Online (AJOL)

    E. coli O157 is an important serotype that caused many food borne outbreaks worldwide in the past decades. This study was carried out to estimate the prevalence and determine the antimicrobial susceptibility of E. coli O157 isolated from bovine carcasses and cecal contents at one abattoir in Jimma. A total of 300 samples ...

  6. 33 CFR 157.13 - Designated observation area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Designated observation area. 157... OIL IN BULK Design, Equipment, and Installation § 157.13 Designated observation area. Each new vessel must have a designated observation area on the weather deck or above that is: (a) Located where the...

  7. The effects of free chlorine concentration, organic load, and exposure time on the inactivation of Salmonella, Escherichia coli O157:H7 and non-O157 STEC

    Science.gov (United States)

    This study evaluated the effects of free chlorine (FC) concentration, contact time, and organic load on the inactivation of Salmonella, E. coli O157:H7, and non-O157 STEC in suspension. Four strains each of Salmonella, E. coli O157:H7, or non-O157 STEC cells were inoculated separately or as a multi-...

  8. [Survival of VTEC O157 and non-O157 in water troughs and bovine feces].

    Science.gov (United States)

    Polifroni, Rosana; Etcheverría, Analía I; Arroyo, Guillermo H; Padola, Nora L

    2014-01-01

    Verotoxin-producing Escherichia coli (VTEC) is the etiologic agent of hemolytic-uremic syndrome (HUS), which typically affects children ranging in age from six months to five years old. Transmission is produced by consumption of contaminated food, by direct contact with animals or the environment and from person to person. In previous studies we determined that the environment of a dairy farm is a non-animal reservoir; thus, we proposed to study the survival of 4 VTEC isolates (O20:H19; O91:H21; O157:H7 and O178:H19) in sterile water troughs and bovine feces by viable bacteria count and detection of virulence genes by PCR. It was demonstrated that the survival of different VTEC isolates (O157 and non-O157) varied in terms of their own characteristics as well as of the environmental conditions where they were found. The main differences between isolates were their survival time and the maximal counts reached. The competitive and adaptive characteristics of some isolates increase the infection risk for people that are visiting or working on a farm, as well as the risk for reinfection of the animals and food contamination. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  9. Effect of carvacrol on O157 and non-O157 Shiga toxin producing Escherichia coli

    Directory of Open Access Journals (Sweden)

    Alexandros Stratakos

    2017-06-01

    Full Text Available Shiga toxin Escherichia coli (STEC strains are important foodborne bacteria linked to diarrhea, enteritis, hemolytic-uremic syndrome and in some cases death. E. coli O157:H7 is the most common strain amongst STECs however non-O157 STECs have been connected with several outbreaks on an international level.  The use of natural plant extracts to reduce the risk from foodborne pathogens is gaining increasing importance. Therefore in this study, we tested the antibacterial effect of carvacrol, a major component of oregano essential oil, on E. coli serogroups O157, O26, O45, O103, O111, O121, O145 as well as serogroup O104 responsible for the massive outbreak in Germany in 2011. Carvacrol showed antibacterial effect on all strains tested. The relative electric conductivity was assessed in order to investigate the changes in membrane permeability and thus to investigate the antimicrobial mechanism of carvacrol. Results showed that the relative conductivity increased with increasing concentrations of carvacrol which showed that there was an increasing leakage of electrolytes due to disruption of the cell membrane. The data presented here revealed that carvacrol has the potential to be used as a natural antimicrobial against STECs.

  10. Toxicity by NSAIDs. Counteraction by stable gastric pentadecapeptide BPC 157.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Aralica, Gorana; Safic, Hana; Suran, Jelena; Rak, Davor; Dzidic, Senka; Vrcic, Hrvoje; Sebecic, Bozidar

    2013-01-01

    Stable gastric pentadecapeptide BPC 157 is an anti-ulcer peptidergic agent, proven in clinical trials to be both safe in inflammatory bowel disease (PL-10, PLD-116, PL 14736) and wound healing, stable in human gastric juice, with no toxicity being reported. Recently, we claim that BPC 157 may be used as an antidote against NSAIDs. We focused on BPC 157 beneficial effects on stomach, duodenum, intestine, liver and brain injuries, adjuvant arthritis, pain, hyper/hypothermia, obstructive thrombus formation and thrombolysis, blood vessel function, counteraction of prolonged bleeding and thrombocytopenia after application of various anticoagulants and antiplatelet agents and wound healing improvement. The arguments for BPC 157 antidote activity (i.e., the role of BPC 157 in cytoprotection, being a novel mediator of Robert's cytoprotection and BPC 157 beneficial effects on NSAIDs mediated lesions in the gastrointestinal tract, liver and brain and finally, counteraction of aspirin-induced prolonged bleeding and thrombocytopenia) obviously have a counteracting effect on several established side-effects of NSAIDs use. The mentioned variety of the beneficial effects portrayed by BPC 157 may well be a foundation for establishing BPC 157 as a NSAIDs antidote since no other single agent has portrayed a similar array of effects. Unlike NSAIDs, a very high safety (no reported toxicity (LD1 could be not achieved)) profile is reported for BPC 157. Also, unlike the different dosage levels of aspirin, as a NSAIDs prototype, which differ by a factor of about ten, all these beneficial and counteracting effects of BPC 157 were obtained using the equipotent dosage (μg, ng/kg) in parenteral or peroral regimens.

  11. Perforating corneal injury in rat and pentadecapeptide BPC 157.

    Science.gov (United States)

    Masnec, Sanja; Kokot, Antonio; Zlatar, Mirna; Kalauz, Miro; Kunjko, Kristian; Radic, Bozo; Klicek, Robert; Drmic, Domagoj; Lazic, Ratimir; Brcic, Luka; Radic, Radivoje; Ivekovic, Renata; Seiwerth, Sven; Sikiric, Predrag

    2015-07-01

    Based on its healing effects in various tissues, we hypothesized that the stable gastric pentadecapeptide BPC 157 heals corneal ulcerations in rats and effects corneal transparency. We made a penetrant linear 2-mm incision in the paralimbal region of the left cornea at the 5 o'clock position with a 20-gauge MVR incision knife at 45° under an operating microscope. Medication was BPC 157 (2 pg/mL, 2 ng/mL, and 2 μg/mL distilled water, two eye drops/left rat eye) immediately after injury induction and then every 8 h up to 120 h; controls received an equal volume of distilled water. In contrast to the poor healing response in controls, BPC 157 significantly accelerated the healing process in 2 μg and 2 ng BPC 157-treated eyes, starting 24 h after the injury, and the fluorescein and Seidel tests became negative. The epithelial defects were completely healed at 72 h (2 μg BPC 157-treated group) and at 96 h (2 ng BPC 157-treated group) after injury. Aqueous cells were absent at 96 h and 120 h after injury in the 2 μg and 2 ng BPC 157-treated groups, respectively. In conclusion, BPC 157 effects the rapid regaining of corneal transparency. Whereas controls developed new vessels that grew from the limbus to the penetrated area, BPC 157-treated rats generally had no new vessels, and those that did form in the limbus did not make contact with the penetrated area. Thus, BPC 157 eye drops successfully close perforating corneal incisions in rats. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Topological data analysis of Escherichia coli O157:H7 and non-O157 survival in soils

    Science.gov (United States)

    Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in major fresh produce-growing soils are limited due to the complexity in datasets generated from different ...

  13. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  14. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  15. Topological Data Analysis of Escherichia coli O157:H7 and Non-O157 Survival in Soils

    Directory of Open Access Journals (Sweden)

    ABASIOFIOK MARK IBEKWE

    2014-09-01

    Full Text Available Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in soils are limited due to the complexity in datasets generated from different environmental variables and bacterial taxa. There is a continuing need to distinguish the various environmental variables and different bacterial groups to understand the relationships among these factors and the pathogen survival. Using an approach called Topological Data Analysis (TDA; we reconstructed the relationship structure of E. coli O157 and non-O157 survival in 32 soils (16 organic and 16 conventionally managed soils from California (CA and Arizona (AZ with a multi-resolution output. In our study, we took a community approach based on total soil microbiome to study community level survival and examining the network of the community as a whole and the relationship between its topology and biological processes. TDA produces a geometric representation of complex data sets. Network analysis showed that Shiga toxin negative strain E. coli O157:H7 4554 survived significantly longer in comparison to E. coli O157:H7 EDL933, while the survival time of E. coli O157:NM was comparable to that of E. coli O157:H7 strain 933 in all of the tested soils. Two non-O157 strains, E. coli O26:H11 and E. coli O103:H2 survived much longer than E. coli O91:H21 and the three strains of E. coli O157. We show that there are complex interactions between E. coli strain survival, microbial community structures, and soil parameters.

  16. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  17. Antiinflammatory effect of BPC 157 on experimental periodontitis in rats.

    Science.gov (United States)

    Keremi, B; Lohinai, Z; Komora, P; Duhaj, S; Borsi, K; Jobbagy-Ovari, G; Kallo, K; Szekely, A D; Fazekas, A; Dobo-Nagy, C; Sikiric, P; Varga, G

    2009-12-01

    The pentadecapeptide BPC 157 has been shown to have anti-inflammatory and wound healing effects on multiple target tissues and organs. The purpose of the present study was to investigate the effect of BPC 157 on inflammation and bone resorption in experimental periodontitis in rats. First the acute effect of BPC was tested on gingival blood flow by laser doppler flowmetry. Then periodontitis was produced by a silk ligature placed around the lower left first molar. Rats were treated with BPC 157 (once daily for 12 days) or vehicle. At day 13, the gingivomucosal tissues encircling the molars were removed on both sides. Inflammation was assessed by Evans blue plasma extravasation technique and by histology. Alveolar bone loss was analyzed by microCT. BPC 157 had no effect on gingivomucosal blood flow. Twelve day ligature caused a significantly increased Evans blue extravasation in the gingivomucosal tissue, histological signs of inflammation, and alveolar bone destruction. BPC 157 treatment significantly reduced both plasma extravasation, histological alterations and alveolar bone resorption. In conclusion, systemic application of BPC 157 does not alter blood circulation in healthy gingiva. Chronic application of the peptide has potent antiinflammatory effects on periodontal tissues in ligature induced periodontitis in rats. Taken together, this proof of concept study suggests that BPC 157 may represent a new peptide candidate in the treatment of periodontal disease.

  18. Pentadecapeptide BPC 157 and the esophagocutaneous fistula healing therapy.

    Science.gov (United States)

    Cesarec, Vedran; Becejac, Tomislav; Misic, Marija; Djakovic, Zeljko; Olujic, Danijela; Drmic, Domagoj; Brcic, Luka; Rokotov, Dinko Stancic; Seiwerth, Sven; Sikiric, Predrag

    2013-02-15

    Esophagocutaneous fistulas are a failure of the NO-system, due to NO-synthase blockage by the NOS-blocker L-NAME consequently counteracted by l-arginine and gastric pentadecapeptide BPC 157 (l-arginine BPC 157), precipitating a therapeutic benefit. Previously, there was an established BPC 157-NO-system interaction. BPC 157 GEPPPGKPADDAGLV, MW 1419 (LD1 not achieved), is a safe and stable anti-ulcer peptide, successful in inflammatory bowel disease trials, counteracting esophagitis, sphincter failure, gastrointestinal and skin ulcers, gastrocutaneous or colocutaneous fistulas. We treated rats with established cervical esophagocutaneous fistulas throughout four days (both open skin and esophageal defects, with significant leakage) with BPC 157 (parenterally and perorally) and L-NAME (blocking NO genesis) and l-arginine (NO-substrate) alone or in combination. RT-PCR investigated eNOS, iNOS, COX-2 mRNA levels in the fistulas. We evidenced a closely inter-related process of unhealed skin, esophageal defects, unhealed fistulas (up regulated eNOS, iNOS and COX2 mRNA levels), usually lethal, particularly NO-system related and therapy dependent. Generally, the course of fistula healing was accelerated either to a greater extent (with BPC 157 (in particular, less eNOS gene expression) completely counteracting L-NAME effects, in L-NAME+BPC 157 and L-NAME+l-arginine+BPC 157 groups), or to a lesser extent (with l-arginine). Conversely, the process was aggravated, rapidly and prominently (with L-NAME). In particular, BPC 157 was effective either given per-orally/intraperitoneally, in μg- and ng-regimens. Shortly, defects started to heal, with less fistula leakage and no mortality at day 4. Failure of pyloric and lower esophageal sphincter pressure was restored, with practically no esophagitis. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Prevalence of O157:H7 and non-O157 E. coli in Iranian domestic sheep.

    Science.gov (United States)

    Tahamtan, Yahya; Namavari, Mehdi

    2014-01-01

    The aim of the present study was the isolation of both E. coli O157 and non-O157 in sheep. Verotoxins (VT) 1, 2 and eae genes were tested for this propose. Sheep faces are an important source of Shiga toxin-producing Escherichia coli (STEC). Escherichia coli O157:H7 is a highly virulent food-borne pathogen and threat to public health. Rectal swab samples from sheep were collected during 2009-2010. Conventional plating and Polymerase Chain Reaction (PCR) were carried out according to virulence factors (Stx1, Stx2 and eaeA).There significant differences between prevalence of STEC and session were observed. It was at highest in spring and late summer. Six (3.92%) sheep carcasses were contaminated by E. coli O157:H7.Only six samples were positive by PCR specific for the VT2 gene and produced verocytotoxin VT2, whereas all isolates were negative for the presence of VT1 and eae virulence genes considered. Geographical variations and season may be influenced in the prevalence rate. The composition of the gastrointestinal flora may be changed by different diet and, therefore O157 STEC rate in sheep and lamb was different. Iranian sheep indicated as a natural host of E. coli O157 strains therefore, may be potentially pathogenic for humans. This is the first report of E. coli O157 detection from sheep in Iran.

  20. Stable gastric pentadecapeptide BPC 157: novel therapy in gastrointestinal tract.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Vrcic, Hrvoje; Sebecic, Bozidar

    2011-01-01

    Stable gastric pentadecapeptide BPC 157 is an anti-ulcer peptidergic agent, safe in inflammatory bowel disease clinical trials (GEPPPGKPADDAGLV, M.W. 1419, PL 14736) and wound healing, stable in human gastric juice and has no reported toxicity. We focused on BPC 157 as a therapy in peridontitis, esophagus, stomach, duodenum, intestine, liver and pancreas lesions. Particularly, it has a prominent effect on alcohol-lesions (i.e., acute, chronic) and NSAIDs-lesions (interestingly, BPC 157 both prevents and reverses adjuvant arthritis). In rat esophagitis and failed function of both lower esophageal sphincter (LES) and pyloric sphincters (PS), BPC 157 increased pressure in both sphincters till normal and reduced esophagitis. However, in healthy rats, it may decrease (PS) or increase (LES) the pressure in sphincters. It has strong angiogenic potential, it acts protectively on endothelium, prevents and reverses thrombus formation after abdominal aorta anastomosis, affects many central disturbances (i.e., dopamine and 5-HT system), the NO-system (either L-arginine and L-NAME effects), endothelin, acts as a free radical scavenger (counteracting CCl4-, paracetamol-, diclofenac-injuries) and exhibits neuroprotective properties. BPC 157 successfully heals the intestinal anastomosis, gastrocutaneous, duodenocutaneous and colocutaneous fistulas in rats, as well as interacting with the NO-system. Interestingly, the fistula closure was achieved even when the BPC 157 therapy was postponed for one month. In short-bowel syndrome escalating throughout 4 weeks, the constant weight gain above preoperative values started immediately with peroral and parental BPC 157 therapy and the villus height, crypth depth and muscle thickness (inner (circular) muscular layer) additionally increased. Thus, BPC 157 may improve gastrointestinal tract therapy.

  1. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  2. Pentadecapeptide BPC 157 attenuates chronic amphetamine-induced behavior disturbances.

    Science.gov (United States)

    Sikiric, Predrag; Jelovac, Nikola; Jelovac-Gjeldum, Andjelka; Dodig, Goran; Staresinic, Mario; Anic, Tomislav; Zoricic, Ivan; Rak, Davor; Perovic, Darko; Aralica, Gorana; Buljat, Gojko; Prkacin, Ingrid; Lovric-Bencic, Martina; Separovic, Jadranka; Seiwerth, Sven; Rucman, Rudolf; Petek, Marijan; Turkovic, Branko; Ziger, Tihomil; Boban-Blagaic, Alenka; Bedekovic, Vlado; Tonkic, Ante; Babic, Slaven

    2002-05-01

    To investigate the effect of pentadecapeptide BPC 157 on chronic exposure to amphetamine in rats, particularly the changes commonly referred in chronic amphetamine studies as tolerance (lesser grade of stereotyped behavior, without increased excitability) and reverse tolerance (ie, prominent stereotyped behavior and heightened startle response upon late amphetamine challenges). After initial application (initial single dose-regimen), amphetamine (10 mg/kg,ip) was given once daily till d 5 (continuous administration-regimen), and thereafter on d 8, 16, and 46 (intermittent administration regimen). Fo r stereotyped behavior and heightened startle response the observation period was 120 min after amphetamine application, and each animal was observed for 10 s in 5 min intervals. Pentadecapeptide BPC 157 (10 microg/kg or 10 ng/k g, ip) or saline (5.0 mL/kg, ip) were given only at the beginning of the experiment, simultaneously with the initial dose of amphetamine. In relation to applied initial-single/continuous/intermittent amphetamine applications regimen, the control amphetamine rats throughout the experiment showed the changes in stereotyped behavior and heightened startle response, increment or decrement, commonly explained in chronic amphetamine studies as tolerance and reverse tolerance. After t he initial application of the amphetamine, the higher BPC 157 dosage apparently attenuated the stereotyped behavior, while the lower dosage of BPC 157 did not reach a statistical significance. Considering the forthcoming amphetamine challenges, in the rats initially treated with pentadecapeptide BPC 157, either 10 microg- or 10 ng-dose, at the time of the first application of amphetamine, the stereotyped behavior remains to be attenuated after all additional amphetamine challenges (on d 2-5, 8, 16, and 46). This attenuation was not limited to stereotyped behavior only. After the initial application of the amphetamine the heighten ed startle response was also apparently

  3. Gastric pentadecapeptide BPC 157 and short bowel syndrome in rats.

    Science.gov (United States)

    Sever, Marko; Klicek, Robert; Radic, Bozo; Brcic, Luka; Zoricic, Ivan; Drmic, Domagoj; Ivica, Mihovil; Barisic, Ivan; Ilic, Spomenko; Berkopic, Lidija; Blagaic, Alenka Boban; Coric, Marijana; Kolenc, Danijela; Vrcic, Hrvoje; Anic, Tomislav; Seiwerth, Sven; Sikiric, Predrag

    2009-10-01

    The gastric pentadecapeptide BPC 157, which was shown to be safe as an antiulcer peptide in trials for inflammatory bowel disease (PL14736, Pliva), successfully healed intestinal anastomosis and fistula in rat. Therefore, we studied for 4 weeks rats with escalating short bowel syndrome and progressive weight loss after small bowel resection from fourth ileal artery cranially of ileocecal valve to 5 cm beneath pylorus. BPC 157 (10 microg/kg or 10 ng/kg) was given perorally, in drinking water (12 ml/rat/day) or intraperitoneally (once daily, first application 30 min following surgery, last 24 h before sacrifice). Postoperatively, features of increasingly exhausted presentation were: weight loss appearing immediately regardless of villus height, twofold increase in crypt depth and fourfold increase in muscle thickness within the first week, jejunal and ileal overdilation, and disturbed jejunum/ileum relation. In contrast, constant weight gain above preoperative values was observed immediately with BPC 157 therapy, both perorally and parenterally, and villus height, crypt depth, and muscle thickness [inner (circular) muscular layer] also increased, at 7, 14, 21, and 28 days. Moreover, rats treated with pentadecapeptide BPC 157 showed not different jejunal and ileal diameters, constant jejunum-to-ileum ratio, and increased anastomosis breaking strength. In conclusion, pentadecapeptide BPC 157 could be helpful to cure short bowel syndrome.

  4. Extensive genomic diversity and selective conservation of virulence-determinants in enterohemorrhagic Escherichia coli strains of O157 and non-O157 serotypes

    OpenAIRE

    Ogura, Yoshitoshi; Ooka, Tadasuke; Asadulghani,; Terajima, Jun; Nougayr?de, Jean-Philippe; Kurokawa, Ken; Tashiro, Kousuke; Tobe, Toru; Nakayama, Keisuke; Kuhara, Satoru; Oswald, Eric; Watanabe, Haruo; Hayashi, Tetsuya

    2007-01-01

    Background: Enterohemorrhagic Escherichia coli (EHEC) O157 causes severe food-borne illness in humans. The chromosome of O157 consists of 4.1 Mb backbone sequences shared by benign E. coli K-12, and 1.4 Mb O157-specific sequences encoding many virulence determinants, such as Shiga toxin genes (stx genes) and the locus of enterocyte effacement (LEE). Non-O157 EHECs belonging to distinct clonal lineages from O157 also cause similar illness in humans. According to the "parallel" evolution model,...

  5. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  6. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  7. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  8. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  9. Experimental Escherichia coli O157:H7 carriage in calves.

    OpenAIRE

    Brown, C A; Harmon, B G; Zhao, T; Doyle, M P

    1997-01-01

    Nine weaned calves (6 to 8 weeks of age) were given 10(10) CFU of a five-strain mixture of enterohemorrhagic Escherichia coli O157:H7 by oral-gastric intubation. After an initial brief period of pyrexia in three calves and transient mild diarrhea in five calves, calves were clinically normal throughout the 13- to 27-day study. The population of E. coli O157:H7 in the faces decreased dramatically in all calves during the first 2 weeks after inoculation. Thereafter, small populations of E. coli...

  10. Using Candida oleophila as a biocontriol agens to prevent foodborne Escherichia coli O157 EHEC infections

    OpenAIRE

    Wang, Yujian; Wei, An; Li, Hongyu

    2012-01-01

    Escherichia coli O157:H7 (EHEC O157) is a serious pathogen causing haemorrhagic colitis. In this study, inactivation kinetics of inoculated EHEC O157 and response of EHEC O157 in apple wounds by different concentrations of C. oleophila was investigated. The results presented in this study indicated that EHEC O157 could survive and grow in wounded ?Fuji? apples and extensively proliferate. Water as a decontaminant was ineffective in reducing EHEC O157 in wounded apples. C. oleophila could be a...

  11. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli

    OpenAIRE

    Ogura, Yoshitoshi; Ooka, Tadasuke; Iguchi, Atsushi; Toh, Hidehiro; Asadulghani, Md; Oshima, Kenshiro; Kodama, Toshio; Abe, Hiroyuki; Nakayama, Keisuke; Kurokawa, Ken; Tobe, Toru; Hattori, Masahira; Hayashi, Tetsuya

    2009-01-01

    Among the various pathogenic Escherichia coli strains, enterohemorrhagic E. coli (EHEC) is the most devastating. Although serotype O157:H7 strains are the most prevalent, strains of different serotypes also possess similar pathogenic potential. Here, we present the results of a genomic comparison between EHECs of serotype O157, O26, O111, and O103, as well as 21 other, fully sequenced E. coli/Shigella strains. All EHECs have much larger genomes (5.5–5.9 Mb) than the other strains and contain ...

  12. Phenotype abnormality: 157 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 157 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u663i decreased efficiency... in organ named root hair cell during process named growth ... root hair cell ... decreased efficiency ... growth ...

  13. Prevalence and antibiogram of Escherichia coli O157 isolated from ...

    African Journals Online (AJOL)

    Safty and immunogenic- ity of Escherichia coli O157 O-specific polysacaride conjugate. Christopher, A., Mshana, S. E, Kidenya, B. R, Hokororo, A. and Morona, D. 2013. Bac- teremia and resistant gram-negative pathogens among under-fives in Tanzania. Ital. J. Pediatr., 39, 27-34. Carney, E., O'Brien, S. B., Sheridan, J. J., ...

  14. 29 CFR 780.157 - Other transportation incident to farming.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Other transportation incident to farming. 780.157 Section... transportation incident to farming. (a) Transportation by a farmer or on a farm as an incident to or in conjunction with the farming operations of the farmer or of that farm is within the scope of agriculture even...

  15. 33 CFR 157.124 - COW tank washing machines.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false COW tank washing machines. 157....124 COW tank washing machines. (a) COW machines must be permanently mounted in each cargo tank. (b... allowed in paragraph (f) of this section, each cargo tank must have COW machines located to wash all...

  16. 27 CFR 9.157 - San Francisco Bay.

    Science.gov (United States)

    2010-04-01

    ..., San Mateo, Santa Clara, Alameda, and Contra Costa, which border the San Francisco Bay. The area also... proceed along the San Francisco, San Mateo, and Santa Cruz County shoreline (across the Quadrangles of San... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false San Francisco Bay. 9.157...

  17. 18 CFR 157.218 - Changes in customer name.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Changes in customer... Act for Certain Transactions and Abandonment § 157.218 Changes in customer name. (a) Automatic... reflect the change in the name of an existing customer, if the certificate holder has filed any necessary...

  18. Enterohaemorrhagic Escherichia coli O157: a current threat ...

    African Journals Online (AJOL)

    Enterohaemorrhagic. Escherichia coli O157: a survey of dairy cattle in. Tripoli, Libya' (1). The Libyan data presented by Ghen- ghesh et al. in the 1990s were based on the analysis of stool specimens from pediatric patients aged between only a ...

  19. 33 CFR 157.23 - Cargo and ballast system information.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Design, Equipment, and Installation § 157.23 Cargo and ballast system information. (a... automatic and manual operation of the cargo and ballast system in the vessel. (b) The format and information... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo and ballast system...

  20. BPC 157: The counteraction of succinylcholine, hyperkalemia, and arrhythmias.

    Science.gov (United States)

    Stambolija, Vasilije; Stambolija, Tamara Perleta; Holjevac, Jadranka Katancic; Murselovic, Tamara; Radonic, Jelena; Duzel, Viktor; Duplancic, Bozidar; Uzun, Sandra; Zivanovic-Posilovic, Gordana; Kolenc, Danijela; Drmic, Domagoj; Romic, Zeljko; Seiwerth, Sven; Sikiric, Predrag

    2016-06-15

    After the demonstration of its life-saving effect in severe hyperkalemia and the recovery of skeletal muscle after injury, pentadecapeptide BPC 157 has been shown to attenuate the local paralytic effect induced by succinylcholine, in addition to systemic muscle disability (and consequent muscle damage). Hyperkalemia, arrhythmias and a rise in serum enzyme values, were counteracted in rats. Assessments were made at 3 and 30min and 1, 3, 5, and 7 days after succinylcholine administration (1.0mg/kg into the right anterior tibial muscle). BPC 157 (10µg/kg, 10ng/kg) (given intraperitoneally 30min before or immediately after succinylcholine or per-orally in drinking water through 24h until succinylcholine administration) mitigated both local and systemic disturbances. BPC 157 completely eliminated hyperkalemia and arrhythmias, markedly attenuated or erradicated behavioral agitation, muscle twitches, motionless resting and completely eliminated post-succinylcholine hyperalgesia. BPC 157 immediately eliminated leg contractures and counteracted both edema and the decrease in muscle fibers in the diaphragm and injected/non-injected anterior tibial muscles. Therefore, the depolarizing neuromuscular blocker effects of succinylcholine were successfully antagonized. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. 38 CFR 17.157 - Definition-adaptive equipment.

    Science.gov (United States)

    2010-07-01

    ... MEDICAL Automotive Equipment and Driver Training § 17.157 Definition-adaptive equipment. The term... Health or designee as ordinarily necessary for any of the classes of losses or combination of such losses..., and special equipment necessary to assist the eligible person into or out of the automobile or other...

  2. 40 CFR 205.157-3 - Configuration identification.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Configuration identification. 205.157... identification. (a) A separate vehicle configuration shall be determined by each combination of the following parameters: (1) Exhaust system (engine): (i) Mufflers; (ii) expansion chambers; (iii) spark arrestors; and...

  3. Enterohaemorrhagic Escherichia coli O157: a survey of dairy cattle ...

    African Journals Online (AJOL)

    The zoonotic potential of enterohaemorrhagic. Escherichia coli (EHEC) subtype O157 represents a serious food-borne threat to human health. (1Б3). A common animal vector of this pathogen is cattle, and human cases of infection are frequently caused by ingesting food products contaminated with bacteria shed in the ...

  4. Gastric pentadecapeptide BPC 157 effective against serotonin syndrome in rats.

    Science.gov (United States)

    Boban Blagaic, Alenka; Blagaic, Vladimir; Mirt, Mirela; Jelovac, Nikola; Dodig, Goran; Rucman, Rudolf; Petek, Marijan; Turkovic, Branko; Anic, Tomislav; Dubovecak, Miroslav; Staresinic, Mario; Seiwerth, Sven; Sikiric, Predrag

    2005-04-11

    Serotonin syndrome commonly follows irreversible monoamine oxidase (MAO)-inhibition and subsequent serotonin (5-HT) substrate (in rats with fore paw treading, hind limbs abduction, wet dog shake, hypothermia followed by hyperthermia). A stable gastric pentadecapeptide BPC 157 with very safe profile (inflammatory bowel disease clinical phase II, PL-10, PLD-116, PL-14736, Pliva) reduced the duration of immobility to a greater extent than imipramine, and, given peripherally, has region specific influence on brain 5-HT synthesis (alpha-[14C]methyl-L-tryptophan autoradiographic measurements) in rats, different from any other serotonergic drug. Thereby, we investigate this peptide (10 microg, 10 ng, 10 pg/kg i.p.) in (i) full serotonin syndrome in rat combining pargyline (irreversible MAO-inhibition; 75 mg/kg i.p.) and subsequent L-tryptophan (5-HT precursor; 100 mg/kg i.p.; BPC 157 as a co-treatment), or (ii, iii) using pargyline or L-tryptophan given separately, as a serotonin-substrate with (ii) pargyline (BPC 157 as a 15-min posttreatment) or as a potential serotonin syndrome inductor with (iii) L-tryptophan (BPC 157 as a 15 min-pretreatment). In all experiments, gastric pentadecapeptide BPC 157 contrasts with serotonin-syndrome either (i) presentation (i.e., particularly counteracted) or (ii) initiation (i.e., neither a serotonin substrate (counteraction of pargyline), nor an inductor for serotonin syndrome (no influence on L-tryptophan challenge)). Indicatively, severe serotonin syndrome in pargyline + L-tryptophan rats is considerably inhibited even by lower pentadecapeptide BPC 157 doses regimens (particularly disturbances such as hyperthermia and wet dog shake thought to be related to stimulation of 5-HT2A receptors), while the highest pentadecapeptide dose counteracts mild disturbances present in pargyline rats (mild hypothermia, feeble hind limbs abduction). Thereby, in severe serotonin syndrome, gastric pentadecapeptide BPC 157 (alone, no behavioral or

  5. Stable gastric pentadecapeptide BPC 157-NO-system relation.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Turkovic, Branko; Rokotov, Dinko Stancic; Brcic, Luka; Sever, Marko; Klicek, Robert; Radic, Bozo; Drmic, Domagoj; Ilic, Spomenko; Kolenc, Danijela; Aralica, Gorana; Stupnisek, Mirjana; Suran, Jelena; Barisic, Ivan; Dzidic, Senka; Vrcic, Hrvoje; Sebecic, Bozidar

    2014-01-01

    We reviewed stable gastric pentadecapeptide BPC 157-NO-system-relation, its close participation in Moncada's (maintained vascular integrity, platelets control) homeostatic healing response of NO-system to injury. Namely, BPC 157's particular healing effect also affects all events after vascular integrity loss (dependent on circumstances, it reduces either thrombosis (abdominal aorta anastomosis) or bleeding/thrombocytopenia (amputation, heparin, warfarin, aspirin)) and in a series of different injurious models, acute and chronic, BPC 157 consistently advances healing after severe injuries in various tissues spontaneously unable to heal; stimulates egr-1 and naB2 genes; exhibits high safety (LD1 not achieved)). Hypothesis, that BPC 157 (since formed constitutively in the gastric mucosa, stable in human gastric juice, along with significance of NO-synthase and the basal formation of NO in stomach mucosa, greater than that seen in other tissues) exhibits a general, effective competing both with L-arginine analogues (i. e., L-NAME) and L-arginine, and that this has some physiologic importance (NO-generation), later, practically supports its beneficial effects illustrating BPC 157 and NOsystem mutual (with L-NAME/L-arginine; alone and together) relations in (i) gastric mucosa and mucosal protection, following alcohol lesions, in cytoprotection course, NO-generation, and blood pressure regulation; (ii) alcohol acute/chronic intoxication, and withdrawal; (iii) cardiovascular disturbances, chronic heart failure, pulmonary hypertension, and arrhythmias; (iv) disturbances after hypokalemia and hyperkalemia, and potassium-cell membrane dysfunction; and finally, in (v) complex healing failure, proved by the fistulas healing, colocutaneous and esophagocutaneous. However, how this advantage of modulating NO-system (i. e., particular effect on eNOS gene), may be practically translated into an enhanced clinical performance remains to be determined.

  6. Stable gastric pentadecapeptide BPC 157 heals rat colovesical fistula.

    Science.gov (United States)

    Grgic, Tihomir; Grgic, Dora; Drmic, Domagoj; Sever, Anita Zenko; Petrovic, Igor; Sucic, Mario; Kokot, Antonio; Klicek, Robert; Sever, Marko; Seiwerth, Sven; Sikiric, Predrag

    2016-06-05

    To establish the effects of BPC 157 on the healing of rat colovesical fistulas, Wistar Albino male rats were randomly assigned to different groups. BPC 157, a stable gastric pentadecapeptide, has been used in clinical applications-specifically, in ulcerative colitis-and was successful in treating both external and internal fistulas. BPC 157 was provided daily, perorally, in drinking water (10µg/kg, 12ml/rat/day) until sacrifice or, alternatively, 10µg/kg or 10ng/kg intraperitoneally, with the first application at 30min after surgery and the last at 24h before sacrifice. Controls simultaneously received an equivolume of saline (5.0ml/kg ip) or water only (12ml/rat/day). Assessment (i.e., colon and vesical defects, fistula leaking, fecaluria and defecation through the fistula, adhesions and intestinal obstruction as healing processes) took place on days 7, 14 and 28. Control colovesical fistulas regularly exhibited poor healing, with both of the defects persisting; continuous fistula leakage; fecaluria and defecation through the fistula; advanced adhesion formation; and intestinal obstruction. By contrast, BPC 157 given perorally or intraperitoneally and in µg- and ng-regimens rapidly improved the whole presentation, with both colon and vesical defects simultaneously ameliorated and eventually healed. The maximal instilled volume was continuously raised until it reached the values of healthy rats, there were no signs of fecaluria and no defecation through the fistula, there was counteraction of advanced adhesion formation or there was an intestinal obstruction. In conclusion, BPC 157 effects appear to be suited to inducing full healing of colocutaneous fistulas in rats. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  8. Comparison of Enterohemorrhagic Escherichia coli (EHEC) O157 and EHEC Non-O157 Isolates from Patients with Diarrhea in Korea.

    Science.gov (United States)

    Oh, Kyung-Hwan; Jung, Su-Mi; Shin, Eunkyung; Chung, Gyung Tae; Seong, Won-Keun; Cho, Seung-Hak

    2017-05-24

    We compared 47 enterohemorrhagic Escherichia coli (EHEC) O157 isolates with 184 EHEC non-O157 isolates from Korean patients with diarrhea. In the O157 group, the strains harboring both Shiga toxin genes (stx1 and stx2) were detected with highest frequency, whereas the strains harboring only stx1 gene were most frequently detected in the non-O157 group. Eight virulence genes (eaeA, hlyA, ehx, iha, efa1, tir, toxB, and espA) were found to show a higher frequency of occurrence in the O157 group than in the non-O157 group. In addition, the symptom of bloody diarrhea was exhibited at a higher rate in the O157 group (51.1%) than in the non-O157 group (16.8%). Our findings demonstrate that EHEC O157 strains are more frequently implicated in cases of bloody diarrhea in the Korean population than EHEC non-O157 strains.

  9. Colonization of the meat extracellular matrix proteins by O157 and non-O157 enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Chagnot, Caroline; Caccia, Nelly; Loukiadis, Estelle; Ganet, Sarah; Durand, Alexandra; Bertin, Yolande; Talon, Régine; Astruc, Thierry; Desvaux, Mickaël

    2014-10-01

    Enterohemorrhagic Escherichia coli (EHEC) are anthropozoonotic agents that range third among food-borne pathogens respective to their incidence and dangerousness in the European Union. EHEC are Shiga-toxin producing E. coli (STEC) responsible for foodborne poisoning mainly incriminated to the consumption of contaminated beef meat. Among the hundreds of STEC serotypes identified, EHEC mainly belong to O157:H7 but non-O157 can represent 20 to 70% of EHEC infections per year. Seven of those serogroups are especially of high-risk for human health, i.e. O26, O45, O103, O111, O121, O145 and O104. While meat can be contaminated all along the food processing chain, EHEC contamination essentially occurs at the dehiding stage of slaughtering. Investigating bacterial colonization to the skeletal-muscle extracellular matrix (ECM) proteins, it appeared that environmental factors influenced specific and non-specific bacterial adhesion of O157 and non-O157 EHEC as well as biofilm formation. Importantly, mechanical treatment (i.e. shaking, centrifugation, pipetting and vortexing) inhibited and biased the results of bacterial adhesion assay. Besides stressing the importance of the protocol to investigate bacterial adhesion to ECM proteins, this study demonstrated that the colonization abilities to ECM proteins vary among EHEC serogroups and should ultimately be taken into consideration to evaluate the risk of contamination for different types of food matrices. Copyright © 2014. Published by Elsevier B.V.

  10. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  11. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  12. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  13. 75 FR 56987 - Expansion of Foreign-Trade Zone 157, Casper, WY

    Science.gov (United States)

    2010-09-17

    ... Foreign-Trade Zones Board Expansion of Foreign-Trade Zone 157, Casper, WY Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as amended (19 U.S.C. 81a-81u), the Foreign-Trade Zones..., grantee of Foreign-Trade Zone 157, submitted an application to the Board for authority to expand FTZ 157...

  14. 27 CFR 25.157 - Determination of tax on bottled beer.

    Science.gov (United States)

    2010-04-01

    ... bottled beer. 25.157 Section 25.157 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Determination of Tax § 25.157 Determination of tax on bottled beer. The quantities of bottled beer removed subject to tax shall be computed to...

  15. 9 CFR 381.157 - Canned boned poultry and baby or geriatric food.

    Science.gov (United States)

    2010-01-01

    ... geriatric food. 381.157 Section 381.157 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE... Standards of Identity or Composition § 381.157 Canned boned poultry and baby or geriatric food. (a) Canned... with 25 percent broth.” (f) Poultry products intended for infant or geriatric use and represented as...

  16. 26 CFR 157.5891-1 - Imposition of excise tax on structured settlement factoring transactions.

    Science.gov (United States)

    2010-04-01

    ... settlement factoring transactions. 157.5891-1 Section 157.5891-1 Internal Revenue INTERNAL REVENUE SERVICE... SETTLEMENT FACTORING TRANSACTIONS Tax on Structured Settlement Factoring Transactions § 157.5891-1 Imposition of excise tax on structured settlement factoring transactions. (a) In general. Section 5891 imposes...

  17. Meeting the challenges of 157-nm microstepper technology

    Science.gov (United States)

    Yamabe, Osamu; Uchida, Noboru; Itani, Toshiro

    2002-07-01

    For the aim of fabricating next-generation semiconductor devices, researchers are now attempting to enhance 157-nm lithography so as to achieve 70-nm node level various circuit designs. Many of the challenges for 157-nm technology such as contamination and purge control, calcium fluoride intrinsic birefringence, finding resists with suitable performance characteristics, have been performed. The major challenge, in terms of stability of tool performance, has been the apparent accumulation of contamination on the bottom of the objective. This has been evidenced by a reduction in resolution performance and an increase in the non-uniformity of the illumination intensity across the image plane. Uniformity over the entire imaging field has increased from 0.58% to as much as 18.5% through the use of the tool. This paper reports our demonstration that loss of uniformity due to contamination from resist outgassing can be reversed by cleaning the bottom surface of the lens of 157-nm microstepper (Ultratech Stepper Inc.) in- situ using 157-nm light and a small concentration of O2 in the N2 purging for exposure area. With an in-situ oxygen (O2) and vacuum ultra violet (VUV) cleaning, the uniformity of over the full imaging field has been improved from 18.5% to 6.0%. The edges of the imaging field do not recover as well during a cleaning as the center of the field, as the central 0.5 mm diameter of the field uniformity has been improved to more or less 2.0%. The procedure of this in-situ O2 cleaning will also be introduced, and in addition to this in-situ O2 cleaning, some recent results in system performance will be shown and many of these challenges will be discussed.

  18. Stable gastric pentadecapeptide BPC 157 heals rectovaginal fistula in rats.

    Science.gov (United States)

    Baric, Marko; Sever, Anita Zenko; Vuletic, Lovorka Batelja; Rasic, Zarko; Sever, Marko; Drmic, Domagoj; Pavelic-Turudic, Tatjana; Sucic, Mario; Vrcic, Hrvoje; Seiwerth, Sven; Sikiric, Predrag

    2016-03-01

    Rectovaginal fistula is a devastating condition providing more than 99% of patients for surgical treatment. We hypothesized that rectovaginal fistula may be healed by therapy with stable gastric pentadecapeptide BPC 157, in consistence with its initial clinical application and effect on external fistulas. BPC 157 (10μg/kg or 10ng/kg) was given perorally, in drinking water (0.16μg/ml or 0.16ng/ml, 12ml/rat/day) till sacrifice, or alternatively, intraperitoneally, first application at 30min after surgery, last at 24h before sacrifice. Controls simultaneously received an equivolume of saline (5.0ml/kg ip) or water only (12ml/rat/day). The assessment (i.e., rectal and vaginal defect, fistula leakage, defecation through the fistula, adhesions and intestinal obstruction as healing processes) was at day 1, 3, 5, 7, 10, 14 and 21. Regularly, rectovaginal fistulas exhibited poor healing, with both of the defects persisting, continuous fistula leakage, defecation through the fistula, advanced adhesion formation and intestinal obstruction. By contrast, BPC 157 given perorally or intraperitoneally, in μg- and ng-regimens rapidly improved the whole presentation, with both rectal and vaginal defects simultaneously ameliorated and eventually healed. The maximal instilled volume was continuously raised till the values of healthy rats were achieved, there were no signs of defecation through the fistula. A counteraction of advanced adhesion formation and intestinal obstruction was achieved. Microscopic improvement was along with macroscopic findings. BPC 157 effects appear to be suited to induce a full healing of rectovaginal fistulas in rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Peptide therapy with pentadecapeptide BPC 157 in traumatic nerve injury.

    Science.gov (United States)

    Gjurasin, Miroslav; Miklic, Pavle; Zupancic, Bozidar; Perovic, Darko; Zarkovic, Kamelija; Brcic, Luka; Kolenc, Danijela; Radic, Bozo; Seiwerth, Sven; Sikiric, Predrag

    2010-02-25

    We focused on the healing of rat transected sciatic nerve and improvement made by stable gastric pentadecapeptide BPC 157 (10 microg, 10ng/kg) applied shortly after injury (i) intraperitoneally/intragastrically/locally, at the site of anastomosis, or after (ii) non-anastomozed nerve tubing (7 mm nerve segment resected) directly into the tube. Improvement was shown clinically (autotomy), microscopically/morphometrically and functionally (EMG, one or two months post-injury, walking recovery (sciatic functional index (SFI)) at weekly intervals). BPC 157-rats exhibited faster axonal regeneration: histomorphometrically (improved presentation of neural fascicles, homogeneous regeneration pattern, increased density and size of regenerative fibers, existence of epineural and perineural regeneration, uniform target orientation of regenerative fibers, and higher proportion of neural vs. connective tissue, all fascicles in each nerve showed increased diameter of myelinated fibers, thickness of myelin sheet, number of myelinated fibers per area and myelinated fibers as a percentage of the nerve transected area and the increased blood vessels presentation), electrophysiologically (increased motor action potentials), functionally (improved SFI), the autotomy absent. Thus, BPC 157 markedly improved rat sciatic nerve healing. Copyright 2009 Elsevier B.V. All rights reserved.

  20. Focus on ulcerative colitis: stable gastric pentadecapeptide BPC 157.

    Science.gov (United States)

    Sikiric, P; Seiwerth, S; Rucman, R; Turkovic, B; Rokotov, D S; Brcic, L; Sever, M; Klicek, R; Radic, B; Drmic, D; Ilic, S; Kolenc, D; Stambolija, V; Zoricic, Z; Vrcic, H; Sebecic, B

    2012-01-01

    Stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, M.W. 1419) may be the new drug stable in human gastric juice, effective both in the upper and lower GI tract, and free of side effects. BPC 157, in addition to an antiulcer effect efficient in therapy of inflammatory bowel disease (IBD) (PL 14736) so far only tested in clinical phase II, has a very safe profile, and exhibited a particular wound healing effect. It also has shown to interact with the NO-system, providing endothelium protection and angiogenic effect, even in severely impaired conditions (i.e., it stimulated expression of early growth response 1 gene responsible for cytokine and growth factor generation and early extracellular matrix (collagen) formation (but also its repressor nerve growth factor 1-A binding protein-2)), important to counteract severe complications of advanced and poorly controlled IBD. Hopefully, the lessons from animal studies, particularly advanced intestinal anastomosis healing, reversed short bowel syndrome and fistula healing indicate BPC 157's high significance in further IBD therapy. Also, this supportive evidence (i.e., no toxic effect, limit test negative, LD1 not achieved, no side effect in trials) may counteract the problems commonly exercised in the use of peptidergic agents, particularly those used on a long-term basis.

  1. Estimating true incidence of O157 and non-O157 Shiga toxin-producing Escherichia coli illness in Germany based on notification data of haemolytic uraemic syndrome

    NARCIS (Netherlands)

    Kuehne, A; Bouwknegt, M; Havelaar, A|info:eu-repo/dai/nl/072306122; Gilsdorf, A; Hoyer, P; Stark, K; Werber, D

    2016-01-01

    Shiga toxin-producing Escherichia coli (STEC) is an important cause of gastroenteritis (GE) and haemolytic uraemic syndrome (HUS). Incidence of STEC illness is largely underestimated in notification data, particularly of serogroups other than O157 ('non-O157'). Using HUS national notification data

  2. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  3. Antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli O157 and Non-O157 recovered from domestic farm animals in rural communities in Northwestern Mexico

    Directory of Open Access Journals (Sweden)

    Bianca A. Amézquita-López

    2016-01-01

    Full Text Available Abstract Background Antimicrobial resistance in Shiga toxin-producing Escherichia coli (STEC O157 and non-O157 is a matter of increasing concern. The aim of the present study was to investigate the antimicrobial resistance profiles of STEC O157 and non-O157 recovered from feces of domestic farm animals in the agricultural Culiacan Valley in Northwestern Mexico. Findings All of the examined STEC strains showed susceptibility to five antimicrobials, ceftazidime, ceftriaxone, ciprofloxacin, nalidixic acid, and trimethoprim-sulfamethoxazole. However, resistance to the four antimicrobials, ampicillin, cephalothin, chloramphenicol, and kanamycin was commonly observed. Interestingly, non-susceptibility to cephalothin was predominant among the examined STEC strains, corresponding to 85 % (22/26 of the O157:H7 from cattle, sheep and chicken and 73 % (24/33 of the non-O157 strains from cattle and sheep. Statistical analyses revealed that resistance to ampicillin was significantly correlated to 38 % (10/26 of STEC O157:H7 strains from multiple animal sources. Another significant correlation was found between serotype, source, and antimicrobial resistance; all of the O20:H4 strains, recovered from sheep, were highly resistant to tetracycline. Multidrug resistance profiles were identified in 42 % (22/53 of the non-susceptible STEC strains with clinically-relevant serotypes O8:H9, O75:H8, O146:H21, and O157:H7. Conclusions STEC O157 and non-O157 strains, recovered from domestic farm animals in the Culiacan Valley, exhibited resistance to classes of antimicrobials commonly used in Mexico, such as aminoglycosides, tetracyclines, cephalosporins and penicillin but were susceptible to fluoroquinolones, quinolones, and sulfonamides. These findings provide fundamental information that would aid in the surveillance of antimicrobial resistance in an important agricultural region in Northwestern Mexico.

  4. Traumatic brain injury in mice and pentadecapeptide BPC 157 effect.

    Science.gov (United States)

    Tudor, Mario; Jandric, Ivan; Marovic, Anton; Gjurasin, Miroslav; Perovic, Darko; Radic, Bozo; Blagaic, Alenka Boban; Kolenc, Danijela; Brcic, Luka; Zarkovic, Kamelija; Seiwerth, Sven; Sikiric, Predrag

    2010-02-25

    Gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, an anti-ulcer peptide, efficient in inflammatory bowel disease trials (PL 14736), no toxicity reported, improved muscle crush injury. After an induced traumatic brain injury (TBI) in mice by a falling weight, BPC 157 regimens (10.0microg, 10.0ng/kgi.p.) demonstrated a marked attenuation of damage with an improved early outcome and a minimal postponed mortality throughout a 24h post-injury period. Ultimately, the traumatic lesions (subarachnoidal and intraventricular haemorrhage, brain laceration, haemorrhagic laceration) were less intense and consecutive brain edema had considerably improved. Given prophylactically (30 min before TBI) the improved conscious/unconscious/death ratio in TBI-mice was after force impulses of 0.068 Ns, 0.093 Ns, 0.113 Ns, 0.130 Ns, 0.145 Ns, and 0.159 Ns. Counteraction (with a reduction of unconsciousness, lower mortality) with both microg- and ng-regimens included the force impulses of 0.068-0.145 Ns. A higher regimen presented effectiveness also against the maximal force impulse (0.159 Ns). Furthermore, BPC 157 application immediately prior to injury was beneficial in mice subjected to force impulses of 0.093 Ns-TBI. For a more severe force impulse (0.130 Ns, 0.145 Ns, or 0159 Ns), the time-relation to improve the conscious/unconscious/death ratio was: 5 min (0.130 Ns-TBI), 20 min (0.145 Ns-TBI) or 30 min (0.159 Ns-TBI). Copyright 2009 Elsevier B.V. All rights reserved.

  5. Photon Strength Functions for ^156, 157, 159Gd

    Science.gov (United States)

    Baramsai, Bayarbadrakh; Mitchell, G. E.; Chyzh, A.; Dashdorj, D.; Walker, C.; Bredeweg, T. A.; Couture, A.; Haight, R. C.; Jandel, M.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Wouters, J. M.; Ullmann, J. L.; Vieira, D. J.; Agvaanluvsan, U.; Becvar, F.; Krticka, M.

    2010-11-01

    In recent years the low energy behavior of the Photon Strength Function (PSF) has attracted much attention. A completely consistent description of this behavior is not available. The neutron capture γ-ray spectra measured by the DANCE detector array located at the Los Alamos Neutron Science Center has been used for the study of the PSF below the neutron separation energy. The radiative decay of the compound nuclei ^156, 157, 159Gd has been measured. The spectra were simulated with the DICEBOX code. A variety of phenomenological models of the PSF were considered in the simulations. Comparison of the experimental and simulated spectra will be presented.

  6. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Science.gov (United States)

    2010-01-01

    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  7. Modulatory effect of gastric pentadecapeptide BPC 157 on angiogenesis in muscle and tendon healing.

    Science.gov (United States)

    Brcic, L; Brcic, I; Staresinic, M; Novinscak, T; Sikiric, P; Seiwerth, S

    2009-12-01

    Angiogenesis is a natural and complex process controlled by angiogenic and angiostatic molecules, with a central role in healing process. One of the most important modulating factors in angiogenesis is the vascular endothelial growth factor (VEGF). Pentadecapeptide BPC 157 promotes healing demonstrating particular angiogenic/angiomodulatory potential. We correlated the angiogenic effect of BPC 157 with VEGF expression using in vitro (cell culture) and in vivo (crushed muscle and transected muscle and tendon) models. Results revealed that there is no direct angiogenic effect of BPC 157 on cell cultures. On the other hand, immunohistochemical analysis of muscle and tendon healing using VEGF, CD34 and FVIII antibodies showed adequately modulated angiogenesis in BPC 157 treated animals, resulting in a more adequate healing. Therefore the angiogenic potential of BPC 157 seems to be closely related to the healing process in vivo with BPC 157 stimulating angiogenesis by up-regulating VEGF expression.

  8. Effect of heat treatment on the survival of Escherichia Coli O157:H7 ...

    African Journals Online (AJOL)

    The survival of Escherichia coli O157:H7 in raw milk treated in experimental pasteurizer was investigated in the year 2010. Raw milk was inoculated with different initial concentrations of E. coli O157:H7 and heated for 15 seconds at temperatures ranging from 69OC to 73OC. E. coli O157:H7 cells were not isolated from the ...

  9. Culture confirmation of Escherichia coli serotype O157:H7 by direct immunofluorescence.

    OpenAIRE

    Tison, D L

    1990-01-01

    An evaluation of a fluorescein-labeled, polyclonal, affinity-purified goat antibody to Escherichia coli serotype O157:H7 (Kirkegaard & Perry Laboratories Inc., Gaithersburg, Md.) was conducted to determine the efficacy of this research reagent for the rapid direct immunofluorescence identification of E. coli O157:H7 isolated from fecal specimens cultured on sorbitol-MacConkey (SMAC) agar. The E. coli O157:H7 fluorescent-antibody conjugate proved to be 100% sensitive and specific for the rapid...

  10. Prevalence of Escherichia coli O157:H7 in Gallbladders of Beef Cattle▿ †

    OpenAIRE

    Reinstein, S.; Fox, J. T.; Shi, X.; Nagaraja, T. G.

    2006-01-01

    Gallbladders and rectal contents were collected from cattle (n = 933) at slaughter to determine whether the gallbladder harbors Escherichia coli O157:H7. Both gallbladder mucosal swabs and homogenized mucosal tissues were used for isolation. Only five gallbladders (0.54%) were positive for E. coli O157:H7. Fecal prevalence averaged 7.1%; however, none of the cattle that had E. coli O157:H7 in the gallbladder was positive for E. coli O157:H7 in feces. Therefore, the gallbladder does not appear...

  11. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  12. Identification of Protozoa in Dairy Lagoon Wastewater that Consume Escherichia coli O157:H7 Preferentially

    Science.gov (United States)

    Ravva, Subbarao V.; Sarreal, Chester Z.; Mandrell, Robert E.

    2010-01-01

    Escherichia coli O157:H7 (EcO157), an agent of life threatening hemolytic-uremic syndrome, resides in ruminants and is released in feces at numbers as high as 10 million cells/gram. EcO157 could survive in manure for as long as 21 months, but we observed a 90% decrease in cells of an outbreak strain of EcO157 within half a day in wastewater from dairy lagoons. Although chemical, environmental and biological factors may be responsible for this decrease, we observed an 11-fold increase in native protozoa when wastewater was re-inoculated with 2×107 cells of EcO157/mL. These protozoa engulfed the green fluorescent protein labeled EcO157 within 2 hours after inoculation, but expelled vacuoles filled with live EcO157 cells within 3 days into surrounding wastewater, whereas other protozoa retained the EcO157-filled vacuoles for 7 days. EcO157 was not detected by confocal microscopy either inside or outside protozoa after 7 days. Mixed cultures of protozoa enriched from wastewater consumed EcO157 preferentially as compared to native aerobic bacteria, but failed to eliminate them when EcO157 cells declined to 104/mL. We isolated three protozoa from mixed cultures and typed them by 18S sequencing as Vorticella microstoma, Platyophyra sp. and Colpoda aspera. While all three protozoa internalized EcO157, only Platyophyra and Colpoda acted as predators. Similar to mixed cultures, these protozoa failed to eliminate EcO157 from PBS containing no other supplemental nutrients or prey. However, spiking PBS with cereal grass medium as nutrients induced predation of EcO157 by Platyophyra sp. after 3 days or enhanced predation by Colpoda after 5 days. Therefore, attempts to enrich protozoa to decrease EcO157 from dairy lagoons, may correspond to an increase in protozoa similar to Vorticella and possibly facilitate transport of bacterial pathogens to food crops grown in proximity. PMID:21187934

  13. Inhibition of methyldigoxin-induced arrhythmias by pentadecapeptide BPC 157: a relation with NO-system.

    Science.gov (United States)

    Balenovic, Dijana; Bencic, Martina Lovric; Udovicic, Mario; Simonji, Karol; Hanzevacki, Jadranka Separovic; Barisic, Ivan; Kranjcevic, Stjepan; Prkacin, Ingrid; Coric, Vedran; Brcic, Luka; Coric, Marijana; Brcic, Iva; Borovic, Suzana; Radic, Bozo; Drmic, Domagoj; Vrcic, Hrvoje; Seiwerth, Sven; Sikiric, Predrag

    2009-08-07

    Pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, MW 1419) reversed congestive heart failure and various arrhythmias, influenced the NO-system and showed no proarrhythmic effect. In therapy analogy, we challenged rats with digitalis, to show attenuation by BPC 157 and the relation between the NO-system and digitalis toxicity. (i). BPC 157 prophylactic effect. Development of cumulative intravenous digitalis toxicity, BPC 157 (50 microg, 10 microg, 10 ng/kg applied intravenously immediately before a methyldigoxin increment regimen (2.0/1.5/1.5/1.0 mg/kg at 15 min-intervals, total dose 6.0 mg/kg/45 min)) reduced the number of ventricular premature beats, prolonged the time before onset of ventricular tachycardia, reduced ventricular tachycardia and AV-block duration (microg-regimes) or reduced mainly the AV-block duration (ng-regimen). (ii). BPC 157 therapy. Advanced methyldigoxin toxicity (6.0 mg/kg i.v. bolus). BPC 157 applied at the 20th second of the grade 3 AV-block shortened AV-blocks, mitigated a further digitalis toxicity course. Ventricular tachycardias were either avoided (50 microg), or markedly reduced (10 microg, 10 ng). Fatal outcome was either avoided (50 microg), reduced (10 microg), or only delayed (10 ng) (iii) BPC 157, L-NAME, l-arginine, L-NAME+l-arginine application. L-NAME-application (5 mg/kg i.p.) aggravated methyldigoxin-arrhythmias. l-arginine (200 mg/kg i.p.) alone had no effect but blunted L-NAME-exaggeration (L-NAME+l-arginine). In this respect, BPC 157 (50 microg/kg i.p.) was prophylactically and therapeutically more effective: the antagonism of L-NAME with BPC 157 produced an effect similar to BPC 157 alone. In conclusion, digitalis-induced arrhythmias in rats could be prevented and counteracted by pentadecapeptide BPC 157, mainly through an interaction with the NO-system.

  14. Protective effects of pentadecapeptide BPC 157 on gastric ulcer in rats.

    Science.gov (United States)

    Xue, Xiao-Chang; Wu, Yong-Jie; Gao, Ming-Tang; Li, Wen-Guang; Zhao, Ning; Wang, Zeng-Lu; Bao, Chun-Jie; Yan, Zhen; Zhang, Ying-Qi

    2004-04-01

    To investigate the protective effects of gastric pentadecapeptide BPC 157 on acute and chronic gastric ulcers in rats and to compare the results in therapy of human gastric ulcers by different administration methods. Gastric pentadecapeptide BPC 157 was administered (initial single or continuous administration) into rats either intragastrically or intramuscularly before (induced acute gastric ulcer) or after (induced chronic gastric ulcer) the applications of inducing agents, and each animal was sacrificed to observe the protective effects of BPC 157 on gastric ulcers. Both intramuscular (im) and intragastric (ig) administration of BPC 157 could apparently reduce the ulcer area and accelerate the healing of induced ulcer in different models and the effect of im administered BPC 157 was better than that of ig. The rats treated with higher dosages (400 ng/kg, 800 ng/kg) of BPC 157 (im and ig) showed significantly less lesion (PBPC 157 in pylorus ligation induced model (PBPC 157) in three models, the inhibition ratio of ulcer formation was 65.5%, 65.6% and 59.9%, respectively, which was better than that of famotidine (its inhibition rate was 60.8%, 57.2% and 34.3%, respectively). Continuous application of BPC 157 (in chronic acetate induced gastric ulcer) could accelerate rebuilding of glandular epithelium and formation of granulation tissue (PBPC 157 can apparently ameliorate acute gastric ulcer in rats and antagonize the protracted effect of acetate challenge on chronic ulcer. The effect of im administration of BPC 157 is better than that of ig, and the effective dosage of the former is lower than that of the latter.

  15. PCR and ELISA (VIDAS ECO O157®) Escherichia coli O157:H7 identification in Minas Frescal cheese commercialized in Goiânia, GO

    Science.gov (United States)

    Carvalho, Rosangela Nunes; de Oliveira, Antonio Nonato; de Mesquita, Albenones José; Minafra e Rezende, Cíntia Silva; de Mesquita, Adriano Queiroz; Romero, Rolando Alfredo Mazzoni

    2014-01-01

    Escherichia coli O157:H7 has been incriminated in food poisoning outbreaks and sporadic cases of hemorrhagic colitis and hemolytic uremic syndrome in many countries. Considering the high susceptibility of Minas Frescal cheese to contamination by E. coli O157:H7, the aim of this study was to determine the occurrence of this pathogen through PCR (Polymerase Chain Reaction) and ELISA (VIDAS ECO O157®, bioMérieux, Lyon, France) test. Thirty cheese samples manufactured by artisan farmhouse producers were collected from open-air markets in Goiânia and thirty from industries under Federal Inspection located in Goiás State which trade their products in supermarkets in Goiânia. E. coli O157:H7 was detected in 6.67% samples collected in open air markets using ELISA, and 23,33% with PCR. The pathogen was not detected in samples from industries under Federal Inspection. PMID:24948907

  16. PCR and ELISA (VIDAS ECO O157® Escherichia coli O157:H7 identification in Minas Frescal cheese commercialized in Goiânia, GO

    Directory of Open Access Journals (Sweden)

    Rosangela Nunes Carvalho

    2014-01-01

    Full Text Available Escherichia coli O157:H7 has been incriminated in food poisoning outbreaks and sporadic cases of hemorrhagic colitis and hemolytic uremic syndrome in many countries. Considering the high susceptibility of Minas Frescal cheese to contamination by E. coli O157:H7, the aim of this study was to determine the occurrence of this pathogen through PCR (Polymerase Chain Reaction and ELISA (VIDAS ECO O157®, bioMérieux, Lyon, France test. Thirty cheese samples manufactured by artisan farmhouse producers were collected from open-air markets in Goiânia and thirty from industries under Federal Inspection located in Goiás State which trade their products in supermarkets in Goiânia. E. coli O157:H7 was detected in 6.67% samples collected in open air markets using ELISA, and 23,33% with PCR. The pathogen was not detected in samples from industries under Federal Inspection.

  17. Problems in classical electromagnetism 157 exercises with solutions

    CERN Document Server

    Macchi, Andrea; Pegoraro, Francesco

    2017-01-01

    This book contains 157 problems in classical electromagnetism, most of them new and original compared to those found in other textbooks. Each problem is presented with a title in order to highlight its inspiration in different areas of physics or technology, so that the book is also a survey of historical discoveries and applications of classical electromagnetism. The solutions are complete and include detailed discussions, which take into account typical questions and mistakes by the students. Without unnecessary mathematical complexity, the problems and related discussions introduce the student to advanced concepts such as unipolar and homopolar motors, magnetic monopoles, radiation pressure, angular momentum of light, bulk and surface plasmons, radiation friction, as well as to tricky concepts and ostensible ambiguities or paradoxes related to the classical theory of the electromagnetic field. With this approach the book is both a teaching tool for undergraduates in physics, mathematics and electric engine...

  18. 10 CFR 52.157 - Contents of applications; technical information in final safety analysis report.

    Science.gov (United States)

    2010-01-01

    ...; technical information in final safety analysis report. The application must contain a final safety analysis... 10 Energy 2 2010-01-01 2010-01-01 false Contents of applications; technical information in final safety analysis report. 52.157 Section 52.157 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES...

  19. 21 CFR 133.157 - Part-skim mozzarella and scamorza cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Part-skim mozzarella and scamorza cheese. 133.157... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.157 Part-skim mozzarella and scamorza cheese. Part-skim...

  20. Antibacterial activity of cinnamaldehyde and Sporan against Escherichia coli O157:H7 and Salmonella

    Science.gov (United States)

    The in vitro antimicrobial effect of cinnamaldehyde and Sporan in combination with acetic acid against E. coli O157:H7 and Salmonella was investigated. A five strain cocktail of E. coli O157:H7 and Salmonella were inoculated in Luria-Bertoni broth (LB broth, 7 log CFU ml-1) containing cinnamaldehyde...

  1. Internalization of E. coli O157:H7 in spinach cultivated in soil and hydroponic media

    Science.gov (United States)

    Introduction: Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. Previous studies that have investigated uptake of E. coli O157:H7 into leafy greens have expressed green fluorescent protein (gfp) from a plasmid, possibly limiting detecti...

  2. 40 CFR 65.157 - Performance test and flare compliance determination requirements.

    Science.gov (United States)

    2010-07-01

    ... determination requirements. 65.157 Section 65.157 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... requirements. (a) Performance tests and flare compliance determinations. Where §§ 65.145 through 65.155 require... halogen reduction device, or a compliance determination for a flare, the requirements of paragraphs (b...

  3. Occurrence of Escherichia coli O157 in a river used for fresh ...

    African Journals Online (AJOL)

    PRECIOUS

    2010-01-11

    Jan 11, 2010 ... Key words: Escherichia coli O157, contamination, irrigation water, nitrate, fresh produce, surface waters. INTRODUCTION. Escherichia coli O157 is an important agent of food- and water-borne illnesses in humans globally (Chalmers et al., 2000; Bettelheim and Beutin, 2003; Duffy, 2003). The first reported ...

  4. 18 CFR 157.212 - Synthetic and liquefied natural gas facilities.

    Science.gov (United States)

    2010-04-01

    ... natural gas facilities. 157.212 Section 157.212 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES... 7 OF THE NATURAL GAS ACT Interstate Pipeline Blanket Certificates and Authorization Under Section 7...

  5. Diet, fecal microbiome and Escherichia coli O157:H7 shedding in beef Cattle

    Science.gov (United States)

    Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7, and in cattle the terminal gastrointestinal tra...

  6. Diet, Escherichia coli O157:H7, and cattle: A review after 10 years

    Science.gov (United States)

    Escherichia coli are commensal bacteria that can account for up to 1% of the bacterial population of the gut. Ruminant animals are reservoirs of the pathogenic bacteria E. coli O157:H7, and approximately 30% of feedlot cattle shed E. coli O157:H7. Feedlot and high-producing dairy cattle are fed hi...

  7. Escherichia coli O157:H7, diet, and fecal microbiome in beef cattle

    Science.gov (United States)

    Shiga-toxigenic Escherichia coli, such as E. coli O157:H7, are foodborne zoonotic pathogens that can cause severe illness and death in humans. The gastrointestinal tract of ruminant animals has been identified as a primary habitat for E. coli O157:H7, and in cattle the terminal gastrointestinal tra...

  8. 17 CFR 1.57 - Operations and activities of introducing brokers.

    Science.gov (United States)

    2010-04-01

    ... introducing brokers. 1.57 Section 1.57 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION... introducing brokers. (a) Each introducing broker must: (1) Open and carry each customer's and option customer..., That an introducing broker which has entered into a guarantee agreement with a futures commission...

  9. Impact of Vacuum Cooling on Escherichia coli O157:H7 Infiltration into Lettuce Tissue▿

    Science.gov (United States)

    Li, Haiping; Tajkarimi, Mehrdad; Osburn, Bennie I.

    2008-01-01

    Vacuum cooling is a common practice in the California leafy green industry. This study addressed the impact of vacuum cooling on the infiltration of Escherichia coli O157:H7 into lettuce as part of the risk assessment responding to the E. coli O157:H7 outbreaks associated with leafy green produce from California. Vacuum cooling significantly increased the infiltration of E. coli O157:H7 into the lettuce tissue (2.65E+06 CFU/g) compared to the nonvacuumed condition (1.98E+05 CFU/g). A stringent surface sterilization and quadruple washing could not eliminate the internalized bacteria from lettuce. It appeared that vacuuming forcibly changed the structure of lettuce tissue such as the stomata, suggesting a possible mechanism of E. coli O157:H7 internalization. Vacuuming also caused a lower reduction rate of E. coli O157:H7 in stored lettuce leaves than that for the nonvacuumed condition. PMID:18344328

  10. Current trends in detecting non-O157 Shiga toxin-producing Escherichia coli in food.

    Science.gov (United States)

    Wang, Fei; Yang, Qianru; Kase, Julie A; Meng, Jianghong; Clotilde, Laurie M; Lin, Andrew; Ge, Beilei

    2013-08-01

    Non-O157 Shiga toxin-producing Escherichia coli (non-O157 STEC) strains are increasingly recognized as important foodborne pathogens worldwide. Together with E. coli O157:H7, six additional STEC serogroups (O26, O45, O103, O111, O121, and O145) are now regulated as adulterants in certain raw beef products in the United States. However, effective detection and isolation of non-O157 STEC strains from food matrices remain challenging. In the past decade, great attention has been paid to developing rapid and reliable detection methods for STEC in general (targeting common virulence factors) and specific STEC serogroups in particular (targeting serogroup-specific traits). This review summarizes current trends in detecting non-O157 STEC in food, including culture, immunological, and molecular methods, as well as several novel technologies.

  11. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  12. Changes in Gene Transcription Induced by Hydrogen Peroxide Treatment of Verotoxin-Producing Escherichia coli O157:H7 and Non-O157 Serotypes on Romaine Lettuce.

    Science.gov (United States)

    Mei, Gui-Ying; Tang, Joshua; Bach, Susan; Kostrzynska, Magdalena

    2017-01-01

    Disease outbreaks of verotoxin-producing Escherichia coli (VTEC) O157:H7 and non-O157 serotypes associated with leafy green vegetables are becoming a growing concern. A better understanding of the behavior of VTEC, particularly non-O157 serotypes, on lettuce under stress conditions is necessary for designing more effective control strategies. Hydrogen peroxide (H2O2) can be used as a sanitizer to reduce the microbial load in leafy green vegetables, particularly in fresh produce destined for the organic market. In this study, we tested the hypothesis that H2O2 treatment of contaminated lettuce affects in the same manner transcription of stress-associated and virulence genes in VTEC strains representing O157 and non-O157 serotypes. Six VTEC isolates representing serotypes O26:H11, O103:H2, O104:H4, O111:NM, O145:NM, and O157:H7 were included in this study. The results indicate that 50 mM H2O2 caused a population reduction of 2.4-2.8 log10 (compared to non-treated control samples) in all six VTEC strains present on romaine lettuce. Following the treatment, the transcription of genes related to oxidative stress (oxyR and sodA), general stress (uspA and rpoS), starvation (phoA), acid stress (gadA, gadB, and gadW), and virulence (stx1A, stx2A, and fliC) were dramatically downregulated in all six VTEC serotypes (P ≤ 0.05) compared to not treated control samples. Therefore, VTEC O157:H7 and non-O157 serotypes on lettuce showed similar survival rates and gene transcription profiles in response to 50 mM H2O2 treatment. Thus, the results derived from this study provide a basic understanding of the influence of H2O2 treatment on the survival and virulence of VTEC O157:H7 and non-O157 serotypes on lettuce.

  13. Modulation of CD157 expression in multi-lineage myeloid differentiation of promyelocytic cell lines.

    Science.gov (United States)

    Hussain, A M; Lee, H C; Chang, C F

    2000-10-01

    CD157/BST-1 is expressed on mature myeloid cells but not on their precursors in vivo. Also CD38, a homologous gene to CD157, is upregulated in promyelocytic HL-60 cells by the monocyte and granulocyte differentiation-inducing 1alpha,25dihydroxyvitamin D3 (VD3) and all-trans retinoic acid (ATRA), respectively. We have examined whether CD157 expression is upregulated when the promyeloid HL-60 and/or U937 cells are induced to differentiate into mature phenotypes in vitro. VD3 treatment irreversibly upregulated the expression of CD157 in HL-60 cells but not in U937 cells in a time- and concentration-dependent manner when analyzed by flow cytometry, immunoblotting and/or RT-PCR. Different monocyte and granulocyte lineage inducers induced CD157 expression to varying extents while the macrophage differentiation-inducing phorbol 12-myristate 13-acetate (PMA) induced its down-regulation. Time-kinetics of VD3 treatment of HL-60 cells showed that the appearance of CD157 and CD11b (a differentiation marker) antigens were not substantial up to 24 hours but increased subsequently although the appearance of CD38 became significant within 6 hours. Two-color staining of VD3-treated HL-60 cells displayed an apparently linear correlation between CD157 and CD11b expression. Dibutyryl cAMP (cAMP agonist) and forskolin (cAMP-increasing agent) augmented the VD3-dependent induction of CD157 and CD11b expression while PGE1 (cAMP-decreasing agent) inhibited it, suggesting the involvement of a cAMP-dependent mechanism in VD3-induced CD157 upregulation. Co-treatment of HL-60 cells with VD3 plus TNF-alpha or ara-C produced an additive effect on CD157 upregulation. The upregulated CD157 in the VD3-differentiated HL-60 cells was able to activate CD157-dependent tyrosine kinase signal when cross-linked with anti-CD157 antibody.

  14. Vivione Bioscience RAPID-B(®) E. coli O157 test kit and non-O157 STEC test kit evaluation.

    Science.gov (United States)

    Miller, Melinda; Ramsaroop, Shawn; Lopez, Chris; Brahmanda, Bharath

    2015-01-01

    RAPID-B(®) is a high performance, integrated microbiology/infectious disease diagnostic system. The system uses hardware and software that are specifically designed for optimal detection using custom, immuno-based reagents designed to react to cell surface antigens of the target bacteria. The Vivione Bioscience RAPID-B Escherichia coli O157 and non-O157 Shiga toxin-producing E. coli (STEC) kits were validated alongside the U.S. Department of Agriculture, Food Safety and Inspection Service (FSIS), Microbiology Laboratory Guidebook (MLG) 5.07 (for E. coli O157) and FSIS MLG 5B.04 (for non-O157 STEC) reference methods for the detection of E. coli O157 and STEC. The matrixes, ground beef and beef trim, were inoculated with appropriate CFU/test portion of E. coli O157 and STEC so as to generate fractional positives results, 5 to 15 positives out of 20 inoculated samples. Samples were enriched in prewarmed Brain Heart Infusion broth at 42 ± 1°C for 6.5-7.5 h or 8.5-9.5 h depending on the sample size. All samples were confirmed using the MLG reference method, regardless of initial screen result. The RAPID-B test methods were statistically equivalent to the reference method for the detection of E. coli O157 and STEC in all tested samples. Inclusivity and exclusivity testing of the RAPID-B methods showed 100% specificity for both kits. Finally, the RAPID-B test methods were shown to be robust when variations were applied to enrichment time, broth temperature, and vortexing time.

  15. 17 CFR 230.157 - Small entities under the Securities Act for purposes of the Regulatory Flexibility Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Small entities under the Securities Act for purposes of the Regulatory Flexibility Act. 230.157 Section 230.157 Commodity and... General § 230.157 Small entities under the Securities Act for purposes of the Regulatory Flexibility Act...

  16. 75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product

    Science.gov (United States)

    2010-03-08

    ... Food Safety Inspection Service Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef... raw beef product that FSIS has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also... Agency procedures for identifying product that may be positive for E. coli O157:H7. DATES: The public...

  17. Plant lesions promote the rapid multiplication of Escherichia coli O157:H7 on post-harvest lettuce

    Science.gov (United States)

    Several outbreaks of Escherichia coli O157:H7 (EcO157) infections have been associated with minimally processed leafy vegetables in the U.S. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with EcO157, the e...

  18. Super-Shed Escherichia coli O157:H7 have potential for increased pathogen persistence and antibiotic resistance dissemination

    Science.gov (United States)

    Cattle are primary reservoirs of Escherichia coli O157:H7 (O157), and super-shedding cattle shed O157 at greater than or equal to 10,000 colony-forming units/g feces. Host, bacteria, and/or the environment reportedly influence the super-shedding phenomenon. We recently demonstrated that a super-she...

  19. 33 CFR Appendix A to Part 157 - Damage Assumptions, Hypothetical Outflows, and Cargo Tank Size and Arrangements

    Science.gov (United States)

    2010-07-01

    ... Outflows, and Cargo Tank Size and Arrangements A Appendix A to Part 157 Navigation and Navigable Waters... MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Pt. 157, App. A Appendix A to Part 157... from tank vessels, three dimensions of the extent of damage of a parallelepiped on the side and bottom...

  20. Detection of Escherichia coli O157:H7 using immuno beads

    Science.gov (United States)

    Tu, Shu-I.; Gehring, Andrew

    2005-11-01

    A new fluorescent sandwich method for the detection of Escherichia coli O157:H7 was developed. Strepavidin coated magnetic beads and fluorescence beads reacted with biotinylated anti E. coli O157 antibodies to form the immuno magnetic beads (IMB) and immuno fluorescence beads (IFB), respectively. The E. coli bacteria captured by IMB were further labeled with IFB to form IMBM-(E. coliO157:H7)N-IFBO sandwich complexes where the subscripts M, N and O were integral numbers. Using broth cultured E. coli O157:H7, the sandwich method was able to detect the bacteria at the level of ~ 103to 104 CFU/mL. Known quantity of freshly cultured E. coli O157:H7 cells were added to ground beef obtained from local markets. The bacteria in inoculated beef patties were enriched in EC broth containing novobiocin. After enriched for 4 h at 40 °C, the developed IMB-IFB method was applied to detect the presence of E. coli O157:H7. The results demonstrated that the developed method could detect the presence of 1 CFU of E. coli O157:H7 per gram of ground beef.

  1. Comparison of two methods for detection of E. coli O157H7 in unpasteurized milk.

    Science.gov (United States)

    Farahmandfar, Maryam; Moori-Bakhtiari, Naghmeh; Gooraninezhad, Saad; Zarei, Mehdi

    2016-10-01

    The most common serotype of enterohaemorrhagic Esherichia coli group or Shiga-toxin-producing E. coli is O157:H7. Domestic and wild ruminants are regarded as the main natural reservoirs. O157:H7 serotype is the major cause of gastrointestinal infections in developed countries. In this study was conducted to survey on the toxigenic E. coli O157: H7 strains in milk of industrial dairy farms. A total number of 150 milk samples were collected from dairy industry in Khuzestan, over a period of 6 months and were evaluated by cultivation in selective media (CT-SMAC) and multiplex PCR. Two isolates were identified as E. coli using biochemical tests, none of them were toxigenic E. coli O157:H7 as determined by multiplex PCR. Using direct PCR on milk samples, 45 samples contained at least one gene of the studied genes in this investigation (rfb, flic, stx1, stx2). With direct PCR, 2 milk samples were positive for toxigenic O157:H7. E. coli O157:H7 is present in this region and so the necessity for strict compliance of health standards is recommended. This is the first study on O157: H7 E. coli milk contamination in Khuzestan province. Based on these results, direct PCR is more accurate than indirect PCR.

  2. Pentadecapeptide BPC 157 Enhances the Growth Hormone Receptor Expression in Tendon Fibroblasts

    Directory of Open Access Journals (Sweden)

    Chung-Hsun Chang

    2014-11-01

    Full Text Available BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

  3. Gastric pentadecapeptide BPC 157 counteracts morphine-induced analgesia in mice.

    Science.gov (United States)

    Boban Blagaic, A; Turcic, P; Blagaic, V; Dubovecak, M; Jelovac, N; Zemba, M; Radic, B; Becejac, T; Stancic Rokotov, D; Sikiric, P

    2009-12-01

    Previously, the gastric pentadecapeptide BPC 157, (PL 14736, Pliva) has been shown to have several beneficial effects, it exert gastroprotective, anti-inflammatory actions, stimulates would healing and has therapeutic value in inflammatory bowel disease. The present study aimed to study the effect of naloxone and BPC 157 on morphine-induced antinociceptive action in hot plate test in the mouse. It was found that naloxone and BPC 157 counteracted the morphine (16 mg/kg s.c.) - analgesia. Naloxone (10 mg/kg s.c.) immediately antagonised the analgesic action and the reaction time returned to the basic values, the development of BPC 157-induced action (10 pg/kg, 10 ng/kg, 10 microg/kg i.p.) required 30 minutes. When haloperidol, a central dopamine-antagonist (1 mg/kg i.p.), enhanced morphine-analgesia, BPC 157 counteracted this enhancement and naloxone reestablished the basic values of pain reaction. BPC 157, naloxone, and haloperidol per se failed to exert analgesic action. In summary, interaction between dopamine-opioid systems was demonstrated in analgesia, BPC 157 counteracted the haloperidol-induced enhancement of the antinociceptive action of morphine, indicating that BPC acts mainly through the central dopaminergic system.

  4. Pentadecapeptide BPC 157 enhances the growth hormone receptor expression in tendon fibroblasts.

    Science.gov (United States)

    Chang, Chung-Hsun; Tsai, Wen-Chung; Hsu, Ya-Hui; Pang, Jong-Hwei Su

    2014-11-19

    BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

  5. Cloacael Carriage and Multidrug Resistance Escherichia coli O157:H7 from Poultry Farms, Eastern Ethiopia

    Directory of Open Access Journals (Sweden)

    Mude Shecho

    2017-01-01

    Full Text Available A cross-sectional study was carried out to determine antimicrobial drug resistance patterns of E. coli O157:H7 isolates and estimate the level of the pathogen. A total of 194 cloacae swab samples were collected randomly in two poultry farms. Standard cultural, biochemical, and serological (latex agglutination methods were used to isolate E. coli O157:H7. The isolates were subjected to antimicrobial susceptibility testing using disc diffusion method. Out of 194 cloacae samples examined, 13.4% (n=26 were found to be positive for E. coli O157:H7. The finding indicated differences in E. coli O157:H7 infection among the different risk factors. Chicken from Adele Poultry Farm showed higher E. coli O157:H7 infection (OR = 3.89 than Haramaya University poultry farm and young birds had more infection (OR = 4.62 than adult birds. Of the total 14 antimicrobials included in the panel of study, the susceptibility results were varied with 96.15% and 0% E. coli O157:H7 isolates expressing resistance to erythromycin, clindamycin, spectinomycin, and ciprofloxacin, respectively. Multidrug resistance to more than two antimicrobial agents was detected in 24 (92.30% of the isolates. The study showed high presence of antimicrobial resistant isolates of E. coli O157:H7. Further study is required to better understand the ecology and evolution of bacterial resistance to antimicrobial agents.

  6. Effects of lactoferrin treatment on Escherichia coli O157:H7 rectal colonization in cattle.

    Science.gov (United States)

    Rybarczyk, Joanna; Kieckens, Evelien; De Zutter, Lieven; Remon, Jean Paul; Vanrompay, Daisy; Cox, Eric

    2017-04-01

    The terminal rectal mucosa has been identified as the predominant colonization site of Escherichia coli O157:H7 in cattle, thus a possible intervention approach should directly target this colonization site. To determine the effect of lactoferrin on E. coli O157:H7 mucosal colonization at the rectum, five 6-month-old Holstein-Friesian calves were experimentally infected with E. coli O157:H7 and received daily rectal treatment with bovine lactoferrin. Three calves that did not receive the lactoferrin served as control group. The treatment decreased faecal shedding of E. coli O157:H7 and completely eliminated the infection in all animals (n=5) after 19 days administration. The rectal mucosa of all animals (n=5) was cleared from E. coli O157:H7 within 13 days of lactoferrin treatment. To evaluate the local immune responses, three calves treated previously with lactoferrin and three calves of the control group were re-infected when E. coli O157:H7 excretion was no longer detected. The rectal administration of lactoferrin resulted in an EspA- and EspB-specific IgA responses at the rectal mucosa. These mucosal antibodies were not detected in the animals which did not receive the lactoferrin powder. Interestingly, no serum IgA antibodies could be found in animals of the group that received the lactoferrin. These findings emphasize the ability of bovine lactoferrin to clear E. coli O157:H7 colonization in cattle, where lactoferrin may influence the local immune processes against E. coli O157:H7 infection. Thus, bovine lactoferrin treatment could be used in the field to eliminate high-level faecal excretion of E. coli O157:H7 in cattle. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Characteristics of Shiga Toxin-Producing Escherichia coli O157 in Slaughtered Reindeer from Northern Finland.

    Science.gov (United States)

    Zweifel, Claudio; Fierz, Lisa; Cernela, Nicole; Laaksonen, Sauli; Fredriksson-Ahomaa, Maria; Stephan, Roger

    2017-03-01

    Fecal samples collected from 470 slaughtered reindeer 6 to 7 months of age were screened by real-time PCR (after enrichment) for Shiga toxin genes (stx) and then for Escherichia coli serogroup O157. Shiga toxin genes were found frequently (>30% of samples), and serogroup O157 was detected in 20% of the stx-positive samples. From these samples, a total of 25 E. coli O157:H - isolates (nonmotile but PCR positive for fliC H7 ) were obtained. Twenty-four of these E. coli O157:H - isolates did not ferment sorbitol and originated from one geographic area. These 24 isolates belonged to the multilocus sequence type 11, typical for Shiga toxin-producing E. coli (STEC) O157:H7 and O157:H - , and harbored genes stx 1a , stx 2c , eae, and hlyA; the stx 2c subtype has been associated with high virulence. In contrast, one E. coli O157:H - isolate (multilocus sequence type 11) did ferment sorbitol, lacked Shiga toxin genes, but was positive for eae, hlyA, and sfpA. This isolate closely resembled an STEC that has lost its Shiga toxin genes. Additional examination revealed that reindeer can be colonized by various other STEC isolates; 21 non-O157 STEC isolates belonged to four multilocus sequence types, harbored stx 1a (8 isolates) or stx 2b (13 isolates), and in the stx 2b -positive isolates the recently described new allelic variants (subAB2-2 and subAB2-3) for subtilase cytotoxin were identified. Hence, slaughtered semidomesticated Finnish reindeer might constitute a little known reservoir for STEC O157:H7/H - and other serogroups, and the risk of direct or indirect transmission of these pathogens from reindeer to humans and domestic livestock must not be overlooked.

  8. Plant Lesions Promote the Rapid Multiplication of Escherichia coli O157:H7 on Postharvest Lettuce▿

    Science.gov (United States)

    Brandl, M. T.

    2008-01-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, the population sizes of E. coli O157:H7 increased 4.0-, 4.5-, and 11.0-fold on lettuce leaves that were mechanically bruised, cut into large pieces, and shredded into multiple pieces, respectively. During the same time, E. coli O157:H7 population sizes increased only twofold on leaves that were left intact after harvest. Also, the population size of E. coli O157:H7 was 27 times greater on young leaves affected by soft rot due to infection by Erwinia chrysanthemi than on healthy middle-aged leaves. Confocal microscopy revealed that leaf tip burn lesions, which are caused by a common physiological disorder of lettuce, harbored dense populations of E. coli O157:H7 cells both internally and externally. Investigation of the colonization of cut lettuce stems by E. coli O157:H7 showed that the pathogen grew 11-fold over 4 h of incubation after its inoculation onto the stems, from which large amounts of latex were released. The results of this study indicate that plant tissue damage of various types can promote significant multiplication of E. coli O157:H7 over a short time and suggest that harvesting and processing are critical control points in the prevention or reduction of E. coli O157:H7 contamination of lettuce. PMID:18641153

  9. Plant lesions promote the rapid multiplication of Escherichia coli O157:H7 on postharvest lettuce.

    Science.gov (United States)

    Brandl, M T

    2008-09-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, the population sizes of E. coli O157:H7 increased 4.0-, 4.5-, and 11.0-fold on lettuce leaves that were mechanically bruised, cut into large pieces, and shredded into multiple pieces, respectively. During the same time, E. coli O157:H7 population sizes increased only twofold on leaves that were left intact after harvest. Also, the population size of E. coli O157:H7 was 27 times greater on young leaves affected by soft rot due to infection by Erwinia chrysanthemi than on healthy middle-aged leaves. Confocal microscopy revealed that leaf tip burn lesions, which are caused by a common physiological disorder of lettuce, harbored dense populations of E. coli O157:H7 cells both internally and externally. Investigation of the colonization of cut lettuce stems by E. coli O157:H7 showed that the pathogen grew 11-fold over 4 h of incubation after its inoculation onto the stems, from which large amounts of latex were released. The results of this study indicate that plant tissue damage of various types can promote significant multiplication of E. coli O157:H7 over a short time and suggest that harvesting and processing are critical control points in the prevention or reduction of E. coli O157:H7 contamination of lettuce.

  10. Escherichia coli O157:H7: Animal Reservoir and Sources of Human Infection

    Science.gov (United States)

    Ferens, Witold A.

    2011-01-01

    Abstract This review surveys the literature on carriage and transmission of enterohemorrhagic Escherichia coli (EHEC) O157:H7 in the context of virulence factors and sampling/culture technique. EHEC of the O157:H7 serotype are worldwide zoonotic pathogens responsible for the majority of severe cases of human EHEC disease. EHEC O157:H7 strains are carried primarily by healthy cattle and other ruminants, but most of the bovine strains are not transmitted to people, and do not exhibit virulence factors associated with human disease. Prevalence of EHEC O157:H7 is probably underestimated. Carriage of EHEC O157:H7 by individual animals is typically short-lived, but pen and farm prevalence of specific isolates may extend for months or years and some carriers, designated as supershedders, may harbor high intestinal numbers of the pathogen for extended periods. The prevalence of EHEC O157:H7 in cattle peaks in the summer and is higher in postweaned calves and heifers than in younger and older animals. Virulent strains of EHEC O157:H7 are rarely harbored by pigs or chickens, but are found in turkeys. The bacteria rarely occur in wildlife with the exception of deer and are only sporadically carried by domestic animals and synanthropic rodents and birds. EHEC O157:H7 occur in amphibian, fish, and invertebrate carriers, and can colonize plant surfaces and tissues via attachment mechanisms different from those mediating intestinal attachment. Strains of EHEC O157:H7 exhibit high genetic variability but typically a small number of genetic types predominate in groups of cattle and a farm environment. Transmission to people occurs primarily via ingestion of inadequately processed contaminated food or water and less frequently through contact with manure, animals, or infected people. PMID:21117940

  11. British Escherichia coli O157 in Cattle Study (BECS): to determine the prevalence of E. coli O157 in herds with cattle destined for the food chain.

    Science.gov (United States)

    Henry, M K; Tongue, S C; Evans, J; Webster, C; McKENDRICK, I J; Morgan, M; Willett, A; Reeves, A; Humphry, R W; Gally, D L; Gunn, G J; Chase-Topping, M E

    2017-11-01

    Escherichia coli O157 are zoonotic bacteria for which cattle are an important reservoir. Prevalence estimates for E. coli O157 in British cattle for human consumption are over 10 years old. A new baseline is needed to inform current human health risk. The British E. coli O157 in Cattle Study (BECS) ran between September 2014 and November 2015 on 270 farms across Scotland and England & Wales. This is the first study to be conducted contemporaneously across Great Britain, thus enabling comparison between Scotland and England & Wales. Herd-level prevalence estimates for E. coli O157 did not differ significantly for Scotland (0·236, 95% CI 0·166-0·325) and England & Wales (0·213, 95% CI 0·156-0·283) (P = 0·65). The majority of isolates were verocytotoxin positive. A higher proportion of samples from Scotland were in the super-shedder category, though there was no difference between the surveys in the likelihood of a positive farm having at least one super-shedder sample. E. coli O157 continues to be common in British beef cattle, reaffirming public health policy that contact with cattle and their environments is a potential infection source.

  12. Characterization of biofilms produced by Escherichia coli O157 isolated from cattle hides

    Science.gov (United States)

    Milojević, L.; Velebit, B.; Baltić, T.; Nikolić, A.; Mitrović, R.; Đorđević, V.

    2017-09-01

    This study aimed to investigate possibility E. coli O157 from cattle hides to produced biofilms. We had 28 suspect primoisolates and 17 were confirmed to be E. coli O157. Biofilm production test showed that more than 50% of this isolates did not produce biofilm. From the other half of the isolates, 5 of them were weakly adherent, 3 were moderately adherent. Since E. coli O157 are one of the main foodborne hazards in meat processing industry and the discovery that some of them can produce moderately adherent biofilms, request necessity of strict implementation of HACCP procedures to prevent further expansion this pathogen.

  13. Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli.

    Science.gov (United States)

    Li, Baoguang; Liu, Huanli; Wang, Weimin

    2017-11-09

    Shiga toxin-producing Escherichia coli (STEC), including E. coli O157:H7, are responsible for numerous foodborne outbreaks annually worldwide. E. coli O157:H7, as well as pathogenic non-O157:H7 STECs, can cause life-threating complications, such as bloody diarrhea (hemolytic colitis) and hemolytic-uremic syndrome (HUS). Previously, we developed a real-time PCR assay to detect E. coli O157:H7 in foods by targeting a unique putative fimbriae protein Z3276. To extend the detection spectrum of the assay, we report a multiplex real-time PCR assay to specifically detect E. coli O157:H7 and screen for non-O157 STEC by targeting Z3276 and Shiga toxin genes (stx1 and stx2). Also, an internal amplification control (IAC) was incorporated into the assay to monitor the amplification efficiency. The multiplex real-time PCR assay was developed using the Life Technology ABI 7500 System platform and the standard chemistry. The optimal amplification mixture of the assay contains 12.5 μl of 2 × Universal Master Mix (Life Technology), 200 nM forward and reverse primers, appropriate concentrations of four probes [(Z3276 (80 nM), stx1 (80 nM), stx2 (20 nM), and IAC (40 nM)], 2 μl of template DNA, and water (to make up to 25 μl in total volume). The amplification conditions of the assay were set as follows: activation of TaqMan at 95 °C for 10 min, then 40 cycles of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 60 s. The multiplex assay was optimized for amplification conditions. The limit of detection (LOD) for the multiplex assay was determined to be 200 fg of bacterial DNA, which is equivalent to 40 CFU per reaction which is similar to the LOD generated in single targeted PCRs. Inclusivity and exclusivity determinants were performed with 196 bacterial strains. All E. coli O157:H7 (n = 135) were detected as positive and all STEC strains (n = 33) were positive for stx1, or stx2, or stx1 and stx2 (Table 1). No cross reactivity was detected with Salmonella

  14. Genotypic analyses of shiga toxin-producing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico.

    Directory of Open Access Journals (Sweden)

    Bianca A Amézquita-López

    Full Text Available Shiga toxin-producing Escherichia coli (STEC are zoonotic enteric pathogens associated with human gastroenteritis worldwide. Cattle and small ruminants are important animal reservoirs of STEC. The present study investigated animal reservoirs for STEC in small rural farms in the Culiacan Valley, an important agricultural region located in Northwest Mexico. A total of 240 fecal samples from domestic animals were collected from five sampling sites in the Culiacan Valley and were subjected to an enrichment protocol followed by either direct plating or immunomagnetic separation before plating on selective media. Serotype O157:H7 isolates with the virulence genes stx2, eae, and ehxA were identified in 40% (26/65 of the recovered isolates from cattle, sheep and chicken feces. Pulse-field gel electrophoresis (PFGE analysis grouped most O157:H7 isolates into two clusters with 98.6% homology. The use of multiple-locus variable-number tandem repeat analysis (MLVA differentiated isolates that were indistinguishable by PFGE. Analysis of the allelic diversity of MLVA loci suggested that the O157:H7 isolates from this region were highly related. In contrast to O157:H7 isolates, a greater genotypic diversity was observed in the non-O157 isolates, resulting in 23 PFGE types and 14 MLVA types. The relevant non-O157 serotypes O8:H19, O75:H8, O111:H8 and O146:H21 represented 35.4% (23/65 of the recovered isolates. In particular, 18.5% (12/65 of all the isolates were serotype O75:H8, which was the most variable serotype by both PFGE and MLVA. The non-O157 isolates were predominantly recovered from sheep and were identified to harbor either one or two stx genes. Most non-O157 isolates were ehxA-positive (86.5%, 32/37 but only 10.8% (4/37 harbored eae. These findings indicate that zoonotic STEC with genotypes associated with human illness are present in animals on small farms within rural communities in the Culiacan Valley and emphasize the need for the development of

  15. Genotypic Analyses of Shiga Toxin-Producing Escherichia coli O157 and Non-O157 Recovered from Feces of Domestic Animals on Rural Farms in Mexico

    Science.gov (United States)

    Amézquita-López, Bianca A.; Quiñones, Beatriz; Cooley, Michael B.; León-Félix, Josefina; Castro-del Campo, Nohelia; Mandrell, Robert E.; Jiménez, Maribel; Chaidez, Cristóbal

    2012-01-01

    Shiga toxin-producing Escherichia coli (STEC) are zoonotic enteric pathogens associated with human gastroenteritis worldwide. Cattle and small ruminants are important animal reservoirs of STEC. The present study investigated animal reservoirs for STEC in small rural farms in the Culiacan Valley, an important agricultural region located in Northwest Mexico. A total of 240 fecal samples from domestic animals were collected from five sampling sites in the Culiacan Valley and were subjected to an enrichment protocol followed by either direct plating or immunomagnetic separation before plating on selective media. Serotype O157:H7 isolates with the virulence genes stx2, eae, and ehxA were identified in 40% (26/65) of the recovered isolates from cattle, sheep and chicken feces. Pulse-field gel electrophoresis (PFGE) analysis grouped most O157:H7 isolates into two clusters with 98.6% homology. The use of multiple-locus variable-number tandem repeat analysis (MLVA) differentiated isolates that were indistinguishable by PFGE. Analysis of the allelic diversity of MLVA loci suggested that the O157:H7 isolates from this region were highly related. In contrast to O157:H7 isolates, a greater genotypic diversity was observed in the non-O157 isolates, resulting in 23 PFGE types and 14 MLVA types. The relevant non-O157 serotypes O8:H19, O75:H8, O111:H8 and O146:H21 represented 35.4% (23/65) of the recovered isolates. In particular, 18.5% (12/65) of all the isolates were serotype O75:H8, which was the most variable serotype by both PFGE and MLVA. The non-O157 isolates were predominantly recovered from sheep and were identified to harbor either one or two stx genes. Most non-O157 isolates were ehxA-positive (86.5%, 32/37) but only 10.8% (4/37) harbored eae. These findings indicate that zoonotic STEC with genotypes associated with human illness are present in animals on small farms within rural communities in the Culiacan Valley and emphasize the need for the development of control

  16. The ecological habitat and transmission of Escherichia coli O157:H7.

    Science.gov (United States)

    Chekabab, Samuel Mohammed; Paquin-Veillette, Judith; Dozois, Charles M; Harel, Josée

    2013-04-01

    Since its first description in 1982, the zoonotic life-threatening Shiga toxin-producing Escherichia coli O157:H7 has emerged as an important food- and water-borne pathogen that causes diarrhea, hemorrhagic colitis, and hemolytic-uremic syndrome in humans. In the last decade, increases in E. coli O157:H7 outbreaks were associated with environmental contamination in water and through fresh produce such as green leaves or vegetables. Both intrinsic (genetic adaptation) and extrinsic factors may contribute and help E. coli O157:H7 to survive in adverse environments. This makes it even more difficult to detect and monitor food and water safety for public health surveillance. E. coli O157:H7 has evolved in behaviors and strategies to persist in the environment. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. Attribution of human VTEC O157 infection from meat products: a quantitative risk assessment approach.

    Science.gov (United States)

    Kosmider, Rowena D; Nally, Pádraig; Simons, Robin R L; Brouwer, Adam; Cheung, Susan; Snary, Emma L; Wooldridge, Marion

    2010-05-01

    To address the risk posed to human health by the consumption of VTEC O157 within contaminated pork, lamb, and beef products within Great Britain, a quantitative risk assessment model has been developed. This model aims to simulate the prevalence and amount of VTEC O157 in different meat products at consumption within a single model framework by adapting previously developed models. The model is stochastic in nature, enabling both variability (natural variation between animals, carcasses, products) and uncertainty (lack of knowledge) about the input parameters to be modeled. Based on the model assumptions and data, it is concluded that the prevalence of VTEC O157 in meat products (joints and mince) at consumption is low (i.e., <0.04%). Beef products, particularly beef burgers, present the highest estimated risk with an estimated eight out of 100,000 servings on average resulting in human infection with VTEC O157.

  18. Surface Characteristics and Adhesion Behavior of Escherichia coli O157:H7: Role of Extracellular Macromolecules

    Science.gov (United States)

    Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...

  19. Gastric pentadecapeptide BPC 157 promotes corneal epithelial defects healing in rats.

    Science.gov (United States)

    Lazić, Ratimir; Gabrić, Nikica; Dekaris, Iva; Bosnar, Damir; Boban-Blagaić, Alenka; Sikirić, Predrag

    2005-06-01

    We evaluated the role of human gastric pentadecapeptide BPC 157 in corneal epithelial defects healing in rats. 48 rats, in 4 groups (N=12). Total debridement of corneal epithelium preformed unilaterally and lesions stained and photographed. Animals medicated as follows: distilled water (control group) or BPC 157 2 pg/ml, 2 ng/ml, 2 microg/ml, 2 drops/rat eye started immediately after injury induction, every 8 hours up to 40 hours (i.e., at 0, 8, 16, 24, 32, 40 h). Lesions were photographed before application or sacrifice (at 48 h). Defect area was analyzed using a special program. Through 48 hour period a steady recovery is noted in controls. Recovery was markedly accelerated in eyes on microg- or ng-topical regimen of BPC 157 (p BPC 157 was shown to be effective in promoting corneal defects healing in rats. Results were dose dependent.

  20. Lettuce cultivar mediates both phyllosphere and rhizosphere activity of Escherichia coli O157:H7.

    Science.gov (United States)

    Quilliam, Richard S; Williams, A Prysor; Jones, Davey L

    2012-01-01

    Plant roots and leaves can be colonized by human pathogenic bacteria, and accordingly some of the largest outbreaks of foodborne illness have been associated with salad leaves contaminated by E. coli O157. Integrated disease management strategies often exploit cultivar resistance to provide a level of protection from economically important plant pathogens; however, there is limited evidence of whether the genotype of the plant can also influence the extent of E. coli O157 colonization. To determine cultivar-specific effects on colonization by E. coli O157, we used 12 different cultivars of lettuce inoculated with a chromosomally lux-marked strain of E. coli O157:H7. Lettuce seedlings grown gnotobiotically in vitro did exhibit a differential cultivar-specific response to E. coli O157 colonization, although importantly there was no relationship between metabolic activity (measured as bioluminescence) and cell numbers. Metabolic activity was highest and lowest on the cultivars Vaila-winter gem and Dazzle respectively, and much higher in endophytic and tightly bound cells than in epiphytic and loosely bound cells. The cultivar effect was also evident in the rhizosphere of plants grown in compost, which suggests that cultivar-specific root exudate influences E. coli O157 activity. However, the influence of cultivar in the rhizosphere was the opposite to that in the phyllosphere, and the higher number and activity of E. coli O157 cells in the rhizosphere may be a consequence of them not being able to gain entry to the plant as effectively. If metabolic activity in the phyllosphere corresponds to a more prepared state of infectivity during human consumption, leaf internalization of E. coli O157 may pose more of a public health risk than leaf surface contamination alone.

  1. Sorbitol-fermenting Shiga toxin-producing Escherichia coli O157 in Austria.

    Science.gov (United States)

    Orth, Dorothea; Grif, Katharina; Zimmerhackl, Lothar Bernd; Würzner, Reinhard

    2009-01-01

    Infections with enterohemorrhagic Escherichia coli (EHEC) are the major cause of hemolytic uremic syndrome (HUS), the most common cause of acute renal failure in childhood. Shiga toxins are considered to be the most important virulence factor of EHEC strains. Non-sorbitol-fermenting EHEC O157:H7 is still the most prevalent serotype isolated worldwide; however, sorbitol-fermenting (SF) EHEC O157:H- (H- indicates nonmotility) strains are increasingly reported. Thirteen SF EHEC O157:H- strains (11 of human origin, two from animals) were detected in Austria between 2002 and 2008. Among the 11 human cases, seven suffered from HUS, two from diarrhea and the remaining two were asymptomatic. Seven of the cases were identified in patients living in or visiting (in one case) the province Salzburg, four were in patients from the province Vorarlberg. Three outbreaks with no more than three persons involved were detected, the other four cases occurred sporadically. The pulsed-field gel-electrophoresis banding patterns of the 13 SF EHEC O157:H- isolates were grouped into three distinct clusters (groups 1, 2 and 3). Strains of the three outbreaks were identical (except for one outbreak strain with one band difference) within each outbreak. In comparison, the Bavarian epidemic strain showed a pattern different from all SF O157:H- strains isolated in Austria. For effective detection of SF EHEC O157:H-, screening for Shiga toxins by ELISA and/or Shiga toxin genes by PCR is absolutely necessary; screening on the basis of phenotypic characteristics such as sorbitol-non-fermentation is not sufficient. Typing methods relying solely on investigation of O157 will detect these strains but should nevertheless also be avoided, so that the prevalent non-O157 strains causing HUS are not missed.

  2. Enhanced detection sensitivity of Escherichia coli O157:H7 using surface-modified gold nanorods

    OpenAIRE

    Ramasamy M; Yi DK; An SSA

    2015-01-01

    Mohankandhasamy Ramasamy,1 Dong Kee Yi,2,3 Seong Soo A An4 1School of Chemical Engineering, Yeungnam University, Gyeongsan, 2Department of Chemistry, 3Department of Energy and Biotechnology, Myongji University, Yongin, 4Department of BioNano Technology, Gachon University, Seongnam, Republic of Korea Abstract: Escherichia coli O157:H7 (O157) is a Gram negative and highly virulent bacteria found in food and water sources, and is a leading cause of chronic diseases worldwide. Diagnosis and pre...

  3. Lettuce cultivar mediates both phyllosphere and rhizosphere activity of Escherichia coli O157:H7.

    Directory of Open Access Journals (Sweden)

    Richard S Quilliam

    Full Text Available Plant roots and leaves can be colonized by human pathogenic bacteria, and accordingly some of the largest outbreaks of foodborne illness have been associated with salad leaves contaminated by E. coli O157. Integrated disease management strategies often exploit cultivar resistance to provide a level of protection from economically important plant pathogens; however, there is limited evidence of whether the genotype of the plant can also influence the extent of E. coli O157 colonization. To determine cultivar-specific effects on colonization by E. coli O157, we used 12 different cultivars of lettuce inoculated with a chromosomally lux-marked strain of E. coli O157:H7. Lettuce seedlings grown gnotobiotically in vitro did exhibit a differential cultivar-specific response to E. coli O157 colonization, although importantly there was no relationship between metabolic activity (measured as bioluminescence and cell numbers. Metabolic activity was highest and lowest on the cultivars Vaila-winter gem and Dazzle respectively, and much higher in endophytic and tightly bound cells than in epiphytic and loosely bound cells. The cultivar effect was also evident in the rhizosphere of plants grown in compost, which suggests that cultivar-specific root exudate influences E. coli O157 activity. However, the influence of cultivar in the rhizosphere was the opposite to that in the phyllosphere, and the higher number and activity of E. coli O157 cells in the rhizosphere may be a consequence of them not being able to gain entry to the plant as effectively. If metabolic activity in the phyllosphere corresponds to a more prepared state of infectivity during human consumption, leaf internalization of E. coli O157 may pose more of a public health risk than leaf surface contamination alone.

  4. Escherichia coli O157:H7 - An Emerging Pathogen in foods of Animal Origin

    Directory of Open Access Journals (Sweden)

    Ch. Bindu Kiranmayi

    Full Text Available Escherichia coli O157:H7 is an emerging public health concern in most countries of the world. E. coli O157:H7 was known to be a human pathogen for nearly 24 years. EHEC O157 infection is estimated to be the fourth most costly food borne disease in Canada and USA, not counting the cost of possible litigation. E. coli O157:H7 and Salmonella are the leading causes of produce related outbreaks, accounting for 20 and 30% respectively. The authority of the Federal Meat Inspection Act, FSIS (Food Safety and Inspection Service declared Escherichia coli O157:H7, an adulterant in raw ground beef and enforced “zero tolerance” (USDA-FSIS, 17 December 1998. Because of the severity of these illnesses and the apparent low infective dose (less than 10 cells, Escherichia coli O157:H7 is considered one of the most serious of known food borne pathogens. Escherichia coli O157:H7 is mainly pathogenic to human but in cattle and other animals, it did not induce any clinical disease except diarrhea. So, these animals act as carriers to Escherichia coli O157:H7. The majority transmission is through eating of undercooked contaminated ground meat and consumption of raw milk, raw vegetables, fruits contaminated by water, cheese, curd and also through consumption of sprouts, lettuce and juice. The conventional isolation procedure includes growth in enrichment broth like modified EC (E. coli broth or modified tryptic soy broth (mTSB Since the infection primarily occurs via faeco-oral route, the preventive measures include food hygiene measures like proper cooking of meat, consumption of pasteurized milk, washing fruits and vegetables especially those to be eaten raw and drinking chlorine treated water and personnel hygiene measures like washing hands after toilet visits. [Veterinary World 2010; 3(8.000: 382-389

  5. Brain-gut Axis and Pentadecapeptide BPC 157: Theoretical and Practical Implications.

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Kolenc, Danijela; Vuletic, Lovorka Batelja; Drmic, Domagoj; Grgic, Tihomir; Strbe, Sanja; Zukanovic, Goran; Crvenkovic, Dalibor; Madzarac, Goran; Rukavina, Iva; Sucic, Mario; Baric, Marko; Starcevic, Neven; Krstonijevic, Zoran; Bencic, Martina Lovric; Filipcic, Igor; Rokotov, Dinko Stancic; Vlainic, Josipa

    2016-01-01

    Brain-gut interaction involves, among others, peptidergic growth factors which are native in GI tract and have strong antiulcer potency and thus could from periphery beneficially affect CNS-disorders. We focused on the stable gastric pentadecapeptide BPC 157, an antiulcer peptidergic agent, safe in inflammatory bowel disease trials and now in multiple sclerosis trial, native and stable in human gastric juice. Review of our research on BPC 157 in terms of brain-gut axis. BPC 157 may serve as a novel mediator of Robert's cytoprotection, involved in maintaining of GI mucosa integrity, with no toxic effect. BPC 157 was successful in the therapy of GI tract, periodontitis, liver and pancreas lesions, and in the healing of various tissues and wounds. Stimulated Egr-1 gene, NAB2, FAK-paxillin and JAK-2 pathways are hitherto implicated. Initially corresponding beneficial central influence was seen when BPC 157 was given peripherally and a serotonin release in particular brain areas, mostly nigrostriatal, was changed. BPC 157 modulates serotonergic and dopaminergic systems, beneficially affects various behavioral disturbances that otherwise appeared due to specifically (over)stimulated/damaged neurotransmitters systems. Besides, BPC 157 has neuroprotective effects: protects somatosensory neurons; peripheral nerve regeneration appearent after transection; after traumatic brain injury counteracts the otherwise progressing course, in rat spinal cord compression with tail paralysis, axonal and neuronal necrosis, demyelination, cyst formation and rescues tail function in both short-terms and long-terms; after NSAIDs or insulin overdose or cuprizone encephalopathies were attenuated along with GI, liver and vascular injuries. BPC 157, a gastric peptide, may serve as remedy in various CNS-disorders.

  6. Plant Lesions Promote the Rapid Multiplication of Escherichia coli O157:H7 on Postharvest Lettuce▿

    OpenAIRE

    Brandl, M. T.

    2008-01-01

    Several outbreaks of Escherichia coli O157:H7 infections have been associated with minimally processed leafy vegetables in the United States. Harvesting and processing cause plant tissue damage. In order to assess the role of plant tissue damage in the contamination of leafy greens with E. coli O157:H7, the effect of mechanical, physiological, and plant disease-induced lesions on the growth of this pathogen on postharvest romaine lettuce was investigated. Within only 4 h after inoculation, th...

  7. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays

    Directory of Open Access Journals (Sweden)

    Jinliang Wang

    2016-03-01

    Full Text Available Shiga toxin-producing Escherichia coli O157:H7 (STEC cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2 that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA; one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 105 CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  8. Rapid Detection of Escherichia coli O157 and Shiga Toxins by Lateral Flow Immunoassays.

    Science.gov (United States)

    Wang, Jinliang; Katani, Robab; Li, Lingling; Hegde, Narasimha; Roberts, Elisabeth L; Kapur, Vivek; DebRoy, Chitrita

    2016-03-25

    Shiga toxin-producing Escherichia coli O157:H7 (STEC) cause food-borne illness that may be fatal. STEC strains enumerate two types of potent Shiga toxins (Stx1 and Stx2) that are responsible for causing diseases. It is important to detect the E. coli O157 and Shiga toxins in food to prevent outbreak of diseases. We describe the development of two multi-analyte antibody-based lateral flow immunoassays (LFIA); one for the detection of Stx1 and Stx2 and one for the detection of E. coli O157 that may be used simultaneously to detect pathogenic E. coli O157:H7. The LFIA strips were developed by conjugating nano colloidal gold particles with monoclonal antibodies against Stx1 and Stx2 and anti-lipid A antibodies to capture Shiga toxins and O157 antigen, respectively. Our results indicate that the LFIA for Stx is highly specific and detected Stx1 and Stx2 within three hours of induction of STEC with ciprofloxacin at 37 °C. The limit of detection for E. coli O157 LFIA was found to be 10⁵ CFU/mL in ground beef spiked with the pathogen. The LFIAs are rapid, accurate and easy to use and do not require sophisticated equipment or trained personnel. Following the assay, colored bands on the membrane develop for end-point detection. The LFIAs may be used for screening STEC in food and the environment.

  9. Reduction of Escherichia coli O157:H7 populations in soy sauce, a fermented seasoning.

    Science.gov (United States)

    Masuda, S; Hara-Kudo, Y; Kumagai, S

    1998-06-01

    We studied five Escherichia coli O157:H7 strains in soy sauce which was incubated at 4, 18, or 30 degrees C after inoculation. The cell numbers of E. coli O157:H7 decreased to an undetectable level (soy sauce samples at 30 degrees C, but did not decrease in the 0.1 M phosphate-buffered saline (pH 7.0) control solution under the same conditions. Soy sauce reduced the cell numbers of bacteria at 18 degrees C to a lesser extent than at 30 degrees C, but to a greater extent than at 4 degrees C. Components of soy sauce such as 10% or 16% NaCl, 5% ethanol, lactic acid, or acetic acid at pH 4.5, sodium benzoate (0.6 g/kg), or p-hydroxybenzoic acid n-butyl ester (0.05 g/liter) caused a reduction of the E. coli O157:H7 population at 30 degrees C, and the anti-E. coli O157:H7 effect of each component was less than that of soy sauce. The fate of E. coli O157:H7 cells in a buffered solution containing various components of soy sauce resembled that in soy sauce at 30 degrees C, which demonstrated the importance of the combination of the soy sauce components for its anti-E coli O157:H7 action.

  10. Selection of antibiotics in detection procedure of Escherichia coli O157:H7 in vegetables

    Science.gov (United States)

    Hoang, Hoang A.; Nhung, Nguyen T. T.

    2017-09-01

    Detection of Escherichia coli O157:H7 in ready-to-eat fresh vegetables is important since this bacteria is considered as one of the most important pathogens in relation to public health. However, it could be a big challenge for detection of initial low concentrations of E. coli O157:H7 in the samples. In this study, selection of antibiotics that suppress growth of background bacteria to enable detection of E. coli O157:H7 in ready-to-eat fresh vegetables was investigated. Firstly, different combinations of two antibiotics, i.e. novobiocin (N) and vancomycin (V), in BHI broth were conducted. The three antibiotic combinations were preliminary examined their effect on the growth of E. coli O157:H7 and Bacillus spp. in broth based on OD600nm measurement. The combination of both the antibiotics was selected to examine their possibility to support detection of E. coli O157:H7 in vegetables. It was successful when two antibiotics showed their support in detection of E. coli O157:H7 at very low concentration of 2 CFU per one gram of lettuce. Usage of these antibiotics is simple and cheap in the detection procedure and could be applied to other types of ready-to-eat fresh vegetables popular in Vietnam.

  11. Soil macropores and compaction control the leaching potential of Escherichia coli O157:H7.

    Science.gov (United States)

    Artz, Rebekka R E; Townend, John; Brown, Katie; Towers, Willie; Killham, Ken

    2005-02-01

    The influence of soil structure in controlling leaching of Escherichia coli O157:H7 through soil was investigated under controlled conditions using both intact and repacked soil cores. Leaching rates of E. coli O157:H7 decreased with increasing dry bulk density and were significantly increased by the presence of earthworm (Lumbricus terrestris) burrows in repacked cores. For intact cores, the percentage of E. coli O157:H7 that leached through replicate cores within 72 h varied from 0.01% to 24%. In contrast, the dry bulk densities of intact cores varied only slightly and were not significantly correlated with leaching. Differences in the numbers of E. coli O157:H7 cells in the leachates were not related to variability in the flow volumes, which were relatively constant as a result of the experimental design, but were strongly correlated with the variations in concentrations of E. coli O157:H7 in the leachates. Relatively small variations in the internal structure of soil cores can therefore significantly affect the pathway that cells can take through soil. Factors such as compaction and the occurrence of pores providing preferential flow are prime determinants in the degree of leaching of E. coli O157:H7 through soil.

  12. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  13. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  14. Effect of Citrus Byproducts on Survival of O157:H7 and Non-O157 Escherichia coli Serogroups within In Vitro Bovine Ruminal Microbial Fermentations

    Directory of Open Access Journals (Sweden)

    Heather A. Duoss-Jennings

    2013-01-01

    Full Text Available Citrus byproducts (CBPs are utilized as a low cost nutritional supplement to the diets of cattle and have been suggested to inhibit the growth of both Escherichia coli O157:H7 and Salmonella. The objective of this study was to examine the effects in vitro that varying concentrations of CBP in the powdered or pelleted variety have on the survival of Shiga-toxin Escherichia coli (STEC serotypes O26:H11, O103:H8, O111:H8, O145:H28, and O157:H7 in bovine ruminal microorganism media. The O26:H11, O111:H8, O145:H28, and O157:H7 serotypes did not exhibit a change in populations in media supplemented with CBP with either variety. The O103:H8 serotype displayed a general trend for an approximate 1log10 reduction in 5% powdered CBP and 20% pelleted CBP over 6 h. There was a trend for reductions in populations of a variant form of O157:H7 mutated in the stx1 and stx2 genes in higher concentrations of CBP. These results suggest that variations exist in the survival of these serotypes of STEC within mixed ruminal microorganism fluid media when supplemented with CBP. Further research is needed to determine why CBPs affect STEC serotypes differently.

  15. Growth of Escherichia coli O157:H7, Non-O157 Shiga Toxin-Producing Escherichia coli , and Salmonella in Water and Hydroponic Fertilizer Solutions.

    Science.gov (United States)

    Shaw, Angela; Helterbran, Kara; Evans, Michael R; Currey, Christopher

    2016-12-01

    The desire for local, fresh produce year round is driving the growth of hydroponic growing systems in the United States. Many food crops, such as leafy greens and culinary herbs, grown within hydroponics systems have their root systems submerged in recirculating nutrient-dense fertilizer solutions from planting through harvest. If a foodborne pathogen were introduced into this water system, the risk of contamination to the entire crop would be high. Hence, this study was designed to determine whether Escherichia coli O157:H7, non-O157 Shiga toxin-producing E. coli , and Salmonella were able to survive and reproduce in two common hydroponic fertilizer solutions and in water or whether the bacteria would be killed or suppressed by the fertilizer solutions. All the pathogens grew by 1 to 6 log CFU/ml over a 24-h period, depending on the solution. E. coli O157:H7 reached higher levels in the fertilizer solution with plants (3.12 log CFU/ml), whereas non-O157 Shiga toxin-producing E. coli and Salmonella reached higher levels in the fertilizer solution without plants (1.36 to 3.77 log CFU/ml). The foodborne pathogens evaluated here survived for 24 h in the fertilizer solution, and populations grew more rapidly in these solutions than in plain water. Therefore, human pathogens entering the fertilizer solution tanks in hydroponic systems would be expected to rapidly propagate and spread throughout the system and potentially contaminate the entire crop.

  16. Therapeutic potential of pro-angiogenic BPC157 is associated with VEGFR2 activation and up-regulation.

    Science.gov (United States)

    Hsieh, Ming-Jer; Liu, Hsien-Ta; Wang, Chao-Nin; Huang, Hsiu-Yun; Lin, Yuling; Ko, Yu-Shien; Wang, Jong-Shyan; Chang, Vincent Hung-Shu; Pang, Jong-Hwei S

    2017-03-01

    BPC 157, a pentadecapeptide with extensive healing effects, has recently been suggested to contribute to angiogenesis. However, the underlying mechanism is not yet clear. The present study aimed to explore the potential therapeutic effect and pro-angiogenic mechanism of BPC 157. As demonstrated by the chick chorioallantoic membrane (CAM) assay and endothelial tube formation assay, BPC 157 could increase the vessel density both in vivo and in vitro, respectively. BPC 157 could also accelerate the recovery of blood flow in the ischemic muscle of the rat hind limb as detected by laser Doppler scanning, indicating the promotion of angiogenesis. Histological analysis of the hind limb muscle confirmed the increased number of vessels and the enhanced vascular expression of vascular endothelial growth factor receptor 2 (VEGFR2) in rat with BPC 157 treatment. In vitro study using human vascular endothelial cells further confirmed the increased mRNA and protein expressions of VEGFR2 but not VEGF-A by BPC 157. In addition, BPC 157 could promote VEGFR2 internalization in vascular endothelial cells which was blocked in the presence of dynasore, an inhibitor of endocytosis. BPC 157 time dependently activated the VEGFR2-Akt-eNOS signaling pathway which could also be suppressed by dynasore. The increase of endothelial tube formation induced by BPC 157 was also inhibited by dynasore. This study demonstrates the pro-angiogenic effects of BPC 157 that is associated with the increased expression, internalization of VEGFR2, and the activation of VEGFR2-Akt-eNOS signaling pathway. BPC 157 promotes angiogenesis in CAM assay and tube formation assay. BPC 157 accelerates the blood flow recovery and vessel number in rats with hind limb ischemia. BPC 157 up-regulates VEGFR2 expression in rats with hind limb ischemia and endothelial cell culture. BPC 157 promotes VEGFR2 internalization in association with VEGFR2-Akt-eNOS activation. BPC 157 promotes angiogenesis in CAM assay and tube

  17. Isolation of shiga toxin-producing Escherichia coli O157:H7/NM from hamburger and chicken nugget

    Directory of Open Access Journals (Sweden)

    Ali Miri

    2014-01-01

    Material and Methods: From June 2013 to July 2013, a total of 190 hamburger (120 and chicken nugget (70, were collected from four randomly selected factories in Isfahan, Iran. They were evaluated for the presence of E. coli O157:H7/NM using microbiological culture and polymerase chain reaction. Statistical analysis was performed using SPSS software version 16.0 (SPSS Inc., Chicago o, IL, USA. Results: From a total of 190 samples analyzed four samples (2.1% were contaminated with E. coli O157. All of the E. coli O157 were isolated from hamburger samples (3.3% and chicken nugget samples were negative. Of four E. coli O157 isolated, only one sample was serotype E. coli O157:H7 and others were serotype E. coli O157:NM. Among four E. coli O157:H7/NM isolates, one strain was positive for all stx1, stx2, eaeA and ehxA genes. One strain was positive for stx2 gene. The other two were negative for these genes. All isolates (100% were resistant to one or more antimicrobial agents. Conclusions: The results of this study showed that hamburger could be a significant source of E. coli O157:H7 and E. coli O157:NM serotypes in Iran and multi-resistance was found in 27% of E. coli O157 strains and this is a major public health concern.

  18. Overexpression of CD157 contributes to epithelial ovarian cancer progression by promoting mesenchymal differentiation.

    Directory of Open Access Journals (Sweden)

    Simona Morone

    Full Text Available Epithelial ovarian carcinoma (EOC is an aggressive tumor often diagnosed at an advanced stage, when there is little or no prospect of cure. Despite advances in surgical and chemotherapeutic strategies, only marginal improvements in patient outcome have been obtained. Hence, unraveling the biological mechanisms underpinning EOC progression is critical for improving patients' survival. Recently, we reported that CD157 (an ectoenzyme regulating leukocyte diapedesis is expressed in EOC and that high expression of the molecule is negatively correlated with the disease outcome in patients. Here, we demonstrate that forced overexpression of CD157 in OVCAR-3, TOV-21G, A2780 and OV-90 ovarian cancer cell lines promotes morphological and phenotypic changes characterized by disruption of intercellular junctions, downregulation of epithelial markers and upregulation of mesenchymal ones. These changes in cell shape and phenotype bring to reduced sensitivity to anoikis, increased anchorage-independent growth, cell motility and mesothelial invasion. Conversely, knockdown of CD157 in OV-90 and OC314 cells reverts the mesenchymal phenotype and reduces the cells' migratory potential. Transcriptome profiling analysis highlighted 378 significantly differentially expressed genes, representing the signature of CD157-overexpressing OVCAR-3 and OV-90 cells. The modulation of selected genes translates into alteration of protein expression that give cells a highly malignant phenotype. The overall picture deduced from the analysis of the modulated transcripts is that high expression of CD157 strengthens a number of biological processes favoring tumor progression (including development and cell motility, and weakens several biological processes hindering tumor progression (such as apoptosis, cell death and response to stress. Together, these findings implicate CD157 in the progression of EOC to metastatic disease and suggest that CD157 may represent a valuable therapeutic

  19. Characterization of Shiga Toxin-Producing Escherichia coli O157 Isolates from Bovine Carcasses.

    Science.gov (United States)

    Fontcuberta, M; Planell, R; Torrents, A; Sabaté, S; Gonzalez, R; Ramoneda, M; de Simón, M

    2016-08-01

    The main purpose of this study was to determine the prevalence of Escherichia coli O157 on bovine carcasses before and after chilling at a large slaughterhouse located in the city of Barcelona, Spain, to assess the effectiveness of dry chilling on reducing E. coli O157 contamination of carcasses. In addition, the study characterized the E. coli O157 strains isolated in terms of virulence factors, antibiotic susceptibility, and their genetic diversity. Individual bovine carcasses were sampled before (n = 300) and after (n = 300) chilling over an 8-month period. Positive samples for E. coli O157 were subjected to virulence screening by PCR (stx1, stx2, and eaeA genes and the fliCH7 gene), antimicrobial susceptibility testing, and molecular typing by pulsed-field gel electrophoresis. A total of 9.7% (29 of 300) of the nonrefrigerated carcasses examined and 2.3% (7 of 300) of the refrigerated carcasses were positive for E. coli O157. All the isolates were serotype O157:H7, 92% (33 of 36) carried the stx1, stx2, and eaeA genes, and 8% (3 of 36) carried the stx2 and eaeA genes. Antimicrobial susceptibility testing showed a high degree of resistance: 29 strains (81%) were resistant to at least 1 antimicrobial of the 12 antimicrobials tested; 69% (25 of 36) were resistant to 4 or more antimicrobials. Molecular typing by pulsed-field gel electrophoresis found a high diversity of genetic types, implying little cross-contamination in the slaughterhouse. This study confirms that E. coli O157:H7 is present on the carcasses slaughtered in Spain, although its prevalence is reduced by the dry chilling process used. The recovered isolates showed potential pathogenesis and a high degree of multidrug resistance, confirming the importance of bovine meat monitoring.

  20. Role of glycoside hydrolase genes in sinigrin degradation by E. coli O157:H7.

    Science.gov (United States)

    Cordeiro, Roniele P; Doria, Juan H; Zhanel, George G; Sparling, Richard; Holley, Richard A

    2015-07-16

    This work examined Escherichia coli O157:H7 strain 02-0304 for putative genes responsible for sinigrin hydrolysis. Sinigrin is a glucosinolate present in Oriental mustard (Brassica juncea), and its hydrolysis is mediated in plants by the enzyme myrosinase. Sinigrin hydrolysis by plant or bacterial myrosinase yields allyl isothiocyanate (AITC) which is bactericidal. In silico analysis using public databases found sequence similarity between plant myrosinase and enzymes encoded by genes from β-glucosidase families in E. coli O157:H7. Specifically, 6-phospho-β-glucosidase encoded by the genes bglA and ascB (family 1), and chbF (family 4) present in E. coli O157:H7 showed the highest similarity. Polymerase chain reaction (PCR) confirmed the presence of bglA, ascB, and chbF in the clinical E. coli strain tested. Disruption of these genes in wild-type E. coli O157:H7 strain 02-0304 using lambda-red replacement created single and double mutants. The relative importance of each gene in the hydrolysis of sinigrin by E. coli O157:H7 was also assessed by comparing gene expression and sinigrin degradation rates among the E. coli O157:H7 wild-type strain and its mutants. The results suggested that the genes bglA and ascB play a substantial role in the degradation of sinigrin by E. coli O157:H7 strain 02-0304. Copyright © 2015. Published by Elsevier B.V.

  1. ADP ribosyl-cyclases (CD38/CD157), social skills and friendship.

    Science.gov (United States)

    Chong, Anne; Malavasi, Fabio; Israel, Salomon; Khor, Chiea Chuen; Yap, Von Bing; Monakhov, Mikhail; Chew, Soo Hong; Lai, Poh San; Ebstein, Richard P

    2017-04-01

    Why some individuals seek social engagement while others shy away has profound implications for normal and pathological human behavior. Evidence suggests that oxytocin (OT), the paramount human social hormone, and CD38 that governs OT release, contribute to individual differences in social skills from intense social involvement to extreme avoidance that characterize autism. To explore the neurochemical underpinnings of sociality, CD38 expression of peripheral blood leukocytes (PBL) was measured in Han Chinese undergraduates. First, CD38 mRNA levels were correlated with lower Autism Quotient (AQ), indicating enhanced social skills. AQ assesses the extent of autistic-like traits including the propensity and dexterity needed for successful social engagement in the general population. Second, three CD157 eQTL SNPs in the CD38/CD157 gene region were associated with CD38 expression. CD157 is a paralogue of CD38 and is contiguous with it on chromosome 4p15. Third, association was also observed between the CD157 eQTL SNPs, CD38 expression and AQ. In the full model, CD38 expression and CD157 eQTL SNPs altogether account for a substantial 14% of the variance in sociality. Fourth, functionality of CD157 eQTL SNPs was suggested by a significant association with plasma oxytocin immunoreactivity products. Fifth, the ecological validity of these findings was demonstrated with subjects with higher PBL CD38 expression having more friends, especially for males. Furthermore, CD157 sequence variation predicts scores on the Friendship questionnaire. To summarize, this study by uniquely leveraging various measures reveals salient elements contributing to nonkin sociality and friendship, revealing a likely pathway underpinning the transition from normality to psychopathology. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Influence of transportation stress and animal temperament on fecal shedding of Escherichia coli O157:H7 in feedlot cattle.

    Science.gov (United States)

    Schuehle Pfeiffer, C E; King, D A; Lucia, L M; Cabrera-Diaz, E; Acuff, G R; Randel, R D; Welsh, T H; Oliphint, R A; Curley, K O; Vann, R C; Savell, J W

    2009-02-01

    To test the influence of transportation stress and temperament on shedding of Escherichia coli O157:H7, cattle (n=150) were classified at various stages of production as Excitable, Intermediate or Calm based on a variety of disposition scores. Presence of E. coli O157:H7 was determined by rectal swabs from live animals and from colons collected postmortem. Percentage of cattle shedding E. coli O157:H7 at arrival at the feedlot was approximately equal among temperament groups. Before shipment to the processing facility, a higher (P=0.03) proportion of cattle from the Calm group shed E. coli O157:H7 compared to the other temperament groups. When pooled across all sampling periods, cattle from the Calm group had a greater percentage test positive for E. coli O157:H7. Neither the acute stressor of transportation nor a more excitable temperament led to increased shedding of E. coli O157:H7 in cattle.

  3. Inactivation of Escherichia coli O157:H7 by essential oil from Cinnamomum zeylanicum.

    Science.gov (United States)

    Senhaji, Ouafae; Faid, Mohamed; Kalalou, Ichraq

    2007-04-01

    Escherichia coli O157:H7 is a pathogen strain, which causes hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans. The control of bacterial cells in foods is an important factor to reduce foodborne diseases due to E. coli O157:H7. Assays to inactivate E. coli O157:H7 were carried out by using the cinnamon oil obtained by steam distillation for 6 hours. When E. coli O157:H7 cells were incubated at 37 degrees C for 2 hours in the presence of 0.025% of the essential oil from cinnamon, a dramatic decrease was observed in the viable counts (from 10(7) to 3.10(4) CFU/mL-1). In the presence of 0.05% of the oil, most of cells were killed after 30 min, suggesting that the antimicrobial activity of essential oil is bactericidal against E. coli. The minimal inhibitory concentration of the essential oil from cinnamon was around 625 ppm against E. coli O157:H7 and E. coli ATCC 25921, around 1250 ppm against E. coli ATCC25922 and around 2500 ppm against E. coli ATCC11105.

  4. Inactivation of Escherichia coli O157:H7 by essential oil from Cinnamomum zeylanicum

    Directory of Open Access Journals (Sweden)

    Ouafae Senhaji

    Full Text Available Escherichia coli O157:H7 is a pathogen strain, which causes hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans. The control of bacterial cells in foods is an important factor to reduce foodborne diseases due to E. coli O157:H7. Assays to inactivate E. coli O157:H7 were carried out by using the cinnamon oil obtained by steam distillation for 6 hours. When E. coli O157:H7 cells were incubated at 37°C for 2 hours in the presence of 0.025% of the essential oil from cinnamon, a dramatic decrease was observed in the viable counts (from 10(7 to 3.10(4 CFU/mL-1. In the presence of 0.05% of the oil, most of cells were killed after 30 min, suggesting that the antimicrobial activity of essential oil is bactericidal against E. coli. The minimal inhibitory concentration of the essential oil from cinnamon was around 625 ppm against E. coli O157:H7 and E. coli ATCC 25921, around 1250 ppm against E. coli ATCC25922 and around 2500 ppm against E. coli ATCC11105.

  5. Environmental sources and transmission of Escherichia coli O157 in feedlot cattle.

    Science.gov (United States)

    Van Donkersgoed, J; Berg, J; Potter, A; Hancock, D; Besser, T; Rice, D; LeJeune, J; Klashinsky, S

    2001-01-01

    A study was conducted in 2 feedlots in southern Alberta to identify environmental sources and management factors associated with the prevalence and transmission of Escherichia coli O157:H7. Escherichia coli O157:H7 was isolated in preslaughter pens of cattle from feces (0.8%), feedbunks (1.7%), water troughs (12%), and incoming water supplies (4.5%), but not from fresh total mixed rations. Fresh total mixed rations did not support the growth of E. coli O157:H7 and E. coli from bovine feces following experimental inoculation. Within a feedlot, the feces, water troughs, and feedbunks shared a few indistinguishable subtypes of E. coli O157:H7. A few subtypes were repeatedly isolated in the same feedlot, and the 2 feedlots shared a few indistinguishable subtypes. The prevalence of E. coli O157:H7 in water troughs of preslaughter cattle in 1 feedlot was associated with season, maximum climatic temperatures the week before sampling; total precipitation the week before sampling, and coliform and E. coli counts in the water trough. PMID:11565371

  6. Detection and in vitro metabolism of the confiscated peptides BPC 157 and MGF R23H.

    Science.gov (United States)

    Cox, Holly D; Miller, Geoff D; Eichner, Daniel

    2017-10-01

    A new peptide, body protecting compound (BPC), BPC 157, and a variant of mechano-growth factor (MGF), MGF R23H, were identified in confiscated vials. BPC 157 has the amino acid sequence, GEPPPGKPADDAGLV, and is currently under investigation for the promotion of healing and recovery in a variety of tissues. In vitro metabolism experiments in plasma demonstrate that MGF R23H has good stability and should be detectable in urine, while BPC 157 forms a stable metabolite that should be detectable in urine. A weak cation exchange solid phase extraction method was validated for detection of BPC 157 in urine. The method has a limit of detection of 0.1 ng/mL, precision of less than 20%, and good linearity, r(2) 0.998. BPC 157 was stable in urine for at least 4 days. The specificity of the method is improved by measurement of a potential BPC metabolite along with the parent peptide. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Gastric pentadecapeptide BPC 157 as an effective therapy for muscle crush injury in the rat.

    Science.gov (United States)

    Novinscak, Tomislav; Brcic, Luka; Staresinic, Mario; Jukic, Ivana; Radic, Bozo; Pevec, Danira; Mise, Sandro; Tomasovic, Sanja; Brcic, Iva; Banic, Tihomir; Jakir, Ana; Buljat, Gojko; Anic, Tomislav; Zoricic, Ivan; Romic, Zeljko; Seiwerth, Sven; Sikiric, Predrag

    2008-01-01

    Stable gastric pentadecapeptide BPC 157 accelerates the healing of a transected Achilles tendon and a transected quadriceps muscle. It may also be of clinical relevance as a systemic and local peptide treatment for crush injury of a major muscle, such as gastrocnemius muscle complex. BPC 157 is effective without a carrier, and it is presently undergoing trials for inflammatory bowel disease, and no toxicity has so far been reported. In crushed rats (force delivered 0.727 Ns/cm2), BPC 157 was applied either intraperitoneally or locally, as a thin cream layer, immediately after injury (sacrifice at 2 h), and once a day for 14 days. BPC 157 improved muscle healing, macroscopically (less hematoma and edema, no post-injury leg contracture), microscopically, functionally, and also based on enzyme activity (creatine kinase, lactate dehydrogenase, aspartate aminotransferase, alanine aminotransferase). BPC 157, at all investigated intervals, given locally or intraperitoneally, accelerated post-injury muscle healing and also helped to restore the full function.

  8. Pentadecapeptide BPC 157 (PL 14736) improves ligament healing in the rat.

    Science.gov (United States)

    Cerovecki, Tomislav; Bojanic, Ivan; Brcic, Luka; Radic, Bozo; Vukoja, Ivan; Seiwerth, Sven; Sikiric, Predrag

    2010-09-01

    We improved medial collateral ligament (MCL) healing throughout 90 days after surgical transection. We introduced intraperitoneal, per-oral (in drinking water) and topical (thin cream layer) peptide therapy always given alone, without a carrier. Previously, as an effective peptide therapy, stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, an anti-ulcer peptide effective in inflammatory bowel disease therapy (PL 14736)) particularly improved healing of transected tendon and muscle and wound healing effect including the expression of the early growth response 1 (egr-1) gene. After MCL transection BPC 157 was effective in rats when given once daily intraperitoneally (10 microg or 10 ng/kg) or locally as a thin layer (1.0 microg dissolved in distilled water/g commercial neutral cream) at the site of injury, first application 30 min after surgery and the final application 24 h before sacrifice. Likewise, BPC 157 was effective given per-orally (0.16 microg/ml in the drinking water (12 ml/day/rat)) until sacrifice. Commonly, BPC 157 microg-ng-rats exhibited consistent functional, biomechanical, macroscopic and histological healing improvements. Thus, we suggest BPC 157 improved healing of acute ligament injuries in further ligament therapy. (c) 2010 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  9. The stable gastric pentadecapeptide BPC 157, given locally, improves CO2 laser healing in mice.

    Science.gov (United States)

    Bilic, M; Bumber, Z; Blagaic, A Boban; Batelja, L; Seiwerth, S; Sikiric, P

    2005-05-01

    The stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV; mol. wt. 1419), which is at present in phase II clinical trials for the treatment of inflammatory bowel disease, has been shown to counteract healing impairment by systemic corticosteroids in burned mice, both in vivo and in vitro, in the absence of carrier or protease inhibitor. Because of the particular healing problems associated with laser use, we have now studied the effect of pentadecapeptide BPC 157 on CO(2) laser injuries (Sharplan 1075 laser: 20 W, distance 12.5 cm, spot size 0.8 mm and exposure time 1s) created on the dorsal skin of anaesthetised male NMRI-Hannover mice. The injury was either not treated or treated by topical application of a thin layer of neutral cream containing pentadecapeptide BPC 157 (1 microg, 1 ng or 1 pg (dissolved in saline)/g) or vehicle only, once daily, with the first application 60 min after injury and the last 24 h before killing (1, 7 and 21 days after the laser application). BPC 157 consistently improved healing after the CO(2) laser injury, both macroscopically and microscopically. The effect was produced with a simple method of application and favourable peptide stability (no carrier), and confirms the effectiveness of an ointment containing 1 microg BPC 157 (dissolved in saline)/g neutral cream.

  10. Impact of pentadecapeptide BPC 157 on muscle healing impaired by systemic corticosteroid application.

    Science.gov (United States)

    Pevec, Danira; Novinscak, Tomislav; Brcic, Luka; Sipos, Kristijan; Jukic, Ivana; Staresinic, Mario; Mise, Sandro; Brcic, Iva; Kolenc, Danijela; Klicek, Robert; Banic, Tihomir; Sever, Marko; Kocijan, Ana; Berkopic, Lidija; Radic, Bozo; Buljat, Gojko; Anic, Tomislav; Zoricic, Ivan; Bojanic, Ivan; Seiwerth, Sven; Sikiric, Predrag

    2010-03-01

    The effect of systemic and local peptide treatment effective in muscle contusion and then on counteraction of corticosteroid-induced impairment was tested. The pentadecapeptide BPC 157, given without a carrier, improved the healing of transected quadriceps muscle. It also improved muscle healing in rats with muscle crush injury when applied systemically or locally. Importantly, it counteracted corticosteroid-impairment in tendon to bone healing. Thus BPC 157 is proposed as an effective treatment that can improve muscle healing in spite of corticosteroid treatment. After the gastrocnemius muscle complex had been injured, rats received BPC 157 (intraperitoneally or locally as a cream) and/or 6alpha-methylprednisolone (intraperitoneally) only once (immediately after injury, sacrifice at 2 h) or once daily (final dose 24 hours before sacrifice and/or assessment procedure at days 1, 2, 4, 7, and 14). Muscle healing was evaluated functionally, macroscopically, and histologically. Without therapy, crushed gastrocnemius muscle complex controls showed limited improvement. 6alpha-methylprednisolone markedly aggravated healing. In contrast, BPC 157 induced faster muscle healing and full function restoration and improved muscle healing despite systemic corticosteroid treatment when given intraperitoneally or locally and demonstrated functionally, macroscopically, and histologically at all investigated intervals. BPC 157 completely reversed systemic corticosteroid-impaired muscle healing.

  11. Targeting CD157 in AML using a novel, Fc-engineered antibody construct.

    Science.gov (United States)

    Krupka, Christina; Lichtenegger, Felix S; Köhnke, Thomas; Bögeholz, Jan; Bücklein, Veit; Roiss, Michael; Altmann, Torben; Do, To Uyen; Dusek, Rachel; Wilson, Keith; Bisht, Arnima; Terrett, Jon; Aud, Dee; Pombo-Villar, Esteban; Rohlff, Christian; Hiddemann, Wolfgang; Subklewe, Marion

    2017-05-30

    Antibody-based immunotherapy represents a promising strategy to eliminate chemorefractory leukemic cells in acute myeloid leukemia (AML). In this study, we evaluated a novel Fc-engineered antibody against CD157 (MEN1112) for its suitability as immunotherapy in AML. CD157 was expressed in 97% of primary AML patient samples. A significant, albeit lower expression level of CD157 was observed within the compartment of leukemia-initiating cells, which are supposed to be the major source of relapse. In healthy donor bone marrow, CD157 was expressed on CD34+ cells. In ex vivo assays, MEN1112 triggered natural killer (NK) cell-mediated cytotoxicity against AML cell lines and primary AML cells. Compared to its parental analogue, the Fc-engineered antibody exhibited higher antibody dependent cellular cytotoxicity responses. Using NK cells from AML patients, we observed heterogeneous MEN1112-mediated cytotoxicity against AML cells, most likely due to well-documented defects in AML-NK cells and corresponding inter-patient variations in NK cell function. Cytotoxicity could not be correlated to the time after completion of chemotherapy. In summary, we could demonstrate that CD157 is strongly expressed in AML. MEN1112 is a promising antibody construct that showed high cytotoxicity against AML cells and warrants further clinical testing. Due to variability in NK-cell function of AML patients, the time of application during the course of the disease as well as combinatorial strategies might influence treatment results.

  12. Phylogenetic Analysis of Enterohemorrhagic Escherichia coli O157, Germany, 1987–2008

    Science.gov (United States)

    Jenke, Christian; Harmsen, Dag; Weniger, Thomas; Rothgänger, Jörg; Hyytiä-Trees, Eija; Bielaszewska, Martina; Karch, Helge

    2010-01-01

    Multilocus variable number tandem repeat analysis (MLVA) is a subtyping technique for characterizing human pathogenic bacteria such as enterohemorrhagic Escherichia coli (EHEC) O157. We determined the phylogeny of 202 epidemiologically unrelated EHEC O157:H7/H– clinical isolates through 8 MLVA loci obtained in Germany during 1987–2008. Biodiversity in the loci ranged from 0.66 to 0.90. Four of 8 loci showed null alleles and a frequency <44.1%. These loci were distributed among 48.5% of all strains. Overall, 141 MLVA profiles were identified. Phylogenetic analysis assigned 67.3% of the strains to 19 MLVA clusters. Specific MLVA profiles with an evolutionary persistence were identified, particularly within sorbitol-fermenting EHEC O157:H–.These pathogens belonged to the same MLVA cluster. Our findings indicate successful persistence of this clone. PMID:20350374

  13. Outbreak of Escherichia coli O157 infection associated with a music festival.

    Science.gov (United States)

    Crampin, M; Willshaw, G; Hancock, R; Djuretic, T; Elstob, C; Rouse, A; Cheasty, T; Stuart, J

    1999-04-01

    Seven persons who attended the Glastonbury Music Festival were infected with Vero cytotoxin-producing Escherichia coli O157 and an eighth person had serological evidence of infection. Cases were reported from different parts of England. Patients were interviewed by telephone about clinical symptoms, festival attendance, camping details, food history, water exposure, and contact with mud and animals. The interviews identified no common food source, differing use of water sources and widely dispersed camping sites. Escherichia coli O157 strains from seven persons and from a cow belonging to a herd that had previously grazed the site all belonged to phage type 2 and possessed genes for Vero cytotoxin 2. Drug resistance and DNA-based tests showed that six patients were infected with strains indistinguishable from each other and from the bovine isolate. The most likely vehicle of infection was mud contaminated with Escherichia coli O157 from infected cattle.

  14. Fast detection of both O157 and non-O157 shiga-toxin producing Escherichia coli by real-time optical immunoassay.

    Science.gov (United States)

    Mondani, L; Delannoy, S; Mathey, R; Piat, F; Mercey, T; Slimani, S; Fach, P; Livache, T; Roupioz, Y

    2016-01-01

    Among bacterial pathogens involved in food-illnesses, seven serogroups (O26, O45, O103, O111, O121, O145 and O157) of Shiga-toxin producing Escherichia coli (STEC), are frequently identified. During such outbreak, and due to the perishable property of most foodstuff, the time laps for the identification of contaminated products and pathogens is thus critical to better circumvent their spread. Traditional detection methods using PCR or culture plating are time consuming and may present some limitations. In this study, we present a multiplexed immunoassay for the optical detection of most commonly enterohemorrhagic E. coli serogroups: O26, O45, O103, O111, O121, O145 and O157:H7 in a single device. The use of Surface Plasmon Resonance imaging not only enabled the label-free analysis of the samples but gave results in a real-time manner. A dedicated protocol was set up for the detection of both low contaminating bacterial concentrations of food samples (5 CFU per 25 g) and postenrichment aliquots. By combining one single device for the detection of O157 and non-O157 STEC in a label-free manner, this rapid approach may have an important economic and societal impact. This article presents a simple-to-operate immunoassay for the specific detection of Shiga-toxin producing Escherichia coli (STEC). This approach consists in the on-chip assay detection of viable cells on a specifically designed antibody microarray. By skipping any enrichment step and avoiding the use of labelling agent, this approach based on the Surface Plasmon Resonance imaging of the microarrays turns out to be much faster and more cost effective by comparison with standardized methods. © 2015 The Society for Applied Microbiology.

  15. Derivation of Escherichia coli O157:H7 from Its O55:H7 Precursor

    Science.gov (United States)

    Zhou, Zhemin; Li, Xiaomin; Liu, Bin; Beutin, Lothar; Xu, Jianguo; Ren, Yan; Feng, Lu; Lan, Ruiting; Reeves, Peter R.; Wang, Lei

    2010-01-01

    There are 29 E. coli genome sequences available, mostly related to studies of species diversity or mode of pathogenicity, including two genomes of the well-known O157:H7 clone. However, there have been no genome studies of closely related clones aimed at exposing the details of evolutionary change. Here we sequenced the genome of an O55:H7 strain, closely related to the major pathogenic O157:H7 clone, with published genome sequences, and undertook comparative genomic and proteomic analysis. We were able to allocate most differences between the genomes to individual mutations, recombination events, or lateral gene transfer events, in specific lineages. Major differences include a type II secretion system present only in the O55:H7 chromosome, fewer type III secretion system effectors in O55:H7, and 19 phage genomes or phagelike elements in O55:H7 compared to 23 in O157:H7, with only three common to both. Many other changes were found in both O55:H7 and O157:H7 lineages, but in general there has been more change in the O157:H7 lineages. For example, we found 50% more synonymous mutational substitutions in O157:H7 compared to O55:H7. The two strains also diverged at the proteomic level. Mutational synonymous SNPs were used to estimate a divergence time of 400 years using a new clock rate, in contrast to 14,000 to 70,000 years using the traditional clock rates. The same approaches were applied to three closely related extraintestinal pathogenic E. coli genomes, and similar levels of mutation and recombination were found. This study revealed for the first time the full range of events involved in the evolution of the O157:H7 clone from its O55:H7 ancestor, and suggested that O157:H7 arose quite recently. Our findings also suggest that E. coli has a much lower frequency of recombination relative to mutation than was observed in a comparable study of a Vibrio cholerae lineage. PMID:20090843

  16. Esophagogastric anastomosis in rats: Improved healing by BPC 157 and L-arginine, aggravated by L-NAME.

    Science.gov (United States)

    Djakovic, Zeljko; Djakovic, Ivka; Cesarec, Vedran; Madzarac, Goran; Becejac, Tomislav; Zukanovic, Goran; Drmic, Domagoj; Batelja, Lovorka; Zenko Sever, Anita; Kolenc, Danijela; Pajtak, Alen; Knez, Nikica; Japjec, Mladen; Luetic, Kresimir; Stancic-Rokotov, Dinko; Seiwerth, Sven; Sikiric, Predrag

    2016-11-07

    To cure typically life-threatening esophagogastric anastomosis in rats, lacking anastomosis healing and sphincter function rescue, in particular. Because we assume esophagogastric fistulas represent a particular NO-system disability, we attempt to identify the benefits of anti-ulcer stable gastric pentadecapeptide BPC 157, which was in trials for ulcerative colitis and currently for multiple sclerosis, in rats with esophagocutaneous fistulas. Previously, BPC 157 therapies have promoted the healing of intestinal anastomosis and fistulas, and esophagitis and gastric lesions, along with rescued sphincter function. Additionally, BPC 157 particularly interacts with the NO-system. In the 4 d after esophagogastric anastomosis creation, rats received medication (/kg intraperitoneally once daily: BPC 157 (10 μg, 10 ng), L-NAME (5 mg), or L-arginine (100 mg) alone and/or combined or BPC 157 (10 μg, 10 ng) in drinking water). For rats underwent esophagogastric anastomosis, daily assessment included progressive stomach damage (sum of the longest diameters, mm), esophagitis (scored 0-5), weak anastomosis (mL H2O before leak), low pressure in esophagus at anastomosis and in the pyloric sphincter (cm H2O), progressive weight loss (g) and mortality. Immediate effect assessed blood vessels disappearance (scored 0-5) at the stomach surface immediately after anastomosis creation. BPC 157 (all regimens) fully counteracted the perilous disease course from the very beginning (i.e., with the BPC 157 bath, blood vessels remained present at the gastric surface after anastomosis creation) and eliminated mortality. Additionally, BPC 157 treatment in combination with L-NAME nullified any effect of L-NAME that otherwise intensified the regular course. Consistently, with worsening (with L-NAME administration) and amelioration (with L-arginine), either L-arginine amelioration prevails (attenuated esophageal and gastric lesions) or they counteract each other (L-NAME + L-arginine); with the

  17. The promoting effect of pentadecapeptide BPC 157 on tendon healing involves tendon outgrowth, cell survival, and cell migration.

    Science.gov (United States)

    Chang, Chung-Hsun; Tsai, Wen-Chung; Lin, Miao-Sui; Hsu, Ya-Hui; Pang, Jong-Hwei Su

    2011-03-01

    Pentadecapeptide BPC 157, composed of 15 amino acids, is a partial sequence of body protection compound (BPC) that is discovered in and isolated from human gastric juice. Experimentally it has been demonstrated to accelerate the healing of many different wounds, including transected rat Achilles tendon. This study was designed to investigate the potential mechanism of BPC 157 to enhance healing of injured tendon. The outgrowth of tendon fibroblasts from tendon explants cultured with or without BPC 157 was examined. Results showed that BPC 157 significantly accelerated the outgrowth of tendon explants. Cell proliferation of cultured tendon fibroblasts derived from rat Achilles tendon was not directly affected by BPC 157 as evaluated by MTT assay. However, the survival of BPC 157-treated cells was significantly increased under the H(2)O(2) stress. BPC 157 markedly increased the in vitro migration of tendon fibroblasts in a dose-dependent manner as revealed by transwell filter migration assay. BPC 157 also dose dependently accelerated the spreading of tendon fibroblasts on culture dishes. The F-actin formation as detected by FITC-phalloidin staining was induced in BPC 157-treated fibroblasts. The protein expression and activation of FAK and paxillin were determined by Western blot analysis, and the phosphorylation levels of both FAK and paxillin were dose dependently increased by BPC 157 while the total amounts of protein was unaltered. In conclusion, BPC 157 promotes the ex vivo outgrowth of tendon fibroblasts from tendon explants, cell survival under stress, and the in vitro migration of tendon fibroblasts, which is likely mediated by the activation of the FAK-paxillin pathway.

  18. Evaluation of a novel antimicrobial solution and its potential for control E. coli O157:H7, non-O157:H7 shiga toxin-producing E. coli, Salmononella spp., and Listeria monocytogenes on beef

    Science.gov (United States)

    The goal of this study was to evaluate the efficacy of a novel antimicrobial solution made with chitosan, lauric arginate ester, and organic acids on Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and non-O157 shiga toxin-producing E. coli cocktails and to test its potential to b...

  19. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  20. 78 FR 54168 - Special Local Regulation, Cumberland River, Mile 157.0 to 159.0; Ashland City, TN

    Science.gov (United States)

    2013-09-03

    ... beginning at mile marker 157.0 and ending at mile marker 159.0, extending bank to bank. This zone is... ground floor of the Department of Transportation West ] Building, 1200 New Jersey Avenue SE., Washington... Purpose The Nashvegas Triathlon takes place on the Cumberland River from mile marker 157.0 to 159.0. The...

  1. 77 FR 26725 - Changes to FSIS Traceback, Recall Procedures for Escherichia coli O157:H7 Positive Raw Beef...

    Science.gov (United States)

    2012-05-07

    .... coli O157:H7. FSAs are complete investigations concerning the establishment's entire HACCP system. FSIS... effectiveness of HACCP measures in addressing the pathogen. Therefore, in order for a sampled and tested claim... its HACCP system measures designed to control for E. coli O157:H7, and it must use sampling and...

  2. Hha Represses Biofilm Formation in Escherichia coli O157:H7 by Affecting the Expression of Flagella and Curli Fimbriae

    Science.gov (United States)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a zoonotic pathogen that produces a broad-spectrum of diarrheal illnesses in infected humans. Although the genetic and molecular mechanisms enabling EHEC O157:H7 to produce characteristic adherence on epithelial cells are well characterized, the g...

  3. Evaluation of the Effects of SDIA, a LUXR Homologue, on Adherence and Motility of Escherichia coli O157:H7

    Science.gov (United States)

    Quorum-sensing (QS) signaling pathways are important regulatory networks for controlling the expression of genes promoting adherence of Enterohemorrhagic Escherichia coli (EHEC) O157:H7 to epithelial cells. A recent study has shown that EHEC O157:H7 encodes a luxR homologue, called sdiA¸ which upon...

  4. Control of VTEC O157 and Campylobacter jejuni/coli on cattle farms : Effective interventions and implementation

    NARCIS (Netherlands)

    Ellis-Iversen, J

    2009-01-01

    Verocytotoxogenic E. coli O157 (VTEC O157) and Campylobacter jejuni/coli are zoonotic pathogens of public health importance, which are commonly carried and shed by cattle. Control at farm level needed isto limit shedding and contamination of the environment and the human food chain. On- farm risk

  5. Functional metagenomics of Escherichia coli O157:H7 interactions with spinach indigenous microorganisms during biofilm formation

    Science.gov (United States)

    The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157) with spinach leaf microflora during co-colonization and establishment of a...

  6. Biofilm formation of non-O157 Shiga toxin-producing Escherichia coli (STEC) on equipment surfaces

    Science.gov (United States)

    Introduction: Shiga toxin-producing Escherichia coli (STEC) serotype O157:H7 has been the most commonly recognized STEC serotype responsible for foodborne outbreaks in the US. Numerous outbreaks associated with non-O157 serotypes have also been reported due to consumption of contaminated food. The ...

  7. Utilization of evolutionary model, bioinformatics and heuristics for development of a multiplex Escherichia coli O157:H7 PCR assay

    Science.gov (United States)

    Introduction: Escherichia coli O157:H7 is a devastating foodborne pathogen causing many foodborne outbreaks worldwide with significant morbidity and mortality. The plasticity of the E. coli O157:H7 genome, inconsistent expression of surface antigens, and sharing of genetic elements with other non-...

  8. Functional Metagenomics of Escherichia coli O157:H7 Interactions with Spinach Indigenous Microorganisms during Biofilm Formation

    Science.gov (United States)

    Carter, Michelle Q.; Xue, Kai; Brandl, Maria T.; Liu, Feifei; Wu, Liyou; Louie, Jacqueline W.; Mandrell, Robert E.; Zhou, Jizhong

    2012-01-01

    The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157) with spinach leaf indigenous microorganisms during co-colonization and establishment of a mixed biofilm on a stainless steel surface. Stainless steel surface was selected to mimic the surface of produce-processing equipment, where retention of foodborne pathogens such as EcO157 could serve as a potential source for transmission. We observed a positive effect of spinach-associated microbes on the initial attachment of EcO157, but an antagonistic effect on the EcO157 population at the later stage of biofilm formation. Metagenomic analyses of the biofilm community with the GeoChip revealed an extremely diverse community (gene richness, 23409; Shannon-Weiner index H, 9.55). Presence of EcO157 in the mixed biofilm resulted in a significant decrease in the community α-diversity (t test, Pbiofilm at 48 h (ANOVA, Pbiofilm is likely associated with its metabolic potential in utilizing spinach nutrients: the generation time of EcO157 in spinach lysates at 28°C is ∼ 38 min, which is comparable to that in rich broth. The significant decrease in the abundance of many genes involved in carbon, nitrogen, and phosphorus cycling in the EcO157-inoculated biofilms (t test, Pbiofilm species. PMID:22957052

  9. Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain

    NARCIS (Netherlands)

    Franz, E.; Bruggen, van A.H.C.

    2008-01-01

    There is an increased concern that plants might be more important as a carrier for human enteric pathogens like E. coli O157:H7 and Salmonella enterica serovars than previously thought. This review summarizes the knowledge available on the ecology of E. coli O157:H7 and Salmonella enterica in the

  10. Thermal inactivation of Escherichia coli O157:H7 in strawberry puree and its effect on anthocyanins and color

    Science.gov (United States)

    Raw whole strawberries, if contaminated with pathogens such as E. coli O157:H7, must be pasteurized prior to consumption. Therefore, the objective of this research was to investigate the thermal inactivation kinetics of E. coli O157:H7 in strawberry puree (SP), and evaluate the changes in anthocyan...

  11. Essential oils reduce Escherichia coli O157:H7 and Salmonella on spinach leaves without affecting produce quality

    Science.gov (United States)

    The efficacy of cinnamaldehyde and Sporan alone, or in combination with acetic acid in reducing E. coli O157:H7 and Salmonella on spinach leaves was investigated. Spinach leaves were inoculated with a cocktail of five-strain Salmonella or E. coli O157:H7, air-dried for 30 min, and then immersed in a...

  12. Comparative survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Murine Norovirus on spinach plants

    Science.gov (United States)

    Introduction: Outbreaks resulting from the consumption of leafy greens contaminated with E. coli O157:H7, Salmonella spp., and norovirus have occurred. It is unclear how the stress response factor rpoS in E. coli O157:H7 and Salmonella spp. affects their survival on spinach. Purpose: A comparison ...

  13. Detection and characterization of Escherichia coli O157:H7 from feral pigeon in Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Hossein Esameili

    2015-02-01

    Full Text Available Objective: To detect and characterize Escherichia coli (E. coli O157:H7 in feral pigeons in Qom province, Iran. Methods: In this survey, 290 cloacal samples were obtained from trapped feral pigeons in Qom province. Microbiological, biochemical and serological examinations were done to detect the E. coli O157:H7. Isolates were subjected to multiplex polymerase chain reaction for the detection of stx1, stx2, eaeA and hlyA genes. Results: Four samples (1.38% were positive for E. coli O157:H7 by using O157 and H7 antisera and only one E. coli O157:H7 strain isolated showed the presence of stx1, stx2, eaeA and hlyA genes. Conclusions: The results of present survey revealed that feral pigeons in Qom province had the potential to be a reservoir of E. coli O157:H7. The low prevalence of E. coli O157:H7 can be attributed to sampling each pigeon just once and fecal culture limits, and true prevalence of the E. coli O157:H7 might be higher than our findings.

  14. Pentadecapeptide BPC 157 reduces bleeding time and thrombocytopenia after amputation in rats treated with heparin, warfarin or aspirin.

    Science.gov (United States)

    Stupnisek, Mirjana; Franjic, Sandra; Drmic, Domagoj; Hrelec, Masa; Kolenc, Danijela; Radic, Bozo; Bojic, Davor; Vcev, Aleksandar; Seiwerth, Sven; Sikiric, Predrag

    2012-05-01

    Recently, in rat abdominal aorta terminoterminal-anastomosis the stable gastric pentadecapeptide BPC 157 prevents obstructive thrombus formation and rapidly destroys already formed obstructive thrombus. Also, BPC 157 wound healing may signify the clot as conductive matrix or "scaffold" to speed up wound healing process, and decrease bleeding. Here, in rats, BPC 157 (10 μg/kg, 10 ng/kg) improved always reduced bleeding time and amount of bleeding after (tail) amputation only, heparin (250 mg/kg, 25mg/kg, 10mg/kg i.v.), warfarin (1.5mg/kg i.g. once daily for 3 consecutive days), aspirin (0.1g/kg i.g. (once daily/3 consecutive days) or 1.0 g/kg i.p. once), and amputation associated with those agents application. BPC 157 counteracting regimens (i.v., i.p., i.g. (immediately after any challenge)) correspondingly follow the route of bleeding-agents application. All heparin-, warfarin-, and aspirin-rats and normal-rats that received BPC 157 exhibited lesser fall in platelets count. BPC 157 attenuated over-increased APTT-, TT-values in 10mg/kg heparin-rats, but did not influence heparin activity (anti-Xa test). Indicatively, unless counteracted in BPC 157 rats, excessive bleeding-acute thrombocytopenia (BPC 157 markedly prolongs the survival time (heparin-rats, 25mg/kg, right foot amputation). Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. A Novel Approach to Investigate Internalization of Escherichia coli O157:H7 in Lettuce and Spinach

    Science.gov (United States)

    The chromosomal integration of the green fluorescent protein (gfp) gene was successfully accomplished into four nalidixic acid resistant E. coli strains: two O157:H7 strains from produce outbreaks, 4407 and 5279, one O157:H7 strain from a beef-associated outbreak, 86-24h11, and a non-pathogenic comm...

  16. Distribution of the urease gene cluster among and urease activities of enterohemorrhagic Escherichia coli O157 isolates from humans

    NARCIS (Netherlands)

    Friedrich, Alexander W; Köck, Robin; Bielaszewska, Martina; Zhang, Wenlan; Karch, Helge; Mathys, Werner

    Enterohemorrhagic Escherichia coli (EHEC) O157 strains belong to two closely related major groups, which are differentiated by their sorbitol fermentation phenotypes. Here we studied the conservation of urease genes and their expression in sorbitol-fermenting (SF) and non-SF EHEC O157 isolates. PCR

  17. PREVALENCE OF VEROCYTOTOXIGENIC ESCHERICHIA-COLI SEROTYPE O157H7 IN CHILDREN WITH DIARRHEA ATTENDING A SYDNEY HOSPITAL

    NARCIS (Netherlands)

    ONG, J; ROBINSBROWNE, R; GAPES, M; OLOUGHLIN, EV

    Verotoxin producing Escherichia coli, in particular serotype O157:H7, have been implicated as an important cause of acute gastroenteritis in children. This study was undertaken to determine if E.coli O157:H7 is an important cause of acute gastroenteritis in children in metropolitan Sydney. During

  18. Evolution of a zoonotic pathogen: investigating prophage diversity in enterohaemorrhagic E. coli O157 by long-read sequencing

    Science.gov (United States)

    Enterohaemorrhagic Escherichia Coli (EHEC) is a zoonotic pathogen known to be potentially lethal in humans. Its main animal reservoir is ruminants, specifically cattle, and yearly outbreaks occur worldwide with the most prevalent serotype being EHEC O157:H7. Most virulence factors of EHEC O157, incl...

  19. Detecting and genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.; Brockman, Fred J.; Chandler, Darrell P.

    2001-07-05

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFUs ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  20. Detecting and Genotyping Escherichia coli O157:H7 using multiplexed PCR and nucleic acid microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Call, Douglas R.(Michigan, Univ Of - Ann Arbor); Brockman, Fred J.(BATTELLE (PACIFIC NW LAB)); Chandler, Darrell P.(Pacific Northwest National Laboratory)

    2000-12-01

    Rapid detection and characterization of food borne pathogens such as Escherichia coli O157:H7 is crucial for epidemiological investigations and food safety surveillance. As an alternative to conventional technologies, we examined the sensitivity and specificity of nucleic acid microarrays for detecting and genotyping E. coli O157:H7. The array was composed of oligonucleotide probes (25-30 mer) complementary to four virulence loci (intimin, Shiga-like toxins I and II, and hemolysin A). Target DNA was amplified from whole cells or from purified DNA via single or multiplexed polymerase chain reaction (PCR), and PCR products were hybridized to the array without further modification or purification. The array was 32-fold more sensitive than gel electrophoresis and capable of detecting amplification products from < 1 cell equivalent of genomic DNA (1 fg). Immunomagnetic capture, PCR and a microarray were subsequently used to detect 55 CFU ml-1 (E. coli O157:H7) from chicken rinsate without the aid of pre-enrichment. Four isolates of E. coli O157:H7 and one isolate of O91:H2, for which genotypic data were available, were unambiguously genotyped with this array. Glass based microarrays are relatively simple to construct and provide a rapid and sensitive means to detect multiplexed PCR products and the system is amenable to automation.

  1. Optical methods for detecting Escherichia coli O157:H7 spiked on cantaloupes

    Science.gov (United States)

    Tu, Shu-I.; Uknalis, Joseph; Gehring, Andrew

    2004-11-01

    Outbreaks of E. coli O157:H7 by the consumption of contaminated cantaloupes fruits have been documented. Pathogens harbored in the networked but porous veins in khaki colored skin are difficult to remove. Thus, sensitive and efficient methods are needed to detect the presence of E. coli O157:H7 in cantaloupes. In this work, known quantities of the E. coli were inoculated on cantaloupe skins or flesh at room temperature for 1 h. The contaminated samples were incubated in growth media at 37°C for 3.3h. The bacteria captured by magnetic beads coated with anti E. coli O157 antibodies were further sandwiched by second anti E. coli O157 antibodies containing peroxidase for chemiluminescent measurements of captured bacteria. Alternatively, the captured bacteria were treated with electron-shuttering reagent to detect the cellular level of NAD(P)H via bioluminescence. The detected enzyme activity (peroxidase) and the NAD(P)H were used to measure the presence of the pathogen. The results indicated both the chemiluminescence and the fluorescence methods, in 96 well microplate format, could be applied to detect the E. coli contamination of cantaloupes.

  2. 33 CFR 157.102 - Plans for foreign tank vessels: Submission.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Crude Oil Washing (COW) System on Tank Vessels General § 157.102 Plans for foreign...) The design of each COW machine; (c) The arrangement, location, and installation of the COW machines... nozzles of the COW machines on the surfaces of each tank, showing the surface areas not reached by direct...

  3. Karistusseadustiku § 157² probleeme Internetiga seotud identiteedivarguste kontekstis / Merika Nimmo

    Index Scriptorium Estoniae

    Nimmo, Merika, 1990-

    2014-01-01

    Karistusseadustikus §-s 157² sisalduv kuriteokoosseis ning selle reguleerimisala ja efektiivsus Internetiga seotud identiteedivarguste kontekstis. Artikkel põhineb Tartu Ülikooli õigusteaduskonnas 2014. a kevadel kaitstud magistritööl, mille teemaks on „Internetiga seotud identiteedivargus ja selle regulatsioon Eesti karistusõiguses“

  4. Whole-genome sequence of Escherichia coli serotype O157:H7 strain B6914-ARS

    Science.gov (United States)

    Escherichia coli serotype O157:H7 strain B6914-MS1 is a Shiga toxin-deficient human fecal isolate obtained by the Centers for Disease Control and Prevention that has been used extensively in applied research studies. Here we report the genome sequence of strain B6914-ARS, a B6914-MS1 clone that has ...

  5. the occurrence of escherichia coli o157:h7 in market and abattoir ...

    African Journals Online (AJOL)

    user

    The severity of the infections caused by this food borne pathogen in the young and ... diseases. One strain in particular, named E. coli. O157:H7 can cause severe bloody diarrhoea leading to hemorrhagic colitis and in some cases leads to serious complications such as hemolytic ... pasteurized milk and juice are becoming.

  6. The occurrence of Escherichia coli O157:H7 in market and abattoir ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is a newly emerging pathogen frequently associated with the consumption of foods of bovine origin. The severity of the infections caused by this food borne pathogen in the young and the elderly has had a tremendous impact on human health and food industry. The present study evaluated the ...

  7. Proliferation of Escherichia coli O157:H7 in soil and hydroponic microgreen production systems

    Science.gov (United States)

    Radish (Raphanus sativus var. longipinnatus) microgreens were produced from seeds inoculated with Escherichia coli O157: H7 using soil substitute and hydroponic production systems. E. coli populations on the edible and inedible parts of harvested microgreen plants and in growth medium were examined....

  8. Fingerprints of resistant Escherichia coli O157:H7 from vegetables and environmental samples

    Science.gov (United States)

    In the last decade, increases in E. coli O157:H7 outbreaks linked to fresh produce had been associated with contaminated irrigation water. However, studies on antibiotics resistance in E. coli associated with fresh produce impacted by contaminated water in Nigeria is very limited. The aim of this st...

  9. Effect of green manure on E. coli O157:H7 survival in soil

    Science.gov (United States)

    Green manure is the remnants of crops (stems, outer leaves, tops of leaves, etc.) that remain in the field after harvest, and are plowed back into the field to increase fertility. The role of green manure in the survival of E. coli O157:H7 in soil has not been examined. We evaluated three types of g...

  10. 75 FR 17125 - Foreign-Trade Zone 157-Casper, Wyoming, Application for Expansion

    Science.gov (United States)

    2010-04-05

    ... Foreign-Trade Zones Board Foreign-Trade Zone 157--Casper, Wyoming, Application for Expansion An application has been submitted to the Foreign-Trade Zones Board (the Board) by the Casper/Natrona County..., Wyoming. The application was submitted pursuant to the provisions of the Foreign-Trade Zones Act, as...

  11. Prevalence of VTEC O157 in dairy and veal herds and risk factors for veal herds

    NARCIS (Netherlands)

    Berends, I.M.G.A.; Graat, E.A.M.; Swart, W.A.J.M.; Weber, M.F.; Giessen, van de A.W.; Lam, T.J.G.M.; Heuvelink, A.E.; Weering, H.J.

    2008-01-01

    The aim of this study was to determine the herd prevalence of veal and dairy herds and to identify risk factors for VTEC O157 positive veal herds. The study was based on monitoring data from November 1996 through July 2005 of 1051 dairy herds and 930 veal herds. The herd level prevalence (95% CI)

  12. A COINCIDENCE STUDY OF MULTIPLE-ELECTRON CAPTURE IN N-15(7+)-AR COLLISIONS

    NARCIS (Netherlands)

    DENIJS, G; HOEKSTRA, R; MORGENSTERN, R

    1994-01-01

    We present energy spectra of autoionization electrons resulting from collisions between fully stripped N-15(7+) ions and Ar in the energy range of 1-10 keV amu-1. These spectra have been measured in coincidence with charge-state analysed Ar ions. Observed populations of the various configurations

  13. Investigation of E. coli O157:H7 Mixed-Species Biofilm Formation

    Science.gov (United States)

    During 2006, there were three multi-state produce-associated outbreaks of E. coli O157:H7, two of which involved the state of Pennsylvania. In September, 26 states reported illnesses linked to spinach, which resulted in 205 confirmed cases of illness and 3 deaths (1). In November, 5 states reported ...

  14. 40 CFR 86.157-98 - Refueling test procedures for liquefied petroleum gas-fueled vehicles.

    Science.gov (United States)

    2010-07-01

    ... Light-Duty Trucks and New Otto-Cycle Complete Heavy-Duty Vehicles; Test Procedures § 86.157-98 Refueling... shall be performed for each fuel tank. (e) Records required. (1) Test: test number, system or device... total refueling mass emissions by the total gallons of fuel dispensed in the refueling test (see...

  15. Impact of indigenous microorganisms on Escherichia coli O157:H7 growth in cured compost.

    Science.gov (United States)

    Kim, Jinkyung; Miller, Cortney M; Shepherd, Marion W; Liu, Xiaohua; Jiang, Xiuping

    2011-10-01

    Both autoclaving and dry-heat treatments were applied to dairy manure-based compost to achieve target populations of indigenous microorganisms. A 3 strain-mixture of Escherichia coli O157:H7 of ca. 2 log CFU/g was inoculated into acclimated autoclaved compost (AAC) and dry heat-treated compost (DHTC) with different moistures, and stored at 8, 22, or 30 °C. Only selected groups of microorganisms grew in AAC during acclimation, whereas the relative ratio of each group of microorganisms was maintained in DHTC after heat treatment. E. coli O157:H7 grew more in AAC than DHTC in the presence of same level of indigenous mesophiles. However, control compost (no heat treatment) did not support E. coli O157:H7 growth. Our results revealed that both the type and population of indigenous microorganisms is critical for suppressing E. coli O157:H7 growth in compost, and dry-heat treatment can result in a compost product which resembles cured compost with different levels of indigenous microorganisms. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. 20 CFR 655.157 - Withholding of U.S. workers prohibited.

    Science.gov (United States)

    2010-04-01

    ... TEMPORARY EMPLOYMENT OF FOREIGN WORKERS IN THE UNITED STATES Labor Certification Process for Temporary Agricultural Employment in the United States (H-2A Workers) Post-Acceptance Requirements § 655.157 Withholding... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Withholding of U.S. workers prohibited. 655...

  17. 18 CFR 157.9 - Notice of application and notice of schedule for environmental review.

    Science.gov (United States)

    2010-04-01

    ... § 157.9 Notice of application and notice of schedule for environmental review. (a) Notice of each... schedule for the environmental review will be issued within 90 days of the notice of the application, and... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice of application...

  18. Abdominal aorta anastomosis in rats and stable gastric pentadecapeptide BPC 157, prophylaxis and therapy.

    Science.gov (United States)

    Hrelec, M; Klicek, R; Brcic, L; Brcic, I; Cvjetko, I; Seiwerth, S; Sikiric, P

    2009-12-01

    We focused on abdominal aorta, clamped and transected bellow renal arteries, and aortic termino-terminal anastomosis created in Albino male rats. We suggested stomach cytoprotection theory holding endothelium protection and peptidergic anti-ulcer cytoprotection therapy to improve management of abdominal aorta anastomosis and thrombus formation. The stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, MW 1419) is a small anti-ulcer peptide efficient in inflammatory bowel disease trials (PL 14736) and various wound treatment, no toxicity reported. After 24 h following aortic termino-terminal anastomosis, we shown that BPC 157 (10 microg/kg) may also decrease formation of cloth after aortic termino-terminal anastomosis and preserved walking ability and muscle strength when given as a bath immediately after aortic anastomosis creation. This may be important since aortic termino-terminal anastomosis is normally presenting in rats with a formed cloth obstructing more than third of aortic lumen, severely impaired walking ability, painful screaming and weak muscle strength. Thereby, the effect of BPC 157 (10 microg/kg) was additionally studied at 24 h following aortic termino-terminal anastomosis. Given at the that point, intraperitoneally, within 3 minutes post-application interval the pentadecapeptide BPC 157 rapidly recovered the function of lower limbs and muscle strength while no cloth could be seen in those rats at the anastomosis site.

  19. Gene Expression during Survival of Escherichia coli O157:H7 in Soil and Water

    Directory of Open Access Journals (Sweden)

    Ashley D. Duffitt

    2011-01-01

    Full Text Available The in vitro survival of Escherichia coli O157:H7 at 15∘C under two experimental conditions (sterile soil and sterile natural water was examined. DNA microarrays of the entire set of E. coli O157:H7 genes were used to measure the genomic expression patterns after 14 days. Although the populations declined, some E. coli O157:H7 cells survived in sterile stream water up to 234 days and in sterile soil for up to 179 days. Cells incubated in soil microcosms for 14 days expressed genes for antibiotic resistance, biosynthesis, DNA replication and modification, metabolism, phages, transposons, plasmids, pathogenesis and virulence, antibiotic resistance, ribosomal proteins, the stress response, transcription, translation, and transport and binding proteins at significantly higher levels than cells grown in Luria broth. These results suggest that E. coli O157:H7 may develop a different phenotype during transport through the environment. Furthermore, this pathogen may become more resistant to antibiotics making subsequent infections more difficult to treat.

  20. Escherichia coli O157 Infection and Secondary Spread, Scotland, 1999–2008

    Science.gov (United States)

    Pollock, Kevin G.J.; Allison, Lesley J.; Rae, Linda; Hanson, Mary F.; Cowden, John M.

    2011-01-01

    To determine the proportion of Escherichia coli O157 cases in Scotland attributable to secondary spread, we analyzed data obtained through entire-population enhanced surveillance. We identified 11% of cases as secondary. Secondary cases in single households were younger than secondary cases in outbreaks affecting >1 household and had similar risk for hemolytic uremic syndrome. PMID:21392450

  1. Escherichia coli O157 in foodstuffs: first year results of monitoring plan in Piedmont region, 2011

    Directory of Open Access Journals (Sweden)

    Antonio Barbaro

    2012-10-01

    Full Text Available A total of 260 food samples were examined for the presence of Shiga toxin-producing Escherichia coli O157 (STEC O157. Samples were collected between May 2011 and September 2011 in Piedmont region and included 120 minced meat and meat preparation (hamburger and meat balls and 180 soft and semi-soft cheeses made from raw milk with less than 60 days of ripening. Samples were collected at re-tail level. All samples were tested using an Enzyme Linked Fluorescent Assay (ELFA (AFNOR BIO 12/8 - 07/00, with kit VIDAS® ECO (bioMérieux; if positive, the samples have been tested with VIDAS® ICE and spread onto selective media to allow the growth of the strains. If present, all the strains have been tested to detect the genes encoding the pathogen factors (stx1, stx2 and eae. STEC O157 was not detected in any products. This survey on the presence of STEC O157 in foodstuffs provided data, demonstrating a low prevalence of the pathogen in our Region.

  2. 33 CFR 157.415 - Bridge resource management policy and procedures.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Bridge resource management policy... Petroleum Oils § 157.415 Bridge resource management policy and procedures. (a) Not later than February 1... resources are being allocated and used, based on bridge resource management principles. This written policy...

  3. Variable colonization of chickens perorally inoculated with Escherichia coli O157:H7 and subsequent contamination of eggs.

    OpenAIRE

    Schoeni, J L; Doyle, M P

    1994-01-01

    Challenging 1-day-old White Leghorn chicks perorally with 2.6 x 10(1) to 2.6 x 10(5) Escherichia coli O157:H7 bacteria per chick resulted in cecal colonization at all levels. Two of six chicks inoculated with only 2.6 x 10(1) E. coli O157:H7 bacteria carried 10(3) to 10(4) E. coli O157:H7 bacteria per g of cecal tissue when sacrificed 3 months postinoculation. E. coli O157:H7 colonization persisted at least 10 to 11 months when chicks were administered 10(8) E. coli O157:H7 bacteria. Eggs fro...

  4. Stress in Gastrointestinal Tract and Stable Gastric Pentadecapeptide BPC 157. Finally, do we have a Solution?

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Drmic, Domagoj; Stupnisek, Mirjana; Kokot, Antonio; Sever, Marko; Zoricic, Ivan; Zoricic, Zoran; Batelja, Lovorka; Ziger, Tihomil; Luetic, Kresimir; Vlainic, Josipa; Rasic, Zarko; Bencic, Martina Lovric

    2017-01-01

    Selye's syndrome produced by diverse nocuous agents and "response to damage as such" means Selye's stress triad in stress coping response to reestablish homeostasis. Logically, from the gastrointestinal tract viewpoint, such organoprotective/healing response implies the angiogenic growth factors that commonly signify the healing. Thereby, the gastric pentadecapeptide BPC 157-organoprotection (huge range of beneficial effects) signifies the Selye's stress concept/stress coping response implemented in and from gastrointestinal tract, and BPC 157 as an integrative mediator that integrates the adaptive bodily response to stress. In clinical trials without side effects, LD1 not achieved, BPC 157 healing in gastrointestinal tract, and particularly the healing of the extragastrointestinal tissues (i.e., skin/tendon/ligament/muscle/bone; nerve; cornea/ brain) were referred throughout its integrative capabilities (i.e., ulcerative colitis/multiple sclerosis model equally counteracted), native in gastrointestinal tract, stability in human gastric juice (and thereby, strong efficacy and applicability), its relevance for dopamine-system function (and thereby, counteracting effects of dopamine-system dysfunction and overfunction, centrally and peripherally (mucosa maintenance); interaction with serotonin- and GABA-system)), afforded cytoprotection/adaptive cytoprotection/organoprotection (and thereby, beneficial effects on gastric and whole intestinal tract lesions and adaptation, wounds and fistulas healing, blood vessels, somatosensory neurons, NSAIDs-side effects (including also pancreas, liver, brain lesions, and blood disturbances, prolonged bleeding, thrombocytopenia, thrombosis)). Further, we combine such gut-brain axis and the NO-system where BPC 157 counteracts complications of either L-NAME application (i.e., various lesions aggravation, hypertension) or Larginine application (i.e., hypotension, prolonged bleeding, thrombocytopenia). Also, BPC 157 particularly affects

  5. Survival of Escherichia coli O157:H7 during manufacture and storage of white brined cheese.

    Science.gov (United States)

    Osaili, Tareq M; Al-Nabulsi, Anas A; Olaimat, Amin N; Shaker, Reyad R; Taha, Mohammad; Holley, Richard A

    2014-09-01

    Escherichia coli O157:H7 is a major foodborne pathogen that causes severe disease in humans. Survival of E. coli O157:H7 during processing and storage of white brined cheese was investigated. Cheeses were prepared using pasteurized milk inoculated with a 4 strain E. coli O157:H7 cocktail (7 log(10) CFU/g) with or without yogurt starter culture (Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus salivarius ssp. thermophilus) and stored in 10% or 15% NaCl brine at 10 and 21 ºC for 28 d. NaCl concentration, water activity (a(w)), pH, and numbers of E. coli O157:H7 and lactic acid bacteria (LAB) were determined in cheese and brine. E. coli O157:H7 was able to survive in cheese stored in both brines at 10 and 21 ºC regardless of the presence of starter LAB, although the latter significantly enhanced E. coli O157:H7 reduction in cheese or its brine at 10 ºC. E. coli O157:H7 numbers were reduced by 2.6 and 3.4 log(10) CFU/g in cheese stored in 10% and 15% NaCl brine, respectively, in the presence of starter LAB and by 1.4 and 2.3 log(10) CFU/g, respectively, in the absence of starter LAB at 10 ºC. The pathogen survived, but at lower numbers in the brines. The salt concentration of cheese stored in 10% brine remained about 5% during ripening, but in 15% brine, the NaCl level increased 1.6% to 8.1% (w/w) by 28 d. Values of pH and a(w) slightly decreased 1 d after exposure to brine and reached 5.5 to 6.6 and 0.88 to 0.94, respectively, in all treatments. © 2014 Institute of Food Technologists®

  6. Occurrence of Escherichia coli O157 in raw material and food in Czech Republic.

    Science.gov (United States)

    Lukásová, J; Abraham, B; Cupáková, S

    2004-03-01

    The study was carried out to investigate the incidence of Escherichia coli O157 in raw materials, foodstuffs and the agricultural environment. Of a total of 987 samples examined, 22 strains (2.2%) were identified as E. coli O157 and 10 of them as E. coli O157:H7. Cefixime-Tellurite MacConkey sorbitol agar (CT-SMAC) agar and Biosynth culture medium (BCM) E. coli O157:7 medium were used for the isolation. The virulence factors (stx1, stx2, eae, and ehxA genes) were identified by polymerase chain reaction (PCR). Most strains were isolated from the mechanically deboned poultry meat (nine), minced meat (six) and raw milk (four). One strain was isolated from beef carcass and two strains from waste water. No strains were were found in mass for sausages, refreshment salads, swabs of pork and poultry carcasses and faeces of cattle and pigs. Ten strains from the 22 identified proved to be positive for all factors of virulence. They were isolated from minced meat (four), raw milk (four), waste water (one) and swab from beef carcass (one). Sensitivity to the antimicrobial drugs ampicillin (AMS), ampicillin-sublactam (SAM), tetracycline (TET), ofloxacine (OFL), cefuroxime (CRX), chloramphenicol (CPM), gentamicine (GEN), colistin (COL), cephalozine (CLZ), cefoxitin (CXT), aztreonam (AZT), and sulphamethoxazole + trimethoprim (COT) was tested using the standard dilution technique and disc diffusion test. Minimum inhibitory concentrations (MIC) characteristics (MIC(50), MIC(90), MIC range) and inhibitory zone diameter were determined for each strain. As determined by MICs, the resistance to tested antibiotics in E. coli O157 isolates was found to AMS (90.9%), CLZ (81.8%), CRX (63.6%), CXT (72.7%), CPM (72.7%), TET (81.8%), SAM (59.1%), COT (9.1%), COL (63.61%), AZT (9%) and GEN (4.5%). The similar results were obtained using the disc diffusion method. The differences were found relating to SAM, CXT, CMO and TET. Resistance against one or more antibiotics was found in 95.4% of E

  7. Electrical DNA biosensor using aluminium interdigitated electrode for E.Coli O157:H7 detection

    Science.gov (United States)

    Natasha, N. Z.; Rajapaksha, R. D. A. A.; Uda, M. N. A.; Hashim, U.

    2017-09-01

    Escherichia Coli (E.Coli) O157:H7 is the one of the most dangerous foodborne pathogens based diseases that presence in our daily life that causes illness and death increase every year. Aluminum Interdigitated Electrode (Al IDE) biosensor was introduced to detect E.Coli O157:H7 in earlier stage. In this paper we investigated ssDNA of E.Coli O157:H7 bacteria detection through electrical behavior of Al IDE sensor. The physical properties of Al IDE biosensor has been characterized using Low Power Microscope (LPM), High Power Microscope (HPM), Scanning Electron Microscope (SEM) and 3D Nano Profiler. The bare Al IDE was electrical characterized by using I-V measurement. The surface modification was accomplished by salinization using APTES and immobilization using Carboxylic Probe E.Coli which was the first step in preparing Al IDE biosensor. Geared up prepared biosensor was hybridized with complementary, non-complementary and single based mismatch ssDNA to confirmed specificity detection of E Coli O157:H7 ssDNA target. The Current - Voltage was performed for each step such as bare Al IDE, surface modification, immobilization and hybridization. Sensitivity measurement was accomplished using different concentration of complementary ssDNA target from 1 fM - 10 µM. Selectivity measurements was achieved using same concentration which was 10 µM concentration for complement, non-complement and mismatch E.Coli O157:H7 ssDNA target. It's totally proved that the Al IDE able to detect specific and small current down to Femtomolar concentration.

  8. Dual gold nanoparticle lateflow immunoassay for sensitive detection of Escherichia coli O157:H7.

    Science.gov (United States)

    Chen, Minghui; Yu, Zhibiao; Liu, Daofeng; Peng, Tao; Liu, Kun; Wang, Shuying; Xiong, Yonghua; Wei, Hua; Xu, Hengyi; Lai, Weihua

    2015-05-30

    Two patterns of signal amplification lateral flow immunoassay (LFIA), which used anti-mouse secondary antibody-linked gold nanoparticle (AuNP) for dual AuNP-LFIA were developed. Escherichia coli O157:H7 was selected as the model analyte. In the signal amplification direct LFIA method, anti-mouse secondary antibody-linked AuNP (anti-mouse-Ab-AuNP) was mixed with sample solution in an ELISA well, after which it was added to LFIA, which already contained anti-E. coli O157:H7 monoclonal antibody-AuNP (anti-E. coli O157:H7-mAb-AuNP) dispersed in the conjugate pad. Polyclonal antibody was the test line, and anti-mouse secondary antibody was the control line in nitrocellulose (NC) membrane. In the signal amplification indirect LFIA method, anti-mouse-Ab-AuNP was mixed with sample solution and anti-E. coli O157:H7-mAb-AuNP complex in ELISA well, creating a dual AuNP complex. This complex was added to LFIA, which had a polyclonal antibody as the test line and secondary antibody as the control line in NC membrane. The detection sensitivity of both LFIAs improved 100-fold and reached 1.14×10(3) CFU mL(-1). The 28 nm and 45 nm AuNPs were demonstrated to be the optimal dual AuNP pairs. Signal amplification LFIA was perfectly applied to the detection of milk samples with E. coli O157:H7 via naked eye observation. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Corticosteroid-impairment of healing and gastric pentadecapeptide BPC-157 creams in burned mice.

    Science.gov (United States)

    Sikiric, P; Seiwerth, S; Mise, S; Staresinic, M; Bedekovic, V; Zarkovic, N; Borovic, S; Gjurasin, M; Boban-Blagaic, A; Batelja, L; Rucman, R; Anic, T

    2003-06-01

    The amelioration of corticosteroid-impairment of healing by a stable gastric pentadecapeptide BPC-157 (GEPPPGKPADDAGLV, M(w) 1419, currently in early clinical trials for inflammatory bowel disease) was studied in thermally injured mice. Its effects on corticosteroid impaired healing of deep partial skin thickness burns, and burn-gastric lesions were investigated. Male NMRI-Hannover mice (sacrificed at 1-3,7,14 and 21 days following burning 20% of total burn area at the back (open flame for 7s) received intraperitoneally (per kg bw) 6alpha-methylprednisolone (Depo-medrol, 1.0 or 10.0mg), or an equal volume of saline (5.0 ml), once daily, first application 30 min after injury, last 24h before sacrifice. The injury was subsequently treated by topical application of a thin layer of pentadecapeptide BPC-157 cream at three different levels a neutral cream of no treatment. Pentadecapeptide BPC-157 consistently improved given burn healing (both microscopical and tensionmetry assessment), and counteracted corticosteroid-impairment of burn healing. In burn-gastric lesions investigation of the effects of BPC showed an anti-ulcer effect of its own in burned non-corticosteroid-treated mice and potentiated the anti-ulcer effect observed in 6alpha-methylprednisolone-treated mice. Pentadecapeptide BPC-157 inhibited corticosteroid immunosuppression. In vitro, in spleenic cells assessment, animals (sacrificed at day 21) treated with 6alpha-methylprednisolone 1mg showed decreased reactivity to nitrogen in comparison with control, healthy animals, while the addition of BPC-157 (1 microg/g cream) returned cell reactivity to values noted in control healthy animals.

  10. Diarrhea Incidence and Farm-Related Risk Factors for Escherichia coli O157:H7 and Campylobacter jejuni Antibodies among Rural Children

    National Research Council Canada - National Science Library

    Edward A. Belongia; Po-Huang Chyou; Robert T. Greenlee; Guillermo Perez-Perez; William F. Bibb; Edna O. DeVries

    2003-01-01

    .... Antibodies to Campylobacter jejuni and Escherichia coli O157:H7 lipopolysaccharide (O157 LPS) immunoglobulin G were measured, and the incidence of clinic visits for diarrheal illness was determined...

  11. Host Inflammatory Response Inhibits Escherichia coli O157:H7 Adhesion to Gut Epithelium through Augmentation of Mucin Expression

    Science.gov (United States)

    Xue, Yansong; Zhang, Hanying; Wang, Hui; Hu, Jia; Du, Min

    2014-01-01

    Escherichia coli O157:H7, a major Shiga toxin-producing pathogen, has a low infectious dose and causes serious illness in humans. The gastrointestinal tract of cattle is the primary reservoir of E. coli O157:H7, and thus, it is critical to eliminate or reduce E. coli O157:H7 gut colonization. Given that E. coli O157:H7 produces effectors that attenuate inflammatory signaling, we hypothesized that the host inflammatory response acts to perturb E. coli O157:H7 intestinal colonization. Tumor necrosis factor alpha (TNF-α) treatment of HT-29 cells resulted in increased expression of inflammatory cytokine interleukin 1β (IL-1β), IL-8, and TNF-α genes and increased IL-8 protein and resulted in decreased adhesion of E. coli O157:H7. Similarly, E. coli O157:H7 adhesion to cattle colonic explants was reduced by TNF-α treatment. Irrespective of the presence of E. coli O157:H7, TNF-α enhanced activation of p65, the key mediator of NF-κB inflammatory signaling, whereas E. coli O157:H7 infection suppressed this pathway by inhibiting p65 activation in HT-29 cells. To further explore the mechanisms linking the inflammatory response to attenuated E. coli O157:H7 adhesion, mucin 2 (MUC2) expression was analyzed, considering that the intestinal mucus layer is the first defense against enteric pathogens and MUC2 is the major secretory mucin in the intestine. MUC2 expression in HT-29 cells was increased by TNF-α treatment and by E. coli O157:H7 infection. However, reducing mucin expression by blocking mitogen-activated protein kinase (MAPK) extracellular signal-regulated protein kinases 1/2 (ERK1/2) and/or phosphatidylinositol 3-kinase (PI3K)/Akt signaling increased E. coli O157:H7 adherence to HT-29 cells. These data suggest that the inflammatory cytokine response acts to protect host epithelial cells against E. coli O157:H7 colonization, at least in part, by promoting mucin production. PMID:24566630

  12. Intermittent Escherichia coli O157:H7 colonisation at the terminal rectum mucosa of conventionally-reared lambs§

    Science.gov (United States)

    Best, Angus; Clifford, Derek; Crudgington, Bentley; Cooley, William A.; Nunez, Alejandro; Carter, Ben; Weyer, Ute; Woodward, Martin J.; La Ragione, Roberto M.

    2009-01-01

    In cattle, the lymphoid rich regions of the rectal-anal mucosa at the terminal rectum are the preferred site for Escherichia coli O157:H7 colonisation. All cattle infected by rectal swab administration demonstrate long-term E. coli O157:H7 colonisation, whereas orally challenged cattle do not demonstrate long-term E. coli O157:H7 colonisation in all animals. Oral, but not rectal challenge of sheep with E. coli O157:H7 has been reported, but an exact site for colonisation in sheep is unknown. To determine if E. coli O157:H7 can effectively colonise the ovine terminal rectum, in vitro organ culture (IVOC) was initiated. Albeit sparsely, large, densely packed E. coli O157:H7 micro-colonies were observed on the mucosa of ovine and control bovine terminal rectum explants. After necropsy of orally inoculated lambs, bacterial enumeration of the proximal and distal gastrointestinal tract did suggest a preference for E. coli O157:H7 colonisation at the ovine terminal rectum, albeit for both lymphoid rich and non-lymphoid sites. As reported for cattle, rectal inoculation studies were then conducted to determine if all lambs would demonstrate persistent colonisation at the terminal rectum. After necropsy of E. coli O157:H7 rectally inoculated lambs, most animals were not colonised at gastrointestinal sites proximal to the rectum, however, large densely packed micro-colonies of E. coli O157:H7 were observed on the ovine terminal rectum mucosa. Nevertheless, at the end point of the study (day 14), only one lamb had E. coli O157:H7 micro-colonies associated with the terminal rectum mucosa. A comparison of E. coli O157:H7 shedding yielded a similar pattern of persistence between rectally and orally inoculated lambs. The inability of E. coli O157:H7 to effectively colonise the terminal rectum mucosa of all rectally inoculated sheep in the long term, suggests that E. coli O157:H7 may colonise this site, but less effectively than reported previously for cattle. PMID:18959839

  13. 18 CFR Appendix I to Subpart F of... - Procedures for Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i)

    Science.gov (United States)

    2010-04-01

    ... Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i) I Appendix I to Subpart F of... Transactions and Abandonment Pt. 157, Subpt. F, App. I Appendix I to Subpart F of Part 157—Procedures for Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i) The following procedures apply to...

  14. Spread and change in stress resistance of Shiga toxin-producing Escherichia coli O157 on fungal colonies.

    Science.gov (United States)

    Lee, Ken-Ichi; Kobayashi, Naoki; Watanabe, Maiko; Sugita-Konishi, Yoshiko; Tsubone, Hirokazu; Kumagai, Susumu; Hara-Kudo, Yukiko

    2014-11-01

    To elucidate the effect of fungal hyphae on the behaviour of Shiga toxin-producing Escherichia coli (STEC) O157, the spread and change in stress resistance of the bacterium were evaluated after coculture with 11 species of food-related fungi including fermentation starters. Spread distances of STEC O157 varied depending on the co-cultured fungal species, and the motile bacterial strain spread for longer distances than the non-motile strain. The population of STEC O157 increased when co-cultured on colonies of nine fungal species but decreased on colonies of Emericella nidulans and Aspergillus ochraceus. Confocal scanning microscopy visualization of green fluorescent protein-tagged STEC O157 on fungal hyphae revealed that the bacterium colonized in the water film that existed on and between hyphae. To investigate the physiological changes in STEC O157 caused by co-culturing with fungi, the bacterium was harvested after 7 days of co-culturing and tested for acid resistance. After co-culture with eight fungal species, STEC O157 showed greater acid resistance compared to those cultured without fungi. Our results indicate that fungal hyphae can spread the contamination of STEC O157 and can also enhance the stress resistance of the bacteria. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  15. Effect of Neem (Azadirachta indica) on the Survival of Escherichia coli O157:H7 in Dairy Manure.

    Science.gov (United States)

    Ravva, Subbarao V; Korn, Anna

    2015-07-10

    Escherichia coli O157:H7 (EcO157) shed in cattle manure can survive for extended periods of time and intervention strategies to control this pathogen at the source are critical as produce crops are often grown in proximity to animal raising operations. This study evaluated whether neem (Azadirachta indica), known for its antimicrobial and insecticidal properties, can be used to amend manure to control EcO157. The influence of neem materials (leaf, bark, and oil) on the survival of an apple juice outbreak strain of EcO157 in dairy manure was monitored. Neem leaf and bark supplements eliminated the pathogen in less than 10 d with a D-value (days for 90% elimination) of 1.3 d. In contrast, nearly 4 log CFU EcO157/g remained after 10 d in neem-free manure control. The ethyl acetate extractable fraction of neem leaves was inhibitory to the growth of EcO157 in LB broth. Azadirachtin, a neem product with insect antifeedant properties, failed to inhibit EcO157. Application of inexpensive neem supplements to control pathogens in manure and possibly in produce fields may be an option for controlling the transfer of foodborne pathogens from farm to fork.

  16. Effect of Neem (Azadirachta indica on the Survival of Escherichia coli O157:H7 in Dairy Manure

    Directory of Open Access Journals (Sweden)

    Subbarao V. Ravva

    2015-07-01

    Full Text Available Escherichia coli O157:H7 (EcO157 shed in cattle manure can survive for extended periods of time and intervention strategies to control this pathogen at the source are critical as produce crops are often grown in proximity to animal raising operations. This study evaluated whether neem (Azadirachta indica, known for its antimicrobial and insecticidal properties, can be used to amend manure to control EcO157. The influence of neem materials (leaf, bark, and oil on the survival of an apple juice outbreak strain of EcO157 in dairy manure was monitored. Neem leaf and bark supplements eliminated the pathogen in less than 10 d with a D-value (days for 90% elimination of 1.3 d. In contrast, nearly 4 log CFU EcO157/g remained after 10 d in neem-free manure control. The ethyl acetate extractable fraction of neem leaves was inhibitory to the growth of EcO157 in LB broth. Azadirachtin, a neem product with insect antifeedant properties, failed to inhibit EcO157. Application of inexpensive neem supplements to control pathogens in manure and possibly in produce fields may be an option for controlling the transfer of foodborne pathogens from farm to fork.

  17. Survival of Escherichia coli O157:H7 in ground beef jerky assessed on two plating media.

    Science.gov (United States)

    Harrison, J A; Harrison, M A; Rose, R A

    1998-01-01

    Recent outbreaks of food-borne illness due to Salmonella spp. in beef jerky and Escherichia coli O157:H7 in venison jerky, coupled with the fact that a variety of preparation methods and dying procedures abound, raise concern over the safety of processed meat products made in the home. The potential of injured bacterial cells to regain the ability to cause illness is a particular threat with pathogens such as E. coli O157:H7, which is believed to have a low infectious dose. This study examined the efficacy of various methods of jerky preparation in reducing populations of E, coli O157:H7 in ground beef jerky and compared the recovery rate of E. coli O157:H7 on two selective plating media, modified sorbitol MacConkey agar (MSMA) and modified eosin methylene blue agar (MEMB). Populations of E. coli O157:H7 in both heated and unheated samples exhibited a greater decline during drying when a nitrite and salt cure mix was added during jerky preparation. When recovery of E. coli O157:H7 on MSMA and MEMB was compared, a trend toward slightly higher recovery rates with MEMB was observed. On the basis of these results, MEMB is a suitable alternative to MSMA for the recovery of E. coli O157:H7 from heated and dried meat samples similar to beef jerky.

  18. Subtractive Inhibition Assay for the Detection of E. coli O157:H7 Using Surface Plasmon Resonance

    Directory of Open Access Journals (Sweden)

    Chengyan Si

    2011-03-01

    Full Text Available A surface plasmon resonance (SPR immunosensor was developed for the detection of E. coli O157:H7 by means of a new subtractive inhibition assay. In the subtractive inhibition assay, E. coli O157:H7 cells and goat polyclonal antibodies for E. coli O157:H7 were incubated for a short of time, and then the E. coli O157:H7 cells which bound antibodies were removed by a stepwise centrifugation process. The remaining free unbound antibodies were detected through interaction with rabbit anti-goat IgG polyclonal antibodies immobilized on the sensor chip using a BIAcore 3000 biosensor. The results showed that the signal was inversely correlated with the concentration of E. coli O157:H7 cells in a range from 3.0 × 104 to 3.0 × 108 cfu/mL with a detection limit of 3.0 × 104 cfu/mL. Compared with direct SPR by immobilizing antibodies on the chip surface to capture the bacterial cells and ELISA for E. coli O157:H7 (detection limit: both 3.0 × 105 cfu/mL in this paper, the detection limit of subtractive inhibition assay method was reduced by one order of magnitude. The method simplifies bacterial cell detection to protein-protein interaction, which has the potential for providing a practical alternative for the monitoring of E. coli O157:H7 and other pathogens.

  19. Subtractive inhibition assay for the detection of E. coli O157:H7 using surface plasmon resonance.

    Science.gov (United States)

    Wang, Yixian; Ye, Zunzhong; Si, Chengyan; Ying, Yibin

    2011-01-01

    A surface plasmon resonance (SPR) immunosensor was developed for the detection of E. coli O157:H7 by means of a new subtractive inhibition assay. In the subtractive inhibition assay, E. coli O157:H7 cells and goat polyclonal antibodies for E. coli O157:H7 were incubated for a short of time, and then the E. coli O157:H7 cells which bound antibodies were removed by a stepwise centrifugation process. The remaining free unbound antibodies were detected through interaction with rabbit anti-goat IgG polyclonal antibodies immobilized on the sensor chip using a BIAcore 3000 biosensor. The results showed that the signal was inversely correlated with the concentration of E. coli O157:H7 cells in a range from 3.0 × 10(4) to 3.0 × 10(8) cfu/mL with a detection limit of 3.0 × 10(4) cfu/mL. Compared with direct SPR by immobilizing antibodies on the chip surface to capture the bacterial cells and ELISA for E. coli O157:H7 (detection limit: both 3.0 × 10(5) cfu/mL in this paper), the detection limit of subtractive inhibition assay method was reduced by one order of magnitude. The method simplifies bacterial cell detection to protein-protein interaction, which has the potential for providing a practical alternative for the monitoring of E. coli O157:H7 and other pathogens.

  20. Climate, lactation, and treatment factors influence faecal shedding of Escherichia coli O157 pathotypes in dairy cows.

    Science.gov (United States)

    Stenkamp-Strahm, C; McCONNEL, C; Rao, S; Magnuson, R; Hyatt, D R; Linke, L

    2017-01-01

    Among pathogens shed by cattle, Escherichia coli O157 ranks highest in those causing human illness. To date, prevalence and risk factors for O157 shedding have been assessed in feedlot, but not dairy cattle. The study aimed to determine prevalence levels and risk factors for O157 atypical enteropathogenic E. coli (aEPEC) and enterohaemorrhagic E. coli (EHEC) shedding in dairy cattle. Dairy cattle (n = 899) within the first 21 days of lactation were sampled monthly over the course of 1 year, on three dry lot dairies surrounding Fort Collins, CO. During visits multiple factors were measured (disease history, pharmaceutical use, climate measures, etc.), and cattle faeces were collected and assessed for presence of O157 and virulence genes. Logistic regression analysis was performed using O157 outcomes and measured factors. Prevalence of O157 aEPEC was 3·7%, while EHEC was 3·0%. Many potential risk factors were highly correlated, and used to build separate multivariable models. An increase in humidity was positively associated with aEPEC, while fluid faeces and history of disease showed a negative association. Meanwhile, an increase in temperature and antibiotic treatment was positively associated with EHEC, while more days in milk, higher hygiene score and cow contact were negatively associated. These results may guide mitigation strategies that reduce O157 shedding, and contamination of the human food chain.

  1. Thermal inactivation of acid-adapted Escherichia coli O157:H7 in dairy compost.

    Science.gov (United States)

    Singh, Randhir; Jiang, Xiuping

    2012-08-01

    It is well documented that stress-adapted microorganisms can develop cross-resistance to other unrelated stress. This study was designed to evaluate the thermal resistance of acid-adapted Escherichia coli O157:H7 in both fresh and finished dairy composts. A three-strain mixture of E. coli O157:H7, either acid-adapted or non-adapted (control), was inoculated into dairy compost to a final concentration of approximately 10(7) CFU/g. The inoculated compost was kept in an environmental chamber which was programmed to raise temperature from room to target temperatures (50°C, 55°C, and 60°C) in 2 days, simulating the early phase of composting. In fresh dairy compost with 2 days of come-up time, acid-adapted and control E. coli O157:H7 survived for 19 and 17 days at 50°C, respectively, and 6 and 4 days for both types of culture at 55°C and 60°C, respectively. Overall, pathogen survival was non-significant (p>0.05) between control and acid-adapted cultures at all tested temperatures. In finished compost, the same trend in pathogen survival between control and acid-adapted cultures was observed at 55°C. However, the duration of survival for both cultures was short in comparison to that in fresh compost. In fresh compost with short come-up time (15 min), acid-adaptation provided E. coli O157:H7 some cross-protection to heat at 55°C up to 30 min of exposure. The effect of heating medium on thermal resistance of acid-adapted E. coli O157:H7 revealed that in saline, acid-adapted E. coli O157:H7 was inactivated slower (pcompost with 2 days of come-up time during composting. Additionally, the type of compost and heating medium can influence the rate of pathogen inactivation at composting temperatures.

  2. Inactivation of Escherichia coli O157:H7 in Minute Steaks Cooked under Selected Conditions.

    Science.gov (United States)

    Yang, Xianqin; Devos, Julia; Klassen, Mark D

    2017-10-01

    A national survey was conducted in Canada to determine consumer cooking practices for minute steaks (thin, mechanically tenderized beef cutlets). Results indicate that most Canadians prefer cooking minute steaks by pan frying and to a medium level of doneness. To identify safe cooking conditions, retail minute steaks (∼125 g), inoculated at three sites per steak with a five-strain cocktail of nontoxigenic Escherichia coli O157:H7 (6.1 log CFU per site), were cooked on a hot plate (200°C), mimicking a pan-frying scenario. The steaks (n = 5) were cooked for 4, 6, 8, or 10 min with turning over (flipping) up to four times at equal time intervals; or to 63 or 71°C at the thickest area with or without a tinfoil lid. When cooked for 4 min, E. coli O157:H7 was recovered from all inoculation sites, and the mean reductions at various sites (1.2 to 3.4 log CFU per site) were not different (P > 0.05), irrespective of the flipping frequency. When cooked for 6 min with flipping once or twice, or for 8 min with flipping once, E. coli O157:H7 was recovered from most sites; the mean reductions (3.8 to 5.3 log CFU per site) were not different (P > 0.05), but they were higher (P coli O157:H7 was eliminated from most sites, but sites with coli O157:H7 by >5 log at all inoculation sites were attained when the steaks were cooked for 10 or 8 min with two or more or three or more flippings, respectively, or for 6 min with four flippings. When flipped twice during cooking to 63 or 71°C, E. coli O157:H7 was recovered from three or fewer sites; however, >5-log reductions throughout the steaks were only attained for the latter temperature, irrespective of whether the hot plate was covered with the tinfoil lid. Thus, turning over minute steaks twice during cooking to 71°C or flipping two, three, or four times with a cooking time of 10, 8, or 6 min could achieve 5-log reductions throughout the steaks.

  3. Characterization of interactions between Escherichia coli O157:H7 with epiphytic bacteria in vitro and on spinach leaf surfaces.

    Science.gov (United States)

    Lopez-Velasco, Gabriela; Tydings, Heather A; Boyer, Renee R; Falkinham, Joseph O; Ponder, Monica A

    2012-02-15

    This study characterized the types of interactions between Escherichia coli O157:H7 and spinach phylloepiphytic bacteria and identified those that influence persistence of E. coli O157:H7 on edible plants. A total of 1512 phylloepiphytic bacterial isolates were screened for their ability to inhibit or to enhance the growth of E. coli O157:H7 in vitro and on spinach leaf surfaces. Fifteen different genera, the majority belonging to Firmicutes and Enterobacteriaceae, reduced growth rates of E. coli O157:H7 in vitro by either nutrient competition or acid production. Reduced numbers of E. coli O157:H7 were recovered from detached spinach leaves that were co-inoculated with epiphytic isolates belonging to five genera. A 1.8 log reduction in E. coli O157:H7 was achieved when co-inoculated with Erwinina perscinia and 20% cellobiose, a carbon source used by the phylloepiphytes but not E. coli O157:H7. The reduction on leaves was significantly less than reduction measured in vitro. Phylloepiphytic bacteria belonging to eight different genera, increased numbers of E. coli O157:H7 when co-cultured in vitro on spent medium and when co-cultured on detached spinach leaves. The results, showing reduction of E. coli O157:H7 numbers by natural epiphytic bacteria, support the hypothesis that native plant microbiota can be used for bio-control of foodborne pathogens, however, other epiphytes may promote the persistence of enteric pathogens on the phyllosphere. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Effect of chemical sanitizer combined with modified atmosphere packaging on inhibiting Escherichia coli O157:H7 in commercial spinach.

    Science.gov (United States)

    Lee, Sun-Young; Baek, Seung-Youb

    2008-06-01

    Escherichia coli O157:H7 contaminated spinach has recently caused several outbreaks of human illness in the USA and Canada. However, to date, there has been no study demonstrating an effective way to eliminate E. coli O157:H7 in spinach. Therefore, this study was conducted to investigate the effect of chemical sanitizers alone or in combination with packaging methods such as vacuum and modified atmosphere packaging (MAP) on inactivating E. coli O157:H7 in spinach during storage time. Spinach inoculated with E. coli O157:H7 was packaged in four different methods (air, vacuum, N(2) gas, and CO(2) gas packaging) following treatment with water, 100 ppm chlorine dioxide, or 100 ppm sodium hypochlorite for 5 min at room temperature and stored at 7+/-2 degrees C. Treatment with water did not significantly reduce levels of E. coli O157:H7 in spinach. However, treatment with chlorine dioxide and sodium hypochlorite significantly decreased levels of E. coli O157:H7 by 2.6 and 1.1 log(10)CFU/g, respectively. Levels of E. coli O157:H7 in samples packaged in air following treatments grew during storage time, whereas levels were maintained in samples packaged in other packaging methods (vacuum, N(2) gas, and CO(2) gas packaging). Therefore there were significant differences (about 3-4 log) of E. coli O157:H7 populations between samples packed in air and other packaging methods following treatment with chemical sanitizers after 7 days storage. These results suggest that the combination of treatment with chlorine dioxide and packaging methods such as vacuum and MAP may be useful for improving the microbial safety of spinach against E. coli O157:H7 during storage.

  5. Mortal hyperkalemia disturbances in rats are NO-system related. The life saving effect of pentadecapeptide BPC 157.

    Science.gov (United States)

    Barisic, Ivan; Balenovic, Diana; Klicek, Robert; Radic, Bozo; Nikitovic, Bojana; Drmic, Domagoj; Udovicic, Mario; Strinic, Dean; Bardak, Darija; Berkopic, Lidija; Djuzel, Viktor; Sever, Marko; Cvjetko, Ivan; Romic, Zeljko; Sindic, Aleksandra; Bencic, Martina Lovric; Seiwerth, Sven; Sikiric, Predrag

    2013-02-10

    We demonstrate the full counteracting ability of stable gastric pentadecapeptide BPC 157 against KCl-overdose (intraperitoneal (i), intragastric (ii), in vitro (iii)), NO-system related. (i) We demonstrated potential (/kg) of: BPC 157 (10ng, 10μg ip, complete counteraction), l-arginine (100mg ip, attenuation) vs. L-NAME (5mg ip, deadly aggravation), given alone and/or combined, before or after intraperitoneal KCl-solution application (9mEq/kg). Therapy was confronted with promptly unrelenting hyperkalemia (>12mmol/L), arrhythmias (and muscular weakness, hypertension, low pressure in lower esophageal and pyloric sphincter) with an ultimate and a regularly inevitable lethal outcome within 30min. Previously, we established BPC 157-NO-system interaction; now, a huge life-saving potential. Given 30min before KCl, all BPC 157 regimens regained sinus rhythm, had less prolongation of QRS, and had no asystolic pause. BPC 157 therapy, given 10min after KCl-application, starts the rescue within 5-10min, completely restoring normal sinus rhythm at 1h. Likewise, other hyperkalemia-disturbances (muscular weakness, hypertension, low sphincteric pressure) were also counteracted. Accordingly with NO-system relation, deadly aggravation by L-NAME: l-arginine brings the values to the control levels while BPC 157 always completely nullified lesions, markedly below those of controls. Combined with l-arginine, BPC 157 exhibited no additive effect. (ii) Intragastric KCl-solution application (27mEq/kg) - (hyperkalemia 7mmol/L): severe stomach mucosal lesions, sphincter failure and peaked T waves were fully counteracted by intragastric BPC 157 (10ng, 10μg) application, given 30min before or 10min after KCl. (iii). In HEK293 cells, hyperkalemic conditions (18.6mM potassium concentrations), BPC 157 directly affects potassium conductance, counteracting the effect on membrane potential and depolarizations caused by hyperkalemic conditions. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Anxiolytic effect of BPC-157, a gastric pentadecapeptide: shock probe/burying test and light/dark test.

    Science.gov (United States)

    Sikiric, P; Jelovac, N; Jelovac-Gjeldum, A; Dodig, G; Staresinic, M; Anic, T; Zoricic, I; Ferovic, D; Aralica, G; Buljat, G; Prkacin, I; Lovric-Bencic, M; Separovic, J; Seiwerth, S; Rucman, R; Petek, M; Turkovic, B; Ziger, T

    2001-03-01

    To study anxiolytic effect of a gastric pentadecapeptide, BPC-157. In shock probe/burying test, pentadecapeptide BPC-157 (10 microg/kg, 10 ng/kg, ip), diazepam (0.075, 0.0375 mg/kg, ip), and an equivolume of saline (5 mL/kg, ip) were given at 30 min prior test. In light/dark test, the same dosage of diazepam, BPC-157, and saline were given at 45 min prior procedure. Shock probe/burying test: rats treated with either diazepam or pentadecapeptide BPC-157 were much less afraid after the shock: almost not burying and the total time spent in burying was clearly less than in controls. However, while in the diazepam treated rats the number of shocks received increased over control values, in pentadecapeptide BPC-157 treated groups the number of shocks remained not modified compared with the control values. Light/dark test: after exposure to the intense light, diazepam treated mice had longer latencies of crossing to the dark compartment, a greater number of crossing and a greater number of exploratory rearing, and spent longer time in the light compartment, as compared to the control mice, while BPC-157 mice had a similar behavior to that of the control mice. In contrast with the effect in light area, in dark zone diazepam produced no change with respect to controls, while BPC-157 (10 microg/kg) mice had a greater number of crossing and a greater number of exploratory rearing. Both diazepam and BPC-157 displayed a bidirectional effect, but the activity of pentadecapeptide BPC-157 was particular, and different from diazepam.

  7. Effects of phosphate on the transport of Escherichia coli O157:H7 in saturated quartz sand.

    Science.gov (United States)

    Wang, Lixia; Xu, Shangping; Li, Jin

    2011-11-15

    Consumption of groundwater contaminated with E. coli O157:H7 has led to several waterborne disease outbreaks over the past decade. A thorough understanding of the transport of E. coli O157:H7 within the soil-groundwater system is critical to the protection of public health. Although phosphate is ubiquitous in the natural environment, the influence of phosphate on the transport of E. coli O157:H7 in the groundwater system remains unknown. In this research, we performed column transport experiments to evaluate the effect of phosphate on the transport of E. coli O157:H7 cells within saturated sand. The pH of the solutions was maintained at 7.2, the ionic strength varied from 10 to 100 mM, and the phosphate concentration ranged from 0 to 1 mM. Our results show that (1) phosphate could enhance the transport of E. coli O157:H7 cells under both ionic strength conditions; (2) E. coli O157:H7 displayed lower retention in sand under higher ionic strength conditions; (3) increased phosphate in the mobile aqueous phase led to the release of previously immobilized E. coli O157:H7 cells. The response of E. coli O157:H7 cells to variations in phosphate concentrations and ionic strength conditions are explained using the extended DLVO (XDLVO) theory and the steric repulsion caused by extracellular macromolecules. In summary, our results suggest that phosphate could widen the spread of E. coli O157:H7 cells, and potentially other types of bacterial cells, within the soil-groundwater system.

  8. Molecular characterization of Verocytotoxigenic Escherichia coli O157:H7 isolates from Argentina by Multiple-Loci VNTR Analysis (MLVA)

    Science.gov (United States)

    Bustamante, Ana V.; Lucchesi, Paula M.A.; Parma, Alberto E.

    2009-01-01

    The aim of this work was to adapt described MLVA protocols to the molecular typing and characterization of VTEC O157:H7 isolates from Argentina. Nine VNTR loci were amplified by PCR showing diversity values from 0.49 to 0.73. Nine MLVA profiles were observed and the cluster analysis indicated both unrelated and closely related VTEC O157:H7 strains. In spite of the limited number of isolates studied, the panel of VNTR used made it possible to perform a first approach of the high genetic diversity of native strains of O157:H7 by MLVA. PMID:24031443

  9. Influence of raw meat natural background flora on growth of Escherichia coli O157: H7 in ground beef

    OpenAIRE

    Saad, Susana M.I.; Franco, Bernadette D.G.M.

    1999-01-01

    Escherichia coli O157:H7 is a foodborne pathogen of increasing importance. It has been involved in several threatening outbreaks, most of them associated with meat products. In this study, the influence of some bacteria from the natural background flora of raw meat over E.coli O157:H7 in ground beef stored under refrigeration and at room temperature was evaluated. Different levels of E.coli O157:H7 (101-102, 103-104 and 106-107 CFU/g), inoculated in ground beef samples, were challenged with s...

  10. Functional metagenomics of Escherichia coli O157:H7 interactions with spinach indigenous microorganisms during biofilm formation.

    Directory of Open Access Journals (Sweden)

    Michelle Q Carter

    Full Text Available The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157 with spinach leaf indigenous microorganisms during co-colonization and establishment of a mixed biofilm on a stainless steel surface. Stainless steel surface was selected to mimic the surface of produce-processing equipment, where retention of foodborne pathogens such as EcO157 could serve as a potential source for transmission. We observed a positive effect of spinach-associated microbes on the initial attachment of EcO157, but an antagonistic effect on the EcO157 population at the later stage of biofilm formation. Metagenomic analyses of the biofilm community with the GeoChip revealed an extremely diverse community (gene richness, 23409; Shannon-Weiner index H, 9.55. Presence of EcO157 in the mixed biofilm resulted in a significant decrease in the community α-diversity (t test, P<0.05, indicating a putative competition between the pathogen and indigenous spinach microbes. The decrease in the β-diversity of the EcO157-inoculated biofilm at 48 h (ANOVA, P<0.05 suggested a convergent shift in functional composition in response to EcO157 invasion. The success of EcO157 in the mixed biofilm is likely associated with its metabolic potential in utilizing spinach nutrients: the generation time of EcO157 in spinach lysates at 28°C is ~ 38 min, which is comparable to that in rich broth. The significant decrease in the abundance of many genes involved in carbon, nitrogen, and phosphorus cycling in the EcO157-inoculated biofilms (t test, P<0.05 further support our conclusion that competition for essential macronutrients is likely the primary interaction between the EcO157 and indigenous spinach-biofilm species.

  11. Incidence and Tracking of Escherichia coli O157:H7 in a Major Produce Production Region in California

    OpenAIRE

    Michael Cooley; Diana Carychao; Leta Crawford-Miksza; Jay, Michele T.; Carol Myers; Christopher Rose; Christine Keys; Jeff Farrar; Mandrell, Robert E.

    2007-01-01

    Fresh vegetables have become associated with outbreaks caused by Escherichia coli O157:H7 (EcO157). Between 1995-2006, 22 produce outbreaks were documented in the United States, with nearly half traced to lettuce or spinach grown in California. Outbreaks between 2002 and 2006 induced investigations of possible sources of pre-harvest contamination on implicated farms in the Salinas and San Juan valleys of California, and a survey of the Salinas watershed. EcO157 was isolated at least once from...

  12. Prevalence and Genomic Characterization of Escherichia coli O157:H7 in Cow-Calf Herds throughout California.

    Science.gov (United States)

    Worley, Jay N; Flores, Kristopher A; Yang, Xun; Chase, Jennifer A; Cao, Guojie; Tang, Shuai; Meng, Jianghong; Atwill, Edward R

    2017-08-15

    Escherichia coli serotype O157:H7 is a zoonotic food- and waterborne bacterial pathogen that causes a high hospitalization rate and can cause life-threatening complications. Increasingly, E. coli O157:H7 infections appear to originate from fresh produce. Ruminants, such as cattle, are a prominent reservoir of E. coli O157:H7 in the United States. California is one of the most agriculturally productive regions in the world for fresh produce, beef, and milk. The close proximity of fresh produce and cattle presents food safety challenges on a uniquely large scale. We performed a survey of E. coli O157:H7 on 20 farms in California to observe the regional diversity and prevalence of E. coli O157:H7. Isolates were obtained from enrichment cultures of cow feces. Some farms were sampled on two dates. Genomes from isolates were sequenced to determine their relatedness and pathogenic potential. E. coli O157:H7 was isolated from approximately half of the farms. The point prevalence of E. coli O157:H7 on farms was highly variable, ranging from zero to nearly 90%. Within farms, generally one or a few lineages were found, even when the rate of isolation was high. On farms with high isolation rates, a single clonal lineage accounted for most of the isolates. Farms that were visited months after the first visit might have had the same lineages of E. coli O157:H7. Strains of E. coli O157:H7 may be persistent for months on farms. IMPORTANCE This survey of 20 cow-calf operations from different regions of California provides an in depth look at resident Escherichia coli O157:H7 populations at the molecular level. E. coli O157:H7 is found to have a highly variable prevalence, and with whole-genome sequencing, high prevalences in herds were found to be due to a single lineage shed from multiple cows. Few repeat lineages were found between farms in this area; therefore, we predict that E. coli O157:H7 has significant diversity in this area beyond what is detected in this survey. All

  13. BPC 157 antagonized the general anaesthetic potency of thiopental and reduced prolongation of anaesthesia induced by L-NAME/thiopental combination.

    Science.gov (United States)

    Zemba, Mladen; Cilic, Andrea Zemba; Balenovic, Igor; Cilic, Matija; Radic, Bozo; Suran, Jelena; Drmic, Domagoj; Kokot, Antonio; Stambolija, Vasilije; Murselovic, Tamara; Holjevac, Jadranka Katancic; Uzun, Sandra; Djuzel, Viktor; Vlainic, Josipa; Seiwerth, Sven; Sikiric, Predrag

    2015-12-01

    We hypothesized that certain effects of the general anaesthetic thiopental are dependent on NO-related mechanisms, which were consequently counteracted by stable gastric pentadecapeptide BPC 157. (1) All rats intraperitoneally received thiopental (20, 30, 40, and 50 mg/kg) while medication BPC 157 (10 μg/kg, 10 ng/kg, and 10 pg/kg) was given intraperitoneally at 5 min before thiopental. (2) To determine NO-related mechanisms, all rats received intraperitoneally thiopental 40 mg/kg while BPC 157 (10 μg/kg), L-NAME (10 mg/kg) and L-arginine (30 mg/kg) were applied alone and/or combined. BPC 157 was given at 25 min before thiopental while L-NAME, L-arginine, alone and/or combined, were applied at 20 min before thiopental. (1) BPC 157 own effect on thiopental anaesthesia: BPC 157 (10 ng/kg and 10 μg/kg) caused a significant antagonism of general anaesthesia produced by thiopental with a parallel shift of the dose-response curve to the right. (2) L-NAME-L-arginine-BPC 157 interrelations: L-NAME: Thiopental-induced anaesthesia duration was tripled. L-arginine: Usual thiopental anaesthesia time was not influenced. Active only when given with L-NAME or BPC 157: potentiating effects of L-NAME were lessened, not abolished; shortening effect of BPC 157: abolished. BPC 157 and L-NAME: Potentiating effects of L-NAME were abolished. BPC 157 and L-NAME and L-arginine: BPC 157 +L-NAME +L-arginine rats exhibited values close to those in BPC 157 rats. Thiopental general anaesthesia is simultaneously manipulated in both ways with NO system activity modulation, L-NAME (prolongation) and BPC 157 (shortening/counteraction) and L-arginine (interference with L-NAME and BPC 157).

  14. Survival of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella in juice concentrates.

    Science.gov (United States)

    Oyarzábal, Omar A; Nogueira, Mara C L; Gombas, David E

    2003-09-01

    The survival of Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella was studied in apple, orange, pineapple, and white grape juice concentrates and banana puree. Pouches of juice concentrate or puree were inoculated with pathogens at a level > or = 10(3) CFU/g and stored at -23 degrees C (-10 degrees F). Pathogen survival was monitored at 6 and 24 h, once a week for four consecutive weeks, and biweekly thereafter until 12 weeks. When pathogens were not detectable by direct plating, samples were enriched in universal preenrichment broth for 72 h and plated on selective media. Results showed that E. coli O157:H7, L. monocytogenes, and Salmonella were recoverable from all five concentrates through 12 weeks of storage at -23 degrees C.

  15. Escherichia coli O157:H7-Clinical aspects and novel treatment approaches.

    Science.gov (United States)

    Rahal, Elias A; Kazzi, Natalie; Nassar, Farah J; Matar, Ghassan M

    2012-01-01

    Escherichia coli O157:H7 is a notorious pathogen often contracted by intake of contaminated water or food. Infection with this agent is associated with a broad spectrum of illness ranging from mild diarrhea and hemorrhagic colitis to the potentially fatal hemolytic uremic syndrome (HUS). Treating E. coli O157:H7 infection with antimicrobial agents is associated with an increased risk of severe sequelae such as HUS. The difficulty in treating this bacterium using conventional modalities of antimicrobial agent administration has sparked an interest in investigating new therapeutic approaches to this bacterium. These approaches have included the use of probiotic agents and natural products with variable success rates. In addition, novel modalities and regimen of antimicrobial agent administration have been assessed in an attempt at decreasing their association with aggravating infection outcomes.

  16. Escherichia coli O157:H7—Clinical aspects and novel treatment approaches

    Science.gov (United States)

    Rahal, Elias A.; Kazzi, Natalie; Nassar, Farah J.; Matar, Ghassan M.

    2012-01-01

    Escherichia coli O157:H7 is a notorious pathogen often contracted by intake of contaminated water or food. Infection with this agent is associated with a broad spectrum of illness ranging from mild diarrhea and hemorrhagic colitis to the potentially fatal hemolytic uremic syndrome (HUS). Treating E. coli O157:H7 infection with antimicrobial agents is associated with an increased risk of severe sequelae such as HUS. The difficulty in treating this bacterium using conventional modalities of antimicrobial agent administration has sparked an interest in investigating new therapeutic approaches to this bacterium. These approaches have included the use of probiotic agents and natural products with variable success rates. In addition, novel modalities and regimen of antimicrobial agent administration have been assessed in an attempt at decreasing their association with aggravating infection outcomes. PMID:23162800

  17. Shiga Toxin-Producing Escherichia coli O157, England and Wales, 1983-2012.

    Science.gov (United States)

    Adams, Natalie L; Byrne, Lisa; Smith, Geraldine A; Elson, Richard; Harris, John P; Salmon, Roland; Smith, Robert; O'Brien, Sarah J; Adak, Goutam K; Jenkins, Claire

    2016-04-01

    We evaluated clinical Shiga toxin-producing Escherichia coli O157 infections in England and Wales during 1983-2012 to describe changes in microbiological and surveillance methods. A strain replacement event was captured; phage type (PT) 2 decreased to account for just 3% of cases by 2012, whereas PT8 and PT21/28 strains concurrently emerged, constituting almost two thirds of cases by 2012. Despite interventions to control and reduce transmission, incidence remained constant. However, sources of infection changed over time; outbreaks caused by contaminated meat and milk declined, suggesting that interventions aimed at reducing meat cross-contamination were effective. Petting farm and school and nursery outbreaks increased, suggesting the emergence of other modes of transmission and potentially contributing to the sustained incidence over time. Studies assessing interventions and consideration of policies and guidance should be undertaken to reduce Shiga toxin-producing E. coli O157 infections in England and Wales in line with the latest epidemiologic findings.

  18. Genetic features of human and bovine Escherichia coli O157:H7 strains isolated in Argentina.

    Science.gov (United States)

    Pianciola, L; D'Astek, B A; Mazzeo, M; Chinen, I; Masana, M; Rivas, M

    2016-02-01

    Shiga toxin-producing Escherichia coli (STEC) are important food-borne pathogens associated with human diseases. In Argentina, O157:H7 is the dominant serotype in hemolytic uremic syndrome (HUS) cases. Previously, we have described the almost exclusive circulation of human E. coli O157 strains belonging to the hypervirulent clade 8 in Neuquén Province. The aim of the present study was to investigate, by a broad molecular characterization, if this particular distribution of E. coli O157 clades in Neuquén is similar to the situation in other regions of the country and if it may be originated in a similar profile in cattle, its main reservoir. Two-hundred and eighty O157 strains (54 bovine and 226 human) isolated between 2006 and 2008 in different regions of Argentina were studied. All strains harbored rfbO157, fliCH7, eae, and ehxA genes. The predominant genotype was stx2a/stx2c in human (76.1%) and bovine (55.5%) strains. All human isolates tested by Lineage-Specific Polymorphism Assay (LSPA-6), were lineage I/II; among bovine strains, 94.1% belonged to lineage I/II and 5.9% to lineage I. No LSPA-6 lineage II isolates were detected. Single nucleotide polymorphism (SNP) analysis has revealed the existence of nine clade phylogenetic groups. In our clinical strains collection, 87.6% belonged to the hypervirulent clade 8, and 12.4% were classified as clade 4/5. In bovine isolates, 59.3% strains were clade 8, 33.3% clade 4/5 and 7.4% clade 3. More than 80% of human strains showed the presence of 6 of the 7 virulence determinants described in the TW14359 O157 strain associated with the raw spinach outbreak in the U.S. in 2006. More than 80% of bovine strains showed the presence of 3 of these factors. The q933 allele, which has been related to high toxin production, was present in 98.2% of clinical strains and 75.9% of the bovine isolates. The molecular characterization of human STEC O157 strains allows us to conclude that the particular situation previously described

  19. The influence of gastric pentadecapeptide BPC 157 on acute and chronic ethanol administration in mice.

    Science.gov (United States)

    Blagaic, Alenka Boban; Blagaic, Vladimir; Romic, Zeljko; Sikiric, Predrag

    2004-09-24

    The stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, M.W.1419), which was promising in inflammatory bowel disease (PL-10, PLD-116, PL-14736, Pliva) trials, protects against both acute and chronic alcohol-induced lesions in stomach and liver, but also, given peripherally, affects various centrally mediated disturbances. Now, in male NMRI mice BPC 157 (10 pg intraperitoneally, 10 ng and 10 microg, intraperitoneally or intragastrically) (i) strongly opposed acute alcohol (4 g/kg intraperitoneally) intoxication (i.e., quickly produced and sustained anesthesia, hypothermia, increased ethanol blood values, 25% fatality, 90-min assessment period) given before or after ethanol, and (ii) when given after abrupt cessation of ethanol (at 0 or 3 or 7 h withdrawal time), attenuated withdrawal (assessed through 24 hours) after 20%-alcohol drinking (7.6 g/kg) through 13 days, with provocation on the 14th day.

  20. Electrochemical biosensors for rapid detection of Escherichia coli O157:H7.

    Science.gov (United States)

    Xu, Meng; Wang, Ronghui; Li, Yanbin

    2017-01-01

    Electrochemical biosensors have shown great promise in the development of rapid methods for the detection of foodborne pathogens and have been intensively studied over the past two decades. The scope of this review is to summarize the advancements made in the development of electrochemical biosensors for the rapid detection of one of the most common foodborne pathogens, Escherichia coli O157:H7. The article is intended to include different configurations of electrochemical biosensors based on the sensing principles and measured electrical parameters, as well as the latest improvements of technology in the progress of electrochemical biosensor development to detect E. coli O157:H7. By discussing the current and future trend based on some of excellent published literatures and reviews, this survey is hoped to illustrate a broad and comprehensive understanding of electrochemical biosensors for the detection of foodborne pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. [Isolation of enteric pathogeic agents in Côte d'Ivoire: Escherichia coli O157:H7 and enteroaggregative E. coli].

    OpenAIRE

    Dadié, A.; Karou, T.; Adom, N.; Kétté, A.; Dosso, M.

    2000-01-01

    International audience; New pathogens including Escherichia coli O157:H7 have emerged and spread world-wide as the most important cause of foodborne infections. We established a prospective study in Abidjan from 1996 to 1999 to determine the prevalence of Shiga-toxin producing E. coli (STEC) in our environment. Two O157 strains were found. One (EA47) O157:H7 was isolated from chicken and the other (EH144) O157:HNM from human diarrhoeal stool specimens. Both O157 strains carried stx2, eae, and...

  2. Correction of 157-nm lens based on phase ring aberration extraction method

    Science.gov (United States)

    Meute, Jeff; Rich, Georgia K.; Conley, Will; Smith, Bruce W.; Zavyalova, Lena V.; Cashmore, Julian S.; Ashworth, Dominic; Webb, James E.; Rich, Lisa

    2004-05-01

    Early manufacture and use of 157nm high NA lenses has presented significant challenges including: intrinsic birefringence correction, control of optical surface contamination, and the use of relatively unproven materials, coatings, and metrology. Many of these issues were addressed during the manufacture and use of International SEMATECH"s 0.85NA lens. Most significantly, we were the first to employ 157nm phase measurement interferometry (PMI) and birefringence modeling software for lens optimization. These efforts yielded significant wavefront improvement and produced one of the best wavefront-corrected 157nm lenses to date. After applying the best practices to the manufacture of the lens, we still had to overcome the difficulties of integrating the lens into the tool platform at International SEMATECH instead of at the supplier facility. After lens integration, alignment, and field optimization were complete, conventional lithography and phase ring aberration extraction techniques were used to characterize system performance. These techniques suggested a wavefront error of approximately 0.05 waves RMS--much larger than the 0.03 waves RMS predicted by 157nm PMI. In-situ wavefront correction was planned for in the early stages of this project to mitigate risks introduced by the use of development materials and techniques and field integration of the lens. In this publication, we document the development and use of a phase ring aberration extraction method for characterizing imaging performance and a technique for correcting aberrations with the addition of an optical compensation plate. Imaging results before and after the lens correction are presented and differences between actual and predicted results are discussed.

  3. An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.

    LENUS (Irish Health Repository)

    McDonnell, R J

    1997-12-12

    An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.

  4. Bacteriophage-amplified bioluminescent sensing of Escherichia coli O157:H7.

    Science.gov (United States)

    Ripp, Steven; Jegier, Patricia; Johnson, Courtney M; Brigati, Jennifer R; Sayler, Gary S

    2008-05-01

    Escherichia coli O157:H7 remains a continuous public health threat, appearing in meats, water, fruit juices, milk, cheese, and vegetables, where its ingestion at concentrations of perhaps as low as 10 to 100 organisms can result in potent toxin exposure and severe damage to the lining of the intestine. Abdominal pain and diarrhea develop, which in the very young or elderly can progress towards hemolytic uremic syndrome and kidney failure. To assist in the detection of E. coli O157:H7, a recombinant bacteriophage reporter was developed that uses quorum sensing (luxI/luxR) signaling and luxCDABE-based bioluminescent bioreporter sensing to specifically and autonomously respond to O157:H7 serotype E. coli. The bacteriophage reporter, derived from phage PP01, was tested in artificially contaminated foodstuffs including apple juice, tap water, ground beef, and spinach leaf rinsates. In apple juice, detection of E. coli O157:H7 at original inoculums of 1 CFU mL(-1) occurred within approximately 16 h after a 6-h pre-incubation, detection of 1 CFU mL(-1) in tap water occurred within approximately 6.5 h after a 6-h pre-incubation, and detection in spinach leaf rinsates using a real-time Xenogen IVIS imaging system resulted in detection of 1 CFU mL(-1) within approximately 4 h after a 2-h pre-incubation. Detection in ground beef was not successful, however, presumably due to the natural occurrence of quorum sensing autoinducer (N-3-(oxohexanoyl)-L: -homoserine lactone; OHHL), which generated false-positive bioreporter signals in the ground beef samples.

  5. Toward Development of an Oral, Plant-Based Vaccine Against Escherichia coli O157:H7

    Science.gov (United States)

    2004-01-01

    µl) of sonic lysate, column wash, pre -dialysis pooled elution fractions, and post - dialysis concentrated toxoid were subject to SDS-PAGE. The gels...46 Toxin Neutralization Assay. Vero cells were prepared as in the cytotoxicity assay. Both pre and post -immune sera from mice immunized with...34, 431-433. Laegreid, W. W., Elder, R. O., and Keen, J. E. (1999). Prevalence of Escherichia coli O157:H7 in range beef calves at weaning

  6. Evaluation of different approaches for modeling Escherichia coli O157:H7 survival on field lettuce.

    Science.gov (United States)

    McKellar, Robin C; Peréz-Rodríguez, Fernando; Harris, Linda J; Moyne, Anne-Laure; Blais, Burton; Topp, Ed; Bezanson, Greg; Bach, Susan; Delaquis, Pascal

    2014-08-01

    The ability to predict the behavior of Escherichia coli O157:H7 on contaminated field lettuce is essential for the development of accurate quantitative microbial risk assessments. The survival pattern of the species was assessed from several data sets derived from field-based experiments, which were analyzed by regression analysis fitting one monophasic model (log-linear) and two biphasic (Weibull and Cerf's model) models. Probabilistic models were also simulated with @RISK™, integrating the fitted monophasic and biphasic models in order to analyze their impact on the estimate of the extent of die-off subsequent to a contamination event in the field. Regression analysis indicated that E. coli O157:H7 followed a biphasic decay pattern in most cases, with the Weibull and Cerf's model showing similar good fit to individual and pooled survival data. Furthermore, results from the stochastic analysis demonstrated that using the log-linear model could lead to different risk estimates from those obtained with biphasic models, with a lower prevalence in the former scenario as no tailing is assumed in this model. The models and results derived from this work provide the first suitable mathematical base upon which to build probabilistic models to predict the fate of E. coli O157:H7 on field-grown leafy green vegetable. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  7. Corrosion and precipitation effects in a forced-convection Pb–15.7Li loop

    Energy Technology Data Exchange (ETDEWEB)

    Konys, J., E-mail: juergen.konys@kit.edu; Krauss, W.

    2013-11-15

    The helium-cooled lithium lead (HCLL) concept for blankets is based on the application of the liquid breeder Pb–15.7Li, which is in direct contact with the structural components, e.g., RAFM steels. Corrosion attack of the structural material is always present and is mainly governed by the operation temperature and flow velocity of the liquid breeder. At high flow velocities, high dissolution rates of ca. 400 μm/year were evaluated at 823 K (550 °C) and showed a high amount of corrosion products in the Pb–15.7Li. In a test blanket module (TBM) system or also in a testing loop, e.g., the PICOLO loop of KIT, these components are transported with the breeder flow to sections with cooler temperature and will form precipitates due to oversaturation. Effects such as deposition, precipitate formation and transport were less considered in former compatibility testing of RAFM steels (Eurofer) in flowing Pb–15.7Li and test evaluation. However, such formed particles may seriously affect safe and reliable operation of TBM systems. Analytical and modeling work concerning the impact of corrosion products was started and results obtained during PICOLO operation will be presented. Effects observed will also be discussed with respect to further testing needs for model development including their validation as predictive tools for TBMs with a view to DEMO and testing/qualification in ITER.

  8. Fingerprints of resistant Escherichia coli O157:H7 from vegetables and environmental samples.

    Science.gov (United States)

    Abakpa, Grace Onyukwo; Umoh, Veronica J; Kamaruzaman, Sijam; Ibekwe, Mark

    2018-01-01

    Some routes of transmission of Escherichia coli O157:H7 to fresh produce include contaminated irrigation water and manure polluted soils. The aim of the present study was to determine the genetic relationships of E. coli O157:H7 isolated from some produce growing region in Nigeria using enterobacterial repetitive intergenic consensus (ERIC) DNA fingerprinting analysis. A total of 440 samples comprising leafy greens, irrigation water, manure and soil were obtained from vegetable producing regions in Kano and Plateau States, Nigeria. Genes coding for the quinolone resistance-determinant (gyrA) and plasmid (pCT) coding for multidrug resistance (MDR) were determined using polymerase chain reaction (PCR) in 16 isolates that showed MDR. Cluster analysis of the ERIC-PCR profiles based on band sizes revealed six main clusters from the sixteen isolates analysed. The largest cluster (cluster 3) grouped isolates from vegetables and manure at a similarity coefficient of 0.72. The present study provides data that support the potential transmission of resistant strains of E. coli O157:H7 from vegetables and environmental sources to humans with potential public health implications, especially in developing countries. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  9. Assessment of the Contamination of Some Foodstuffs by Escherichia coli O157 in Benin, West Africa

    Directory of Open Access Journals (Sweden)

    Honoré Sourou Bankole

    2014-01-01

    Full Text Available Escherichia coli O157 is a pathogenic bacterium causing haemorrhagic colitis. It represents a serious public health problem in Northern America and Europe, which can plague Africa. Most cases of mentioned poisoning were related to contaminated meat products and vegetables. The present work aimed to estimate the prevalence of E. coli O157 in meat and vegetables in Benin. For this purpose, 6 lots of faeces samples from pigs and 8 from cattle were collected at the farms on the outskirts of Cotonou. Similarly, 20 samples of carcasses, 20 samples of intestines and stomach, and 20 surfaces samples of slaughtering equipment were taken. Vegetables and environment materials in gardens have also been sampled for 84 samples. Bacteriological analyses revealed a percentage of contamination of 50% for pig faeces and 25% for cattle ones. All the meats from stalling parks have been contaminated by this bacterium. For vegetables, 14.6% of samples were contaminated by E. coli O157. The presence of this pathovar in animal breeding and slaughtering environment and in the gardens shows that Benin is not aware of the risks of foodborne illness associated with the consumption of contaminated products. Therefore, it urges including that germ in a systematic search during safety control of food products in Benin.

  10. Ibuprofen hepatic encephalopathy, hepatomegaly, gastric lesion and gastric pentadecapeptide BPC 157 in rats.

    Science.gov (United States)

    Ilic, Spomenko; Drmic, Domagoj; Zarkovic, Kamelija; Kolenc, Danijela; Brcic, Luka; Radic, Bozo; Djuzel, Viktor; Blagaic, Alenka Boban; Romic, Zeljko; Dzidic, Senka; Kalogjera, Livije; Seiwerth, Sven; Sikiric, Predrag

    2011-09-30

    Chronic ibuprofen (0.4 g/kg intraperitoneally, once daily for 4 weeks) evidenced a series of pathologies, not previously reported in ibuprofen-dosed rats, namely hepatic encephalopathy, gastric lesions, hepatomegaly, increased AST and ALT serum values with prolonged sedation/unconsciousness, and weight loss. In particular, ibuprofen toxicity was brain edema, particularly in the cerebellum, with the white matter being more affected than in gray matter. In addition, damaged and red neurons, in the absence of anti-inflammatory reaction was observed, particularly in the cerebral cortex and cerebellar nuclei, but was also present although to a lesser extent in the hippocampus, dentate nucleus and Purkinje cells. An anti-ulcer peptide shown to have no toxicity, the stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, MW 1419, 10 μg, 10 ng/kg) inhibited the pathology seen with ibuprofen (i) when given intraperitoneally, immediately after ibuprofen daily or (ii) when given in drinking water (0.16 μg, 0.16 ng/ml). Counteracted were all adverse effects, such as hepatic encephalopathy, the gastric lesions, hepatomegaly, increased liver serum values. In addition, BPC 157 treated rats showed no behavioral disturbances and maintained normal weight gain. Thus, apart from efficacy in inflammatory bowel disease and various wound treatments, BPC 157 was also effective when given after ibuprofen. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Microarray based comparison of two Escherichia coli O157:H7 lineages

    Directory of Open Access Journals (Sweden)

    Ishizaki Hiroshi

    2006-03-01

    Full Text Available Abstract Background Previous research has identified the potential for the existence of two separate lineages of Escherichia coli O157:H7. Clinical isolates tended to cluster primarily within one of these two lineages. To determine if there are virulence related genes differentially expressed between the two lineages we chose to utilize microarray technology to perform an initial screening. Results Using a 610 gene microarray, designed against the E. coli O157 EDL 933 transcriptome, targeting primarily virulence systems, we chose 3 representative Lineage I isolates (LI groups mostly clinical isolates and 3 representative Lineage II isolates (LII groups mostly bovine isolates. Using standard dye swap experimental designs, statistically different expression (P in vitro anaerobic growth conditions, there is up-regulation of stx2b, ureD, curli (csgAFEG, and stress related genes (hslJ, cspG, ibpB, ibpA in Lineage I, which may contribute to enhanced virulence or transmission potential. Lineage II exhibits significant up-regulation of type III secretion apparatus, LPS, and flagella related transcripts. Conclusion These results give insight into comparative regulation of virulence genes as well as providing directions for future research. Ultimately, evaluating the expression of key virulence factors among different E. coli O157 isolates has inherent value and the interpretation of such expression data will continue to evolve as our understanding of virulence, pathogenesis and transmission improves.

  12. Comparative Effect of Heat Shock on Survival of O157:H7 and Non-O157 Shiga Toxigenic Escherichia coli and Salmonella in Lean Beef with or without Moisture-Enhancing Ingredients.

    Science.gov (United States)

    Vasan, Akhila; Ingham, Steven C; Ingham, Barbara H

    2017-06-01

    Thermal tolerance of pathogenic bacteria has been shown to increase after exposure to sublethal elevated temperatures, or heat shock. We evaluated the effect of heat shock at 48°C on thermal tolerance (D 55°C ) of cocktails of O157 and non-O157 Shiga toxigenic Escherichia coli (STEC) and Salmonella in lean ground beef with or without moisture-enhancing ingredients. Beef was moisture enhanced to 110% (w) with a 5% NaCl-2.5% sodium tripolyphosphate (w/w) brine. Meat, with or without added brine, was inoculated (∼10 8 CFU/g) and heat shocked at 48°C for 0, 5, or 30 min, followed by isothermal heating at 55°C. Inoculated control samples were unenhanced and were not subject to heat shock. From the linear portion of the log CFU per gram surviving cells over time plots, D 55°C -values (minutes) were calculated. D 55°C was 20.43, 28.78, and 21.15 min for O157, non-O157, and Salmonella controls, respectively. Overall, heat shock significantly increased D 55°C , regardless of pathogen (P Salmonella, in unenhanced and enhanced samples, respectively, relative to the pathogen control. D 55°C for Salmonella was the same or significantly less than for O157 and non-O157 STEC, regardless of heat shock, and was significantly less than for O157 and non-O157 STEC in all trials with moisture-enhanced meat (P Salmonella may not prove effective against STEC in all cases and that regulators of the beef industry should focus attention on STEC in nonintact moisture-enhanced beef products.

  13. Utjecaj pentadekapeptida BPC 157 na cijeljenje ozljeda sakrokokcigealne kralježnične moždine u štakora [Sacrococcygeal spinal cord injury in rat – therapeutic effect of pentadecapeptide BPC 157

    OpenAIRE

    Perović, Darko

    2015-01-01

    Background. Spinal cord injury is devastating lesion with life time disability. Previously pentadecapeptide BPC 157 exhibited a healing effect on brain traumas. Aim. To verify influence of pentadecapeptide BPC 157 on rat spinal cord injury. Material and methods. Deeply anaesthetized Wistar Albino male rats were subjected to surgery with injury: after laminectomy L2-L3 60 second compression with neurosurgical piston (60-66 g) on exposed dural sac. One single medication (IP) (...

  14. Internalization of Escherichia coli O157:H7 following Biological and Mechanical Disruption of Growing Spinach Plants

    National Research Council Canada - National Science Library

    Hora, Rajneesh; Warriner, Keith; Shelp, Barry J; Griffiths, Mansel W

    2005-01-01

    The internalization and persistence of a bioluminescent Escherichia coli O157:H7 Ph1 was investigated in growing spinach plants that had been either biologically or mechanically damaged. In control (undamaged...

  15. Assessment of Shiga Toxin-Producing Escherichia coli O157 Illnesses Prevented by Recalls of Beef Products.

    Science.gov (United States)

    Seys, Scott A; Sampedro, Fernando; Hedberg, Craig W

    2015-09-01

    Beef product recall data from 2005 through 2012 associated with Shiga toxin-producing Escherichia coli (STEC) O157 contamination were used to develop quantitative models to estimate the number of illnesses prevented by recalls. The number of illnesses prevented was based on the number of illnesses that occurred relative to the number of pounds consumed, then extrapolated to the number of pounds of recalled product recovered. A simulation using a Program Evaluation and Review Technique (PERT) probability distribution with illness-related recalls estimated 204 (95% credible interval, 117-333) prevented STEC O157 illnesses from 2005 through 2012. Recalls not associated with illnesses had more recalled product recovered and prevented an estimated 83 additional STEC O157 illnesses. Accounting for underdiagnosis resulted in an estimated total of 7500 STEC O157 illnesses prevented over 8 years. This study demonstrates that recalls, although reactive in nature, are an important tool for averting further exposure and illnesses.

  16. Carvacrol and p-cymene inactivate Escherichia coli O157:H7 in apple juice

    Directory of Open Access Journals (Sweden)

    Roller Sibel

    2005-06-01

    Full Text Available Abstract Background Outbreaks of food poisoning associated with drinking un-pasteurised apple juice contaminated with enterohaemorrhagic Escherichia coli O157:H7 are a cause of serious illness and occasionally death. Whilst a well-established heat process (pasteurisation will readily eliminate the pathogen, some consumers are demanding more fresh-like foods that have not been subjected to processing methods that are perceived as severe and may lead to loss of flavour and vitamins. Therefore, alternative methods are being investigated to replace pasteurisation and improve the safety of minimally-processed juices. The addition of natural antimicrobial substances such as the phenolic substances carvacrol and p-cymene (derived from the essential oils of herbs and spices provides a potential new route to assure safety and extend the shelf-life of raw fruit juices. The aim of this study was to evaluate the addition of very low concentrations (0.25–1.25 mM of carvacrol and p-cymene both individually and in combination as a novel means of controlling Escherichia coli O157:H7 in un-pasteurised apple juice. Results When inoculated at a level of 4 log CFU/ml into un-pasteurised apple juice (pH 3.20 ± 0.06, Escherichia coli O157:H7 survived for up to 3 and 19 days at 25° and 4°C, respectively. Treatment of the juice with 1.25 mM carvacrol or p-cymene reduced the numbers of E. coli O157:H7 to undetectable levels within 1–2 days at both storage temperatures. The effective concentrations of carvacrol could be reduced even further by combining it at 0.5 mM with cymene at 0.25 mM. The phenolic compounds were biocidal against both spoilage yeasts and E. coli O157:H7 thereby increasing the shelf-life and improving the safety of un-pasteurised apple juice, particularly when stored at chill temperatures. Conclusion The results showed that the natural antimicrobial compounds carvacrol and p-cymene could potentially be used to extend the shelf life and improve

  17. ANALISIS MIKROBIOLOGI ESCHERICHIA COLI O157:H7 PADA HASIL OLAHAN HEWAN SAPI DALAM PROSES PRODUKSINYA

    Directory of Open Access Journals (Sweden)

    Trini Sudiarti

    2005-06-01

    Full Text Available Microbiological analysis of Escherichia coli O157:H7 on Cow’s Products during the Production Process. The problem on food health is the high amount of bacterial contamination of food served by several kinds of food sellers, e.g. vendors, restaurants, caterers and food industries. Meat and milk products are kinds of food prone to contamination. To secure food against contamination by bacteria such as E. coli O157:H7, especially related to raw food, should beginwith the securing of products through the whole production process till it reaches the consumers. Although these pathogenic bacteria are part of the normal flora in the intestines of cattle, however we should be aware of the possibility of an outbreak in the community due to E. coli O157:H7 contamination of beef products. To anticipate the danger of an outbreak a study should be conducted to know about this microorganism from the beginning i.e. the production phaseuntil the seller phase. The aim of this research is to know the existence of E. coli O157:H7 on beef and milk products obtained from abattoirs, cow ranches, traditional markets and other sellers in addition with knowing the influencing factors on the spreading of the microorganism. The survey design used for this research is the cross sectional design. The material used for the tests are 250 ml water/milk and 250 gram beef/carcass. The bacterial tests included qualitative tests as follows: presumptive test, confirmed test, completed test, whereas quantitatively tests as follows: Total PlateCound (TPC, Most Probable Number (MPN, which is a near amount prediction of bacteria per 100 ml of water. Results showed that all meat (100% coming from abattoirs and traditional markets were contaminated with E. coli O157:H7, in addition with most of the fresh and pasteurized milk samples (73.3% coming from cattle ranches and home industries. Contamination was also found in most of the water samples (60% and in food handlers (41.7%.

  18. Escherichia coli O157:H7 Outbreak Associated with Restaurant Beef Grinding.

    Science.gov (United States)

    Torso, Lauren M; Voorhees, Ronald E; Forest, Stephen A; Gordon, Andrew Z; Silvestri, Sharon A; Kissler, Bonnie; Schlackman, Jessica; Sandt, Carol H; Toma, Paul; Bachert, Joel; Mertz, Kristen J; Harrison, Lee H

    2015-07-01

    Escherichia coli O157:H7 is a common cause of foodborne illness in the United States. Beef ground at establishments regulated by the U.S. Department of Agriculture, Food Safety and Inspection Service is routinely tested for E. coli O157:H7. Prior to December 2013, boxed beef product (wholesale cuts of beef, such as beef loin, packaged into bags and boxed for shipping) was not always tested for this pathogen. Downstream processors or retailers may grind the product; and, if the ground beef is not cooked to the recommended temperature, pathogens on the exterior of the beef introduced to the interior through grinding may survive. On 18 October 2013, the Allegheny County Health Department identified two E. coli O157:H7 cases, both of whom were food handlers at restaurant A, a restaurant that ground locally produced boxed beef for hamburgers on site. Case finding was conducted through public messaging, employee surveys, and disease surveillance. All potential cases were interviewed using a standard questionnaire. A confirmed case was defined as laboratory-confirmed E. coli O157:H7 with exposure to restaurant A. A probable case was defined as a patient with compatible symptoms and exposure to restaurant A but without laboratory confirmation. All human and food isolates were characterized by pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis. The analysis identified 14 confirmed and 10 probable cases of E. coli; 18 nonintact ground beef samples tested positive for E. coli O157:H7. Nine confirmed cases were restaurant A employees. All confirmed cases recalled eating a restaurant A hamburger in the 10 days before illness onset; most cases reported consuming medium to rare hamburgers. Multiple pulsed-field gel electrophoresis and multilocus variable-number tandem repeat analysis patterns were identified among both the human and ground beef isolates, and the patient isolates matched those found in ground beef samples. Restaurant A

  19. Use of copper cast alloys to control Escherichia coli O157 cross-contamination during food processing.

    Science.gov (United States)

    Noyce, J O; Michels, H; Keevil, C W

    2006-06-01

    The most notable method of infection from Escherichia coli O157 (E. coli O157) is through contaminated food products, usually ground beef. The objective of this study was to evaluate seven cast copper alloys (61 to 95% Cu) for their ability to reduce the viability of E. coli O157, mixed with or without ground beef juice, and to compare these results to those for stainless steel. E. coli O157 (NCTC 12900) (2 x 10(7) CFU) mixed with extracted beef juice (25%) was inoculated onto coupons of each copper cast alloy or stainless steel and incubated at either 22 degrees C or 4 degrees C for up to 6 h. E. coli O157 viability was determined by plate counts in addition to staining in situ with the respiratory indicator fluorochrome 5-cyano-2,3-ditolyl tetrazolium. Without beef extract, three alloys completely killed the inoculum during the 6-h exposure at 22 degrees C. At 4 degrees C, only the high-copper alloys (>85%) significantly reduced the numbers of O157. With beef juice, only one alloy (95% Cu) completely killed the inoculum at 22 degrees C. For stainless steel, no significant reduction in cell numbers occurred. At 4 degrees C, only alloys C83300 (93% Cu) and C87300 (95% Cu) significantly reduced the numbers of E. coli O157, with 1.5- and 5-log kills, respectively. Reducing the inoculum to 10(3) CFU resulted in a complete kill for all seven cast copper alloys in 20 min or less at 22 degrees C. These results clearly demonstrate the antimicrobial properties of cast copper alloys with regard to E. coli O157, and consequently these alloys have the potential to aid in food safety.

  20. Efficacy of an Escherichia coli O157:H7 SRP Vaccine in Orally Challenged Goats and Strain Persistence Over Time.

    Science.gov (United States)

    Swift, Jacob M; Foster, Derek M; Rogers, Anna T; Sylvester, Hannah J; Griffith, Emily H; Jacob, Megan E

    2017-03-01

    Small ruminants have been implicated in outbreaks of Escherichia coli O157:H7 at livestock exhibitions throughout the United States. Additionally, goat meat or milk may serve as a reservoir for foodborne transmission of the organism. These associations highlight the public health importance of an effective strategy to reduce E. coli O157:H7 shedding in goats. We examined the efficacy of the SRP® vaccine in goats orally challenged with E. coli O157:H7. Mixed-breed goats (n = 14) were randomly allocated into vaccinated and unvaccinated treatments (n = 7 per treatment). Goats were housed with a vaccinated and unvaccinated animal in each pen. Feces were collected for 3 weeks, then at necropsy, gastrointestinal contents were collected to determine the concentration of E. coli O157:H7. Three isolates per positive sample were saved and evaluated by pulsed-field gel electrophoresis (PFGE) to assess strain persistence over time. The mean concentration of E. coli O157:H7 in the feces of goats was numerically reduced in the vaccinated treatment; however, it was not statistically significant. In addition, the total number of days goats were fecal positive for E. coli O157:H7 were not different between vaccinated and unvaccinated treatments. Pulsotypes of isolates revealed that goats initially shed two of the four challenge strains of E. coli O157:H7, after which there was a distinct shift to two different strains. Further work is needed to evaluate cost-effective intervention strategies that reliably reduce E. coli O157:H7 shedding in goats, particularly those that may reduce the risk of transmission at public events, including petting zoos and fairs.

  1. Physical Covering to control Escherichia coli O157:H7 and Salmonella in Static and Windrow Composting Process

    Science.gov (United States)

    This study investigated the effect of 30-cm covering of finished compost on survival of E. coli O157:H7 and Salmonella in active static and windrow composting systems. Feedstock inoculated with E. coli O157:H7 (7.41 log CFU/g) and Salmonella (6.46 log CFU/g) were placed in biosentry tubes (7.5 cm di...

  2. Risk factors for the presence of high-level shedders of Escherichia coli O157 on Scottish farms

    OpenAIRE

    Chase-Topping, Margo E.; McKendrick, Iain J.; Pearce, Michael C.; MacDonald, Peter; Matthews, Louise; Halliday, Jo; Allison, Lesley; Fenlon, Dave; Low, J. Christopher; Gunn, George; Woolhouse, Mark E. J.

    2007-01-01

    Escherichia coli O157 infections are the cause of sporadic or epidemic cases of often bloody diarrhea that can progress to hemolytic uremic syndrome (HUS), a systematic microvascular syndrome with predominately renal and neurological complications. HUS is responsible for most deaths associated with E. coli O157 infection. From March 2002 to February 2004, approximately 13,000 fecal pat samples from 481 farms with finishing/store cattle throughout Scotland were examined for the presence of E. ...

  3. Antibiotic resistance and hypermutability of Escherichia coli O157 from feedlot cattle treated with growth-promoting agents.

    Science.gov (United States)

    Lefebvre, Brigitte; Diarra, Moussa S; Giguère, Karine; Roy, Gabriel; Michaud, Sophie; Malouin, François

    2005-11-01

    In a longitudinal study (165 days), we investigated the effect of growth-promoting agents (monensin and trenbolone acetate-estradiol) and an antibiotic (oxytetracycline) on the incidence in feedlot steers of Escherichia coli O157, including antibiotic-resistant and hypermutable isolates. Eighty steers in 16 pens were treated with eight combinations of promoters, and each treatment was duplicated. Fecal samples were collected at nine different sampling times for detection of E. coli O157. Overall, 50 E. coli O157 isolates were detected in treated animals, and none were found in untreated animals. Compared with untreated controls, there was a significant association between the utilization of growth-promoting agents or antibiotics and the shedding of E. coli O157 at day 137 (P = 0.03), when a prevalence peak was observed and 50% of the isolates were detected. Multiplex PCR assays were conducted for some virulence genes. PCR results indicated that all except one isolate possessed at least the Shiga toxin gene stx2. MICs for 12 antibiotics were determined, and eight oxytetracycline-resistant E. coli O157 strains were identified. Antibiotic-resistant strains were considered a distinct subpopulation of E. coli O157 by pulsed-field gel electrophoresis typing. Seven of these antibiotic-resistant strains were isolated early in the study (on or before day 25), and among them two were also hypermutable as determined by rifampin mutation frequencies. The proportion of hypermutable strains among E. coli O157 isolates remained relatively constant throughout the study period. These results indicate that the use of growth-promoting agents and antibiotics in beef production may increase the risk of environmental contamination by E. coli O157.

  4. Distribution patterns of Escherichia coli O157:H7 in ground beef produced by a laboratory-scale grinder.

    Science.gov (United States)

    Flores, Rolando A; Tamplin, Mark L

    2002-12-01

    This study determined the distribution patterns of Escherichia coli O157:1H7 in ground beef when a contaminated beef trim was introduced into a batch of uncontaminated beef trims prior to grinding in a small-scale laboratory grinder. A beef trim (15.3 +/- 2 g) was inoculated with a rifampicin-resistant strain of E. coli O157:H7 (E. coli O157:H7rif) and introduced into a stream of noncontaminated beef (322 +/- 33 g) prior to grinding. Seven inoculum levels (6, 5, and 4 total log CFU [high]; and 3, 2, 1, and 0 total log CFU [low]) were studied in triplicate. E. coli O157:H7rif was not detected in 3.1 to 43% of the ground beef inoculated with the high levels or in 3.4 to 96.9% of the ground beef inoculated with the low levels. For all inoculum levels studied, the five ground beef fractions (each 7.8 +/- 0.6 g) with the highest pathogen levels accounted for 59 to 100% of the total pathogens detected. For all inoculum levels, there was a linear relationship between the quantity of ground beef containing E. coli O157:H7rif and the inoculum level. The quantity of E. coli O157:H7rif in the beef remaining in the grinder was proportional to the inoculum level and was related to the location in the grinder. Different components of the grinder accumulated E. coli O157:H7rif in different quantities, with the most significant accumulation being in the nut (collar) that attaches the die to the blade. This study determined specific distribution patterns of E. coli O157:H7rif after the grinding of a contaminated beef trim along with uncontaminated trims, and the results indicate that the grinding operation should be regarded as a means of distribution of microbial contamination in risk analyses of ground beef operations.

  5. Salutary effect of gastric pentadecapeptide BPC 157 in two different stress urinary incontinence models in female rats.

    Science.gov (United States)

    Jandric, Ivan; Vrcic, Hrvoje; Jandric Balen, Marica; Kolenc, Danijela; Brcic, Luka; Radic, Bozo; Drmic, Domagoj; Seiwerth, Sven; Sikiric, Predrag

    2013-03-12

    Since an originally anti-ulcer stable gastric pentadecapeptide BPC 157 (PL 14736) was shown to promote healing of injured striated muscle and smooth muscle in the gastrointestinal tract, we explored its therapeutic potentials for leak point pressure (LPP) recovery in rat stress urinary incontinence (SUI) after transabdominal urethrolysis (TU) and prolonged vaginal dilatation (VD). During a 7-day period, TU-rats and VD-rats (or healthy rats) received BPC 157, either (i) intraperitoneally, 10 µg/kg or 10 ng/kg, once daily (first administration 30 min after surgery, last 24 h before LPP-testing and sacrifice), or (ii) per-orally, 10 µg/kg in drinking water (0.16 µg/mL, 12 mL/rat/day). Vesicourethral segments were harvested for immunohistochemical evaluation. All BPC 157 regimens counteracted decrease of LPP values in TU-rats and VD-rats. Additionally, BPC 157-TU rats (µg-intraperitoneally or per-orally) and BPC 157-VD rats (µg intraperitoneally) reached LPP values originally noted in healthy rats. Conversely, in healthy rats, BPC 157 did not alter LPP. Immunohistochemical studies revealed higher desmin (delineates striated organization of skeletal muscle), smooth muscle actin, and CD34 (angiogenic marker) positivity within the urethral wall in BPC 157-treated rats vs. controls, as well as overall preserved muscle/connective tissue ratio assessed with Mallory's trichrome staining. Pentadecapeptide BPC 157, applied parenterally or per-orally, appears to ameliorate the SUI in rat models, improving the otherwise detrimental course of healing after VD and TU, which may be analogous to human injury. These beneficial effects may possibly be selectively used in future strategies for treatment of SUI.

  6. Shiga toxin-producing Escherichia coli O157:H7 in milk and milk products in Ogun State, Nigeria.

    Science.gov (United States)

    Ivbade, Akhigbe; Ojo, Olufemi Ernest; Dipeolu, Morenike Atinuke

    2014-01-01

    Shiga toxin producing Escherichia coli (STEC) O157 is a major cause of food-borne illnesses in humans. This study investigated the presence of STEC O157 in milk and milk products in Ogun State, Nigeria. Of a total of 202 samples 10 (5%) were positive for STEC O157 including 1 (2%) of 50 raw milk samples, 3 (6%) of 50 samples of fresh local cheese, 1 (2%) of 50 samples of fried local cheese and 5 (9.6%) of 52 fermented milk samples. There was no significant difference (p>0.05) in the prevalence of STEC O157 among the sample types. Of 10 isolates, shiga toxin 1 gene (stx1) was detected only in 2 samples (20%), shiga toxin 2 (stx2) was extracted only in 6 samples (60%), stx1 /stx2 in 2 samples (20.0%), intimin gene (eaeA) in 5 samples (50%), and enterohaemolysin (E-hlyA) gene was isolated in 7 (70%) samples. Rates of resistance of the STEC O157 isolates were: amoxicillin/clavulanic acid 100%, ampicillin 100%, chloramphenicol 60%, nalidixic acid 20%, norfloxacin 10%, streptomycin 30%, sulphamethoxazole/trimethprim 20%, and tetracycline 90%. The isolates were all susceptible to ciprofloxacin and neomycin. The presence of virulent multidrug resistant E. coli O157 strains in milk and milk products as revealed by this study unveils a risk of human exposure to these potentially fatal pathogens following consumption of contaminated products.

  7. Recovery and Behaviour of Stressed Escherichia coli O157:H7 Cells on Rocket Leaf Surfaces Inoculated by Different Methods

    Directory of Open Access Journals (Sweden)

    ANAS A. AL-NABULSI

    2016-03-01

    Full Text Available E. coli O157:H7 is an emerging public health concern worldwide because of its low infectious dose and ability to survive under adverse conditions. Tests were conducted to determine the abilityof unstressed E. coli O157:H7 cells or those stressed by acid, cold, salt exposure or starvation to survive on the surfaces of rocket leaves after contamination by three methods (dip, spray or spot inoculation and following storage at 10 or 25ºC. E. coli O157:H7 numbers recovered from rocket leaves contaminated by the different techniques were in the order of dip > spot > spray inoculation.Numbers of stressed E. coli O157:H7 recovered after inoculation by all three methods increased significantly over 7d storage at 10 or 25ºC, while unstressed E. coli O157:H7 only grew following dip inoculation. Exposure to adverse environmental conditions may increase the risk of E. coli O157:H7 survival and spread on leafy green vegetables.

  8. Sequential effect of phages and cold nitrogen plasma against Escherichia coli O157:H7 biofilms on different vegetables.

    Science.gov (United States)

    Cui, Haiying; Bai, Mei; Yuan, Lu; Surendhiran, Duraiarasan; Lin, Lin

    2018-03-02

    Escherichia coli O157:H7 (E. coli O157:H7) is one of the most common pathogens in fresh vegetables and fruits, and most of the diseases produced by E. coli O157:H7 are associated with biofilms. Cold nitrogen plasma (CNP) is a cold sterilization technique which has no residue. However to completely eliminate the biofilm on the surface of vegetables the processing power and time of CNP have to be enhanced, which will impact on the quality of fruits and vegetables. Thus the sequential treatment of CNP and phage techniques was engineered in this study. Compared to treatment performed separately, sequential treatment not only had more mild treatment conditions as 400W CNP treatment for 2min and 5% phage treatment for 30min, but also exhibited more remarkable effect on eradicating E. coli O157:H7 biofilms in vitro and on vegetables. The population of E. coli O157:H7 was approximately reduced by 2logCFU/cm 2 after individual treatment of 5% phages for 30min or 500W CNP for 3min. While the sequential treatment of CNP (400W, 2min) and phages (5%, 30min) reduced the E. coli O157:H7 viable count in biofilm by 5.71logCFU/cm 2 . Therefore, the sequential treatment holds a great promise to improve the current treatment systems of bacterial contamination on different vegetable surfaces. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Survival mechanism of Escherichia coli O157:H7 against combined treatment with acetic acid and sodium chloride.

    Science.gov (United States)

    Lee, Sun-Young; Kang, Dong-Hyun

    2016-05-01

    The combination of salt and acid is commonly used in the production of many foods, including pickles and fermented foods. However, in our previous studies, the addition of salt significantly reduced the inhibitory effect of acetic acid on Escherichia coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the mechanism by which salt confers resistance against acetic acid in E. coli O157:H7. The addition of high concentrations (up to 9% or 15% [w/v]) of salt increased the resistance of E. coli O157:H7 to acetic acid treatment. Combined treatment with acetic acid and salt showed varying results among different bacterial strains (an antagonistic effect for E. coli O157:H7 and Shigella and a synergistic effect for Listeria monocytogenes and Staphylococcus aureus). The addition of salt increased the cytoplasmic pH of E. coli O157:H7, but decreased the cytoplasmic pH of L. monocytogenes and S. aureus on treatment with acetic acid. Therefore, the addition of salt increases the acid resistance of E. coli O157:H7 possibly by increasing its acid resistance response and consequently preventing the acidification of its cytoplasm by organic acids. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Achilles detachment in rat and stable gastric pentadecapeptide BPC 157: Promoted tendon-to-bone healing and opposed corticosteroid aggravation.

    Science.gov (United States)

    Krivic, Andrija; Anic, Tomislav; Seiwerth, Sven; Huljev, Dubravko; Sikiric, Predrag

    2006-05-01

    Stable gastric pentadecapeptide BPC 157 (BPC 157, as an antiulcer agent in clinical trials for inflammatory bowel disease; PLD-116, PL 14736, Pliva, no toxicity reported) alone (without carrier) ameliorates healing of tendon and bone, respectively, as well as other tissues. Thereby, we focus on Achilles tendon-to-bone healing: tendon to bone could not be healed spontaneously, but it was recovered by this peptide. After the rat's Achilles tendon was sharply transected from calcaneal bone, agents [BPC 157 (10 microg, 10 ng, 10 pg), 6alpha-methylprednisolone (1 mg), 0.9% NaCl (5 mL)] were given alone or in combination [/kg body weight (b.w.) intraperitoneally, once time daily, first 30-min after surgery, last 24 h before analysis]. Tested at days 1, 4, 7, 10, 14, and 21 after Achilles detachment, BPC 157 improves healing functionally [Achilles functional index (AFI) values substantially increased], biomechanically (load to failure, stiffness, and Young elasticity modulus significantly increased), macro/microscopically, immunohistochemistry (better organization of collagen fibers, and advanced vascular appearance, more collagen type I). 6alpha-Methylprednisolone consistently aggravates the healing, while BPC 157 substantially reduces 6alpha-methylprednisolone healing aggravation. Thus, direct tendon-to-bone healing using stabile nontoxic peptide BPC 157 without a carrier might successfully exchange the present reconstructive surgical methods. Copyright 2006 Orthopaedic Research Society.

  11. Relative nephroprotection during Escherichia coli O157:H7 infections: association with intravenous volume expansion.

    Science.gov (United States)

    Ake, Julie A; Jelacic, Srdjan; Ciol, Marcia A; Watkins, Sandra L; Murray, Karen F; Christie, Dennis L; Klein, Eileen J; Tarr, Phillip I

    2005-06-01

    The hemolytic uremic syndrome (HUS) consists of hemolytic anemia, thrombocytopenia, and renal failure. HUS is often precipitated by gastrointestinal infection with Shiga toxin-producing Escherichia coli and is characterized by a variety of prothrombotic host abnormalities. In much of the world, E coli O157:H7 is the major cause of HUS. HUS can be categorized as either oligoanuric (which probably signifies acute tubular necrosis) or nonoligoanuric. Children with oligoanuric renal failure during HUS generally require dialysis, have more complicated courses, and are probably at increased risk for chronic sequelae than are children who experience nonoligoanuric HUS. Oligoanuric HUS should be avoided, if possible. The presentation to medical care of a child with definite or possible E coli O157:H7 infections but before HUS ensues affords a potential opportunity to ameliorate the course of the subsequent renal failure. However, it is not known whether events that occur early in E coli O157:H7 infections, particularly measures to expand circulating volume, affect the likelihood of experiencing oligoanuric HUS if renal failure develops. We attempted to assess whether pre-HUS interventions and events, especially the volume and sodium content of intravenous fluids administered early in illness, affect the risk for developing oligoanuric HUS after E coli O157:H7 infections. We performed a prospective cohort study of 29 children with HUS that was confirmed microbiologically to be caused by E coli O157:H7. Infected children were enrolled when they presented with acute bloody diarrhea or as contacts of patients who were known to be infected with E coli O157:H7, or if they had culture-confirmed infection, or if they presented with HUS. HUS was defined as hemolytic anemia (hematocrit renal insufficiency (serum creatinine concentration that exceeded the upper limit of normal for age). A wide range of pre-HUS variables, including demographic factors, clinical history, medications

  12. A Sensitive Multiplex, Real-Time PCR Assay for Prospective Detection of Shiga Toxin-Producing Escherichia coli from Stool Samples Reveals Similar Incidences but Variable Severities of Non-O157 and O157 Infections in Northern California

    Science.gov (United States)

    Lefterova, Martina I.; Slater, Kathleen A.; Budvytiene, Indre; Dadone, Patricia A.

    2013-01-01

    Rapid and accurate detection of Shiga toxin-producing Escherichia coli (STEC) of all serotypes from patients with diarrhea is critical for medical management and for the prevention of ongoing transmission. In this prospective study, we assessed the performance of a multiplex, real-time PCR assay targeting stx1 and stx2 for the detection of O157 and non-O157 STEC in diarrheal stool samples enriched in Gram-negative broth. We show that the assay is 100% sensitive (95% confidence interval [CI], 89.1% to 100%) and 98.5% specific (95% CI, 90.6% to 99.9%) based on a panel of 40 known STEC-positive specimens and 65 known negative specimens. During a 2-year postvalidation period, the assay detected more positive samples from patients in northern California than did culture and PCR testing performed at a public health reference laboratory, with a positive predictive value of 95.6% (95% CI, 87.6% to 99.1%). Serotyping data showed an incidence rate of 51.2% for non-O157 STEC strains, with 5.8% of patients (1/17) with non-O157 strains and 42.9% (6/14) with O157 strains (P = 0.03) developing hemolytic-uremic syndrome. The findings from this study underscore the recommendations of the CDC for laboratories to test all diarrheal stool samples from patients with acute community-acquired diarrhea for non-O157 STEC in addition to the O157 serotype by using a sensitive assay. Additionally, a survey of 17 clinical laboratories in northern California demonstrated that nearly 50% did not screen all stool specimens for the presence of Shiga toxins, indicating that many clinical microbiology laboratories still do not routinely screen all stool specimens for the presence of Shiga toxins as recommended in the 2009 CDC guidelines. PMID:23843484

  13. Acid and alcohol tolerance of Escherichia coli O157:H7 in pulque, a typical Mexican beverage.

    Science.gov (United States)

    Gómez-Aldapa, Carlos A; Díaz-Cruz, Claudio A; Villarruel-López, Angelica; Del Refugio Torres-Vitela, M; Rangel-Vargas, Esmeralda; Castro-Rosas, Javier

    2012-03-01

    Pulque is a traditional Mexican fermented alcoholic beverage produced from the nectar of maguey agave plants. No data exist on the behavior of Escherichia coli O157:H7 in agave nectar and pulque. An initial trial was done of the behavior of E. coli O157:H7 during fermentation of nectar from a single producer, a nectar mixture from different producers and "seed" pulque. A second trial simulating artisanal pulque production was done by contaminating fresh nectar with a cocktail of three E. coli O157:H7 strains, storing at 16 ° and 22 °C for 14 h, adding seed pulque and fermenting until pulque was formed. A third trial used pulque from the second trial stored at 22 °C as seed to ferment fresh nectar at 22 °C for 48 h (fermentation cycle). This procedure was repeated for an additional two fermentation cycles. During incubation at 16 ° or 22 °C in the first trial, the E. coli O157:H7 strains multiplied in both the single producer nectar and nectar mixture, reaching maximum concentration at 12h. E. coli O157:H7 cell concentration then decreased slowly, although it survived at least 72 h in both fermented nectars. E. coli O157:H7 did not multiply in the seed pulque but did survive at least 72 h. In the second trial, the numbers of E. coli O157:H7 increased approximately 1.5 log CFU/ml at 22 °C and 1.2 log CFU/ml at 16 °C after 14 h. After seed pulque was added, E. coli O157:H7 concentration decreased to approximately 2 log CFU/ml, and then remained constant until pulque was produced. In the third trial, the E. coli O157:H7 cells multiplied and survived during at least three nectar fermentation cycles. The results suggest that E. coli O157:H7 can develop acid and alcohol tolerance in pulque, and constitutes a public health risk for pulque consumers. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  15. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  16. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  17. E. coli O157 outbreaks in the United Kingdom: past, present, and future

    Directory of Open Access Journals (Sweden)

    Pennington TH

    2014-08-01

    Full Text Available Thomas Hugh Pennington University of Aberdeen, Aberdeen, United Kingdom Abstract: This review describes Escherichia coli O157 outbreaks in the United Kingdom, beginning from the first, in the 1980s, to those recorded in 2013. We point out that the United Kingdom differs from other countries, particularly the United States, in that it has had a considerable number of outbreaks associated with butchers, but very few caused by contaminated burgers. Two of the butcher-associated outbreaks (in central Scotland in 1996 and South Wales in 2005 were very large and are considered here in detail; the reviewer conducted detailed investigations into both outbreaks. Also considered is the very large outbreak that occurred in visitors to an open farm in Surrey in 2009. Detailed descriptions of some milk-borne outbreaks and incidents connected with camping and childrens' nurseries have been published, and these are also considered in this review. Large outbreaks in the United Kingdom have sometimes led to policy developments regarding food safety, and these are considered, together with public reactions to them, their health effect, and their value, as examples to follow or eschew in terms of the procedures to be adopted in response to incidents of this kind. Regulatory and legal consequences are also considered. As a wise man said, making predictions is difficult, particularly about the future. This review follows this position but points out that although human infections caused by E. coli O157 are rare in the United Kingdom, their incidence has not changed significantly in the last 17 years. This review points out that although a response to an outbreak is to say "lessons must be learned", this response has been tempered by forgetfulness. Accordingly, this review restricts its recommendations regarding outbreaks to two: the crucial importance of a rapid response and the importance of experience, and even "gut feeling", when an inspector is evaluating the

  18. Insight into Shiga toxin genes encoded by Escherichia coli O157 from whole genome sequencing

    Directory of Open Access Journals (Sweden)

    Philip M. Ashton

    2015-02-01

    Full Text Available The ability of Shiga toxin-producing Escherichia coli (STEC to cause severe illness in humans is determined by multiple host factors and bacterial characteristics, including Shiga toxin (Stx subtype. Given the link between Stx2a subtype and disease severity, we sought to identify the stx subtypes present in whole genome sequences (WGS of 444 isolates of STEC O157. Difficulties in assembling the stx genes in some strains were overcome by using two complementary bioinformatics methods: mapping and de novo assembly. We compared the WGS analysis with the results obtained using a PCR approach and investigated the diversity within and between the subtypes. All strains of STEC O157 in this study had stx1a, stx2a or stx2c or a combination of these three genes. There was over 99% (442/444 concordance between PCR and WGS. When common source strains were excluded, 236/349 strains of STEC O157 had multiple copies of different Stx subtypes and 54 had multiple copies of the same Stx subtype. Of those strains harbouring multiple copies of the same Stx subtype, 33 had variants between the alleles while 21 had identical copies. Strains harbouring Stx2a only were most commonly found to have multiple alleles of the same subtype (42%. Both the PCR and WGS approach to stx subtyping provided a good level of sensitivity and specificity. In addition, the WGS data also showed there were a significant proportion of strains harbouring multiple alleles of the same Stx subtype associated with clinical disease in England.

  19. Colistin inhibits E. coli O157:H7 Shiga-like toxin release, binds endotoxins and protects Vero cells.

    Science.gov (United States)

    Percivalle, Elena; Monzillo, Vincenzina; Pauletto, Alessandro; Marone, Piero; Imberti, Roberto

    2016-04-01

    The role of antibiotics in the treatment of Shiga-like toxin (Stx)-producing E. coli infection is still controversial. This study investigated the effects of colistin on Vero cell cytotoxicity caused by the enterohemorrhagic EC O157:H7, and the effects of colistin on Stx and endotoxin release by EC O157:H7. Vero cells were incubated with supernatant collected from EC O157:H7 cultured for 18 h without (control) or with various concentrations of colistin. In the absence of colistin, Vero cell viability after 48 h was 29.1±6.5%. Under the same conditions, the overnight presence of colistin reduced cytotoxicity to Vero cells (viability: 97±3.5 to 56.5±14.4% for colistin concentrations ≥MIC). Sub-MIC concentrations of colistin also provided partial protection (viability: 38.8±12.5 to 36.6±14% for 0.125 and 0.06 mcg/ml colistin, respectively). Endotoxins contributed to the cytotoxic effects on Vero cells since lower but still significant protection was observed when colistin was added directly to the supernatant collected from cultures of untreated EC O157:H7. Colistin reduced Stx release in a concentration-dependent manner, also at sub-MIC concentrations. Coincubation of the supernatant from EC O157:H7 cultures with colistin markedly reduced the endotoxin concentration at all doses investigated. In conclusion, colistin protects Vero cells from EC O157:H7 at supra- and sub-MIC concentrations by inhibiting Stx release and binding endotoxins. Colistin might be a valuable treatment for clinically severe forms of EC O157:H7 infection.

  20. Role of curli and cellulose expression in adherence of Escherichia coli O157:H7 to spinach leaves.

    Science.gov (United States)

    Macarisin, Dumitru; Patel, Jitendra; Bauchan, Gary; Giron, Jorge A; Sharma, Vijay K

    2012-02-01

    Shiga-toxigenic Escherichia coli O157:H7 outbreaks have been linked to consumption of fresh produce. It is generally recognized that bacterial attachment to vegetal matrices constitutes the first step in contamination of fresh produce. Cellular appendages, such as curli fibers, and cellulose, a constituent of extracellular matrix, have been suggested to be involved in E. coli attachment and persistence in fresh produce. A comparative evaluation was conducted on the ability of Shiga toxin-producing E. coli O157:H7 strains EDL933 and 86-24, linked to two independent foodborne disease outbreaks in humans, and their mutants deficient in curli and/or cellulose expression to colonize and to firmly attach to spinach leaf. Inoculated spinach leaves were incubated at 22°C, and at 0, 24, and 48 h after incubation loosely and strongly attached E. coli O157:H7 populations were determined. Curli-expressing E. coli O157:H7 strains developed stronger association with leaf surface, whereas curli-deficient mutants attached to spinach at significantly (pspinach leaves was not significantly different from that of curliated strains. The relative attachment strength of E. coli O157:H7 to spinach increased with incubation time for the curli-expressing strains. Laser scanning confocal microscopy (LSCM) analysis of inoculated leaves revealed that curli-expressing E. coli O157:H7 were surrounded by extracellular structures strongly immunostained with anti-curli antibodies. Production of cellulose was not required to develop strong attachment to spinach leaf. These results indicate that curli fibers are essential for strong attachment of E. coli O157:H7 to spinach whereas cellulose is dispensable.

  1. Dual FITC lateral flow immunoassay for sensitive detection of Escherichia coli O157:H7 in food samples.

    Science.gov (United States)

    Song, Chunmei; Liu, Jinxin; Li, Jianwu; Liu, Qing

    2016-11-15

    A pattern of signal amplification lateral flow immunoassay (LFIA) for pathogen detection, which used fluorescein isothiocyanate (FITC) labeled antigen and antibody for dual FITC-LFIA was developed. Escherichia coli O157:H7 (E.coli O157:H7) was selected as the model analyte. In the signal amplification LFIA method, FITC was mixed with sample culture medium, with the presence of E.coli O157:H7 in the samples, the bacteria could emit a yellow-green fluorescence after incubation, creating a fluorescent antigen probe. This antigen probe was added to LFIA, which already contained E.coli O157:H7 monoclonal antibodies-FITC (McAb-E.coli O157:H7-FITC) dispersed in the conjugate pad. Another E.coli O157:H7 McAb was the test line, and goat anti-mouse IgG antibody was the control line in nitrocellulose (NC) membrane. The visual limit of detection (LOD) of the strip for qualitative detection was 10(5) CFU/mL while the LOD for semi-quantitative detection could down to 10(4) CFU/mL by using scanning reader. Signal amplification LFIA was perfectly applied to the detection of food samples with E.coli O157:H7. The LOD was substantially improved to 1 CFU/mL of the original bacterial content after pre-incubation of the bread, milk and jelly samples in broth for 10, 8 and 8h respectively. The results of this method was more sensitive by 10-fold than the conventional colloidal gold (CG) based strips and comparable to the traditional ELISA. This simple, low-cost and easy to be popularized method served as a significant step towards the development of monitoring food-borne pathogens in food-safety testing. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Inactivation of Escherichia coli O157:H7 on stainless steel upon exposure to Paenibacillus polymyxa biofilms.

    Science.gov (United States)

    Kim, Seonhwa; Bang, Jihyun; Kim, Hoikyung; Beuchat, Larry R; Ryu, Jee-Hoon

    2013-11-01

    We investigated the potential use of biofilm formed by a competitive-exclusion (CE) microorganism to inactivate Escherichia coli O157:H7 on a stainless steel surface. Five microorganisms showing inhibitory activities against E. coli O157:H7 were isolated from vegetable seeds and sprouts. The microorganism with the greatest antimicrobial activity was identified as Paenibacillus polymyxa (strain T5). In tryptic soy broth (TSB), strain T5 reached a higher population at 25 °C than at 12 or 37 °C without losing inhibitory activity against E. coli O157:H7. When P. polymyxa (6 log CFU/mL) was co-cultured with E. coli O157:H7 (2, 3, 4, or 5 log CFU/mL) in TSB at 25 °C, the number of E. coli O157:H7 decreased significantly within 24h. P. polymyxa formed a biofilm on stainless steel coupons (SSCs) in TSB at 25 °C within 24h, and cells in biofilms, compared to attached cells without biofilm formation, showed significantly increased resistance to a dry environment (43% relative humidity [RH]). With the exception of an inoculum of 4 log CFU/coupon at 100% RH, upon exposure to biofilm formed by P. polymyxa on SSCs, populations of E. coli O157:H7 (2, 4, or 6 log CFU/coupon) were significantly reduced within 48 h. Most notably, when E. coli O157:H7 at 2 log CFU/coupon was applied to SSCs on which P. polymyxa biofilm had formed, it was inactivated within 1h, regardless of RH. These results will be useful when developing strategies using biofilms produced by competitive exclusion microorganisms to inactivate foodborne pathogens in food processing environments. © 2013.

  3. Influence of vitamin D on fecal shedding of Escherichia coli O157:H7 in naturally colonized cattle.

    Science.gov (United States)

    Edrington, Tom S; Farrow, Russell L; Mackinnon, Kathryn M; Callaway, Todd R; Anderson, Robin C; Nisbet, David J

    2012-02-01

    Three experiments were conducted to evaluate the influence of vitamin D on fecal shedding of Escherichia coli O157:H7 in cattle. In the first experiment, two groups of cattle (beef and dairy) were assigned to a control treatment or to receive 0.5 × 10(6) IU vitamin D per day via oral bolus for 10 days. Fecal samples were collected before and throughout the dosing period for culture of E. coli O157:H7. No differences were observed for fecal shedding of E. coli O157:H7 among treatments for either beef or dairy animals. Serum concentrations of vitamin D were markedly higher (P vitamin D dosages (2,400, 4,800, and 9,600 IU/day; 14 days each) were administered to 14 dairy steers (7 steers served as controls), fecal samples were collected daily, and serum samples were collected weekly throughout the 42-day experimental period. No significant differences in fecal prevalence or serum vitamin D concentrations were observed for any of the vitamin D dosages. A third experiment sampled feedlot cattle (winter and summer) to determine whether serum vitamin D concentrations were correlated with fecal shedding of E. coli O157:H7. A fecal sample and a blood sample were obtained in each season from 60 randomly selected animals (total of 120 fecal samples and 120 corresponding blood samples). As expected, season was highly correlated (r = 0.66) with serum vitamin D concentration with higher concentrations (P coli O157:H7 prevalence (percentage of positive samples) was not highly correlated (r = 0.16) with season, although the correlation tended to be significant (P = 0.08). The proportion of cattle shedding E. coli O157:H7 was 16.7 and 6.7% for the summer and winter collections, respectively. Results of this research do not support a correlation between vitamin D intake and E. coli O157:H7 shedding in cattle.

  4. Gastric pentadecapeptide BPC 157 accelerates healing of transected rat Achilles tendon and in vitro stimulates tendocytes growth.

    Science.gov (United States)

    Staresinic, M; Sebecic, B; Patrlj, L; Jadrijevic, S; Suknaic, S; Perovic, D; Aralica, G; Zarkovic, N; Borovic, S; Srdjak, M; Hajdarevic, K; Kopljar, M; Batelja, L; Boban-Blagaic, A; Turcic, I; Anic, T; Seiwerth, S; Sikiric, P

    2003-11-01

    In studies intended to improve healing of transected Achilles tendon, effective was a stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, M.W. 1419). Currently in clinical trials for inflammatory bowel disease (PLD-116, PL 14736, Pliva), it ameliorates internal and external wound healing. In rats, the right Achilles tendon transected (5 mm proximal to its calcaneal insertion) presents with a large tendon defect between cut ends. Agents (/kg b.w., i.p., once time daily) (BPC 157 (dissolved in saline, with no carrier addition) (10 microg, 10 ng or 10 pg) or saline (5.0 ml)), were firstly applied at 30 min after surgery, the last application at 24 h before autopsy. Achilles functional index (AFI) was assessed once time daily. Biomechanical, microscopical and macroscopical assessment was on day 1, 4, 7, 10 and 14. Controls generally have severely compromised healing. In comparison, pentadecapeptide BPC 157 fully improves recovery: (i) biomechanically, increased load of failure, load of failure per area and Young's modulus of elasticity; (ii) functionally, significantly higher AFI-values; (iii) microscopically, more mononuclears and less granulocytes, superior formation of fibroblasts, reticulin and collagen; (iv) macroscopically, smaller size and depth of tendon defect, and subsequently the reestablishment of full tendon integrity. Likewise, unlike TGF-beta, pentadecapeptide BPC 157, presenting with no effect on the growth of cultured cell of its own, consistently opposed 4-hydroxynonenal (HNE), a negative modulator of the growth. HNE-effect is opposed in both combinations: BPC 157+HNE (HNE growth inhibiting effect reversed into growth stimulation of cultured tendocytes) and HNE+BPC 157(abolished inhibiting activity of the aldehyde), both in the presence of serum and serum deprived conditions. In conclusion, these findings, particularly, Achilles tendon transection fully recovered in rats, peptide stability suitable delivery, usefully favor gastric

  5. Protozoan Predation of Escherichia coli O157:H7 Is Unaffected by the Carriage of Shiga Toxin-Encoding Bacteriophages.

    Directory of Open Access Journals (Sweden)

    Carrie E Schmidt

    Full Text Available Escherichia coli O157:H7 is a food-borne bacterium that causes hemorrhagic diarrhea and hemolytic uremic syndrome in humans. While cattle are a known source of E. coli O157:H7 exposure resulting in human infection, environmental reservoirs may also be important sources of infection for both cattle and humans. Bacteriophage-encoded Shiga toxins (Stx carried by E. coli O157:H7 may provide a selective advantage for survival of these bacteria in the environment, possibly through their toxic effects on grazing protozoa. To determine Stx effects on protozoan grazing, we co-cultured Paramecium caudatum, a common ciliate protozoon in cattle water sources, with multiple strains of Shiga-toxigenic E. coli O157:H7 and non-Shiga toxigenic cattle commensal E. coli. Over three days at ambient laboratory temperature, P. caudatum consistently reduced both E. coli O157:H7 and non-Shiga toxigenic E. coli populations by 1-3 log cfu. Furthermore, a wild-type strain of Shiga-toxigenic E. coli O157:H7 (EDL933 and isogenic mutants lacking the A subunit of Stx 2a, the entire Stx 2a-encoding bacteriophage, and/or the entire Stx 1-encoding bacteriophage were grazed with similar efficacy by both P. caudatum and Tetrahymena pyriformis (another ciliate protozoon. Therefore, our data provided no evidence of a protective effect of either Stx or the products of other bacteriophage genes on protozoan predation of E. coli. Further research is necessary to determine if the grazing activity of naturally-occurring protozoa in cattle water troughs can serve to decrease cattle exposure to E. coli O157:H7 and other Shiga-toxigenic E. coli.

  6. Thermal inactivation of Escherichia coli O157:H7 in strawberry puree and its effect on anthocyanins and color.

    Science.gov (United States)

    Hsu, Hsin-Yun; Huang, Lihan; Wu, James Swi-Bea

    2014-01-01

    Raw whole strawberries, if contaminated with pathogens, such as Escherichia coli O157:H7, must be pasteurized prior to consumption. Therefore, the objective of this research was to investigate the thermal inactivation kinetics of E. coli O157:H7 in strawberry puree (SP), and evaluate the changes in anthocyanins and color, and the survival of yeasts and molds (YM) after thermal processing. Inoculated with a 5-strain cocktail, fresh SP, with or without added sugar (20 and 40 °Brix), was heated at 50, 52, 54, 57.5, 60, and 62.5 °C to determine the thermal resistance of E. coli O157:H7. In raw SP, the average D-values of E. coli O157:H7 were 909.1, 454.6, 212.8, 46.1, and 20.2 s at 50, 52, 54, 57.5, and 60 °C, respectively, with a z-value of 5.9 °C. While linearly decreasing with temperature, the log D-values of E. coli O157:H7 increased slightly with sugar concentration. The log degradation rates of anthocyanins increased linearly with temperature, but decreased slightly with sugar concentrations. These results suggest that sugar may provide some protection to both E. coli O157: H7 and anthocyanins in SP. The browning index was not affected by heating at 50 and 52 °C at low sugar concentrations, but increased by an average of 1.28%, 2.21%, and 10.1% per min when SP was exposed to heating at 54, 57.5, and 60 °C, respectively. YM was also inactivated by heating. This study demonstrated that properly designed thermal processes can effectively inactivate E. coli O157:H7 and YM in contaminated SP, while minimizing the changes in anthocyanins and color.

  7. Modelling the Growth of Salmonella spp. and Escherichia Coli O157 on Lettuce

    OpenAIRE

    Veys, Olivier; Elias, Susana de Oliveira; Sampers, Imca; Tondo, Eduardo César

    2016-01-01

    This study aimed to model the growth of Salmonella and Escherichia coli O157 on lettuce at different temperatures. Microorganisms were inoculated separately on lettuce and stored at 5, 10, 25, and 37°C. Growth curves were built by fitting the data to the Baranyi’s DMFit model and Ratkowsky equation was used as secondary model. The models were able to assess the growth of both microorganisms and data showed that bacteria did not growth for 24 hours at 10°C, what can be a suitable temperature f...

  8. WASP-157b, a Transiting Hot Jupiter Observed with K2

    Science.gov (United States)

    Močnik, T.; Anderson, D. R.; Brown, D. J. A.; Collier Cameron, A.; Delrez, L.; Gillon, M.; Hellier, C.; Jehin, E.; Lendl, M.; Maxted, P. F. L.; Neveu-VanMalle, M.; Pepe, F.; Pollacco, D.; Queloz, D.; Ségransan, D.; Smalley, B.; Southworth, J.; Triaud, A. H. M. J.; Udry, S.; West, R. G.

    2016-12-01

    We announce the discovery of the transiting hot Jupiter WASP-157b in a 3.95-d orbit around a V = 12.9 G2 main-sequence star. This moderately inflated planet has a Saturn-like density, with a mass of 0.57 ± 0.10 MJup and a radius of 1.06 ± 0.05 RJup. We do not detect any rotational or phase curve modulations, nor the secondary eclipse, with conservative semi-amplitude upper limits of 250 and 20 ppm, respectively.

  9. Defining Moments in MMWR History: 1993 E. coli O157:H7 Hamburger Outbreak

    Centers for Disease Control (CDC) Podcasts

    2017-05-31

    During the 1993 E. coli O157 outbreak, four children died, and approximately 700 persons in four states became ill with severe and often bloody diarrhea after eating hamburgers from fast food restaurants. The first reports of CDC’s investigation into this deadly outbreak were published in MMWR. In this podcast, Dr. Beth Bell shares what it was like to serve as one of CDC’s lead investigators – a boots-on-the-ground disease detective -- for the historic outbreak.  Created: 5/31/2017 by MMWR.   Date Released: 5/31/2017.

  10. Primary and secondary cases in Escherichia coli O157 outbreaks: a statistical analysis.

    LENUS (Irish Health Repository)

    Snedeker, Kate G

    2009-01-01

    BACKGROUND: Within outbreaks of Escherichia coli O157 (E. coli O157), at least 10-15% of cases are thought to have been acquired by secondary transmission. However, there has been little systematic quantification or characterisation of secondary outbreak cases worldwide. The aim of this study was to characterise secondary outbreak cases, estimate the overall proportion of outbreak cases that were the result of secondary transmission and to analyse the relationships between primary and secondary outbreak cases by mode of transmission, country and median age. METHODS: Published data was obtained from 90 confirmed Escherichia coli O157 outbreaks in Great Britain, Ireland, Scandinavia, Canada, the United States and Japan, and the outbreaks were described in terms of modes of primary and secondary transmission, country, case numbers and median case age. Outbreaks were tested for statistically significant differences in the number of ill, confirmed, primary and secondary cases (analysis of variance and Kruskal-Wallis) and in the rate of secondary cases between these variables (Generalised Linear Models). RESULTS: The outbreaks had a median of 13.5 confirmed cases, and mean proportion of 0.195 secondary cases. There were statistically significant differences in the numbers of ill, confirmed, primary and secondary cases between modes of primary transmission (p < 0.021), and in primary and secondary cases between median age categories (p < 0.039) and modes of secondary transmission (p < 0.001).Secondary case rates differed statistically significantly between modes of secondary and primary transmission and median age categories (all p < 0.001), but not between countries (p = 0.23). Statistically significantly higher rates of secondary transmission were found in outbreaks with a median age <6 years and those with secondary transmission via person to person spread in nurseries. No statistically significant interactions were found between country, mode of transmission and age

  11. Comparison of different sample preparation procedures for the detection and isolation of Escherichia coli O157:H7 and Non-O157 STECs from leafy greens and cilantro.

    Science.gov (United States)

    Kase, Julie A; Maounounen-Laasri, Anna; Son, Insook; Deer, Deanne M; Borenstein, Stacey; Prezioso, Samantha; Hammack, Thomas S

    2012-12-01

    The FDA Bacteriological Analytical Manual (BAM) method for the detection/isolation of Shiga toxin-producing Escherichia coli (STEC) involves enrichment of produce rinses, blended homogenates or stomached homogenates. However, the effectiveness of rinsing produce to remove attached bacteria is largely unknown. Moreover, PCR inhibitors can be released under physical treatment. The study objective was to determine the relative effectiveness of recovery methods for STEC contaminated produce. Spinach, lettuce, and cilantro were contaminated with E. coli O157:H7 or a non-O157 STEC, subjected to both the BAM method and a soak method, and tested by real-time PCR and cultural methods. For O157:H7 and non-O157:H7 STECs, the soak method was significantly more productive than leafy green rinses. Of 320 test portions, PCR of recovered colonies confirmed 148 were positive by rinsing and 271 were positive by soaking (an 83% increase in sensitivity). For recovery of O157:H7 from cilantro, of 60 test portions, positives were 38 by soaking, 41 by stomaching, and 28 by blending. Soaking and stomaching were significantly more productive than blending, although soaking was only arithmetically superior to stomaching. Based upon these results, it is recommended that a soak method replace the current BAM procedures. Published by Elsevier Ltd.

  12. Escherichia coli O157: Insights into the adaptive stress physiology and the influence of stressors on epidemiology and ecology of this human pathogen.

    Science.gov (United States)

    Vidovic, Sinisa; Korber, Darren R

    2016-01-01

    Escherichia coli O157, a foodborne pathogen of major concern for public health, has been associated with numerous outbreaks of haemorrhagic colitis and hemolytic uremic syndrome worldwide. Human infection with E. coli O157 has been primarily associated with the food-chain transmission route. This transmission route commonly elicits a multi-faceted adaptive stress response of E. coli O157 for an extended period of time prior to human infection. Several recent research articles have indicated that E. coli O157:H7 has evolved unique survival characteristics which can affect the epidemiology and ecology of this zoonotic pathogen. This review article summarizes the recent knowledge of the molecular responses of E. coli O157 to the most common stressors found within the human food chain, and further emphasizes the influence of these stressors on the epidemiology and ecology of E. coli O157.

  13. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro

    Directory of Open Access Journals (Sweden)

    Huang T

    2015-04-01

    Full Text Available Tonglie Huang,1,* Kuo Zhang,2,* Lijuan Sun,3 Xiaochang Xue,1 Cun Zhang,1 Zhen Shu,1 Nan Mu,1 Jintao Gu,1 Wangqian Zhang,1 Yukun Wang,1 Yingqi Zhang,1 Wei Zhang1 1State Key Laboratory of Cancer Biology, Department of Biopharmaceutics, School of Pharmacy, The Fourth Military Medical University, 2National Engineering Research Center for Miniaturized Detection Systems, School of Life Sciences, Northwest University, 3Department of Ophthalmology, Xijing Hospital, The Fourth Military Medical University, Xi’an, People’s Republic of China *These authors contributed equally to this work Abstract: Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs. Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of

  14. Incidence and tracking of Escherichia coli O157:H7 in a major produce production region in California.

    Science.gov (United States)

    Cooley, Michael; Carychao, Diana; Crawford-Miksza, Leta; Jay, Michele T; Myers, Carol; Rose, Christopher; Keys, Christine; Farrar, Jeff; Mandrell, Robert E

    2007-11-14

    Fresh vegetables have become associated with outbreaks caused by Escherichia coli O157:H7 (EcO157). Between 1995-2006, 22 produce outbreaks were documented in the United States, with nearly half traced to lettuce or spinach grown in California. Outbreaks between 2002 and 2006 induced investigations of possible sources of pre-harvest contamination on implicated farms in the Salinas and San Juan valleys of California, and a survey of the Salinas watershed. EcO157 was isolated at least once from 15 of 22 different watershed sites over a 19 month period. The incidence of EcO157 increased significantly when heavy rain caused an increased flow rate in the rivers. Approximately 1000 EcO157 isolates obtained from cultures of>100 individual samples were typed using Multi-Locus Variable-number-tandem-repeat Analysis (MLVA) to assist in identifying potential fate and transport of EcO157 in this region. A subset of these environmental isolates were typed by Pulse Field Gel Electrophoresis (PFGE) in order to make comparisons with human clinical isolates associated with outbreak and sporadic illness. Recurrence of identical and closely related EcO157 strains from specific locations in the Salinas and San Juan valleys suggests that transport of the pathogen is usually restricted. In a preliminary study, EcO157 was detected in water at multiple locations in a low-flow creek only within 135 meters of a point source. However, possible transport up to 32 km was detected during periods of higher water flow associated with flooding. During the 2006 baby spinach outbreak investigation, transport was also detected where water was unlikely to be involved. These results indicate that contamination of the environment is a dynamic process involving multiple sources and methods of transport. Intensive studies of the sources, incidence, fate and transport of EcO157 near produce production are required to determine the mechanisms of pre-harvest contamination and potential risks for human

  15. Incidence and tracking of Escherichia coli O157:H7 in a major produce production region in California.

    Directory of Open Access Journals (Sweden)

    Michael Cooley

    Full Text Available Fresh vegetables have become associated with outbreaks caused by Escherichia coli O157:H7 (EcO157. Between 1995-2006, 22 produce outbreaks were documented in the United States, with nearly half traced to lettuce or spinach grown in California. Outbreaks between 2002 and 2006 induced investigations of possible sources of pre-harvest contamination on implicated farms in the Salinas and San Juan valleys of California, and a survey of the Salinas watershed. EcO157 was isolated at least once from 15 of 22 different watershed sites over a 19 month period. The incidence of EcO157 increased significantly when heavy rain caused an increased flow rate in the rivers. Approximately 1000 EcO157 isolates obtained from cultures of>100 individual samples were typed using Multi-Locus Variable-number-tandem-repeat Analysis (MLVA to assist in identifying potential fate and transport of EcO157 in this region. A subset of these environmental isolates were typed by Pulse Field Gel Electrophoresis (PFGE in order to make comparisons with human clinical isolates associated with outbreak and sporadic illness. Recurrence of identical and closely related EcO157 strains from specific locations in the Salinas and San Juan valleys suggests that transport of the pathogen is usually restricted. In a preliminary study, EcO157 was detected in water at multiple locations in a low-flow creek only within 135 meters of a point source. However, possible transport up to 32 km was detected during periods of higher water flow associated with flooding. During the 2006 baby spinach outbreak investigation, transport was also detected where water was unlikely to be involved. These results indicate that contamination of the environment is a dynamic process involving multiple sources and methods of transport. Intensive studies of the sources, incidence, fate and transport of EcO157 near produce production are required to determine the mechanisms of pre-harvest contamination and potential risks

  16. Capture of Escherichia coli O157:H7 Using Immunomagnetic Beads of Different Size and Antibody Conjugating Chemistry

    Directory of Open Access Journals (Sweden)

    George Paoli

    2009-01-01

    Full Text Available Immunomagnetic beads (IMB were synthesized using anti-Escherichia coli O157 antibodies and magnetic beads of two different sizes (1 mm and 2.6 to 2.8 mm that contained a streptavidin coating, activated carboxyl groups or tosylated surfaces. The synthesized IMB, together with a commercially available IMB, were used to capture different strains of E. coli O157:H7 and E. coli O157:NM. The E. coli capture was measured by the time resolved fluorescence (TRF intensity using a sandwich assay which we have previously demonstrated of having a sensitivity of 1 CFU/g after 4.5 hour enrichment [1]. The analyses of measured TRF intensity and determined antibody surface concentration indicated that larger beads provided higher response signals than smaller beads and were more effective in capturing the target of interest in pure culture and ground beef. In addition, while each type of IMB showed different favorable capture of E. coli O157:H7, streptavidin-coated IMB elicited the highest response, on average. Streptavidin-coated IMB also provided an economic benefit, costing less than $0.50 per assay. The results could be used to guide the proper choice of IMB for applications in developing detection processes for E. coli O157:H7.

  17. Capture of Escherichia coli O157:H7 Using Immunomagnetic Beads of Different Size and Antibody Conjugating Chemistry.

    Science.gov (United States)

    Tu, Shu-I; Reed, Sue; Gehring, Andrew; He, Yiping; Paoli, George

    2009-01-01

    Immunomagnetic beads (IMB) were synthesized using anti-Escherichia coli O157 antibodies and magnetic beads of two different sizes (1 μm and 2.6 to 2.8 μm) that contained a streptavidin coating, activated carboxyl groups or tosylated surfaces. The synthesized IMB, together with a commercially available IMB, were used to capture different strains of E. coli O157:H7 and E. coli O157:NM. The E. coli capture was measured by the time resolved fluorescence (TRF) intensity using a sandwich assay which we have previously demonstrated of having a sensitivity of 1 CFU/g after 4.5 hour enrichment [1]. The analyses of measured TRF intensity and determined antibody surface concentration indicated that larger beads provided higher response signals than smaller beads and were more effective in capturing the target of interest in pure culture and ground beef. In addition, while each type of IMB showed different favorable capture of E. coli O157:H7, streptavidin-coated IMB elicited the highest response, on average. Streptavidin-coated IMB also provided an economic benefit, costing less than $0.50 per assay. The results could be used to guide the proper choice of IMB for applications in developing detection processes for E. coli O157:H7.

  18. Cross contamination of Escherichia coli O157:H7 between lettuce and wash water during home-scale washing.

    Science.gov (United States)

    Jensen, Dane A; Friedrich, Loretta M; Harris, Linda J; Danyluk, Michelle D; Schaffner, Donald W

    2015-04-01

    Lettuce and leafy greens have been implicated in multiple foodborne disease outbreaks. This study quantifies cross contamination between lettuce pieces in a small-scale home environment. A five-strain cocktail of relevant Escherichia coli O157:H7 strains was used. Bacterial transfer between single inoculated lettuce leaf pieces to 10 non-inoculated lettuce leaf pieces that were washed in a stainless steel bowl of water for 30 s, 1 min, 2 min, and 5 min was quantified. Regardless of washing time, the wash water became contaminated with 90-99% of bacteria originally present on the inoculated lettuce leaf piece. The E. coli O157:H7 concentration on initially inoculated leaf pieces was reduced ∼ 2 log CFU. Each initially uncontaminated lettuce leaf piece had ∼ 1% of the E. coli O157:H7 from the inoculated lettuce piece transferred to it after washing, with more transfer occurring during the shortest (30 s) and longest (5 min) wash times. In all cases the log percent transfer rates were essentially normally distributed. In all scenarios, most of the E. coli O157:H7 (90-99%) transferred from the inoculated lettuce pieces to the wash water. Washing with plain tap water reduces levels of E. coli O157:H7 on the inoculated lettuce leaf pieces, but also spreads contamination to previously uncontaminated leaf pieces. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method.

    Science.gov (United States)

    Amraee, Masoum; Oloomi, Mana; Yavari, Afsaneh; Bouzari, Saeid

    2017-11-01

    Escherichia coli (E. coli) O157:H7 is a foodborne pathogen that causes symptoms in humans. Its rapid identification should be considered to avoid toxic effects of the pathogen. In this study, systematic evolution of ligands by exponential enrichment using whole cells (Cell-SELEX) method was used for recognizing E. coli strain, O157 by single-stranded DNA library of aptamer. Nine rounds of cell-selex procedure were applied using O157, as a whole-cell target, with O42, K12, Top10, DH5α E. coli cells, Shigella flexneri and Salmonella typhi as counterparts. The specific interaction between selected DNA aptamers and targeted cell was assessed. After applying six rounds of SELEX for selection of DNA aptamers, the candidate sequences were obtained. Finally, specific aptamer was selected as an ideal aptamer for detection and capturing of E. coli O157. Dissociation constant of the selected aptamer were calculated (107.6 ± 67.8 pM). In addition, the secondary structure prediction and cross reactivity assays were performed. The isolated aptamer efficiency was confirmed and it was shown that the new DNA aptamer sequence has the ability to use for detection. This specific O157:H7 aptamer have the potential for application as a diagnostic ligand and could be used for detection of the related food borne diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Strategy for Accurate Detection of Escherichia Coli O157:H7 in Ground Pork Using a Lateral Flow Immunoassay.

    Science.gov (United States)

    Cheng, Song; Chen, Ming-Hui; Zhang, Gang-Gang; Yu, Zhi-Biao; Liu, Dao-Feng; Xiong, Yong-Hua; Wei, Hua; Lai, Wei-Hua

    2017-04-02

    Escherichia coli O157:H7 is known to cause serious diseases including hemorrhagic colitis and hemolytic uremic syndrome. A gold nanoparticle lateral flow immunoassay (Au-LFIA) was used to detect Escherichia coli O157:H7 in ground pork samples. False-positive results were detected using Au-LFIA; a Citrobacter freundii strain was isolated from the ground pork samples and identified by using CHROmagar TM plates, API 20E, and 16S RNA sequencing. Since C. freundii showed cross-reactivity with E. coli O157:H7 when Au-LFIA test strips were used, a novel method combining modified enrichment with a lateral flow immunoassay for accurate and convenient detection of E. coli O157:H7 in ground pork was developed in this study to minimize these false positives. MacConkey broth was optimized for E. coli O157:H7 enrichment and C. freundii inhibition by the addition of 5 mg/L potassium tellurite and 0.10 mg/L cefixime. Using the proposed modified enrichment procedure, the false-positive rate of ground pork samples spiked with 100 CFU/g C. freundii decreased to 5%.

  1. Strategy for Accurate Detection of Escherichia Coli O157:H7 in Ground Pork Using a Lateral Flow Immunoassay

    Directory of Open Access Journals (Sweden)

    Song Cheng

    2017-04-01

    Full Text Available Escherichia coli O157:H7 is known to cause serious diseases including hemorrhagic colitis and hemolytic uremic syndrome. A gold nanoparticle lateral flow immunoassay (Au-LFIA was used to detect Escherichia coli O157:H7 in ground pork samples. False-positive results were detected using Au-LFIA; a Citrobacter freundii strain was isolated from the ground pork samples and identified by using CHROmagarTM plates, API 20E, and 16S RNA sequencing. Since C. freundii showed cross-reactivity with E. coli O157:H7 when Au-LFIA test strips were used, a novel method combining modified enrichment with a lateral flow immunoassay for accurate and convenient detection of E. coli O157:H7 in ground pork was developed in this study to minimize these false positives. MacConkey broth was optimized for E. coli O157:H7 enrichment and C. freundii inhibition by the addition of 5 mg/L potassium tellurite and 0.10 mg/L cefixime. Using the proposed modified enrichment procedure, the false-positive rate of ground pork samples spiked with 100 CFU/g C. freundii decreased to 5%.

  2. Escherichia coli O157:H7 populations in ruminants can be reduced by orange peel product feeding.

    Science.gov (United States)

    Callaway, Todd R; Carroll, Jeffery A; Arthington, John D; Edrington, Tom S; Rossman, Michelle L; Carr, Mandy A; Krueger, Nathan A; Ricke, Steven C; Crandall, Phil; Nisbet, David J

    2011-11-01

    Foodborne pathogenic bacteria such as Escherichia coli O157:H7 are threats to the safety of beef. Citrus peel and dried orange pulp are by-products from citrus juice production that have natural antimicrobial effects and are often incorporated into least-cost ration formulations for beef and dairy cattle. This study was designed to determine if orange peel and pulp affected E. coli O157:H7 populations in vivo. Sheep (n = 24) were fed a cracked corn grain-based diet that was supplemented with a 50-50 mixture of dried orange pellet and fresh orange peel to achieve a final concentration (dry matter basis, wt/wt) of 0, 5, or 10% pelleted orange peel (OP) for 10 days. Sheep were artificially inoculated with 10(10) CFU of E. coli O157:H7 by oral dosing. Fecal shedding of E. coli O157:H7 was measured daily for 5 days after inoculation, after which all animals were humanely euthanized. At 96 h postinoculation, E. coli O157:H7 shedding was reduced (P orange peel products can be used as a preharvest intervention strategy as part of an integrated pathogen reduction scheme.

  3. Growth and survival of Escherichia coli O157:H7 and Listeria monocytogenes in egg products held at different temperatures.

    Science.gov (United States)

    Yang, S E; Chou, C C

    2000-07-01

    Growth and survival of Escherichia coli O157:H7 and Listeria monocytogenes in steamed eggs and scrambled eggs held at different temperatures (5, 18, 22, 37, 55, and 60 degrees C) were investigated in the present study. Among the holding temperatures tested, both pathogens multiplied best at 37 degrees C followed by 22, 18, and 5 degrees C. In general, E. coli O157:H7 grew better in the egg products than L. monocytogenes did at all the storage temperatures tested except at 5 degrees C. E. coli O157:H7 did not grow in steamed eggs and scrambled eggs held at 5 degrees C. L. monocytogenes showed a slight population increase of approximately 0.6 to 0.9 log CFU/g in these egg products at the end of the 36-h storage period at 5 degrees C. The population of both pathogens detected in the egg products was affected by the initial population, holding temperature, and length of the holding period. It was also noted that L. monocytogenes was more susceptible than E. coli O157:H7 in steamed eggs held at 60 degrees C. After holding at 60 degrees C for 1 h, no detectable viable cells of L. monocytogenes with a population reduction of 5.4 log CFU/g was observed in steamed eggs, whereas a lower population reduction of only approximately 0.5 log CFU/ml was noted for E. coli O157:H7.

  4. Influence of raw meat natural background flora on growth of Escherichia coli O157: H7 in ground beef

    Directory of Open Access Journals (Sweden)

    Saad Susana M.I.

    1999-01-01

    Full Text Available Escherichia coli O157:H7 is a foodborne pathogen of increasing importance. It has been involved in several threatening outbreaks, most of them associated with meat products. In this study, the influence of some bacteria from the natural background flora of raw meat over E.coli O157:H7 in ground beef stored under refrigeration and at room temperature was evaluated. Different levels of E.coli O157:H7 (101-102, 103-104 and 106-107 CFU/g, inoculated in ground beef samples, were challenged with strains of non-pathogenic E.coli, Pseudomonas putida or Leuconostoc sp. Growth of the pathogen was monitored using standard cultural methods and an ELISA-type rapid method. Non-pathogenic E.coli, Pseudomonas putida and Leuconostoc sp. did not affect growth of E.coli O157:H7 in ground beef, both under refrigeration and at room temperature. Based on these findings, the low occurrence of E.coli O157:H7 in raw meat may not be attributed to antagonistic effects of bacteria from the natural background flora.

  5. Effect of salt addition on acid resistance response of Escherichia coli O157:H7 against acetic acid.

    Science.gov (United States)

    Bae, Young-Min; Lee, Sun-Young

    2017-08-01

    A combination of salt and acid is commonly used in the production of many foods, such as pickles and fermented foods. However, in our previous studies, addition of salt significantly reduced the inhibitory effect of acetic acid against E. coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the effect of salt addition on the acid resistance (AR) response of E. coli O157:H7 after treatment with acetic acid. The combined effect of acetic acid and salt showed different results depending on media tested. Organic compounds such as yeast extract and tryptone were required to observe the antagonistic effect of salt and acetic acid in combination. However, use of an rpoS mutant or addition of chloramphenicol resulted in no changes in the antagonistic effect of acetic acid and salt. The addition of glutamate to phosphate buffer significantly increased the survival levels of E. coli O157:H7 after the acetic acid treatment; however, the survival levels were lower than those after the treatment with acetic acid alone. Thus, the addition of salt may increase the AR response of E. coli O157:H7; however, these survival mechanisms were not proven clearly. Therefore, further studies need to be performed to better understand the antagonism of acetic acid salt against E. coli O157:H7. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Proliferation of Escherichia coli O157:H7 in Soil-Substitute and Hydroponic Microgreen Production Systems.

    Science.gov (United States)

    Xiao, Zhenlei; Bauchan, Gary; Nichols-Russell, Lydia; Luo, Yaguang; Wang, Qin; Nou, Xiangwu

    2015-10-01

    Radish (Raphanus sativus var. longipinnatus) microgreens were produced from seeds inoculated with Escherichia coli O157:H7 by using peat moss-based soil-substitute and hydroponic production systems. E. coli populations on the edible and inedible parts of harvested microgreen plants (7 days postseeding) and in growth medium were examined. E. coli O157:H7 was shown to survive and proliferate significantly during microgreen growth in both production systems, with a higher level in the hydroponic production system. At the initial seed inoculation level of 3.7 log CFU/g, E. coli O157:H7 populations on the edible part of microgreen plants reached 2.3 and 2.1 log CFU/g (overhead irrigation and bottom irrigation, respectively) for microgreens from the soil-substitute production system and reached 5.7 log CFU/g for those hydroponically grown. At a higher initial inoculation of 5.6 log CFU/g seeds, the corresponding E. coli O157:H7 populations on the edible parts of microgreens grown in these production systems were 3.4, 3.6, and 5.3 log CFU/g, respectively. Examination of the spatial distribution of bacterial cells on different parts of microgreen plants showed that contaminated seeds led to systematic contamination of whole plants, including both edible and inedible parts, and seed coats remained the focal point of E. coli O157:H7 survival and growth throughout the period of microgreen production.

  7. Rapid and selective detection of E. coli O157:H7 combining phagomagnetic separation with enzymatic colorimetry.

    Science.gov (United States)

    Zhang, Yun; Yan, Chenghui; Yang, Hang; Yu, Junping; Wei, Hongping

    2017-11-01

    Mammal IgG antibodies are normally used in conventional immunoassays for E. coli O157:H7, which could lead to false positive results from the presence of protein A producing S. aureus. In this study, a natural specific bacteriophage was isolated and then conjugated with magnetic beads as a capture element in a sandwich format for the rapid and selective detection of E. coli O157:H7. To the best of our knowledge, it was the first time to utilize a natural bacteriophage to develop a phagomagnetic separation combined with colorimetric assay for E. coli O157:H7. The method has an overall time less than 2h with a detection limit of 4.9×10 4 CFU/mL. No interference from S. aureus was observed. Furthermore, the proposed method was successfully applied to detect E. coli O157:H7 in spiked skim milk. The proposed detection system provided a potential method for E. coli O157:H7 and other pathogenic bacteria in food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Down-regulation of platelet surface CD47 expression in Escherichia coli O157:H7 infection-induced thrombocytopenia.

    Directory of Open Access Journals (Sweden)

    Ya-Lan Guo

    Full Text Available BACKGROUND: Platelet depletion is a key feature of hemolytic uremic syndrome (HUS caused by Shiga toxin-producing Escherichia coli (STEC infection. The mechanism underlying STEC-induced platelet depletion, however, is not completely understood. METHODOLOGY/PRINCIPAL FINDINGS: Here we demonstrated for the first time that platelet surface expression of CD47 was significantly decreased in C57BL6 mice treated with concentrated culture filtrates (CCF from STEC O157:H7. STEC O157:H7 CCF treatment also led to a sharp drop of platelet counts. The reduction of cell surface CD47 was specific for platelets but not for neutrophil, monocytes and red blood cells. Down-regulation of platelet surface CD47 was also observed in isolated human platelets treated with O157:H7 CCF. Platelet surface CD47 reduction by O157:H7 CCF could be blocked by anti-TLR4 antibody but not anti-CD62 antibody. Down-regulation of platelet surface CD47 was positively correlated with platelet activation and phagocytosis by human monocyte-derived macrophages. Furthermore, the enhanced phagocytosis process of O157:H7 CCF-treated platelets was abolished by addition of soluble CD47 recombinants. CONCLUSIONS/SIGNIFICANCE: Our results suggest that platelet CD47 down-regulation may be a novel mechanism underneath STEC-induced platelet depletion, and that the interactions between CD47 and its receptor, signal regulatory protein alpha (SIRPalpha, play an essential role in modulating platelet homeostasis.

  9. Predictors and risk factors for the intestinal shedding of Escherichia coli O157 among working donkeys (Equus asinus) in Nigeria.

    Science.gov (United States)

    Jedial, Jesse T; Shittu, Aminu; Tambuwal, Faruk M; Abubakar, Mikail B; Garba, Muhammed K; Kwaga, Jacob P; Fasina, Folorunso O

    2015-01-01

    Escherichia coli are an important group of bacteria in the normal gastrointestinal system but can sometimes cause infections in domestic animals and man. Donkeys are routinely used as multipurpose animal but details of burdens of potentially infectious bacteria associated with it are limited. The prevalence and associations between intestinal shedding of E. coli O157 and animal characteristics and management factors were studied among 240 randomly selected working donkeys in north-western Nigeria. Four local government areas, of Sokoto State in north-western Nigeria were recruited in this study. A multistage randomised cluster design was used to select subjects and donkey owners within selected zones. Confirmation of infection was based on bacterial culture, isolation and biochemical test for E. coli O157 from faecal samples. Of the total bacteria isolated, 203 of the 329 (61.70 per cent) were E. coli, 76 of which was E. coli serotype O157. A multivariable logistic regression model was used to examine the relation between intestinal shedding of E. coli O157 and selected variables. The analysis yielded five potential predictors of shedding: soft faeces in donkeys, Akaza and Fari ecotypes of donkey were positive predictors while maize straw as feed and sampling during the cold dry period were negative predictors. This study concludes that controlling intestinal shedding of E. coli O157 among working donkeys in Nigeria is possible using the identified predictors in planning appropriate interventions to reduced human risk of infection.

  10. Severe Outbreak of Sorbitol-Fermenting Escherichia coli O157 via Unpasteurized Milk and Farm Visits, Finland 2012.

    Science.gov (United States)

    Jaakkonen, A; Salmenlinna, S; Rimhanen-Finne, R; Lundström, H; Heinikainen, S; Hakkinen, M; Hallanvuo, S

    2017-09-01

    Shiga toxin-producing, sorbitol-fermenting Escherichia coli O157 (SF O157) has emerged as a cause of severe human illness. Despite frequent human findings, its transmission routes and reservoirs remain largely unknown. Foodborne transmission and reservoir in cattle have been suspected, but with limited supporting evidence. This study describes the outbreak of SF O157 that occurred in Finland in 2012. The outbreak originated from a recreational farm selling unpasteurized milk, as revealed by epidemiologic and microbiological investigations, and involved six hospitalized children and two asymptomatic adults with culture-confirmed infection. An identical strain of SF O157 was isolated from patients, cattle and the farm environment, and epidemiologic analysis suggested unpasteurized milk as the vehicle of transmission. This study reports the first milkborne outbreak of SF O157, provides supporting evidence of cattle as a reservoir and highlights the health risks related to the consumption of unpasteurized milk. © 2017 The Authors. Zoonoses and Public Health Published by Blackwell Verlag GmbH.

  11. Corrosion barriers processed by Al electroplating and their resistance against flowing Pb–15.7Li

    Energy Technology Data Exchange (ETDEWEB)

    Krauss, Wolfgang, E-mail: wolfgang.krauss@kit.edu; Konys, Jürgen; Wulf, Sven-Erik

    2014-12-15

    In the HCLL blanket design, ferritic–martensitic steels are in direct contact with the flowing liquid breeder Pb–15.7Li and have to withstand severe corrosion attack. Beyond corrosion, T-permeation from the breeder into the RAFM-steels is also an important issue and has to be reduced significantly. Earlier work showed that Al-based coatings can act as barriers for both, however, applied processes e.g. HDA or VPS exhibited strong drawbacks in the past. Meanwhile new industrial relevant coating processes, using electroplating technology are under development and called ECA (electrochemical aluminization) and ECX (electrochemical deposition from ionic liquids) process. In this study electrochemically Al-coated and heat-treated Eurofer samples were tested in PICOLO loop for exposure times up to 12,000 h (ECA) and 2000 h (first results ECX) respectively to determine corrosion properties in flowing Pb–15.7Li (550 °C, 0.1 m/s). Cross section analysis afterward corrosion testing proved the ability of thin Al-based barriers made by electrochemical techniques to protect the bare Eurofer from corrosion attack even at exposure times of 12,000 h. Determined radial corrosion rates lay between 10 and 20 μm/a. First results for ECX coated samples (2000 h) revealed more homogeneous corrosion behavior of the barrier layer itself compared to ECA.

  12. Shiga Toxin–Producing Escherichia coli O157, England and Wales, 1983–2012

    Science.gov (United States)

    Byrne, Lisa; Smith, Geraldine A.; Elson, Richard; Harris, John P.; Salmon, Roland; Smith, Robert; O’Brien, Sarah J.; Adak, Goutam K.; Jenkins, Claire

    2016-01-01

    We evaluated clinical Shiga toxin–producing Escherichia coli O157 infections in England and Wales during 1983–2012 to describe changes in microbiological and surveillance methods. A strain replacement event was captured; phage type (PT) 2 decreased to account for just 3% of cases by 2012, whereas PT8 and PT21/28 strains concurrently emerged, constituting almost two thirds of cases by 2012. Despite interventions to control and reduce transmission, incidence remained constant. However, sources of infection changed over time; outbreaks caused by contaminated meat and milk declined, suggesting that interventions aimed at reducing meat cross-contamination were effective. Petting farm and school and nursery outbreaks increased, suggesting the emergence of other modes of transmission and potentially contributing to the sustained incidence over time. Studies assessing interventions and consideration of policies and guidance should be undertaken to reduce Shiga toxin–producing E. coli O157 infections in England and Wales in line with the latest epidemiologic findings. PMID:26982243

  13. CD157 Marks Tissue-Resident Endothelial Stem Cells with Homeostatic and Regenerative Properties.

    Science.gov (United States)

    Wakabayashi, Taku; Naito, Hisamichi; Suehiro, Jun-Ichi; Lin, Yang; Kawaji, Hideya; Iba, Tomohiro; Kouno, Tsukasa; Ishikawa-Kato, Sachi; Furuno, Masaaki; Takara, Kazuhiro; Muramatsu, Fumitaka; Weizhen, Jia; Kidoya, Hiroyasu; Ishihara, Katsuhiko; Hayashizaki, Yoshihide; Nishida, Kohji; Yoder, Mervin C; Takakura, Nobuyuki

    2018-02-01

    The generation of new blood vessels via angiogenesis is critical for meeting tissue oxygen demands. A role for adult stem cells in this process remains unclear. Here, we identified CD157 (bst1, bone marrow stromal antigen 1) as a marker of tissue-resident vascular endothelial stem cells (VESCs) in large arteries and veins of numerous mouse organs. Single CD157 + VESCs form colonies in vitro and generate donor-derived portal vein, sinusoids, and central vein endothelial cells upon transplantation in the liver. In response to injury, VESCs expand and regenerate entire vasculature structures, supporting the existence of an endothelial hierarchy within blood vessels. Genetic lineage tracing revealed that VESCs maintain large vessels and sinusoids in the normal liver for more than a year, and transplantation of VESCs rescued bleeding phenotypes in a mouse model of hemophilia. Our findings show that tissue-resident VESCs display self-renewal capacity and that vascular regeneration potential exists in peripheral blood vessels. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. CD38 and CD157: biological observations to clinical therapeutic targets.

    Science.gov (United States)

    Czura, Amy Warenda; Czura, Christopher J

    2006-01-01

    The application of molecular knowledge for developing new medical technologies is the goal of molecular medicine. Success in this area is highly dependent on the interaction of investigators from fields as diverse as biochemistry, cell biology, immunology, physiology, epidemiology, and physics, with an eye toward applying their insights and discoveries to improving human health. Such interdisciplinary approaches rarely find the common ground and language necessary to achieve this goal. Recently, a meeting of researchers studying the ectoenzymes CD38 and CD157 brought together insights into the regulation of calcium signaling, the metabolism of pyridine nucleotides by CD38 and CD157, and subsequent effects on immune function. Together, these discoveries were being applied to the development of novel therapeutics and diagnostics for myeloma and chronic lymphocytic leukemia. This issue of Molecular Medicine, featuring several short reviews based on a conference held in Turin, Italy, 10-12 June 2006, showcases the current state of this field and highlights some recent progress in molecular medicine.

  15. Antibody Microarray for E. coli O157:H7 and Shiga Toxin in Microtiter Plates

    Directory of Open Access Journals (Sweden)

    Andrew G. Gehring

    2015-12-01

    Full Text Available Antibody microarray is a powerful analytical technique because of its inherent ability to simultaneously discriminate and measure numerous analytes, therefore making the technique conducive to both the multiplexed detection and identification of bacterial analytes (i.e., whole cells, as well as associated metabolites and/or toxins. We developed a sandwich fluorescent immunoassay combined with a high-throughput, multiwell plate microarray detection format. Inexpensive polystyrene plates were employed containing passively adsorbed, array-printed capture antibodies. During sample reaction, centrifugation was the only strategy found to significantly improve capture, and hence detection, of bacteria (pathogenic Escherichia coli O157:H7 to planar capture surfaces containing printed antibodies. Whereas several other sample incubation techniques (e.g., static vs. agitation had minimal effect. Immobilized bacteria were labeled with a red-orange-fluorescent dye (Alexa Fluor 555 conjugated antibody to allow for quantitative detection of the captured bacteria with a laser scanner. Shiga toxin 1 (Stx1 could be simultaneously detected along with the cells, but none of the agitation techniques employed during incubation improved detection of the relatively small biomolecule. Under optimal conditions, the assay had demonstrated limits of detection of ~5.8 × 105 cells/mL and 110 ng/mL for E. coli O157:H7 and Stx1, respectively, in a ~75 min total assay time.

  16. THE (UN? FAIRNESS OF FAIR VALUE: SFAS 157, IRVING FISHER AND GECON

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Barbosa Lustosa

    2017-01-01

    Full Text Available Objective: The objective of this study is to assess the level of adherence of explicit and implicit measurement concepts present in SFAS 157 – Fair Value Measurements to traditional economic-accounting concepts. Background: The expansion of situations in which fair value measurement is required makes more difficult to ensure that the computed measure of value is actually fair. Out of the objectivity of current sales prices in an active market, all other measures of value are expectations about the future, inherently uncertain and inaccurate. Thus, the desired justice of the computed figures lies not in its accuracy, but in the using of the correct concepts for measuring accounting transactions and events. Method: To reach the objective, the characteristics of this standard are confronted with the secular concept of capital and income set by the laureate American neoclassical economist Irving Fisher, which were incorporated into Information System for Economic Management (Gecon. Results: The results indicate that SFAS 157 fair value concept and measurement structure are incorrect or incomplete, suggesting that the maintenance of the fair value expression in accounting seems inadequate. Contributions: This paper contributes to the literature on accounting measurement showing that as a measurement concept in accounting fair value seems inadequate. In abnormal situations or absence of a market, the measure found is always inexact and subjective, and therefore is not correct to call fair the quantity resulting from this arbitrary calculation.

  17. Effective therapy of transected quadriceps muscle in rat: Gastric pentadecapeptide BPC 157.

    Science.gov (United States)

    Staresinic, Mario; Petrovic, Igor; Novinscak, Tomislav; Jukic, Ivana; Pevec, Damira; Suknaic, Slaven; Kokic, Neven; Batelja, Lovorka; Brcic, Luka; Boban-Blagaic, Alenka; Zoric, Zdenka; Ivanovic, Domagoj; Ajduk, Marko; Sebecic, Bozidar; Patrlj, Leonardo; Sosa, Tomislav; Buljat, Gojko; Anic, Tomislav; Seiwerth, Sven; Sikiric, Predrag

    2006-05-01

    We report complete transection of major muscle and the systemic peptide treatment that induces healing of quadriceps muscle promptly and then maintains the healing with functional restoration. Initially, stable gastric pentadecapeptide BPC 157 (GEPPPGKPADDAGLV, M.W. 1419, PL-10, PLD-116, PL 14736 Pliva, Croatia; in trials for inflammatory bowel disease; wound treatment; no toxicity reported; effective alone without carrier) also superiorly accelerates the healing of transected Achilles tendon. Regularly, quadriceps muscle completely transected transversely 1.0 cm proximal to patella presents a definitive defect that cannot be compensated in rat. BPC 157 (10 microg, 10 ng, 10 pg/kg) is given intraperitoneally, once daily; the first application 30 min posttransection, the final 24 h before sacrifice. It consistently improves muscle healing throughout the whole 72-day period. Improved are: (i) biomechanic (load of failure increased); (ii) function (walking recovery and extensor postural thrust/motor function index returned toward normal healthy values); (iii) microscopy/immunochemistry [i.e., mostly muscle fibers connect muscle segments; absent gap; significant desmin positivity for ongoing regeneration of muscle; larger myofibril diameters on both sides, distal and proximal (normal healthy rat-values reached)]; (iv) macroscopic presentation (stumps connected; subsequently, atrophy markedly attenuated; finally, presentation close to normal noninjured muscle, no postsurgery leg contracture). Thus, posttransection healing-consistently improved-may suggest this peptide therapeutic application in muscle disorders. Copyright 2006 Orthopaedic Research Society.

  18. Rectoanal Junction Colonization of Feedlot Cattle by Escherichia coli O157:H7 and Its Association with Supershedders and Excretion Dynamics▿

    OpenAIRE

    Cobbold, Rowland N.; Hancock, Dale D.; Rice, Daniel H.; Berg, Janice; Stilborn, Robert; Hovde, Carolyn J.; Besser, Thomas E.

    2006-01-01

    Feedlot cattle were observed for fecal excretion of and rectoanal junction (RAJ) colonization with Escherichia coli O157:H7 to identify potential “supershedders.” RAJ colonization and fecal excretion prevalences were correlated, and E. coli O157:H7 prevalences and counts were significantly greater for RAJ samples. Based on a comparison of RAJ and fecal ratios of E. coli O157:H7/E. coli counts, the RAJ appears to be preferentially colonized by the O157:H7 serotype. Five supershedders were iden...

  19. Utilization OF Apple Wash Treatments And Ultraviolet Light For The Elimination Of Escherichia coli O157:H7 In Apple Cider

    OpenAIRE

    Wright, Jim

    1999-01-01

    Three studies regarding Escherichia coli O157:H7 in apple cider were conducted. The objectives were: to evaluate the effectiveness of wash and sanitizers for removing E. coli O157:H7 from apples; to survey cider producer practices; and to determine the efficacy of ultraviolet light for reducing E. coli O157:H7 in cider. Apples with a five-strain acid resistant mixture of E. coli O157:H7 were treated with 200 ppm hypochlorite, a phosphoric acid-based fruit wash, 5% acetic acid, 5% acetic...

  20. Identification of E.coli O157:H7 in Intestinal and Urinary Tract Infection in Samawah City .

    Directory of Open Access Journals (Sweden)

    Mouna Akeel Hamed Al-Oebady

    2017-02-01

    Full Text Available This study was conducted to isolate E.coli O157: H7 as an important zoonotic pathogen from 150 samples (75 bloody stools and 75 urine samples of patients at many age groups range from one to 50 years old and for both sexes were collected from patients suffering from diarrhea and urinary tract infection who attend the Samawah Teaching Hospital for pediatrics and Gynecology of AL-Muthanna Governorate. The results revealed that 120 out of 150 were positive to E.coli O157:H7 at a percentage (80%. The number of E. coli isolates in bloody stool were 67(89.3% and urine samples were 53(70.6% gave positive results to E.coli O157:H7 .

  1. Efficacy of (+-Lariciresinol to Control Bacterial Growth of Staphylococcus aureus and Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    Vivek K. Bajpai

    2017-05-01

    Full Text Available This study was undertaken to assess the antibacterial potential of a polyphenolic compound (+-lariciresinol isolated from Rubia philippinensis against selected foodborne pathogens Staphylococcus aureus KCTC1621 and Escherichia coli O157:H7. (+-Lariciresinol at the tested concentrations (250 μg/disk evoked a significant antibacterial effect as a diameter of inhibition zones (12.1–14.9 mm with minimum inhibitory concentration (MIC, and minimum bactericidal concentration values of 125–250 and 125–250 μg/mL, respectively. Furthermore, (+-lariciresinol at MIC showed reduction in bacterial cell viabilities, efflux of potassium (K+ ions and release of 260 nm materials against E. coli O157:H7 and S. aureus KCTC1621. Moreover, deteriorated cell wall morphology of E. coli O157:H7 and S. aureus KCTC1621 cells treated with (+-lariciresinol at MIC further confirmed its inhibitory effect against the tested pathogens, suggesting it to be an alternative means of antimicrobials.

  2. Effect of spinach cultivar and bacterial adherence factors on survival of Escherichia coli O157:H7 on spinach leaves.

    Science.gov (United States)

    Macarisin, Dumitru; Patel, Jitendra; Bauchan, Gary; Giron, Jorge A; Ravishankar, Sadhana

    2013-11-01

    Similar to phytopathogens, human bacterial pathogens have been shown to colonize the plant phylloplane. In addition to environmental factors, such as temperature, UV, relative humidity, etc., the plant cultivar and, specifically, the leaf blade morphological characteristics may affect the persistence of enteropathogens on leafy greens. This study was conducted to evaluate the effect of cultivar-dependent leaf topography and the role of strain phenotypic characteristics on Escherichia coli O157:H7 persistence on organic spinach. Spinach cultivars Emilia, Lazio, Space, and Waitiki were experimentally inoculated with the foodborne E. coli O157:H7 isolate EDL933 and its isogenic mutants deficient in cellulose, curli, or both curli and cellulose production. Leaves of 6-week-old plants were inoculated with 6.5 log CFU per leaf in a biosafety level 2 growth chamber. At 0, 1, 7, and 14 days, E. coli O157:H7 populations were determined by plating on selective medium and verified by laser scanning confocal microscopy. Leaf morphology (blade roughness and stoma density) was evaluated by low-temperature and variable-pressure scanning electron microscopy. E. coli O157:H7 persistence on spinach was significantly affected by cultivar and strain phenotypic characteristics, specifically, the expression of curli. Leaf blade roughness and stoma density influenced the persistence of E. coli O157:H7 on spinach. Cultivar Waitiki, which had the greatest leaf roughness, supported significantly higher E. coli O157:H7 populations than the other cultivars. These two morphological characteristics of spinach cultivars should be taken into consideration in developing intervention strategies to enhance the microbial safety of leafy greens.

  3. Screening of the novel colicinogenic gram-negative rods against pathogenic Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    H Mushtaq

    2015-01-01

    Full Text Available Purpose: Escherichia coli (E. coli O157:H7 is gram-negative enteric pathogen producing different types of Shiga toxin. This bacterium is the most corporate cause of haemorrhagic colitis in human. Administration of antibiotics (particularly sulfa drugs against this pathogen is a debatable topic as this may increase the risk of uremic syndrome; especially in children and aged people. Around the world, microbiologists are in search of alternative therapeutic methods specially probiotics against this pathogen. In the present study, we have focused on the investigation of alternate bio-therapeutics (probiotics for the treatment of patients infected with E. coli O157:H7. This study is based on the identification of colicin-producing gram-negative bacteria (particularly enterobacteriaceae which can competently exclude E. coli O157:H7 from the gut of the infected individual. Materials and Methods: Hundred samples from human, animal faeces and septic tank water were analysed for nonpathogenic gram-negative rods (GNRs. Results: Out of these samples, 175 isolates of GNRs were checked for their activity against E. coli O157:H7. Only 47 isolates inhibited the growth of E. coli O157:H7, among which majority were identified as E. coli. These E. coli strains were found to be the efficient producers of colicin. Some of the closely related species i. e., Citrobacter sp, Pantoea sp. and Kluyvera sp. also showed considerable colicinogenic activity. Moreover, colicinogenic species were found to be nonhaemolytic, tolerant to acidic environment (pH 3 and sensitive to commonly used antibiotics. Conclusion: Nonhaemolytic, acid tolerant and sensitive to antibiotics suggests the possible use of these circulating endothelial cells (CEC as inexpensive and inoffensive therapeutic agent (probiotics in E. coli O157:H7 infections.

  4. RNA-based detection does not accurately enumerate living Escherichia coli O157:H7 cells on plants

    Directory of Open Access Journals (Sweden)

    Wenting eJu

    2016-02-01

    Full Text Available The capacity to distinguish between living and dead cells is an important, but often unrealized, attribute of rapid detection methods for foodborne pathogens. In this study, the numbers of enterohemorrhagic Escherichia coli O157:H7 after inoculation onto Romaine lettuce plants and on plastic (abiotic surfaces were measured over time by culturing, and quantitative PCR (qPCR, propidium monoazide (PMA-qPCR, and reverse transcriptase (RT-qPCR targeting E. coli O157:H7 gapA, rfbE, eae, and lpfA genes and gene transcripts. On Romaine lettuce plants incubated at low relative humidity, E. coli O157:H7 cell numbers declined 107-fold within 96 h according to culture-based assessments. In contrast, there were no reductions in E. coli levels according to qPCR and only 100- and 1000-fold lower numbers per leaf by RT-qPCR and PMA-qPCR, respectively. Similar results were obtained upon exposure of E. coli O157:H7 to desiccation conditions on a sterile plastic surface. Subsequent investigation of mixtures of living and dead E. coli O157:H7 cells strongly indicated that PMA-qPCR detection was subject to false-positive enumerations of viable targets when in the presence of 100-fold higher numbers of dead cells. RT-qPCR measurements of killed E. coli O157:H7 as well as for RNaseA-treated E. coli RNA confirmed that transcripts from dead cells and highly degraded RNA were also amplified by RT-qPCR. These findings show that neither PMA-qPCR nor RT-qPCR provide accurate estimates of bacterial viability in environments where growth and survival is limited.

  5. BPC 157 counteracts QTc prolongation induced by haloperidol, fluphenazine, clozapine, olanzapine, quetiapine, sulpiride, and metoclopramide in rats.

    Science.gov (United States)

    Strinic, Dean; Belosic Halle, Zeljka; Luetic, Kresimir; Nedic, Ana; Petrovic, Igor; Sucic, Mario; Zivanovic Posilovic, Gordana; Balenovic, Dijana; Strbe, Sanja; Udovicic, Mario; Drmic, Domagoj; Stupnisek, Mirjana; Lovric Bencic, Martina; Seiwerth, Sven; Sikiric, Predrag

    2017-10-01

    Commonly, neuroleptics and prokinetics induce a prolonged QTc interval. In this study, stable gastric pentadecapeptide BPC 157 counteracts the prolongation of the QTc interval in Wistar rats that underwent daily administration of dopamine neuroleptics or prokinetics. Previously, in rats and mice, BPC 157 counteracted neuroleptic-induced catalepsy and gastric ulcers. To counteract neuroleptic- or prokinetic-induced prolongation of the QTc interval, rats were given a BPC 157 regimen once daily over seven days (10μg, 10ng/kg ip) immediately after each administrations of haloperidol (0.625, 6.25, 12.5, and 25.0mg/kg ip), fluphenazine (0.5, 5.0mg/kg ip), clozapine (1.0, 10.0mg/kg ip), quetiapine (1.0, 10.0mg/kg ip), sulpiride (1.6, 16.0mg/kg ip), metoclopramide (2.5, 25.0mg/kg ip) or (1.0, 10.0mg/kg ip). Controls simultaneously received saline (5ml/kg ip). To assess the ECG presentation before and after neuroleptic/prokinetic medication, the assessment was at 1, 2, 3, 4, 5, 10, 15, 20 and 30min (first administration) as well as at 30min, 60min and 24h (first administration and subsequent administrations) and the ECG recording started prior to drug administration. Since very early, a prolonged QTc interval has been continually noted with haloperidol, fluphenazine, clozapine, olanzapine, quetiapine, sulpiride, and metoclopramide in rats as a central common effect not seen with domperidone. Consistent counteraction appears with the stable gastric pentadecapeptide BPC 157. Thus, BPC 157 rapidly and permanently counteracts the QTc prolongation induced by neuroleptics and prokinetics. Pentadecapeptide BPC 157 is suited for counteracting a prolonged QT interval. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Assessments of total and viable Escherichia coli O157:H7 on field and laboratory grown lettuce.

    Directory of Open Access Journals (Sweden)

    Anne-Laure Moyne

    Full Text Available Leafy green produce has been associated with numerous outbreaks of foodborne illness caused by strains of Escherichia coli O157:H7. While the amounts of culturable E. coli O157:H7 rapidly decline after introduction onto lettuce in the field, it remains to be determined whether the reduction in cell numbers is due to losses in cell viability, cell injury and a subsequent inability to be detected by standard laboratory culturing methods, or a lack of adherence and hence rapid removal of the organism from the plants during application. To assess which of these options is most relevant for E. coli O157:H7 on leafy green produce, we developed and applied a propidium monoazide (PMA real-time PCR assay to quantify viable (with PMA and total (without PMA E. coli O157:H7 cells on growth chamber and field-grown lettuce. E. coli O157:H7, suspended in 0.1% peptone, was inoculated onto 4-week-old lettuce plants at a level of approximately 10(6 CFU/plant. In the growth chamber at low relative humidity (30%, culturable amounts of the nontoxigenic E. coli O157:H7 strain ATCC 700728 and the virulent strain EC4045 declined 100 to 1000-fold in 24 h. Fewer E. coli O157:H7 cells survived when applied onto plants in droplets with a pipette compared with a fine spray inoculation. Total cells for both strains were equivalent to inoculum levels for 7 days after application, and viable cell quantities determined by PMA real-time PCR were approximately 10(4 greater than found by colony enumeration. Within 2 h after application onto plants in the field, the number of culturable E. coli ATCC 700728 was reduced by up to 1000-fold, whereas PCR-based assessments showed that total cell amounts were equivalent to inoculum levels. These findings show that shortly after inoculation onto plants, the majority of E. coli O157:H7 cells either die or are no longer culturable.

  7. Primer aislamiento de Escherichia coli O157:H7 Enterohemorrágica en el Perú

    OpenAIRE

    Blanca Huapaya C; José Huguet T; Víctor Suárez M; Yvón Torres de Yón; Ysabel Montoya P; Eduardo Salazar L; Silvia Sakuray M; Carlos Tejada; Carlos Gambirazio C; Jorge Gómez B

    2001-01-01

    En Febrero del año 2001 como parte del "Estudio transversal de los agentes etiológicos de diarrea aguda" en la Macrorregión Sur del país, el Laboratorio Referencial de Tacna aisló una cepa procedente de una muestra de heces de un lactante de 11 meses de edad con un cuadro de diarrea disentérica, identificándola como Escherichia coli O157. Esta cepa fue confirmada y caracterizada en el Instituto Nacional de Salud como E. coli O157:H7 toxina shiga tipo II, siendo el primer aislamiento reportado...

  8. Strategy for Accurate Detection of Escherichia Coli O157:H7 in Ground Pork Using a Lateral Flow Immunoassay

    OpenAIRE

    Song Cheng; Ming-hui Chen; Gang-gang Zhang; Zhi-biao Yu; Dao-feng Liu; Yong-hua Xiong; Hua Wei; Wei-hua Lai

    2017-01-01

    Escherichia coli O157:H7 is known to cause serious diseases including hemorrhagic colitis and hemolytic uremic syndrome. A gold nanoparticle lateral flow immunoassay (Au-LFIA) was used to detect Escherichia coli O157:H7 in ground pork samples. False-positive results were detected using Au-LFIA; a Citrobacter freundii strain was isolated from the ground pork samples and identified by using CHROmagarTM plates, API 20E, and 16S RNA sequencing. Since C. freundii showed cross-reactivity with E. co...

  9. Assessments of Total and Viable Escherichia coli O157:H7 on Field and Laboratory Grown Lettuce

    Science.gov (United States)

    Moyne, Anne-Laure; Harris, Linda J.; Marco, Maria L.

    2013-01-01

    Leafy green produce has been associated with numerous outbreaks of foodborne illness caused by strains of Escherichia coli O157:H7. While the amounts of culturable E. coli O157:H7 rapidly decline after introduction onto lettuce in the field, it remains to be determined whether the reduction in cell numbers is due to losses in cell viability, cell injury and a subsequent inability to be detected by standard laboratory culturing methods, or a lack of adherence and hence rapid removal of the organism from the plants during application. To assess which of these options is most relevant for E. coli O157:H7 on leafy green produce, we developed and applied a propidium monoazide (PMA) real-time PCR assay to quantify viable (with PMA) and total (without PMA) E. coli O157:H7 cells on growth chamber and field-grown lettuce. E. coli O157:H7, suspended in 0.1% peptone, was inoculated onto 4-week-old lettuce plants at a level of approximately 106 CFU/plant. In the growth chamber at low relative humidity (30%), culturable amounts of the nontoxigenic E. coli O157:H7 strain ATCC 700728 and the virulent strain EC4045 declined 100 to 1000-fold in 24 h. Fewer E. coli O157:H7 cells survived when applied onto plants in droplets with a pipette compared with a fine spray inoculation. Total cells for both strains were equivalent to inoculum levels for 7 days after application, and viable cell quantities determined by PMA real-time PCR were approximately 104 greater than found by colony enumeration. Within 2 h after application onto plants in the field, the number of culturable E. coli ATCC 700728 was reduced by up to 1000-fold, whereas PCR-based assessments showed that total cell amounts were equivalent to inoculum levels. These findings show that shortly after inoculation onto plants, the majority of E. coli O157:H7 cells either die or are no longer culturable. PMID:23936235

  10. DETECCIÓN DE Escherichia coli O157: H7 y Salmonella spp., EN CERDOS DEL DEPARTAMENTO DE CORDOBA

    OpenAIRE

    Jaime Vargas; Nimia Clavo; Salim Máttar

    2004-01-01

    E. coli O157:H7 y Salmonella spp., son bacterias de distribución mundial causantes de enfermedades intestinales queafectan tanto al hombre como a LOS animales. ESTE estudio tuvo como objetivo determinar la presencia y frecuenciade aparición de E. coli O157:H7 y Salmonella spp., en los diferentes sistemas de producción porcina que se empleanen el departamento de Córdoba. Se realizó un estudio de corte descriptivo prospectivo, con un muestreo al azar enlos sistemas de explotación porcina intens...

  11. Inactivation of Escherichia coli O157:H7 by cinnamon extracts in carrot-kinnow mandarin blends

    OpenAIRE

    Ghosh, Moushumi; Kaur, Sarvnarinder; Ganguli, ABHIJIT

    2007-01-01

    We investigated the antimicrobial efficacy of cinnamon extracts in laboratory prepared Kinnow-mandarin carrot blends challenged with Escerichia coli O157:H7. Freshly squeezed carrot and kinnow-mandarin juices were mixed to obtain a typical blend, inoculated with E. coli O157:H7 cultures at 102 CFU/mL with and without cinnamon extracts (0.3%) and stored at 4, 8 and 28°C for up to 10 hours. Counts on tryptic soy agar (TSA) selective medium (Mac conkey sorbitol agar) and thin agar layer (TAL) we...

  12. Escherichia coli O157:H7--Discerning Facts from Fiction: An Integrated Research and Extension Project for Multiple Audiences.

    Science.gov (United States)

    Moore, D A; Smith, D R; Sischo, W M; Heaton, K; Besser, T E

    2016-02-01

    The O157:H7 (EcO157) epidemiology of Shiga-toxin-producing Escherichia coli (STEC) in cattle is complex, and myths about pre-harvest control are perpetuated. The objectives of this project were to identify perpetuated misinformation and inform four audiences about evidence-based risks and pre-harvest control of EcO157 by addressing: (i) EcO157 epidemiology and pre-harvest control; (ii) how food safety policy is created; and (iii) how to present accurate information about EcO157. An environmental scan using a daily Internet search helped identify themes for education. A literature review of pre-harvest control measures contributed to the development of educational materials (fact sheets, website, web presentations and conferences). Conference 1 was a webinar with 315 registrants, 10 countries including 41 US states and four Canadian provinces. Most participants felt confident in using their new knowledge, more than half felt confident enough to answer EcO157 questions from the public and many would recommend the recorded version of the webinar to colleagues. Conference 2 was live in the Washington, DC, area with most participants employed by the US government. All agreed that they better understood pre-harvest control, how food safety policy was made, and were confident they could create an effective message about STEC pre-harvest control. Videos were posted and received 348 Internet visitors within 2 months. Conference 3 was a webinar with a live audience and Twitter feeds, targeting people who give nutrition advice. Almost all ranked the programme good to excellent and relevant to their work. About 25% indicated that they would share: 'grass-fed beef is not safer than grain-fed', 25% would share information on effectiveness of cattle vaccines, and 14% would share information on message mapping. Across all conferences, major changes in knowledge included the following: there is no additional risk of EcO157 shedding from grain-fed versus grass-fed cattle, pre

  13. Dysregulation of Angiopoietin 1 and 2 in Escherichia coli O157:H7 Infection and the Hemolytic-Uremic Syndrome

    OpenAIRE

    Page, Andrea V.; Tarr, Phillip I.; Watkins, Sandra L.; Rajwans, Nimerta; Petruzziello-Pellegrini, Tania N.; Marsden, Philip A.; Kain, Kevin C.; Liles, W. Conrad

    2013-01-01

    Escherichia coli O157:H7-associated hemolytic-uremic syndrome (HUS) is characterized by profound prothrombotic abnormalities. Endothelial dysfunction, manifested as dysregulation of angiopoietins 1 and 2 (Ang-1/2), could underlie HUS pathophysiology. We measured Ang-1/2 in 77 children with E. coli O157:H7 infection. Ang-1, Ang-2, and the Ang-2/Ang-1 ratio were significantly different in HUS vs the pre-HUS phase of illness or uncomplicated infection. Angiopoietin dysregulation preceded HUS and...

  14. Survival of Escherichia coli o157:h7 co-cultured with different levels of pseudomonas fluorescens and lactobacillus plantarum on fresh beef

    Science.gov (United States)

    Tshabalala, P. A.; de Kock, H. L.; Buys, E. M.

    2012-01-01

    The purpose of this study was to investigate the effect of different levels of Pseudomonas fluorescens (102 and 106 log10 cfu/ml) and Lactobacillus plantarum (102 and 104 log10 cfu/ml) on the growth of Escherichia coli O157:H7 on beef loins. Beef loins inoculated with E. coli O157:H7 and P. fluorescens were aerobically stored for 7 days at 4 ºC, while those inoculated with E. coli O157:H7 and L. plantarum were vacuum packaged and stored for 8 weeks at 4 ºC. Aerobic Plate Counts (APC), E. coli O157:H7 and either P. fluorescens or L. plantarum counts were determined at different storage intervals. For the aerobically packaged beef loins, E. coli O157:H7 was detected throughout the 7 day storage period regardless of the P. fluorescens level in the inoculum. For the vacuum packaged beef loins, similar inoculum levels of E. coli O157:H7 and L. plantarum allowed E. coli O157:H7 to survive until week 5 of storage, while a higher inoculum level of L. plantarum inhibited E. coli O157:H7 from week 3. Once fresh beef has been contaminated with E. coli O157:H7, the level of P. fluorescens in the background flora does not inhibit its survival and growth. However, under vacuum storage, the application of L. plantarum as a biopreservative inhibits the survival of E. coli O157:H7 on beef. The higher the level of L. plantarum in the system, the earlier the onset of the inhibition. Farmers and abattoirs have to strengthen preventive strategies to eliminate contamination of beef carcasses with E. coli O157:H7. PMID:24031970

  15. Common epitopes in LPS of different Enterobacteriaceae are associated with an immune response against Escherichia coli O157 in bovine serum samples.

    Science.gov (United States)

    Navarro, Armando; Eslava, Carlos; García de la Torre, Guadalupe; León, Luis Antonio; Licona, Delia; León, Lemuel; Zarco, Luis Alberto; Cravioto, Alejandro

    2007-11-01

    Epidemiological studies in both humans and animals conducted in Mexico have shown that the isolation frequency of Escherichia coli O157 : H7 is low. In a previous study, IgG antibodies against E. coli O157, O7 and O116 LPS were found in serum samples from children and adults with no previous history of E. coli O157 : H7 infection. The present study was designed to determine whether a similar immune response against E. coli O157 : H7 and other antigenically related bacteria was present in bovine serum samples. A total of 310 serum samples from different herds in Mexico was analysed by microagglutination assays against different enterobacterial antigens, including E. coli O157. Microagglutination assays were positive against E. coli O7 (55 %), O116 (76 %) and O157 (36 %), Escherichia hermannii (15 %), Salmonella enterica serotype Urbana (14 %) and Salmonella enterica subsp. arizonae (40 %). These results were confirmed using a specific ELISA with purified LPS. A positive reaction was observed against the LPS of E. coli O7 (29 %), O116 (12 %) and O157 (22 %), E. hermannii (4 %), Salmonella Urbana (13 %) and S. enterica subsp. arizonae (12 %). Serum absorption studies of positive serum samples indicated the existence of at least three common epitopes shared by the LPS of E. coli O7, O116 and O157, and two others between E. coli O157 and Salmonella Urbana and S. enterica subsp. arizonae. A bactericidal assay against E. coli O157 : H7 using 31 bovine serum samples was performed, and 22 (71 %) of these serum samples gave positive results. The data demonstrated that bovine serum showed a response against different enterobacteria, including E. coli O157, and that this response could be due to the presence of shared epitopes in the LPS of these organisms.

  16. Survival of Escherichia coli O157:H7 in cucumber fermentation brines.

    Science.gov (United States)

    Breidt, Frederick; Caldwell, Jane M

    2011-04-01

    Bacterial pathogens have been reported on fresh cucumbers and other vegetables used for commercial fermentation. The Food and Drug Administration currently has a 5-log reduction standard for E. coli O157:H7 and other vegetative pathogens in acidified pickle products. For fermented vegetables, which are acid foods, there is little data documenting the conditions needed to kill acid resistant pathogens. To address this knowledge gap, we obtained 10 different cucumber fermentation brines at different stages of fermentation from 5 domestic commercial plants. Cucumber brines were used to represent vegetable fermentations because cabbage and other vegetables may have inhibitory compounds that may affect survival. The 5-log reduction times for E. coli O157:H7 strains in the commercial brines were found to be positively correlated with brine pH, and ranged from 3 to 24 d for pH values of 3.2 to 4.6, respectively. In a laboratory cucumber juice medium that had been previously fermented with Lactobacillus plantarum or Leuconostoc mesenteroides (pH 3.9), a 5-log reduction was achieved within 1 to 16 d depending on pH, acid concentration, and temperature. During competitive growth at 30 °C in the presence of L. plantarum or L. mesenteroides in cucumber juice, E. coli O157:H7 cell numbers were reduced to below the level of detection within 2 to 3 d. These data may be used to aid manufacturers of fermented vegetable products determine safe production practices based on fermentation pH and temperature.   Disease causing strains of the bacterium E. coli may be present on fresh vegetables. Our investigation determined the time needed to kill E. coli in cucumber fermentation brines and how E. coli strains are killed in competition with naturally present lactic acid bacteria. Our results showed how brine pH and other brine conditions affected the killing of E. coli strains. These data can be used by producers of fermented vegetable

  17. Comparison of the fate of the top six non-O157 shiga-toxin producing Escherichia coli (STEC) and E. coli O157:H7 during the manufacture of dry fermented sausages.

    Science.gov (United States)

    Balamurugan, S; Ahmed, Rafath; Gao, Anli; Strange, Phil

    2017-10-16

    The study examined the relative fate of the top six non-O157 shiga-toxin producing Escherichia coli (STEC) and E. coli O157:H7 during the manufacture of dry fermented sausages (DFS). Three separate batches of sausages containing a five-strain cocktail for each serogroup and uninoculated control were manufactured and subjected to identical fermentation, maturation and dry curing conditions. Changes in physicochemical properties and inoculated STEC numbers were enumerated during the DFS production stages and log reduction and log reduction rates were calculated. Inoculation of very high concentrations (8logCFUg-1) of STEC in the sausage batter did not significantly (P>0.05) affect the changes in the pH, aw, moisture, protein, fat content compared to the uninoculated DFS. There was a significant (P0.05) from each other. These results indicate that the lethality of DFS production processes observed against E. coli O157:H7 would result in a similar inactivation of the top six non-O157 STEC. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  18. Measured Thermal and Fast Neutron Fluence Rates for ATF-1 Holders During ATR Cycle 157D

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Larry Don [Idaho National Lab. (INL), Idaho Falls, ID (United States); Miller, David Torbet [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-03-01

    This report contains the thermal (2200 m/s) and fast (E>1MeV) neutron fluence rate data for the ATF-1 holders located in core for ATR Cycle 157D which were measured by the Radiation Measurements Laboratory (RML) as requested by the Power Reactor Programs (ATR Experiments) Radiation Measurements Work Order. This report contains measurements of the fluence rates corresponding to the particular elevations relative to the 80-ft. core elevation. The data in this report consist of (1) a table of the ATR power history and distribution, (2) a hard copy listing of all thermal and fast neutron fluence rates, and (3) plots of both the thermal and fast neutron fluence rates. The fluence rates reported are for the average power levels given in the table of power history and distribution.

  19. Energy disposal in CN(X 2Σ+) produced in the 157 nm photodissociation of acrylonitrile

    Science.gov (United States)

    Guo, Jingzhong; Carrington, Tucker; Filseth, S. V.

    2001-11-01

    Photodissociation of acrylonitrile has been studied at 157.6 nm through analysis of laser-induced fluorescence experiments. The CN(X 2Σ+) radicals formed in this dissociation are detected in vibrational levels up to v=6 and rotational population distributions are measured for vibrational levels v=0-3. The average energies found in vibration and rotation of CN are approximately equal and represent about 5% of the available energy if the vinyl radical is the co-fragment. This is close to the 7% expected on the basis of the equipartition theorem which suggests that energy disposal is largely statistical. The vibrational and rotational distributions however are not in good agreement with an energy-conserving prior distribution suggesting that dynamical factors play a significant role in energy disposal.

  20. Multiparametric Magneto-fluorescent Nanosensors for the Ultrasensitive Detection of Escherichia coli O157:H7.

    Science.gov (United States)

    Banerjee, Tuhina; Sulthana, Shoukath; Shelby, Tyler; Heckert, Blaze; Jewell, Jessica; Woody, Kalee; Karimnia, Vida; McAfee, James; Santra, Santimukul

    2016-10-14

    Enterohemorrhagic Escherichia coli O157:H7 presents a serious threat to human health and sanitation and is a leading cause in many food- and waterborne ailments. While conventional bacterial detection methods such as PCR, fluorescent immunoassays and ELISA exhibit high sensitivity and specificity, they are relatively laborious and require sophisticated instruments. In addition, these methods often demand extensive sample preparation and have lengthy readout times. We propose a simpler and more sensitive diagnostic technique featuring multiparametric magneto-fluorescent nanosensors (MFnS). Through a combination of magnetic relaxation and fluorescence measurements, our nanosensors are able to detect bacterial contamination with concentrations as little as 1 colony-forming unit (CFU). The magnetic relaxation property of our MFnS allow for sensitive screening at low target CFU, which is complemented by fluorescence measurements of higher CFU samples. Together, these qualities allow for the detection and quantification of broad-spectrum contaminations in samples ranging from aquatic reservoirs to commercially produced food.

  1. Microstructure, crystallography of phase transformations and multiple precipitations in PH 15-7Mo stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Hongwei [The Australia Centre Microscopy and Microanalysis, The University of Sydney, NSW, 2006 (Australia); Liu, Jiangwen, E-mail: mejwliu@scut.edu.cn [School of Materials Science and Engineering, South China University of Technology, Guangzhou, 510640 (China); Luo, Chengping [School of Materials Science and Engineering, South China University of Technology, Guangzhou, 510640 (China); Liu, Zhijian [Guangdong Research Institute of Iron and Steel, Guangzhou, 510640 (China)

    2016-07-05

    The microstructure and crystallographic features of a semi-austenitic precipitation hardening steel PH 15-7Mo during solution treatment, roddrawing and aging were investigated by means of optical microscope, X-ray diffraction analyzer and transmission electron microscope. It was found that the microstructure of the steel was consist of dominant austenite, small amount of martensite and 10–15 vol.% δ-ferrite after solution treatment at 1050 °C followed by cooling in water at room temperature. The austenite transformed into lath martensite during tensile roddrawing about 60% deforming companied with some coherent fine β-NiAl particles precipitated within martensite. With higher aging temperature and longer holding time, tiny carbide M{sub 23}C{sub 6} particles precipitated from martensite, which kept the cubic–cubic orientation relationship (OR) with austenite and G-T OR with martensite which is different with all the reported orientations. The OR between tiny carbide M{sub 23}C{sub 6} particles G-T OR with martensite was discussed in terms of crystallography of phase transformations. - Highlights: • Microstructure changes of austenitic steel PH15-7Mo were due to alloying elements, service condition and carbide M{sub 23}C{sub 6}. • Lath-shape martensitic laths keep pseudo {112} twinning relationship. • β-NiAl particles hold a typical cubic-to-cubic orientation relationship with martensite. • M{sub 23}C{sub 6} carbide kept a cubic–cubic orientation relationship (OR) with austenite and an unusual G-T OR with martensite. • Multiple orientation relationship between M{sub 23}C{sub 6} and austenite is correlative with their structural similarity.

  2. Minimizing human infection from Escherichia coli O157:H7 using GUMBOS.

    Science.gov (United States)

    Cole, Marsha R; Li, Min; Jadeja, Ravirajsinh; El-Zahab, Bilal; Hayes, Daniel; Hobden, Jeffery A; Janes, Marlene E; Warner, Isiah M

    2013-06-01

    Reduction in faecal shedding of Shiga toxin-producing enterohaemorrhagic Escherichia coli (EHEC) in food-producing animals is a viable strategy to minimize human disease initiated by exposure to these microorganisms. To this end, an intervention strategy involving the electrostatic hybridization of two commonly used anti-infective agents for veterinary practice (i.e. chlorhexidine and ampicillin) was evaluated to curtail EHEC-transmitted disease from ruminant sources. Chlorhexidine di-ampicillin is a novel group of uniform material based on organic salts (GUMBOS) with inherent in vitro antibacterial activity that comes from its parent antimicrobial ions, chlorhexidine and ampicillin. Antibacterial activities for chlorhexidine diacetate, sodium ampicillin, chlorhexidine di-ampicillin and stoichiometrically equivalent 1 : 2 chlorhexidine diacetate : sodium ampicillin were assessed using the serial 2-fold dilution method and time-kill studies against seven isolates of E. coli O157:H7 and one non-pathogenic E. coli 25922. Further studies to investigate synergistic interactions of reacted and stoichiometrically equivalent unreacted antimicrobial agents at MICs and possible mechanisms were also investigated. Synergism and in vitro antibacterial activities against EHEC were observed in this study, which suggests chlorhexidine di-ampicillin could be a useful reagent in reducing EHEC transmission and minimizing EHEC-associated infections. Likewise, chlorhexidine di-ampicillin reduced HeLa cell toxicity as compared with chlorhexidine diacetate or the stoichiometric combination of antimicrobial agents. Further results suggest that the mechanisms of action of chlorhexidine di-ampicillin and chlorhexidine diacetate against E. coli O157:H7 are similar. Reacting antimicrobial GUMBOS as indicated in this study may enhance the approach to current combination drug therapeutic strategies for EHEC disease control and prevention.

  3. Radiosensitivity of E.coli O157: H7 and Salmonella typhimurium on swiss chard

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Marco A.S.; Mastro, Nelida L. del [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mails: masperei@ipen.br; nlmastro@ipen.br

    2007-07-01

    Swiss Chard is a beet (Beta vulgaris cicla) producing large yellowish green leaves with thick succulent stalks and often cooked as a potherb, called also seakale beet or chard. It is a nutritive vegetable rich in potassium, calcium, magnesium, sodium, phosphorus and vitamin C. Ionising radiation is an effective method to reduce pathogens. Radiation sensitivity of bacteria, however, depends on several factors. Particularly, few data are available on the ability of low-dose ionizing radiation to inactivate pathogenic bacteria on ready to eat vegetables. The aim of this study was the evaluation of the radiation sensitivity of pathogens experimentally contaminating the mentioned vegetable. Swiss chard leaves minimally processed were inoculated separately either with E. coli O157:H7 or Salmonella typhimurium by immersion to contain 6 log CFU/g and 1h later gamma-irradiated with 0.25 kGy, 0.5 kGy, 1 kGy and 1.5 kGy, dose rate of 2.94 kGy/h. The assay of pathogen survivors was made by direct plating. After applying a radiation dose of 0.5 kGy reductions of at least 3 log were achieved for both bacteria. The average D10 values, the radiation dose needed to inactivate 1 log of pathogen were 0.12 and 0.10 for E.coli O157:H7 and S.typhimurium respectively. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens that can eventually contaminate ready to eat vegetables. (author)

  4. E. coli O157 outbreaks in the United Kingdom: past, present, and future.

    Science.gov (United States)

    Pennington, Thomas Hugh

    2014-01-01

    This review describes Escherichia coli O157 outbreaks in the United Kingdom, beginning from the first, in the 1980s, to those recorded in 2013. We point out that the United Kingdom differs from other countries, particularly the United States, in that it has had a considerable number of outbreaks associated with butchers, but very few caused by contaminated burgers. Two of the butcher-associated outbreaks (in central Scotland in 1996 and South Wales in 2005) were very large and are considered here in detail; the reviewer conducted detailed investigations into both outbreaks. Also considered is the very large outbreak that occurred in visitors to an open farm in Surrey in 2009. Detailed descriptions of some milk-borne outbreaks and incidents connected with camping and childrens' nurseries have been published, and these are also considered in this review. Large outbreaks in the United Kingdom have sometimes led to policy developments regarding food safety, and these are considered, together with public reactions to them, their health effect, and their value, as examples to follow or eschew in terms of the procedures to be adopted in response to incidents of this kind. Regulatory and legal consequences are also considered. As a wise man said, making predictions is difficult, particularly about the future. This review follows this position but points out that although human infections caused by E. coli O157 are rare in the United Kingdom, their incidence has not changed significantly in the last 17 years. This review points out that although a response to an outbreak is to say "lessons must be learned", this response has been tempered by forgetfulness. Accordingly, this review restricts its recommendations regarding outbreaks to two: the crucial importance of a rapid response and the importance of experience, and even "gut feeling", when an inspector is evaluating the safety of a food business.

  5. Phenotypic and genotypic characterization of sorbitol-negative of slow-fermenting (suspected O157) Escherichia coli isolated from milk samples in Lombardy region

    NARCIS (Netherlands)

    Picozzi, C.; Foschino, R.; Heuvelink, A.E.; Beumer, R.R.

    2005-01-01

    Aims: To investigate phenotypic and genotypic aspects of sorbitol-negative or slow-fermenting Escherichia coli, suspected to belong to O157 serogroup, isolated in Italy. Methods and Results: Milk samples originating from goats and cows were screened for the presence of E. coli O157 with cultural

  6. Role of curli and contamination level on Escherichia coli O157:H7 internalization into organic spinach plants grown on hydroponics and in soil

    Science.gov (United States)

    Introduction: E. coli O157:H7 may be internalized into organic leafy greens via root uptake. Understanding the mechanisms of E. coli O157:H7 internalization into organic leafy greens is important as produce wash treatment may not remove internalized pathogens. Purpose: The internalization potential...

  7. Fate of naturally occurring Escherichia coli O157:H7 and other zoonotic pathogens during minimally managed bovine feedlot manure composting processes

    Science.gov (United States)

    Reducing Escherichia coli O157:H7 in livestock manures before application to cropland is critical for reducing the risk of foodborne illness associated with produce. Our objective was to determine the fate of naturally occurring E. coli O157:H7 and other pathogens during minimally managed on-farm bo...

  8. RcsB contributes to the distinct stress fitness between Escherichia coli O157:H7 curli variants of 1993 hamburger-associated outbreak strains

    Science.gov (United States)

    Curli are adhesive fimbriae of Enterobactericaeae and are involved in surface attachment, cell aggregation and biofilm formation. We previously reported that natural curli variants of E. coli O157:H7 (EcO157) displayed distinct acid resistance; however, this difference was not linked to the curli fi...

  9. Hha controls Escherichia coli O157:H7 biofilm formation by differential regulation of global transcriptional regulators FlhDC and CsgD

    Science.gov (United States)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a zoonotic pathogen that produces a broad-spectrum of diarrheal illnesses in infected humans. Although molecular mechanisms enabling EHEC O157:H7 to produce characteristic adherence on epithelial cells are well characterized, regulatory mechanisms...

  10. A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic media

    Science.gov (United States)

    Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. A Tn7-based plasmid vector was used to insert the green fluorescent protein (gfp) gene into the attTn7 site in the E. coli chromosome. Three gfp-labeled E. coli inocula, O157:H7 strains ...

  11. Effectiveness of lytic bacteriophages in reducing E. coli O157:H7 populations introduced through cross-contamination on fresh cut lettuce

    Science.gov (United States)

    Previous research has shown that lytic bacteriophages (phages) can kill E. coli O157:H7 on produce surfaces. The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 10^8 PFU/m...

  12. Influence of age, sex and herd characteristics on the occurrence of verocytotoxin-producing Escherichia coli O157 in Danish dairy farms

    DEFF Research Database (Denmark)

    Nielsen, E.M.; Tegtmeier, Conny; Andersen, Hans Jørgen

    2002-01-01

    animals were sampled, and 3.6% of these excreted VTEC O157. These animals were located on 10 farms (17%). On average, 21% of the sampled animals in the positive herds excreted VTEC O157. Register data, including age, sex, breed, housing conditions and herd composition, were extracted from a database...

  13. Fate of Escherichia coli O157:H7 in manure and amended soil: effects of cattle feeding, manure type and dairy management

    NARCIS (Netherlands)

    Franz, E.; Diepeningen, van A.D.; Visser, A.A.; Blok, W.J.; Bruggen, van A.H.C.

    2005-01-01

    In the present study, we studied the effect of cattle diet on the survival of E. coli O157:H7 in manure from dairy cattle subjected to 6 different feeding regimes consisting of 3 different roughage types and 2 levels of crude protein concentrates. In addition, the rate of survival of E. coli O157:H7

  14. Persistence of Escherichia coli O157:H7 in feces from cattle fed diets with or without wet distillers grains with solubles

    Science.gov (United States)

    Feeding wet distillers grains with solubles (WDGS) to cattle can increase prevalence of E. coli O157:H7, but mechanisms for this increase are not fully understood. The objective of these experiments was to examine the persistence of E. coli O157:H7 in feces from cattle fed diets with or without WDG...

  15. Patient survival and tumor characteristics associated with CHEK2:p.I157T - findings from the Breast Cancer Association Consortium

    DEFF Research Database (Denmark)

    Muranen, Taru A; Blomqvist, Carl; Dörk, Thilo

    2016-01-01

    characteristics by comparing the p.I157T carrier tumors to non-carrier and c.1100delC carrier tumors. Similarly, we investigated the p.I157T associated risk of early death, breast cancer-associated death, distant metastasis, locoregional relapse and second breast cancer using Cox proportional hazards models...

  16. Mathematical modeling and numerical analysis of the growth of Non-O157 shiga toxin-producing Escherichia coli in spinach leaves

    Science.gov (United States)

    This study was conducted to investigate the growth of non-O157 Shiga toxin-producing Escherichia coli (STEC) in spinach leaves and to develop kinetic models to describe the bacterial growth. Six serogroups of non-O157 STEC, including O26, O45, O103, O111, O121, and O145, were used in the growth stu...

  17. Repetitive Immunosensor with a Fiber-Optic Device and Antibody-Coated Magnetic Beads for Semi-Continuous Monitoring of Escherichia coli O157:H7.

    Science.gov (United States)

    Taniguchi, Midori; Saito, Hirokazu; Mitsubayashi, Kohji

    2017-09-19

    A rapid and reproducible fiber-optic immunosensor for Escherichia coli O157:H7 (E. coli O157:H7) was described. The biosensor consisted of a flow cell, an optical fiber with a thin Ni layer, and a PC linked fluorometer. First, the samples with E. coli O157:H7 were incubated with magnetic beads coated with anti-E. coli O157:H7 antibodies and anti-E. coli O157:H7 antibodies labeled cyanine 5 (Cy5) to make sandwich complexes. Then the Cy5-(E. coli O157:H7)-beads were injected into a flow cell and pulled to the magnetized Ni layer on the optical fiber set in the flow cell. An excitation light (λ = 635 nm) was used to illuminate the optical fiber, and the Cy5 florescent molecules facing the optical fiber were exposed to an evanescent wave from the optical fiber. The 670 nm fluorescent light was measured using a photodiode. Finally, the magnetic intensity of the Ni layer was removed and the Cy5-E. coli O157:H7-beads were washed out for the next immunoassay. E. coli O157:H7, diluted with phosphate buffer (PB), was measured from 1 × 10⁵ to 1 × 10⁷ cells/mL. The total time required for an assay was less than 15 min (except for the pretreatment process) and repeating immunoassay on one optical fiber was made possible.

  18. Genome sequences of thirty Escherichia coli O157:H7 isolates recovered from a single dairy farm and its associated off-site heifer raising facility

    Science.gov (United States)

    Cattle are the primary reservoir of Escherichia coli O157:H7, the most frequently isolated serotype of enterohemorrhagic E. coli infections among humans in North America. To evaluate the diversity of E. coli O157:H7 isolates within a single dairy herd the genomes of 30 isolates collected over a 7-ye...

  19. Escherichia coli O157:H7 converts plant-derived choline to glycine betaine for osmoprotection during pre- and post-harvest colonization of injured lettuce leaves

    Science.gov (United States)

    The opportunistic colonization of damaged plant tissue by human enteric pathogens may contribute to the occurrence of outbreaks of foodborne illness linked to produce. E. coli O157:H7 (EcO157) responds to physicochemical stresses in cut lettuce and lettuce lysates by upregulation of several stress r...

  20. 77 FR 58091 - Risk-Based Sampling of Beef Manufacturing Trimmings for Escherichia coli (E. coli) O157:H7 and...

    Science.gov (United States)

    2012-09-19

    ... Food Safety and Inspection Service Risk-Based Sampling of Beef Manufacturing Trimmings for Escherichia coli (E. coli) O157:H7 and Plans for Beef Baseline AGENCY: Food Safety and Inspection Service (FSIS), U... announcing its intention to redesign its E. coli O157:H7 verification testing program for beef manufacturing...

  1. Prevalence of Escherichia coli O157:H7 in beef cattle at slaughter and beef carcasses at retail shops in Ethiopia

    Science.gov (United States)

    Background: There is paucity of information regarding the epidemiology of Escherichia coli O157: H7 in developing countries. In this study, we investigated the occurrence of E. coli O157: H7 associated with beef cattle at processing plants and at retail shops in Ethiopia. Methods: Various samples we...

  2. High pressure treatments combined with sodium lactate to inactivate Escherichia coli O157:H7 and spoilage microbiota in cured beef carpaccio.

    Science.gov (United States)

    Masana, Marcelo Oscar; Barrio, Yanina Ximena; Palladino, Pablo Martín; Sancho, Ana Maria; Vaudagna, Sergio Ramón

    2015-04-01

    High-pressure treatments (400 and 600 MPa) combined with the addition of sodium lactate (1 and 3%) were tested to reduce Escherichia coli O157:H7 (STEC O157) and spoilage microbiota contamination in a manufactured cured beef carpaccio in fresh or frozen conditions. Counts of spoilage microorganisms and STEC O157 were also examined during the curing step to prepare the carpaccio. STEC O157 counts remained almost unchanged through the curing process performed at 1 ± 1 °C for 12 days, with a small decrease in samples with 3% of sodium lactate. High-pressure treatments at 600 MPa for 5 min achieved an immediate reduction of up to 2 logarithmic units of STEC O157 in frozen carpaccio, and up to 1.19 log in fresh condition. Counts of spoilage bacteria diminished below detection limits in fresh or frozen carpaccio added with sodium lactate by the application of 400 and 600 MPa. Maximum injury on STEC O157 cells was observed at 600 MPa in carpaccio in fresh condition without added sodium lactate. Lethality of high-pressure treatments on STEC O157 was enhanced in frozen carpaccio, while the addition of sodium lactate at 3% reduced the lethality on STEC O157 in frozen samples, and the degree of injury in fresh carpaccio. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Protective effects of lactoferrin chimera and bovine lactoferrin in a mouse model of enterohaemorrhagic Escherichia coli O157:H7 infection

    NARCIS (Netherlands)

    Flores-Villaseñor, H.; Canizalez-Román, A.; Velazquez-Roman, J.; Nazmi, K.; Bolscher, J.G.M.; Leon-Sicairos, N.

    2012-01-01

    Mice orally infected with enterohaemorrhagic Escherichia coli (EHEC) O157:H7 were used to evaluate the activity of bovine lactoferrin (bLF) and the synthetic peptide LFchimera. Groups of BALB/c mice inoculated intragastrically with EHEC O157:H7 showed chronic intestinal infection with the pathogen

  4. International distribution and age estimation of the Portuguese BRCA2 c.156_157insAlu founder mutation

    NARCIS (Netherlands)

    Peixoto, Ana; Santos, Catarina; Pinheiro, Manuela; Pinto, Pedro; Soares, Maria Jose; Rocha, Patricia; Gusmao, Leonor; Amorim, Antonio; van der Hout, Annemarie; Gerdes, Anne-Marie; Thomassen, Mads; Kruse, Torben A.; Cruger, Dorthe; Sunde, Lone; Bignon, Yves-Jean; Uhrhammer, Nancy; Cornil, Lucie; Rouleau, Etienne; Lidereau, Rosette; Yannoukakos, Drakoulis; Pertesi, Maroulio; Narod, Steven; Royer, Robert; Costa, Mauricio M.; Lazaro, Conxi; Feliubadalo, Lidia; Grana, Begona; Blanco, Ignacio; de la Hoya, Miguel; Caldes, Trinidad; Maillet, Philippe; Benais-Pont, Gaelle; Pardo, Bruno; Laitman, Yael; Friedman, Eitan; Velasco, Eladio A.; Duran, Mercedes; Miramar, Maria-Dolores; Rodriguez Valle, Ana; Calvo, Maria-Teresa; Vega, Ana; Blanco, Ana; Diez, Orland; Gutierrez-Enriquez, Sara; Balmana, Judith; Ramon y Cajal, Teresa; Alonso, Carmen; Baiget, Montserrat; Foulkes, William; Tischkowitz, Marc; Kyle, Rachel; Sabbaghian, Nelly; Ashton-Prolla, Patricia; Ewald, Ingrid P.; Rajkumar, Thangarajan; Mota-Vieira, Luisa; Giannini, Giuseppe; Gulino, Alberto; Achatz, Maria I.; Carraro, Dirce M.; de Paillerets, Brigitte Bressac; Remenieras, Audrey; Benson, Cindy; Casadei, Silvia; King, Mary-Claire; Teugels, Erik; Teixeira, Manuel R.

    The c.156_157insAlu BRCA2 mutation has so far only been reported in hereditary breast/ovarian cancer (HBOC) families of Portuguese origin. Since this mutation is not detectable using the commonly used screening methodologies and must be specifically sought, we screened for this rearrangement in a

  5. Classification of non-O157 shiga toxin-producing escherichia coli(STEC) serotypes with hyperspectral microscope imaging

    Science.gov (United States)

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) strains such as O26, O45, O103, O111, O121 and O145 are recognized as serious outbreak to cause human illness due to their toxicity. A conventional microbiological method for cell counting is laborious and needs long time for the results. Since ...

  6. Carvacrol induces heat shock protein 60 and inhibits synthesis of flagellin in Escherichia coli O157:H7

    NARCIS (Netherlands)

    Burt, S.A.|info:eu-repo/dai/nl/140114432; van der Zee, R.|info:eu-repo/dai/nl/071832548; Koets, A.P.|info:eu-repo/dai/nl/194306992; de Graaff, A.M.; van Knapen, F.|info:eu-repo/dai/nl/070114749; Gaastra, W.|info:eu-repo/dai/nl/118557696; Haagsman, H.P.|info:eu-repo/dai/nl/069273278; Veldhuizen, E.J.A.|info:eu-repo/dai/nl/19545264X

    2007-01-01

    The essential oils of oregano and thyme are active against a number of food-borne pathogens, such as Escherichia coli O157:H7. Carvacrol is one of the major antibacterial components of these oils, and p-cymene is thought to be its precursor in the plant. The effects of carvacrol and p-cymene on

  7. Association Study between the CD157/BST1 Gene and Autism Spectrum Disorders in a Japanese Population

    Directory of Open Access Journals (Sweden)

    Shigeru Yokoyama

    2015-05-01

    Full Text Available CD157, also referred to as bone marrow stromal cell antigen-1 (BST-1, is a glycosylphosphatidylinositol-anchored molecule that promotes pre-B-cell growth. Previous studies have reported associations between single-nucleotide polymorphisms (SNPs of the CD157/BST1 gene with Parkinson’s disease. In an attempt to determine whether SNPs or haplotypes in the CD157/BST1 are associated with other brain disorders, we performed a case-control study including 147 autism spectrum disorder (ASD patients at Kanazawa University Hospital in Japan and 150 unselected Japanese volunteers by the sequence-specific primer-polymerase chain reaction method combined with fluorescence correlation spectroscopy. Of 93 SNPs examined, two SNPs showed significantly higher allele frequencies in cases with ASDs than in unaffected controls (rs4301112, OR = 6.4, 95% CI = 1.9 to 22, p = 0.0007; and rs28532698, OR = 6.2, 95% CI = 1.8 to 21, p = 0.0012; Fisher’s exact test; p < 0.002 was considered significant after multiple testing correction. In addition, CT genotype in rs10001565 was more frequently observed in the ASD group than in the control group (OR = 15, 95% CI = 2.0 to 117, p = 0.0007; Fisher’s exact test. The present data indicate that genetic variation of the CD157/BST1 gene might confer susceptibility to ASDs.

  8. 76 FR 48903 - 157th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2011-08-09

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 157th Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  9. Rapid detection of E. Coli O157:H7 by IFAST and ATP bioluminescence assay for water analysis

    CSIR Research Space (South Africa)

    Ngamsom, B

    2016-10-01

    Full Text Available multimeter for readout. 978-0-9798064-9-0/µTAS 2016/$20©16CBMS-0001 63 20th International Conference on Miniaturized Systems for Chemistry and Life Sciences 9-13 October, 2016, Dublin, Ireland RESULTS AND DISCUSSION Initially, isolation of E. coli O157:H7...

  10. Transpositional inactivation of gadW enhances curli production and biofilm formation in Enterohemorrhagic Escherichia coli O157:H7

    Science.gov (United States)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 has been shown to produce variants that either express or are repressed in the expression of curli fimbriae promoting bacterial attachment, aggregation, and biofilm formation. The variant expression of curli fimbriae in some instances could result fr...

  11. Antimicrobial effects of weak acids on the survival of Escherichia coli O157:H7 under anaerobic conditions

    Science.gov (United States)

    Outbreaks of disease due to vegetative bacterial pathogens associated with acid foods (such as apple cider) have raised concerns about acidified vegetables and related products that have a similar pH (3.2 to 4.0). Escherichia coli O157:H7 and related strains of enterohemorrhagic E. coli (EHEC) have ...

  12. Control of Escherichia coli O157:H7 contamination on green leaf lettuce using a bacteriophage cocktail

    Science.gov (United States)

    Unpredictable outbreaks caused by fresh produce contaminated with enterohemorrhagic Escherichia coli O157:H7 (EHEC) have raised concerns about the safety of fruits and vegetables. Since simple washing alone is not sufficient to keep the produce free of pathogens, there is a need for more effective m...

  13. Inactivation of Escherichia coli O157:H7 and Salmonella Typhimurium in black pepper and red pepper by gamma irradiation.

    Science.gov (United States)

    Song, Won-Jae; Sung, Hye-Jung; Kim, Sung-Youn; Kim, Kwang-Pyo; Ryu, Sangryeol; Kang, Dong-Hyun

    2014-02-17

    This study evaluated the efficacy of gamma irradiation to inactivate foodborne pathogens in black pepper (Piper nigrum) and red pepper (dried Capsicum annuum). Black pepper and red pepper inoculated with Escherichia coli O157:H7 and Salmonella Typhimurium were subjected to gamma irradiation in the range of 0, 1, 2, 3 and 5 kGy, and color change was evaluated after treatment. Pathogen populations decreased with increasing treatment doses. A gamma irradiation dose of 5 kGy decreased E. coli O157:H7 and S. Typhimurium populations >4.4 to >5.2 log CFU/g in black pepper without causing color change. Similarly, 5 kGy of gamma irradiation yielded reduction of 3.8 to >5.2 log CFU/g for E. coli O157:H7 and S. Typhimurium in red pepper. During gamma irradiation treatment, L*, a* and b* values of red pepper were not significantly changed except for 297 μm to 420 μm size red pepper treated with 5 kGy of gamma irradiation. Based on the D-value of pathogens in black pepper and red pepper, S. Typhimurium showed more resistant to gamma irradiation than did E. coli O157:H7. These results show that gamma irradiation has potential as a non-thermal process for inactivating foodborne pathogens in spices with minimal color changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Biofilm of Escherichia coli O157:H7 on cantaloupe surface is resistant to lauroyl arginate ethyl and sodium hypochlorite.

    Science.gov (United States)

    Fu, Yezhi; Deering, Amanda J; Bhunia, Arun K; Yao, Yuan

    2017-11-02

    Biofilms formed by Escherichia coli O157:H7 on cantaloupe rind were characterized in this study. Cantaloupe rind pieces inoculated with E. coli O157:H7 B6-914 was sampled after 2, 12, and 24h incubation for imaging with cryo-scanning electron microscopy (Cryo-SEM) or treating with lauroyl arginate ethyl (LAE) or sodium hypochlorite (SHC). Cryo-SEM images showed that E. coli O157:H7 formed a biofilm within 12h on the rind surface. For rind samples treated with LAE or SHC, the residual cell counts were significantly different (pcoli O157:H7 was undetectable (>5-log reduction) after treatment with 2000μg/mL of LAE or SHC. In contrast, for 12h incubation samples, 2000μg/mL of LAE or SHC could only achieve 1.74 or 1.86-log reduction, respectively. The study showed the low efficacy of LAE and SHC on cantaloupe rind surface to reduce the E. coli biofilm, suggesting the needs for cantaloupe cleaning methods beyond washing with conventional antimicrobial agents. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Phytochemicals in lowbush wild blueberry inactivate Escherichia coli O157:H7 by damaging its cell membrane

    Science.gov (United States)

    The antimicrobial activity and model of action of polyphenolic compounds extracted from lowbush wild blueberries (LWB) were studied against E. coli O157:H7. Polyphenols in LWB were extracted using methanol:H20 (80:20, v/v), dried and reconstituted in water and designated as total blueberry phenolic...

  16. Quantification of contamination of lettuce by GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium

    NARCIS (Netherlands)

    Franz, E.; Visser, A.A.; Diepeningen, van A.D.; Klerks, M.M.; Termorshuizen, A.J.; Bruggen, van A.H.C.

    2007-01-01

    The primary objective of this study was to determine the possibility of internalization of GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium (S. Typhimurium) strains MAE 110 (multi-cellular morphology) and 119 (wild type morphology) into lettuce seedlings (Lactuca

  17. Quantification of contamination of lettuce by GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium

    NARCIS (Netherlands)

    Franz, Eelco; Visser, Anna A; Van Diepeningen, Anne D; Klerks, Michel M; Termorshuizen, Aad J; van Bruggen, Ariena H C

    The primary objective of this study was to determine the possibility of internalization of GFP-expressing Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium (S. Typhimurium) strains MAE 110 (multi-cellular morphology) and 119 (wild type morphology) into lettuce seedlings (Lactuca

  18. Inactivation of Escherichia coli O157:H7 in vitro and on the surface of spinach leaves by biobased surfactants

    Science.gov (United States)

    This study was conducted to evaluate the effect of biosurfactants on the populations of Escherichia coli O157:H7 in suspension and on spinach leaves. Eight surfactants including four soybean oil-based biosurfactants, sodium dodecyl sulfate (SDS), polyoxyethylene sorbitan monooleate (Tween 80), sopho...

  19. Ecology and modelling of Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium in cattle manure and soil

    NARCIS (Netherlands)

    Semenov, A.V.

    2008-01-01

    The number of food poisoning cases caused by enteropathogens has increased in recent years. A significant part of the outbreaks associated with the consumption of raw vegetables has been attributed to Escherichia coli O157:H7 and Salmonella enterica subsp. enterica serovar Typhimurium. Bovine manure

  20. Estimating the stability of Escherichia coli O157:H7 survival in manure-amended soils with different management histories

    NARCIS (Netherlands)

    Semenov, A.V.; Franz, E.; Overbeek, van L.S.; Termorshuizen, A.J.; Bruggen, van A.H.C.

    2008-01-01

    The objective of this study is to describe survival of Escherichia coli O157:H7 populations in manure-amended soils in terms of population stability, i.e. the temporal variation around the decline curve, in relation to soil characteristics indicative of soil health. Cow manure inoculated with E.