WorldWideScience

Sample records for samarium 154 reactions

  1. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  2. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  3. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  4. CD40 ligand (CD154) involvement in platelet transfusion reactions.

    Science.gov (United States)

    Sahler, J; Spinelli, S; Phipps, R; Blumberg, N

    2012-06-01

    Platelet transfusions are commonly used treatments that occasionally lead to adverse reactions. Clinical trials, in vitro and animal studies have been performed to try to understand the causes of such reactions. Multiple studies have shown that the supernatant fraction of platelet concentrates contain prothrombotic and pro-inflammatory mediators. The origin of these mediators was first ascribed to white blood cells contaminating the platelet preparation. However, the accumulation of bioactive mediators after leukoreduction focused attention on platelets themselves during storage. Numerous cytokines, chemokines and prostaglandins are released in stored platelet concentrates. We have focused on a powerful mediator called soluble CD40 ligand (sCD40L, formally known as CD154) as a seminal contributor to adverse reactions. sCD40L can bind and signal the surface receptor, CD40, which is present on various types of human cells including white blood cells, vascular cells and fibroblasts. Downstream results of sCD40L/CD40 signaling include pro-inflammatory cytokine and chemokine production, prothrombotic mediator release, adherence and transmigration of leukocytes to endothelium and other undesirable vascular inflammatory events. Increased plasma levels of sCD40L can be detected in conditions such as myocardial infarction, stroke, unstable angina, high cholesterol, or other cardiovascular conditions. In retrospective studies, correlations were made between increased sCD40L levels of platelet concentrates and adverse transfusion reactions. We hypothesize that transfusion of partially activated, CD40L-expressing platelets along with sCD40L into a recipient with damaged or dysfunctional vascular tissue results in a "double-hit", thus inciting inflammation and vascular damage in the recipient. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  5. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))

    1992-02-01

    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  6. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  7. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  8. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  10. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  11. Production cross sections of elements near the N=126 shell in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets

    Science.gov (United States)

    Mayorov, D. A.; Werke, T. A.; Alfonso, M. C.; Bennett, M. E.; Folden, C. M.

    2014-08-01

    Excitation functions for shell-stabilized evaporation residues produced in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets have been measured in experiments performed at the Cyclotron Institute at Texas A&M University. The examined energy range predominantly covers the 3n and 4n evaporation channels with higher cross sections measured for the 4n products. The σ4n are nearly invariant within experimental uncertainty in reactions with Tb159,Dy162, and Ho165 with the maxima at 12.6 ± 1.9, 12.6 ± 1.7, and 9.4 ± 1.3 mb, respectively. For the reaction with Gd154, the maximum is slightly lower at 4.0 ± 0.6 mb. A simple model to describe the measured production cross sections was employed. Capture was estimated by using the "diffused barrier formula" from the "fusion by diffusion" model proposed by Świątecki et al. [Phys. Rev. C 71, 014602 (2005)]., 10.1103/PhysRevC.71.014602 The fusion probability was estimated by using a phenomenological expression presented by Siwek-Wilczyńska et al. [Int. J. Mod. Phys. E 17, 12 (2008)]., 10.1142/S0218301308009501 The survival probability was calculated according to the formula of Vandenbosch and Huizenga [Nuclear Fission (Academic, New York, 1973)], derived from transition-state theory. The best agreement is reached between calculation and experiment upon inclusion of collective effects in the calculation of the survival probability, shown previously to be important for production of weakly deformed nuclei. This, in turn, challenges the expectation that strong shell stabilization benefits the production cross section. The present data are compared with earlier studies on production of neutron-deficient nuclei in Ca-induced reactions with lanthanide targets.

  12. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  13. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  14. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  15. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  16. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  17. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio

    2015-09-01

    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  18. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  19. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  20. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  1. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  2. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  3. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  4. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  5. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  6. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  7. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  8. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  9. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  11. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  12. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  13. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  14. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  15. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  16. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  17. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  18. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  19. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  20. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  2. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  3. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  4. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  5. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  6. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  7. 46 CFR 154.1430 - Equipment locker.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equipment locker. 154.1430 Section 154.1430 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Safety Equipment § 154.1430 Equipment locker. One of each item of equipment under §§ 154.1400 and 154.1420 must be...

  8. Activation cross-sections of deuteron induced reactions on {sup nat}Sm up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Csikai, J. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2014-08-15

    Highlights: •Deuteron induced reactions on natural samarium up to 50 MeV. •Stacked foil irradiation at different energies and accelerators. •Comparison of experimental results with the ALICE-D, EMPIRE-D and TALYS theoretical codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for {sup nat}Sm(d,xn){sup 155,154,152m2,152m1,152g,150m,150g,149,148,147,146}Eu, {sup nat}Sm(d,x) {sup 153,145}Sm and {sup nat}Sm(d,x){sup 151,150,149,145,144,143}Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution γ-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  9. Activation cross-sections of proton induced reactions on {sup nat}Sm up to 65 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2015-03-01

    Highlights: •Proton induced reactions on natural samarium up to 65 MeV. •Stacked foil irradiation technique. •Comparison of experimental results with the ALICE, EMPIRE and TALYS theoretical model codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross sections for proton induced reactions on Sm are presented for the first time for {sup nat}Sm(p,xn){sup 154,152m2,152m1,152g,150m,150g,149,148,147,146,145}Eu, {sup nat}Sm(p,x){sup 153,145}Sm, {sup nat}Sm(p,x){sup 151,150,149,148g,148m,146,144,143}Pm and {sup nat}Sm(p,x){sup 141}Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  10. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  11. 46 CFR 154.446 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.446 Section 154.446 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type B § 154.446 Tank design. An independent tank type B must meet the calculations under § 154...

  12. Reaction pathways of oxide-reduction-diffusion (ORD) synthesis of SmCo5 and in situ study of its hydrogen induced amorphization (HIA)

    Science.gov (United States)

    Belener, Kevin L. A.; Kohlmann, Holger

    2014-12-01

    A modified oxide-reduction-diffusion (ORD) method for the synthesis of single-phase SmCo5 is described. Samarium oxide, cobalt and calcium (20% excess) are heated in sealed niobium tubes following an optimized temperature programme. The reaction proceeds via Ca1-xSmxO as an intermediate and yields SmCo5, and CaO, which may be washed off with dilute acetic acid. Single-phase SmCo5 prepared by this route shows an enhanced reactivity towards hydrogen and reacts already at moderate conditions of p(H2)=0.1 MPa and TX-ray powder diffraction suggest the formation of ternary hydrides SmCo5Hx at temperatures around 473 and 573 K, and disproportionation into cobalt of poor crystallinity and probably an amorphous binary samarium hydride at 700 K, i.e. a hydrogen induced amorphization (HIA) of SmCo5. Neutron powder diffraction was carried out on a 154SmCo5 sample with the high-intensity neutron powder diffractometer D20 at the Institute Laue-Langevin, Grenoble, France. The CaCu5 type crystal structure was confirmed (space group P6/mmm, a=500.60 (2) pm, c=397.01 (2) pm at T=298 (1) K) and the magnetic moments along the crystallographic c axis, μ||c, were refined to be 0.15 (6), 2.02 (6) and 1.75 (5) μB for Sm, Co1 and Co2 atoms, respectively, in ferromagnetic SmCo5. The HIA process was confirmed by in situ neutron powder diffraction at higher pressures of 8.1 MPa deuterium gas.

  13. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  14. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  15. Requirement for CD154 in the progression of atherosclerosis

    NARCIS (Netherlands)

    Lutgens, E.; Gorelik, L.; Daemen, M. J.; de Muinck, E. D.; Grewal, I. S.; Koteliansky, V. E.; Flavell, R. A.

    1999-01-01

    Atherosclerosis is a systemic disease of the large arteries, and activation of inflammatory pathways is important in its pathogenesis. Increasing evidence supports the importance of CD40-CD154 interactions in atherosclerosis, interactions originally known to be essential in major immune reactions

  16. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  17. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  18. 46 CFR 154.660 - Pipe welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Pipe welding. 154.660 Section 154.660 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.660 Pipe welding. (a) Pipe welding must meet Part 57 of this chapter. (b) Longitudinal butt welds...

  19. 46 CFR 154.466 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.466 Section 154.466 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.466 Design criteria. (a) The insulation for a cargo tank without a secondary barrier must be...

  20. 46 CFR 154.471 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.471 Section 154.471 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.471 Design criteria. (a) The cargo tank support system must be designed: (1) For the loads in...

  1. 33 CFR 154.570 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lighting. 154.570 Section 154.570... TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.570 Lighting. (a) Except as... fixed lighting that adequately illuminates: (1) Each transfer connection point on the facility; (2) Each...

  2. 32 CFR 154.61 - Security education.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Security education. 154.61 Section 154.61... PERSONNEL SECURITY PROGRAM REGULATION Continuing Security Responsibilities § 154.61 Security education. (a.... Through security briefings and education, the Department of Defense continues to provide for the...

  3. 29 CFR 1915.154 - Respiratory protection.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Respiratory protection. 1915.154 Section 1915.154 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... (PPE) § 1915.154 Respiratory protection. Respiratory protection for shipyard employment is covered by...

  4. 46 CFR 154.1405 - Respiratory protection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Respiratory protection. 154.1405 Section 154.1405... Equipment § 154.1405 Respiratory protection. When Table 4 references this section, a vessel carrying the listed cargo must have: (a) Respiratory protection equipment for each person on board that protects the...

  5. 46 CFR 154.520 - Piping calculations.

    Science.gov (United States)

    2010-10-01

    ...: (a) Pipe weight loads; (b) Acceleration loads; (c) Internal pressure loads; (d) Thermal loads; and (e... 46 Shipping 5 2010-10-01 2010-10-01 false Piping calculations. 154.520 Section 154.520 Shipping... Process Piping Systems § 154.520 Piping calculations. A piping system must be designed to meet the...

  6. 46 CFR 154.429 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... § 154.429 Calculations. The tank design load calculations for a membrane tank must include the following... submitted to meet this paragraph. (c) The combined strains from static, dynamic, and thermal loads. ... 46 Shipping 5 2010-10-01 2010-10-01 false Calculations. 154.429 Section 154.429 Shipping COAST...

  7. 46 CFR 154.1020 - Emergency power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Emergency power. 154.1020 Section 154.1020 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1020 Emergency power. The emergency generator must be designed to allow operation at the final...

  8. 46 CFR 154.665 - Welding procedures.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Welding procedures. 154.665 Section 154.665 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Construction § 154.665 Welding procedures. Welding procedure tests for cargo tanks for a design temperature...

  9. 33 CFR 154.510 - Loading arms.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Loading arms. 154.510 Section 154... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.510 Loading arms. (a) Each mechanical loading arm used for transferring oil or hazardous material and placed into service...

  10. 46 CFR 154.439 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.439 Section 154.439 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type A § 154.439 Tank design. An independent tank type A must meet the deep tank standard of the...

  11. 46 CFR 154.420 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.420 Section 154.420 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Integral Tanks § 154.420 Tank design. (a) The structure of an integral tank must meet the deep tank scantling standards...

  12. 11 CFR 100.154 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  13. 46 CFR 154.1410 - Decontamination shower.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Decontamination shower. 154.1410 Section 154.1410... Equipment § 154.1410 Decontamination shower. When Table 4 references this section, a vessel carrying the listed cargo must have a decontamination shower and an eye wash that: (a) Are on the weatherdeck; and (b...

  14. 46 CFR 154.428 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

  15. 46 CFR 154.447 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.447 Section 154.447 Shipping COAST... Tank Type B § 154.447 Allowable stress. (a) An independent tank type B designed from bodies of revolution must have allowable stresses 3 determined by the following formulae: 3 See Appendix B for stress...

  16. 46 CFR 154.440 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...

  17. 46 CFR 154.421 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.421 Section 154.421 Shipping COAST... § 154.421 Allowable stress. The allowable stress for the integral tank structure must meet the American Bureau of Shipping's allowable stress for the vessel's hull published in “Rules for Building and Classing...

  18. 46 CFR 154.1840 - Protective clothing.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Protective clothing. 154.1840 Section 154.1840 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1840 Protective clothing... operation, except those assigned to gas-safe cargo control rooms, wears protective clothing. ...

  19. 46 CFR 154.702 - Refrigerated carriage.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Refrigerated carriage. 154.702 Section 154.702 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Pressure and Temperature Control § 154.702 Refrigerated carriage. (a) Each refrigeration system must: (1...

  20. 7 CFR 58.154 - Refrigerated storage.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Refrigerated storage. 58.154 Section 58.154 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... § 58.154 Refrigerated storage. Finished product in containers subject to such conditions that will...

  1. 46 CFR 154.1715 - Moisture control.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Moisture control. 154.1715 Section 154.1715 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1715 Moisture control. When a vessel is carrying sulfur dioxide, the master shall ensure that: (a...

  2. 32 CFR 154.55 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Requirements. 154.55 Section 154.55 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Unfavorable Administrative Actions § 154.55 Requirements. (a) General. For...

  3. 46 CFR 154.703 - Methane (LNG).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG). 154.703 Section 154.703 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... and Temperature Control § 154.703 Methane (LNG). Unless a cargo tank carrying methane (LNG) can...

  4. 40 CFR 417.154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true 417.154 Section 417.154 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Spray Dried Detergents Subcategory § 417.154 ...

  5. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  6. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-07-01

    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  7. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  8. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  9. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  10. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  11. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  12. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  13. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  14. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  15. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  16. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  17. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  18. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  19. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  20. 33 CFR 154.1216 - Facility classification.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Facility classification. 154.1216... Vegetable Oils Facilities § 154.1216 Facility classification. (a) The Coast Guard classifies facilities that... classification of a facility that handles, stores, or transports animal fats or vegetable oils. The COTP may...

  1. 32 CFR 154.34 - Priority requests.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Priority requests. 154.34 Section 154.34... requests. To insure that personnel security investigations are conducted in an orderly and efficient manner, requests for priority for individual investigations or categories of investigations shall be kept to a...

  2. 42 CFR 441.154 - Active treatment.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Active treatment. 441.154 Section 441.154 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... treatment. Inpatient psychiatric services must involve “active treatment”, which means implementation of a...

  3. 46 CFR 154.1725 - Ethylene oxide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide. 154.1725 Section 154.1725 Shipping COAST....1725 Ethylene oxide. (a) A vessel carrying ethylene oxide must: (1) Have cargo piping, vent piping, and... space of an ethylene oxide cargo tank for a period of 30 days under the condition of paragraph (e) of...

  4. 32 CFR 154.30 - General.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false General. 154.30 Section 154.30 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... security investigations shall be limited to those required to accomplish the Defense mission. Such requests...

  5. 32 CFR 154.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Purpose. 154.1 Section 154.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... employees in the Department of Defense (DoD), and granting members of the Armed Forces, DoD civilian...

  6. 18 CFR 154.502 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 154.502... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS Refunds and Reports § 154.502 Reports. (a) When the natural gas company is required, either by a Commission order or as a part of a...

  7. 33 CFR 154.1075 - Appeal process.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Appeal process. 154.1075 Section 154.1075 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED....1075 Appeal process. (a) Any owner or operator of a facility who desires to appeal the classification...

  8. 46 CFR 154.1755 - Nitrogen.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Nitrogen. 154.1755 Section 154.1755 Shipping COAST GUARD... Nitrogen. Except for deck tanks and their piping systems, cargo containment systems and piping systems carrying nitrogen must be specially approved by the Commandant (CG-522). ...

  9. 46 CFR 154.605 - Toughness test.

    Science.gov (United States)

    2010-10-01

    ... of this chapter. (b) If subsize test specimens are used for the Charpy V-notch toughness test, the... 46 Shipping 5 2010-10-01 2010-10-01 false Toughness test. 154.605 Section 154.605 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR...

  10. 46 CFR 154.460 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... dynamic loads in § 154.409(e); (c) If the primary barrier fails, prevent the temperature of the vessel's structure from falling below the minimum allowable service temperature of the steel; and (d) Be designed so... tank for at least 15 days under the dynamic loads in § 154.409(e); (b) If a partial secondary barrier...

  11. 34 CFR 668.154 - Institutional accountability.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Institutional accountability. 668.154 Section 668.154 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY... accountability. An institution shall be liable for the Title IV, HEA program funds disbursed to a student whose...

  12. 40 CFR 93.154 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  13. 33 CFR 154.800 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Applicability. 154.800 Section 154.800 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... receives cargo vapor from a vessel is connected to a facility vapor control system that serves tank storage...

  14. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  15. Dicty_cDB: VHP154 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP154 (Link to dictyBase) - G23560 DDB0231372 Contig-U12088-1 | Contig-U13789-1 VHP...154P (Link to Original site) VHP154F 617 VHP154Z 715 VHP154P 1312 - - Show VHP154 Libr...ary VH (Link to library) Clone ID VHP154 (Link to dictyBase) Atlas ID - NBRP ID G23560 dictyBase ID DDB02313...ycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-C/VHP154Q.Seq.d/ Representative seq. ID VHP154P (Link to Original site) ...Representative DNA sequence >VHP154 (VHP154Q) /CSM/VH/VHP1-C/VHP154Q.Seq.d/ TACAACTGCAGCTAATTTATTCAAGAAAACCG

  16. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  17. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  18. 154 GHz collective Thomson scattering in LHD

    Science.gov (United States)

    Tanaka, K.; Nishiura, M.; Kubo, S.; Shimozuma, T.; Saito, T.; Moseev, D.; Abramovic, I.

    2018-01-01

    Collective Thomson scattering (CTS) was developed by using a 154 GHz gyrotron, and the first data has been obtained. Already, 77 GHz CTS has worked successfully. However, in order to access higher density region, 154 GHz option enhances the usability that reduces the refraction effect, which deteriorates in the local measurements. The system in the down converted frequency was almost identical to the system for 77 GHz. Probing beam, a notch filter, a mixer, and a local oscillator in the receiver system for 77 GHz option were replaced to those for the 154 GHz option. 154 GHz gyrotron was originally prepared for the second harmonic electron cyclotron heating (ECRH) at 2.75 T. However, scattering signal was masked by the second harmonic electron cyclotron emission (ECE) at 2.75 T. Therefore, 154 GHz CTS was operated at 1.375 T with fourth harmonic ECE, and an acceptable signal to noise ratio was obtained. There is a signature of fast ion components with neutral beam (NB) injection. In addition, the CTS spectrum became broader in hydrogen discharge than in deuterium discharge, as the theoretical CTS spectrum expects. This observation indicates a possibility to identify ion species ratio by the 154 GHz CTS diagnostic.

  19. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  20. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  1. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  2. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  3. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. 46 CFR 154.355 - Bow and stern loading piping.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading piping. 154.355 Section 154.355... Arrangements § 154.355 Bow and stern loading piping. (a) Bow and stern loading piping must: (1) Meet § 154.310... other openings to accommodation, service, or control spaces that face the bow or stern loading area must...

  5. 46 CFR 154.408 - Cargo tank external pressure load.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank external pressure load. 154.408 Section 154... Equipment Cargo Containment Systems § 154.408 Cargo tank external pressure load. For the calculation required under § 154.406 (a)(2) and (b), the external pressure load must be the difference between the...

  6. 46 CFR 154.178 - Contiguous hull structure: Heating system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Heating system. 154.178... Equipment Hull Structure § 154.178 Contiguous hull structure: Heating system. The heating system for... the heating capacity to meet § 154.174(b)(2) or § 154.176(b)(2); (b) Have stand-by heating to provide...

  7. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  8. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  9. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  10. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  11. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  12. 18 CFR 154.309 - Incremental expansions.

    Science.gov (United States)

    2010-04-01

    ... Changes § 154.309 Incremental expansions. (a) For every expansion for which incremental rates are charged... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Incremental expansions... incremental facilities to be rolled-in to the pipeline's rates. For every expansion that has an at-risk...

  13. 46 CFR 154.448 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent... similar vessel. (d) A tank buckling analysis considering the maximum construction tolerance. (e) A finite element analysis using the loads determined under § 154.406. (f) A fracture mechanics analysis using the...

  14. 32 CFR 154.41 - Central adjudication.

    Science.gov (United States)

    2010-07-01

    ... administrative action is contemplated under § 154.56(b), the letter of intent (LOI) to deny or revoke must be...-5. A final notification of unfavorable administrative action, subsequent to the issuance of the LOI.... A final notification of unfavorable administrative action subsequent to the issuance of the LOI must...

  15. 18 CFR 154.106 - Map.

    Science.gov (United States)

    2010-04-01

    ....106 Map. (a) The map must show the general geographic location of the company's principal pipeline... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Map. 154.106 Section... on a single map. In addition, a separate map should be provided for each zone. (b) (c) The map must...

  16. 46 CFR 154.1345 - Gas detection.

    Science.gov (United States)

    2010-10-01

    ...” in Table 4 must have: (1) A fixed flammable gas detection system that meets § 154.1350; and (2) Two portable gas detectors that can each measure 0 to 100% of the lower flammable limit of the cargo carried... sulfur dioxide must have a fixed gas detection system that is not located in a gas-safe space. (d) A...

  17. 33 CFR 154.1010 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154.1010 Purpose. This subpart establishes oil spill response plan requirements for all marine transportation... response plan prepares the facility owner or operator to respond to an oil spill. These requirements...

  18. 7 CFR 3560.154 - Tenant selection.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.154 Tenant... documented in the housing project's management plan and Affirmative Fair Housing Marketing Plan. (d... regardless of income. Such applicants, however, will be ranked among themselves by income level, giving...

  19. Studies of the N=90 region: The decay of 154Eu to 154Gd

    Energy Technology Data Exchange (ETDEWEB)

    Kulp, W.D.; Wood, J.L.; Krane, K.S.; Loats, J.; Schmelzenbach, P.; Stapels, C.J.; Larimer, R.-M.; Norman, E.B.

    2003-12-05

    The decay of {sup 154}Eu {yields} {sup 154}Gd has been studied by {gamma}-ray singles and {gamma}-{gamma} coincidence spectroscopy using an array of 20 Compton-suppressed Ge detectors. The primary goal of the work was to confirm or refute a large number of questionable features in the decay scheme: the outcome is the removal of 8 levels from the previously adopted scheme, with the result that a new type of collective band is revealed. Many weak decay branches for the decay are clarified. These results are critical for understanding the structure of {sup 154}Gd and the N = 90 isotones; and the improved completeness of the decay scheme contributes to the use of {sup 154}Eu as a metrological standard.

  20. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  1. Relationship between metalloproteinase 2 and 9 concentrations and soluble CD154 expression in Iranian patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Javad Sanchooli

    2014-05-01

    Full Text Available Matrix metalloproteinases (MMPs play a critical role in the blood–brain barrier permeability and in invasion of the leukocytes into the central nervous system during multiple sclerosis (MS. In this respect, in the present study, we have evaluated the possible role of MMP-9 and MMP-2 on the expression of soluble CD154 (sCD154 and membrane-bound isoform of the CD154 in Iranian MS patients. The expressions of the aforementioned protein-related genes were analyzed at the levels of messenger RNA and proteins by real-time reverse transcription polymerase chain reaction, enzyme-linked immunosorbent assay, and Western blotting. The results showed a high expression of CD154 isoforms, MMP-9 and MMP-2, in MS patients in contrast to controls (p 3-fold in patients with a higher MMPs/tissue inhibitor of metalloproteinase 1 (TIMP-1 ratio. Furthermore, secondary-progressive MS patients with exacerbate period showed higher positive correlation between increasing sCD154 concentration and overexpression of MMP-2 (p < 0.001. Our data demonstrate that following the exacerbation period, sCD154 concentration is increased in patients, which is mutually related to the MMPs/TIMP-1 ratio. This relationship may represent a new link between sCD154 concentration and the MMPs/TIMP-1 ratio with prognostic implications.

  2. 46 CFR 154.411 - Cargo tank thermal loads.

    Science.gov (United States)

    2010-10-01

    ... Containment Systems § 154.411 Cargo tank thermal loads. For the calculations required under § 154.406(a)(4... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank thermal loads. 154.411 Section 154.411... thermal loads for the cooling down periods of cargo tanks for design temperatures lower than −55 °C (−67...

  3. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  4. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  5. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  6. 46 CFR 154.1435 - Medical first aid guide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Medical first aid guide. 154.1435 Section 154.1435 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... Equipment § 154.1435 Medical first aid guide. Each vessel must have a copy of the IMO Medical First Aid...

  7. 46 CFR 154.1150 - Distribution of dry chemical.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Distribution of dry chemical. 154.1150 Section 154.1150... Firefighting System: Dry Chemical § 154.1150 Distribution of dry chemical. (a) All locations on the above deck... chemical hand hose lines; or (2) At least one dry chemical hand hose line and one dry chemical monitor. (b...

  8. 46 CFR 154.560 - Cargo hose: Prototype test.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo hose: Prototype test. 154.560 Section 154.560... Hose § 154.560 Cargo hose: Prototype test. (a) Each cargo hose must be of a type that passes a prototype test at a pressure of at least five times its maximum working pressure at or below the minimum...

  9. 46 CFR 154.802 - Alternate pressure relief settings.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Alternate pressure relief settings. 154.802 Section 154... Equipment Cargo Vent Systems § 154.802 Alternate pressure relief settings. Cargo tanks with more than one relief valve setting must have one of the following arrangements: (a) Relief valves that: (1) Are set and...

  10. 46 CFR Appendix A to Part 154 - Equivalent Stress

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equivalent Stress A Appendix A to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. A Appendix A to Part 154...

  11. 46 CFR Appendix B to Part 154 - Stress Analyses Definitions

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Stress Analyses Definitions B Appendix B to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. B Appendix B to Part 154...

  12. 46 CFR 154.1870 - Bow and stern loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading. 154.1870 Section 154.1870... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1870 Bow and stern loading. (a) When the bow or stern loading piping is not in use, the master shall lock closed the shut-off...

  13. 21 CFR 133.154 - High-moisture jack cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false High-moisture jack cheese. 133.154 Section 133.154... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.154 High-moisture jack cheese. High-moisture jack cheese conforms to...

  14. 46 CFR 154.412 - Cargo tank corrosion allowance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank corrosion allowance. 154.412 Section 154.412... Containment Systems § 154.412 Cargo tank corrosion allowance. A cargo tank must be designed with a corrosion...) carries a cargo that corrodes the tank material. Note: Corrosion allowance for independent tank type C is...

  15. 46 CFR 154.180 - Contiguous hull structure: Welding procedure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Welding procedure. 154.180 Section 154.180 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.180 Contiguous hull structure: Welding procedure. Welding procedure tests for...

  16. 46 CFR 154.546 - Excess flow valve: Closing flow.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Excess flow valve: Closing flow. 154.546 Section 154.546... and Process Piping Systems § 154.546 Excess flow valve: Closing flow. (a) The rated closing flow of vapor or liquid cargo for an excess flow valve must be specially approved by the Commandant (CG-522). (b...

  17. 46 CFR 154.9 - Issuance of documents.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Issuance of documents. 154.9 Section 154.9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES General § 154.9 Issuance of documents. The...

  18. 46 CFR 154.188 - Membrane tank: Inner hull steel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Membrane tank: Inner hull steel. 154.188 Section 154.188... Structure § 154.188 Membrane tank: Inner hull steel. For a vessel with membrane tanks, the inner hull... “Rules for Building and Classing Steel Vessels”, 1981. ...

  19. 46 CFR 154.1340 - Temperature measuring devices.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Temperature measuring devices. 154.1340 Section 154.1340... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1340 Temperature measuring devices. (a) Each cargo tank must have devices that measure the...

  20. 46 CFR 154.172 - Contiguous steel hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous steel hull structure. 154.172 Section 154.172... Structure § 154.172 Contiguous steel hull structure. (a) Except as allowed in paragraphs (b) and (c) of this... construction of the contiguous steel hull structure must meet the thickness and steel grade in Table 1 for the...

  1. 33 CFR 154.820 - Fire, explosion, and detonation protection.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Fire, explosion, and detonation protection. 154.820 Section 154.820 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Systems § 154.820 Fire, explosion, and detonation protection. (a) A vapor control system with a single...

  2. 46 CFR 154.528 - Piping joints: Flange type.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange type. 154.528 Section 154.528 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... and Process Piping Systems § 154.528 Piping joints: Flange type. (a) A flange must be one of the...

  3. 46 CFR 154.526 - Piping joints: Flange connection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange connection. 154.526 Section 154... Equipment Cargo and Process Piping Systems § 154.526 Piping joints: Flange connection. Flange connections for pipe joints must meet § 56.30-10 and § 56.50-105 (a)(4) and (b)(4) of this chapter. ...

  4. 46 CFR 154.195 - Aluminum cargo tank: Steel enclosure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Aluminum cargo tank: Steel enclosure. 154.195 Section 154.195 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.195 Aluminum cargo tank: Steel enclosure. (a) An aluminum cargo tank and its...

  5. 46 CFR 154.514 - Piping: Electrical bonding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping: Electrical bonding. 154.514 Section 154.514... and Process Piping Systems § 154.514 Piping: Electrical bonding. (a) Cargo tanks or piping that are... side. (c) An electrical bond must be made by at least one of the following methods: (1) A metal bonding...

  6. 46 CFR 154.1205 - Mechanical ventilation system: Standards.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: Standards. 154.1205... Equipment Cargo Area: Mechanical Ventilation System § 154.1205 Mechanical ventilation system: Standards. (a) Each exhaust type mechanical ventilation system required under § 154.1200 (a) must have ducts for...

  7. 46 CFR 154.1702 - Materials of construction.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Materials of construction. 154.1702 Section 154.1702... § 154.1702 Materials of construction. When Table 4 references one of the following paragraphs in this section, the materials in the referenced paragraph must not be in components that contact the cargo liquid...

  8. 46 CFR 154.1145 - Dry chemical supply.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Dry chemical supply. 154.1145 Section 154.1145 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Firefighting System: Dry Chemical § 154.1145 Dry chemical supply. (a) A vessel with a cargo carrying capacity...

  9. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  10. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  11. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  12. 46 CFR 154.1854 - Methane (LNG) as fuel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG) as fuel. 154.1854 Section 154.1854... fuel. (a) If methane (LNG) vapors are used as fuel in the main propulsion system of a vessel, the master shall ensure that the fuel oil fired pilot under § 154.705(c) is used when the vessel is on the...

  13. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  14. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  15. Cross sections of deuteron induced reactions on $^{nat}$Sm for production of the therapeutic radionuclide $^{145}$Sm and $^{153}$Sm

    OpenAIRE

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.

    2014-01-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them $^{145}$Sm and $^{153}$Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the $^{nat}$Sm(d,x)$^{145153}$Sm reactions were determined for deuteron energies up to 50 MeV using the st...

  16. Platelet-derived or soluble CD154 induces vascularized allograft rejection independent of cell-bound CD154

    OpenAIRE

    Xu, He; Zhang, Xiaojie; Mannon, Roslyn B.; Kirk, Allan D.

    2006-01-01

    CD154 is a cell surface molecule expressed on activated T cells that binds to CD40, an activating molecule on APCs. Its blockade has been shown to prevent allograft rejection, presumably by interrupting interactions between T cells and APCs. It is known that activated human platelets express and shed CD154 and can induce APC activation and other immune processes in vitro. Here we show that platelet-derived CD154 is sufficient to initiate cardiac allograft rejection independent of any cellular...

  17. Selective steroid oxyfunctionalisation by CYP154C5, a bacterial cytochrome P450

    Science.gov (United States)

    2013-01-01

    Background Cytochrome P450 monooxygenases – able to regio- and stereoselectively hydroxylate non-activated carbon atoms – are important enzymes for the synthesis of valuable intermediates in the production of steroid hormones in the pharmaceutical industry. However, up to now only a few bacterial enzymes able to hydroxylate steroids have been reported. CYP154C5 from Nocardia farcinica IFM 10152, a bacterial P450 monooxygenase, was previously shown to convert testosterone to 16α-hydroxytestosterone. Since the hydroxylation at 16α-position is of special interest for the pharmaceutical industry, we have studied this enzyme in more detail to investigate its activity and selectivity in bioconversions of further steroids. Results CYP154C5 was coexpressed in Escherichia coli together with putidaredoxin and putidaredoxin reductase from Pseudomonas putida as redox partners for electron transfer and applied in bioconversions of various pregnanes and androstanes [pregnenolone (1), dehydroepiandrosterone (2), progesterone (3), androstenedione (4), testosterone (5) and nandrolone (6)]. Structure elucidation of the formed products revealed an exclusive regio- and stereoselectivity of CYP154C5, always yielding the corresponding 16α-hydroxylated steroids. Application of whole cells expressing the three components, P450, Pdx and PdR, in steroid biotransformations resulted in significantly higher conversions and total turnover numbers (TTN) compared to reactions using cell-free extracts. Additionally, considerably higher substrate loads (up to 15 mM) were tolerated by the whole-cell system. Furthermore, turnover numbers (TON) were determined for the six different steroids using whole cells. Thus, testosterone was found to be the worst substrate with a TON of only 0.8 μmol substrate consumed min-1 μmol-1 CYP154C5, while progesterone and pregnenolone were converted the fastest resulting in TON of 3.3 μmol substrate consumed min-1 μmol-1 CYP154C5. Conclusion CYP154C5

  18. The role of CD154 in haematopoietic development

    NARCIS (Netherlands)

    Seijkens, Tom; Engel, David; Tjwa, Marc; Lutgens, Esther

    2010-01-01

    CD154 (CD40 ligand, CD40L, gp139) is a co-stimulatory molecule of the tumour necrosis factor (TNF) family. CD154 was originally discovered on T-cells, and was found to be involved in many immune responses including B-cell activation, isotype switching, and germinal centre formation. The expression

  19. 42 CFR 483.154 - Nurse aide competency evaluation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Nurse aide competency evaluation. 483.154 Section... Requirements That Must Be Met by States and State Agencies: Nurse Aide Training and Competency Evaluation, and Paid Feeding Assistants § 483.154 Nurse aide competency evaluation. (a) Notification to Individual. The...

  20. 76 FR 2726 - Withdrawal of Regulatory Guide 1.154

    Science.gov (United States)

    2011-01-14

    ... Regulatory Guide 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... Regulatory Guide (RG) 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... format and content acceptable to the NRC staff for plant-specific pressurized thermal shock (PTS) safety...

  1. 21 CFR 520.154 - Bacitracin oral dosage forms.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin oral dosage forms. 520.154 Section 520...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.154 Bacitracin oral dosage forms. ...

  2. 46 CFR 154.1808 - Limitations in the endorsement.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Limitations in the endorsement. 154.1808 Section 154... Limitations in the endorsement. No person may operate a vessel unless that person complies with all limitations in the endorsement on the vessel's Certificate of Inspection or Certificate of Compliance. ...

  3. 32 CFR Appendix G to Part 154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false G Appendix G to Part 154 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Appendix G to Part 154 ...

  4. 46 CFR 154.1735 - Methyl acetylene-propadiene mixture.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methyl acetylene-propadiene mixture. 154.1735 Section... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Special Design and Operating Requirements § 154.1735 Methyl acetylene-propadiene mixture. (a) The composition of the methyl...

  5. 43 CFR 15.4 - Refuse and polluting substances.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Refuse and polluting substances. 15.4... § 15.4 Refuse and polluting substances. No person shall dump or deposit in or on the waters of this..., boxes, cans, dirt, rubbish, waste garbage, refuse or other debris or polluting substance. ...

  6. 49 CFR 572.154 - Thorax assembly and test procedure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.154... 12-Month-Old Infant, Alpha Version § 572.154 Thorax assembly and test procedure. (a) Thorax Assembly (refer to § 572.150(a)(1)(iv)) . The thorax consists of the part of the torso assembly shown in drawing...

  7. 33 CFR 154.810 - Vapor line connections.

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Vapor Control Systems § 154.810 Vapor... the OCIMF International Safety Guide for Oil Tankers and Terminals (incorporated by reference; see § 154.106). (h) A vapor collection system fitted with an enriching system that operates at a positive...

  8. 46 CFR 154.174 - Transverse contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Transverse contiguous hull structure. 154.174 Section... Equipment Hull Structure § 154.174 Transverse contiguous hull structure. (a) The transverse contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the standards of...

  9. 46 CFR 154.176 - Longitudinal contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Longitudinal contiguous hull structure. 154.176 Section... Equipment Hull Structure § 154.176 Longitudinal contiguous hull structure. (a) The longitudinal contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the...

  10. 46 CFR 154.1200 - Mechanical ventilation system: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: General. 154.1200 Section... Equipment Cargo Area: Mechanical Ventilation System § 154.1200 Mechanical ventilation system: General. (a... cargo handling equipment must have a fixed, exhaust-type mechanical ventilation system. (b) The...

  11. 33 CFR 154.530 - Small discharge containment.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Small discharge containment. 154.530 Section 154.530 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serves one or more hoses of 6-inch inside diameter or smaller, or loading arms of 6-inch nominal pipe...

  12. 21 CFR 520.154a - Soluble bacitracin methylene disalicylate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Soluble bacitracin methylene disalicylate. 520.154a Section 520.154a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Soluble bacitracin methylene disalicylate. (a) Specifications. Each pound of soluble powder contains the...

  13. 18 CFR 154.312 - Composition of Statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Composition of Statements. 154.312 Section 154.312 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... this chapter) with subtotals by functional classifications, e.g., Intangible Plant, Manufactured Gas...

  14. 24 CFR 982.154 - ACC reserve account.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  15. 29 CFR 1926.154 - Temporary heating devices.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 8 2010-07-01 2010-07-01 false Temporary heating devices. 1926.154 Section 1926.154 Labor... Temporary heating devices. (a) Ventilation. (1) Fresh air shall be supplied in sufficient quantities to... heating devices shall be installed to provide clearance to combustible material not less than the amount...

  16. CD40 ligand (CD154) takes part in regulation of the transition to mononuclear cell dominance during peritonitis.

    Science.gov (United States)

    Mazar, Julia; Agur, Timna; Rogachev, Boris; Ziv, Nadav Yehuda; Zlotnik, Moshe; Chaimovitz, Cidio; Douvdevani, Amos

    2005-04-01

    CD40 is a member of the tumor necrosis factor (TNF) family of receptors whose ligand (CD154) is found mainly on membranes of activated mononuclear cells. CD154-CD40 cross-linking is a central event in antigen presentation, B-cell activation, and regulation of cytokine and chemokine secretion from various types of cells. We have previously demonstrated in vitro the presence of CD40 on human peritoneal mesothelial cells (PMC) and have also shown that CD40 ligation synergizes with interferon-gamma (IFN-gamma) to up-regulate CC chemokine secretion from these cells. The aim of the present study was to investigate the role of CD40 ligation in leukocyte recruitment during peritonitis. Peritonitis was induced in mice by bacterial inoculation, CD40 levels were analyzed on PMC by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry. CD154 levels on leukocytes were analyzed by flow cytometry and RT-PCR. Chemokines mRNA levels were analyzed by RT-PCR. CD154 was blocked in vivo using monoclonal antibodies. Results. In mice inoculated by Staphylococcus epidermidis or Escherichia coli, CD40 in PMC increased twofold at 24 hours and CD154 was induced and reached a peak at 48 hours. In both Gram-positive and Gram-negative-peritonitis, peritoneal macrophages were the main peritoneal leukocyte population to express CD154. Similar results were observed in human subjects during peritonitis. Injection of CD154 blocking monoclonal antibody (MR1) reduced the mononuclear infiltrate by 50% and had no effect on granulocyte recruitment 48 hours after inoculation of S. epidermidis. Our data suggest that CD40 plays a significant role in the process of the mononuclear infiltration during peritonitis.

  17. CD154 Induces Matrix Metalloproteinase-9 Secretion in Human Podocytes.

    Science.gov (United States)

    Rigothier, Claire; Daculsi, Richard; Lepreux, Sébastien; Auguste, Patrick; Villeneuve, Julien; Dewitte, Antoine; Doudnikoff, Evelyne; Saleem, Moin; Bourget, Chantal; Combe, Christian; Ripoche, Jean

    2016-12-01

    Matrix remodeling is a key feature of glomerulosclerosis secondary to diabetes or hypertension. Podocytes contribute to glomerular basement membrane (GBM) turnover by producing matrix components and matrix remodelling enzymes, including matrix metalloproteinases (MMPs). The CD40/CD154 signaling pathway modulates matrix remodeling through the synthesis of MMPs and tissue inhibitors of MMPs. Platelets are a primary blood reservoir of CD154. Here we studied, the impact of the CD154/CD40 pathway on MMP-9 expression by cultured human podocytes. The role of CD40/CD154 was evaluated upon exposure of podocytes to recombinant human CD154 (rhCD154) or activated platelet supernatants from healthy human subjects. We first showed by protein and mRNA expression that CD40 was synthesized by podocytes and detectable on kidney tissue sections. CD40 expression was acquired during podocyte differentiation and enhanced upon exposure to rhCD154. In podocytes, rhCD154 induced an increase of MMP-9 production as shown by RT-PCR, Western blot and and gelatin zymography. Activated platelet supernatants induced MMP-9 mRNA synthesis in podocytes, an effect reduced by anti-CD40 antibody. Our results underscore a potential role for platelets through the CD40/CD154 signaling pathway in the control of GBM synthesis and degradation, via its regulatory role on MMP-9 production. CD154 secretion by activated platelets may contribute to GBM alterations in proteinuric nephropathies. J. Cell. Biochem. 117: 2737-2747, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  19. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  20. 46 CFR 154.1872 - Cargo emergency jettisoning.

    Science.gov (United States)

    2010-10-01

    ... jettisoning. (a) The master shall ensure that emergency jettisoning piping under § 154.356, except bow and stern loading and discharging piping, is only used when an emergency exists. (b) Emergency jettisoning...

  1. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  2. Reduced Lentivirus Susceptibility in Sheep with TMEM154 Mutations

    Science.gov (United States)

    Heaton, Michael P.; Clawson, Michael L.; Chitko-Mckown, Carol G.; Leymaster, Kreg A.; Smith, Timothy P. L.; Harhay, Gregory P.; White, Stephen N.; Herrmann-Hoesing, Lynn M.; Mousel, Michelle R.; Lewis, Gregory S.; Kalbfleisch, Theodore S.; Keen, James E.; Laegreid, William W.

    2012-01-01

    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10−9). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection. PMID:22291605

  3. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu

    2016-09-01

    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  4. Tuberculin reaction and BCG scar

    DEFF Research Database (Denmark)

    Timmermann, Clara Amalie Gade; Biering-Sørensen, Sofie; Aaby, Peter

    2015-01-01

    rate ratio (MRR) comparing children with a BCG scar with those without was 0.42 (95% CI = 0.19; 0.93). There was a similar tendency for TST positivity: MRR = 0.47 (95% CI = 0.14; 1.54). For LBW children who had both a positive TST reaction and a scar, the MRR was 0.22 (95% CI = 0.05; 0.87). For NBW...

  5. Posttranscriptional Regulation in Lymphocytes: The case of CD154

    Science.gov (United States)

    Vavassori, Stefano; Covey, Lori R.

    2010-01-01

    The control of mRNA decay is emerging as an important control point and a major contributor to gene expression in both immune and non-immune cells. The identification of protein factors and cis-acting elements responsible for transcript degradation has illuminated a comprehensive picture of precisely orchestrated events required to both regulate and establish the decay process. One gene that is highly regulated at the posttranscriptional level is CD40 ligand (CD154 or CD40L). CD154 on CD4+ T cells is tightly controlled by an interacting network of transcriptional and posttranscriptional processes that result in precise surface levels of protein throughout an extended time course of antigen stimulation. The activation-induced stabilization of the CD154 transcript by a polypyrimidine tract-binding protein (PTB)-complex is a key event that corresponds to the temporal expression of CD154. In this review, we discuss known and potential roles of major mRNA decay pathways in lymphocytes and focus on the unique posttranscriptional mechanisms leading to CD154 expression by activated CD4+ T cells. PMID:19395873

  6. CD154: the atherosclerotic risk factor in rheumatoid arthritis?

    Science.gov (United States)

    2013-01-01

    Atherosclerosis, now regarded as a chronic inflammatory disease of the arterial wall, and its clinical manifestations have increasingly been associated with rheumatoid arthritis (RA), supporting the notion that autoimmune diseases and vascular disorders share common etiological features. Indeed, evidence pertaining to this matter indicates that inflammation and its multiple components are the driving force behind the pathogenesis of these disorders. Interestingly, CD154 and its receptors have emerged as major players in the development of RA and atherosclerosis, which raises the possibility that this axis may represent an important biological link between both complications. Indeed, CD154 signaling elicits critical inflammatory responses that are common to the pathogenesis of both diseases. Here, we provide an overview of the traditional and disease-related interrelations between RA and vascular abnormalities, while focusing on CD154 as a potential mediator in the development of atherosclerotic events in RA patients. PMID:23433179

  7. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    Science.gov (United States)

    Benslimane, Nadir; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production. PMID:22905203

  8. Requirement of transmembrane domain for CD154 association to lipid rafts and subsequent biological events.

    Directory of Open Access Journals (Sweden)

    Nadir Benslimane

    Full Text Available Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production.

  9. Enfoque terapéutico en 154 pacientes con acromegalia Therapeutic management in 154 acromegalic patients

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.Acromegaly is a chronic, invalidating disease due in over 95% of cases to a growth hormone (GH secreting pituitary adenoma. Its clinical manifestations are associated to local complications related to the tumor growth and/or to the metabolic consequences of GH excess. We report here our experience on 154 acromegalic patients. Surgical remission rate using stringent biochemical criteria was 32%, a figure relatively low due to the great number of patients bearing

  10. Phenotype abnormality: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 154 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u660i decreased efficiency...ent of blue light regimen http://metadb.riken.jp/db/SciNetS_ria224i/cria224u2ria224u29i root ... decreased efficiency ...

  11. 46 CFR 154.438 - Design vapor pressure.

    Science.gov (United States)

    2010-10-01

    ... Independent Tank Type A § 154.438 Design vapor pressure. (a) If the surface of an independent tank type A are mostly flat surfaces,the Po must not exceed 69 kPa gauge (10 psig). (b) If the surfaces of an independent tank type A are formed by bodies of revolution, the design calculation of the Po must be specially...

  12. 32 CFR 154.42 - Evaluation of personnel security information.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Evaluation of personnel security information... SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Adjudication § 154.42 Evaluation of personnel security information. (a) The criteria and adjudicative policy to be used in applying the...

  13. 32 CFR 154.15 - Military appointment, enlistment, and induction.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Military appointment, enlistment, and induction... Requirements § 154.15 Military appointment, enlistment, and induction. (a) General. The appointment, enlistment, and induction of each member of the Armed Forces or their Reserve Components shall be subject to the...

  14. 29__154 -158_ _Galadanci_ANALYSIS OF AURORAL

    African Journals Online (AJOL)

    User

    Bayero Journal of Pure and Applied Sciences, 9(2): 154 - 158. Received: April, 2016. Accepted: August, 2016 ... 1Department of Physics, Bayero University, Kano. NIGERIA. 2Department of Mathematical Sciences, Bayero ... first described by a Japanese geophysicist named. Syun-IchiAkasofu in 1964 (Sarris and Li, 2005).

  15. 27 CFR 44.154 - Claim for refund of tax.

    Science.gov (United States)

    2010-04-01

    ..., WITHOUT PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Claims § 44.154... refunded (without interest) to an export warehouse proprietor on proof satisfactory to the appropriate TTB... ownership of such export warehouse proprietor, or withdrawn by him from the market. Any claim for refund...

  16. 21 CFR 146.154 - Concentrated orange juice with preservative.

    Science.gov (United States)

    2010-04-01

    ... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... ingredients prescribed for concentrated orange juice for manufacturing by § 146.153, except that a...

  17. 154.pdf | 25jan2011 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; currsci; 25jan2011; 154.pdf. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube · Twitter · Facebook · Blog. Academy News. IAS Logo. Ethical Guidelines and Procedures document. Posted on 17 January 2017. A revised version of the ...

  18. 46 CFR 154.1350 - Flammable gas detection system.

    Science.gov (United States)

    2010-10-01

    ... compressor room; (3) Each motor room for cargo handling machinery; (4) Each cargo control station that is not... the space where the gas detection system's readout is located and must meet § 154.1365. (h) Remote... away from all ignition sources. (o) Each flammable gas detection system must not have common sampling...

  19. 33 CFR 154.1125 - Additional response plan requirements.

    Science.gov (United States)

    2010-07-01

    ...) for exercises that test either the entire appendix or individual components(s). (3) Testing... Prince William Sound, Alaska § 154.1125 Additional response plan requirements. (a) The owner or operator of a TAPAA facility shall include the following information in the Prince William Sound appendix to...

  20. 18 CFR 154.401 - RD&D expenditures.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false RD&D expenditures. 154....401 RD&D expenditures. (a) Requirements. Upon approval by the Commission, a natural gas company may file to recover research, development, and demonstration (RD&D) expenditures in its rates under this...

  1. 20 CFR 655.154 - Additional positive recruitment.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Additional positive recruitment. 655.154... recruitment. (a) Where to conduct additional positive recruitment. The employer must conduct positive recruitment within a multistate region of traditional or expected labor supply where the CO finds that there...

  2. 33 CFR 154.545 - Discharge containment equipment.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154... chapter may be utilized in the planning requirements of subpart F and subpart H of this part. ... material and equipment to contain any oil or hazardous material discharged on the water from operations at...

  3. 33 CFR 154.1210 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... planning requirements for an owner or operator of a facility that handles, stores, or transports animal... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Animal Fats and Vegetable Oils Facilities § 154.1210 Purpose and applicability. (a) The requirements of this...

  4. 33 CFR 154.1110 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Additional Response Plan Requirements for a Trans-Alaska Pipeline Authorization Act (TAPAA) Facility Operating in Prince William Sound, Alaska § 154.1110 Purpose and applicability. (a) This subpart establishes oil spill response planning...

  5. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  6. Immunotargeting with CD154 (CD40 Ligand) Enhances DNA Vaccine Responses in Ducks

    OpenAIRE

    Sheryl L. Gares; Karl P Fischer; Congly, Stephen E.; Lacoste, Stacey; Addison, William R.; Tyrrell, D Lorne; Gutfreund, Klaus S.

    2006-01-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated du...

  7. Counteractive functions are encrypted in the residues of CD154.

    Science.gov (United States)

    Bandyopadhyay, Syamdas; Chandel, Himanshu Singh; Singh, Shailza; Roy, Somenath; Krishnasastry, M V; Saha, Bhaskar

    2015-09-01

    CD40, as a single receptor that binds CD154 (CD40-ligand or CD40L), regulates counteractive effector functions such as production of pro- and anti-inflammatory cytokines. Therefore, we examined whether such dual messages are encrypted in CD40L. As such message encryption was never investigated, we hypothesized that mutation of certain amino acid residues should in principle enhance pro-inflammatory cytokine production whereas mutation of some others would enhance anti-inflammatory cytokine secretion. We mutated six such residues, which were previously showed to participate in CD40L function. Here, we report that the mutant CD154 129E→V was superior to the wild-type CD154 in killing of Leishmania donovani, induction of inducible nitric oxide synthase (iNOS) and production of IL-12 and relative phosphorylation of p38MAPK and ERK-1/2 in PBMC-derived macrophages. By contrast, 128S→V promoted L. donovani survival, reducing iNOS, but increasing IL-10 expression and predominant ERK-1/2 phosphorylation. The mutant 144G→V did not have significant effects. Other mutants (142E→V, 143K→A, 145Y→F) mimicked the wild-type CD154. Molecular dynamics simulation suggested that these mutations induced differential conformational changes in the CD40-CD154 complex. Therefore, assortment of the contrasting messages encrypted in a given ligand performing counteractive functions presents a novel fundamental biological principle that can be used for devising various therapies. Copyright © 2015. Published by Elsevier Inc.

  8. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  9. 46 CFR 154.1836 - Vapor venting as a means of cargo tank pressure and temperature control.

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Operations § 154.1836 Vapor venting as a means of cargo tank pressure and temperature... temperature control. 154.1836 Section 154.1836 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... cargo pressure and temperature control system under §§ 154.701 through 154.709 is operating and that...

  10. Immunotargeting with CD154 (CD40 ligand) enhances DNA vaccine responses in ducks.

    Science.gov (United States)

    Gares, Sheryl L; Fischer, Karl P; Congly, Stephen E; Lacoste, Stacey; Addison, William R; Tyrrell, D Lorne; Gutfreund, Klaus S

    2006-08-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated duck hepatitis B virus (DHBV) core antigen (tcore) and chimera of tcore fused to tCD154 (tcore-tCD154). Expression in LMH cells demonstrated that all proteins were secreted and that tCD154 and tcore-tCD154 formed multimers. Ducks immunized with the plasmid ptcore-tCD154 developed accelerated and enhanced core-specific antibody responses compared to ducks immunized with ptcore or ptcore plus ptCD154. Antibody responses were better sustained in both ptcore-tCD154- and ptcore plus ptCD154-immunized ducks. Core-specific proliferative responses of duck peripheral blood mononuclear cells were enhanced in ducks immunized with ptcore-tCD154 or ptcore alone. This study suggests that the role of CD154 in the regulation of adaptive immune responses had already evolved before the divergence of birds and mammals. Thus, targeting of antigens to APCs with CD154 is an effective strategy to enhance DNA vaccine responses not only in mammalian species but also in avian species.

  11. Evaluation of CD86/CD28 and CD40/CD154 pathways in regulating monocyte-derived CD80 expression during their interaction with allogeneic endothelium.

    Science.gov (United States)

    Wang, P; Liu, Z; Wu, C; Zhu, B; Wang, Y; Xu, H

    2008-10-01

    This study was designed to examine the role of monocyte-derived CD80 in providing costimulation to CD4+ cells, and to determine whether monocyte-derived CD80 expression is regulated by CD86/CD28 and CD40/CD154 pathways during allogeneic immunoresponses. Human endothelial cells (EC) and purified monocytes cocultured with or without CD4+ cells were analyzed by real-time quantitative polymerase chain reaction (RT-PCR) and florescence-activated cell scanning (FACS). Peripheral blood mononuclear cells (PBMC)-EC cocultures with or without costimulation blockade were analyzed by FACS. The effects of CD154 and CD28 blockade to inhibit lymphocyte proliferation were evaluated by mixed lymphocyte-EC reaction (MLER). RT-PCR demonstrated upregulation of CD80 transcripts in EC-stimulated monocytes in the absence of CD4+ cells. However, the surface expression of CD80 was undetectable. The expression of CD80 was restored in the presence of CD4+ cells. Additionally, CD80 blockade partially inhibited CD4+ cell proliferation induced by EC-conditioned monocytes. Monocytes demonstrated upregulation of CD80 on the surface during PBMC-EC interaction. CD86, CD28, and CD154 blockade did not prevent upregulation of monocyte-derived CD80 expression. CD28 and CD154 blockade partially inhibited lymphocyte proliferation of MLER. In summary, EC-stimulated monocytes upregulated CD80 expression at the transcript level but not on their surface in the absence of T cells. The surface expression of monocyte-derived CD80 is upregulated on EC-stimulated monocytes in the presence of T cells. CD154/CD40 and CD28/CD86 blockade cannot prevent monocyte-derived CD80 expression, suggesting that CD80 upregulation is through a CD154- or CD86-independent pathway. Specific therapy to prevent monocyte activation may be required for successful allograft transplantation.

  12. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    OpenAIRE

    Ali H. Charafeddine; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by ...

  13. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    OpenAIRE

    Benslimane, Nadir,; Hassan, Ghada,; Yacoub, Daniel; Mourad, Walid,

    2012-01-01

    International audience; Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressi...

  14. 46 CFR 154.1015 - Lighting in gas-dangerous space.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Lighting in gas-dangerous space. 154.1015 Section 154... Equipment Electrical § 154.1015 Lighting in gas-dangerous space. (a) Each gas-dangerous space that has... protective device for any lighting circuit that is in a gas-dangerous space must open each conductor of the...

  15. 46 CFR 154.706 - Cargo boil-off as fuel: Fuel lines.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo boil-off as fuel: Fuel lines. 154.706 Section 154... Equipment Cargo Pressure and Temperature Control § 154.706 Cargo boil-off as fuel: Fuel lines. (a) Gas fuel lines must not pass through accommodation, service, or control spaces. Each gas fuel line passing...

  16. 29 CFR 780.154 - Delivery “to market.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Delivery âto market.â 780.154 Section 780.154 Labor... of Agriculture Specified Delivery Operations § 780.154 Delivery “to market.” The term “delivery * * * to market” includes taking agricultural or horticultural commodities, dairy products, livestock, bees...

  17. 46 CFR 154.300 - Segregation of hold spaces from other spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from other spaces. 154.300 Section 154.300 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.300 Segregation of hold spaces from other spaces. Hold spaces must be...

  18. 46 CFR 154.305 - Segregation of hold spaces from the sea.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from the sea. 154.305 Section 154.305 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.305 Segregation of hold spaces from the sea. In vessels having cargo...

  19. 37 CFR 1.54 - Parts of application to be filed together; filing receipt.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Parts of application to be filed together; filing receipt. 1.54 Section 1.54 Patents, Trademarks, and Copyrights UNITED STATES... Processing Provisions The Application § 1.54 Parts of application to be filed together; filing receipt. (a...

  20. M1 spin strength distribution in [sup 154]Sm

    Energy Technology Data Exchange (ETDEWEB)

    Sarriguren, P.; Guerra, E.M. de (Consejo Superior de Investigaciones Cientificas, Madrid (Spain). Inst. Estructura de la Materia); Nojarov, R.; Faessler, Amand (Tuebingen Univ. (Germany). Inst. fuer Theoretische Physik)

    1993-02-01

    The effect of the residual spin-spin interaction on the M1 spin-flip strength distribution in [sup 154]Sm is studied within the quasi-particle random phase approximation. The double-peaked structure found experimentally is reproduced. A new interpretation for the origin of the two peaks emerges from an analysis of our results. We identify these peaks as isoscalar and isovector and discuss previous theoretical interpretations. (Author).

  1. IL-15 prolongs CD154 expression on human CD4 T cells via STAT5 binding to the CD154 transcriptional promoter

    OpenAIRE

    Lowe, RM; Genin, A; Orgun, N; Cron, RQ

    2014-01-01

    Activation induced CD154 expression on CD4 T cells is prolonged in systemic lupus erythematosus but the mechanism(s) for its dysregulation are unknown. The studies reported herein demonstrate that IL-15 is capable of prolonging CD154 expression on PHA activated CD4 T cells. Since IL-15 signals through STAT5, predicted STAT5 binding sites in the human CD154 transcriptional promoter were identified, and STAT5 binding to the proximal CD154 promoter in vitro and in vivo following primary CD4 T ce...

  2. New neutron-rich isotope production in 154Sm+160Gd

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2016-09-01

    Full Text Available Deep inelastic scattering in 154Sm+160Gd at energies above the Bass barrier is for the first time investigated with two different microscopic dynamics approaches: improved quantum molecular dynamics (ImQMD model and time dependent Hartree–Fock (TDHF theory. No fusion is observed from both models. The capture pocket disappears for this reaction due to strong Coulomb repulsion and the contact time of the di-nuclear system formed in head-on collisions is about 700 fm/c at an incident energy of 440 MeV. The isotope distribution of fragments in the deep inelastic scattering process is predicted with the simulations of the latest ImQMD-v2.2 model together with a statistical code (GEMINI for describing the secondary decay of fragments. More than 40 extremely neutron-rich unmeasured nuclei with 58≤Z≤76 are observed and the production cross sections are at the order of μb to mb. The multi-nucleon transfer reaction of Sm+Gd could be an alternative way to synthesize new neutron-rich lanthanides which are difficult to be produced with traditional fusion reactions or fission of actinides.

  3. Coprecipitation experiment with Sm hydroxide using a multitracer produced by nuclear spallation reaction: A tool for chemical studies with superheavy elements.

    Science.gov (United States)

    Kasamatsu, Yoshitaka; Yokokita, Takuya; Toyomura, Keigo; Shigekawa, Yudai; Haba, Hiromitsu; Kanaya, Jumpei; Huang, Minghui; Ezaki, Yutaka; Yoshimura, Takashi; Morita, Kosuke; Shinohara, Atsushi

    2016-12-01

    To establish a new methodology for superheavy element chemistry, the coprecipitation behaviors of 34 elements with samarium hydroxide were investigated using multitracer produced by a spallation of Ta. The chemical reactions were rapidly equilibrated within 10s for many elements. In addition, these elements exhibited individual coprecipitation behaviors, and the behaviors were qualitatively related to their hydroxide precipitation behaviors. It was demonstrated that the ammine and hydroxide complex formations of superheavy elements could be investigated using the established method. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Identification and characterization of functional CD154 (CD40 ligand) in the Pekin duck.

    Science.gov (United States)

    Fischer, Karl P; Gares, Sheryl L; Wang, Dakun; Lorne Tyrrell, D; Gutfreund, Klaus S

    2007-01-01

    Binding of CD154, a member of the TNF ligand superfamily, to its receptor CD40 is essential for the development and regulation of adaptive immune responses in mammals. The duck CD154 (DuCD154) encoding gene was isolated from activated splenocytes using RT-PCR. Sequence analysis of the cloned DuCD154 gene revealed an open reading frame of 819 base pairs encoding a 272 amino acid protein. The extracellular domain of DuCD154 was identified and expressed for characterization and generation of antibodies. DuCD154 mRNA was predominantly expressed in spleen, thymus and duodenum. DuCD154 protein generated in cell culture was secreted and formed dimers. DuCD154 markedly enhanced proliferative responses in duck splenocytes when used alone or in conjunction with LPS or PHA. These observations suggest that DuCD154 has functional equivalence with mammalian CD154 and that the central role of CD154 as an immunoregulatory protein had already evolved before the divergence of birds and mammals.

  5. Reaction Automata

    OpenAIRE

    Okubo, Fumiya; Kobayashi, Satoshi; YOKOMORI, Takashi

    2011-01-01

    Reaction systems are a formal model that has been introduced to investigate the interactive behaviors of biochemical reactions. Based on the formal framework of reaction systems, we propose new computing models called reaction automata that feature (string) language acceptors with multiset manipulation as a computing mechanism, and show that reaction automata are computationally Turing universal. Further, some subclasses of reaction automata with space complexity are investigated and their la...

  6. Interaction of CD154 with different receptors and its role in bidirectional signals.

    Science.gov (United States)

    Alturaihi, Haydar; Hassan, Ghada S; Al-Zoobi, Loubna; Salti, Suzanne; Darif, Youssef; Yacoub, Daniel; El Akoum, Souhad; Oudghiri, Mounia; Merhi, Yahye; Mourad, Walid

    2015-02-01

    In addition to its classical receptor, CD40, it is now well established that CD154 also binds αIIbβ3, α5β1, and αMβ2 integrins. Although these integrins are all members of the same family, they bind CD154 differently. The current investigation aims to analyze the interaction of CD154 with α5β1 and αMβ2 and investigate its role in bidirectional signals in various human cell lines. Results obtained herein indicate that the CD154 residues involved in the interaction with α5β1 are N151 and Q166, whereas those involved in αMβ2 binding are common to residues required for CD40, namely Y145 and R203. Soluble CD40/CD154 or αMβ2/CD154 complexes do not interfere with the binding of CD154 to α5β1-positive cells, but inhibit the binding of CD154 to CD40- or αMβ2-positive cells, respectively. Ligation of CD154 on CD154-positive cells with soluble CD40, αIIbβ3, α5β1, or αMβ2 stimulates intracellular signaling, including MAPK phosphorylation. Given that CD154 exists as a trimer, our data strongly suggest that CD154 may bind concomitantly to two receptors of the same or different family, and biologically activate cells expressing both receptors. The characterization of CD154/receptor interactions helps the identification of new therapeutic targets for the prevention and/or treatment of CD154-associated autoimmune and inflammatory diseases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Phase Transitions above the Yrast Line in {sup 154}Dy

    Energy Technology Data Exchange (ETDEWEB)

    Ma, W. C. [Mississippi State University, Mississippi State, Mississippi 39762 (United States); Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid, (Spain); Khoo, T. L. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Egido, J. L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid, (Spain); Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Bhattacharyya, P. [Purdue University, West Lafayette, Indiana 47907 (United States); Carpenter, M. P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Daly, P. J. [Purdue University, West Lafayette, Indiana 47907 (United States); Grabowski, Z. W. [Purdue University, West Lafayette, Indiana 47907 (United States)] (and others)

    2000-06-26

    Spectra of the E2 quasicontinuum {gamma} rays feeding different spin regions of the {sup 154}Dy yrast line have been extracted. These are compared with corresponding theoretical spectra obtained by numerical simulations based on temperature-dependent Hartree-Fock theory, with thermal shape fluctuations. In this manner, different regions of the spin-energy plane can be examined. The results support the predictions of a smeared-out phase transition at high spin above the yrast line. (c) 2000 The American Physical Society.

  8. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    Science.gov (United States)

    Charafeddine, Ali H.; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A.; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by platelets obtained from normal individuals, and patients with two genetic defects that influence platelet granule development. Using these unique patient populations and immune-electron microscopy, we confirmed that CD154 was an alpha granule and not a cell surface protein, and thereafter optimized the methods for its in vivo measurement in humans. We then investigated plasma CD154 levels in kidney and liver transplant recipients and found no evidence that CD154 levels fluctuated systemically as a result of kidney or liver transplant procedures. Paradoxically, we found that kidney transplant patients had significantly lower systemic CD154 levels during episodes of rejection. These data suggest that the immune effects of CD154 are likely mediated through local and not systemic mechanisms, and discourage the use of CD154 as a peripheral biomarker in organ transplantation. PMID:22947105

  9. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  10. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  11. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  12. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  13. The role of CD154 in organ transplant rejection and acceptance.

    OpenAIRE

    Kirk, A. D.; Blair, P.J.; Tadaki, D K; Xu, H; Harlan, D. M.

    2001-01-01

    CD154 plays a critical role in determining the outcome of a transplanted organ. This simple statement is amply supported by experimental evidence demonstrating that anti-CD154 antibodies are potent inhibitors of allograft rejection in many rigorous transplant models. Unfortunately, despite intensive investigation over the past ten years, the precise mechanisms by which antibodies against CD154 exert their anti-rejection effects have remained less obvious. Though originally classified with ref...

  14. Cloning, sequence analysis and expression of ovine CD154 (CD40 ligand).

    Science.gov (United States)

    Oledzka, Gabriela; Li, Bo; William Kay, Graham; Chomicz, Lidia; Stankiewicz, Miroslaw

    2007-02-01

    The CD154 (CD40 ligand) molecule is a member of the tumor necrosis factor (TNF) family and plays an important role in the interaction between antigen-specific lymphocytes and antigen-presenting cells. In this study, reverse transcription-PCR cloning was used to derive the sequence encoding ovine CD154. Sequence analysis of the cloned CD154 gene showed a similarity of 97%, 89%, and 88% with the bovine, porcine and human sequences, respectively, at the nucleic acid level. The deduced amino acid sequence for the ovine CD154 shared 97%, 91%, and 87% similarity with the CD154 protein of bovine, porcine and human. The cysteine residues characteristic of the TNF family and N-linked glycosylation sites are conserved although one of the cysteine residues (Cys9) appeared only in ovine CD154. The isolated CD154 sequence was expressed as a mature protein in Chinese hamster ovary (CHO) cells. The analysis of expression of ovine CD154 in mammalian cells by Western blot confirmed the cross reactivity with anti-CD154 antibody.

  15. Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

    Directory of Open Access Journals (Sweden)

    Sujeong Yang

    2014-01-01

    Full Text Available Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie.

  16. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F

    2001-01-01

    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  17. Drug Reactions

    Science.gov (United States)

    ... or diabetes. But medicines can also cause unwanted reactions. One problem is interactions, which may occur between ... more serious. Drug allergies are another type of reaction. They can be mild or life-threatening. Skin ...

  18. Urticarial Reactions In Multi Transfused Patients In University Of ...

    African Journals Online (AJOL)

    Objectives: The study was aimed at determining the pattern of urticarial transfusion reactions (UTR) among patients who received multiple blood transfusions at the University of Maiduguri Teaching Hospital (UMTH) from 1997 2001. Materials and Methods: A total of 154 multi transfused patients who received transfusions ...

  19. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  20. Regiospecific synthesis of 15-(4-[{sup 123}I]iodophenyl)pentadecanoic acid-IPPA via methyl 15-(4-trimethylstannylphenyl)pentadecanoate

    Energy Technology Data Exchange (ETDEWEB)

    Culbert, P.A. [Glaxo Wellcome Inc., Mississauga, ON (Canada); Jianming Lu; Adam, M.J. [TRIUMF, Vancouver, BC (Canada)

    1997-06-01

    The synthesis of methyl 15-(4-trimethylstannylphenyl)pentadecanoate (p-SnPPA), a precursor for the regiospecific production of 15-(4-[{sup 123}I]-iodophenyl)pentadecanoic acid, is described. The stannylated precursor is synthesized in six steps from 4-bromophenylacetylene in an overall yield of 16%. p-SnPPA reacts with N.C.A. [{sup 123}I]NaI in the presence of peracetic acid to yield IPPA in 62% radiochemical yield following hydrolysis. (author).

  1. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  2. Cross sections of deuteron induced reactions on $^{nat}$Sm for production of the therapeutic radionuclide $^{145}$Sm and $^{153}$Sm

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2014-01-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them $^{145}$Sm and $^{153}$Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the $^{nat}$Sm(d,x)$^{145153}$Sm reactions were determined for deuteron energies up to 50 MeV using the stacked-foil technique and high-resolution $\\gamma$-ray spectrometry. The measured cross sections and the contributing reactions were analyzed by comparison with results of the ALICE, EMPIRE and TALYS nuclear reaction codes. A short overview and comparison of possible production routes is given.

  3. 46 CFR 154.650 - Cargo tank and process pressure vessel welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank and process pressure vessel welding. 154.650... Equipment Construction § 154.650 Cargo tank and process pressure vessel welding. (a) Cargo tank and process pressure vessel welding must meet Subpart 54.05 and Part 57 of this chapter. (b) Welding consumables used...

  4. 32 CFR 536.154 - Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management...

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management program (RIMP) claims. 536.154 Section 536.154 National... nonappropriated fund employees: NAFI risk management program (RIMP) claims. The risk management program (RIMP) is...

  5. Elevated serum levels of soluble CD154 in children with juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Zeft Andrew S

    2008-05-01

    Full Text Available Abstract Objective Cytokines play important roles in mediating inflammation in autoimmunity. Several cytokines are elevated in serum and synovial fluid samples from children with Juvenile Idiopathic Arthritis (JIA. Soluble CD154 (sCD154 is elevated in other autoimmune disorders, but has not been characterized in JIA. Our objectives were to determine if sCD154 is elevated in JIA, and to examine correlations between sCD154 and other inflammatory cytokines. Methods Serum from 77 children with JIA and 81 pediatric controls was analyzed for interleukin (IL1β, IL2, IL4, IL5, IL6, IL8, IL10, IL12, IL13, sCD154, interferon-γ (IFNγ, soluble IL2 receptor (sIL2R, and tumor necrosis factor-α (TNFα, using the Luminex Multi-Analyte Profiling system. Differences in levels of cytokines between cases and controls were analyzed. Logistic regression was also performed. Results sCD154 was significantly elevated in cases compared to controls (p Conclusion Serum levels of sCD154, IL1β, IL6, IL8, sIL2R and TNFα are elevated in most JIA subtypes, suggesting a major role for sCD154, and these cytokines and cytokine receptors in the pathogenesis of JIA.

  6. 46 CFR 154.1730 - Ethylene oxide: Loading and off loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide: Loading and off loading. 154.1730... Operating Requirements § 154.1730 Ethylene oxide: Loading and off loading. (a) The master shall ensure that before ethylene oxide is loaded into a cargo tank: (1) The tank is thoroughly clean, dry, and free of...

  7. 21 CFR 520.154b - Bacitracin methylene disalicylate and streptomycin sulfate powder.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin methylene disalicylate and streptomycin sulfate powder. 520.154b Section 520.154b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... bacterial enteritis caused by pathogens susceptible to bacitracin and streptomycin such as Escherichia coli...

  8. 7 CFR 1900.154 - Determining the need for special handling.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Determining the need for special handling. 1900.154 Section 1900.154 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... OF AGRICULTURE PROGRAM REGULATIONS GENERAL Processing and Servicing FmHA or Its Successor Agency...

  9. 46 CFR 154.701 - Cargo pressure and temperature control: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo pressure and temperature control: General. 154.701... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Cargo Pressure and Temperature Control § 154.701 Cargo pressure and temperature control: General...

  10. 46 CFR 154.1375 - Readout for temperature measuring device: Marking.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Readout for temperature measuring device: Marking. 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1375 Readout for temperature measuring device: Marking. Each...

  11. 17 CFR 230.154 - Delivery of prospectuses to investors at the same address.

    Science.gov (United States)

    2010-04-01

    ... investors at the same address. 230.154 Section 230.154 Commodity and Securities Exchanges SECURITIES AND... prospectuses to investors at the same address. (a) Delivery of a single prospectus. If you must deliver a... all of the following conditions are met: (1) The investor has the same last name as the other...

  12. The relationship between hepatic immunoglobulin production and CD154 expression in chronic liver diseases.

    Science.gov (United States)

    Mayo, Marlyn J; Mosby, James M; Jeyarajah, Rohan; Combes, Burton; Khilnani, Smina; Al-halimi, Maha; Handem, Iorna; Grammer, Amrie C; Lipsky, Peter E

    2006-03-01

    CD40-CD154 is a receptor-ligand pair that provides key communication signals between cells of the adaptive immune system in states of inflammation and autoimmunity. The CD40 receptor is expressed constitutively on B lymphocytes, for which it provides important signals regulating clonal expansion and antibody production. CD154 is a member of the tumor necrosis factor superfamily, which is primarily expressed by activated T cells. Because many chronic liver diseases are characterized by lymphocytic infiltration of the liver and several have increased immunoglobulin (Ig) production, the role of CD40-CD154 in hepatic Ig production was investigated in patients with primary biliary cirrhosis (PBC), primary sclerosing cholangitis, autoimmune hepatitis (AIH), hepatitis C, hepatitis B, alcoholic and non-alcoholic steatohepatitis, as well as normal controls. Soluble CD154 levels in the serum were found to be no different in chronic liver diseases vs normal controls. Likewise, CD154 mRNA levels in peripheral blood mononuclear cells did not differ. However, mRNA for CD154 was significantly increased in the liver of individuals with PBC and AIH as compared with the other groups. The quantity of CD154 mRNA in the liver correlated positively with the quantity of mRNA for secretory Ig. These findings suggest that CD40-CD154 signals may be involved in Ig production within the liver of autoimmune liver diseases.

  13. Acute Stress Reactions in Couples after a Burn Event to Their Young Child

    NARCIS (Netherlands)

    Bakker, A.; Van Loey, N.E.; Van der Heijden, P.G.M.|info:eu-repo/dai/nl/073087998; Van Son, M.J.M.|info:eu-repo/dai/nl/068440340

    2012-01-01

    Objective This multicenter study examines acute stress reactions in couples following a burn event to their preschool child. Methods Participants were 182 mothers and 154 fathers, including 143 couples, of 193 children (0–4 years) with acute burns. Parents’ self-reported acute stress reactions and

  14. Development of samarium [{sup 32}P] phosphate colloid for radiosynoviorthesis applications: Preparation, biological and preliminary clinical studies experience

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, G. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India)], E-mail: gantipk47@rediffmail.com; Sachdev, Satbir S.; Umamaheswari, S.; Sivaprasad, N.; Bhatia, Manohar H. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India); Chaudhari, Pradip R. [Laboratory Nuclear Medicine Services, BARC, Mumbai 400 012 (India); Solav, Srikant V. [Spect Lab, Nuclear Medicine Services, Opposite Dinanath Mangeshkar Hospital, Pune 411004 (India)

    2007-12-15

    A new therapeutic radio colloid for radiosynoviorthesis (RS) applications is reported. The method of preparation involves the reaction of SmCl{sub 3} carrier with carrier added [{sup 32}P]H{sub 3}PO{sub 4} in the presence of gelatin. The pure colloid was recovered by dialysis purification leading to radiochemical yield of around 90%. The radiochemical purity of the pure colloid formulated in isotonic saline was over 98%, for the usage period of 14 days, as assessed by paper chromatography. Ninety percent of colloid particles were in the size of 1-10 {mu}m as evident from the laser diffraction particle size analysis, ideally suitable for the intended end use. Animal studies revealed complete retention of the radio colloid in the rabbit knee joint. The results of clinical trials in humans are satisfactory and encouraging, satisfactory retention of the colloid in the knee joint and negligible leakage into the systemic circulation.

  15. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    Science.gov (United States)

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2010-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were correlated with proliferative alloresponses measured by CFSE-dye dilution (n=23), and CTLA4, a negative T-cell costimulator, which antagonizes CD154-mediated effects (n=31). In cross-sectional observations, logistic regression and leave-one-out cross-validation identified donor-specific, CD154+T-cytotoxic (Tc)-memory cells as best associated with rejection outcomes. In the longitudinal cohort, 1) the association between CD154+Tc-memory cells and rejection outcomes was replicated with sensitivity/specificity 92.3%/84.6% for observations at 1–60 days, and 2) elevated pre-LTx CD154+Tc-memory cell responses were associated with significantly increased incidence (p=0.02) and hazard (HR=7.355) of rejection in survival/proportional hazard analysis. CD154 expression correlated with proliferative alloresponses (r=0.835, p=7.1e-07), and inversely with CTLA4 expression of allospecific CD154+Tc-memory cells (r=−0.706, p=3.0e-05). Allospecific CD154+T-helper-memory cells, not CD154+Tc-memory, were inhibited by increasing Tacrolimus concentrations (p=0.026). Collectively, allospecific CD154+T-cells provide an estimate of rejection risk in children with LTx. PMID:18976293

  16. BRCA2 Mutations in 154 Finnish Male Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Kirsi Syrjäkoski

    2004-09-01

    Full Text Available The etiology and pathogenesis of male breast cancer (MBC are poorly known. This is due to the fact that the disease is rare, and large-scale genetic epidemiologic studies have been difficult to carry out. Here, we studied the frequency of eight recurrent Finnish BRCA2 founder mutations in a large cohort of 154 MBC patients (65% diagnosed in Finland from 1967 to 1996. Founder mutations were detected in 10 patients (6.5%, eight of whom carried the 9346(-2 A>G mutation. Two novel mutations (4075 delGT and 5808 del5 were discovered in a screening of the entire BRCA2 coding region in 34 samples. However, these mutations were not found in the rest of the 120 patients studied. Patients with positive family history of breast and/or ovarian cancer were often BRCA2 mutation carriers (44%, whereas those with no family history showed a low frequency of involvement (3.6%; P < .0001. Finally, we found only one Finnish MBC patient with 999 dell, the most common founder mutation in Finnish female breast cancer (FBC patients, and one that explains most of the hereditary FBC and MBC cases in Iceland. The variation in BRCA2 mutation spectrum between Finnish MBC patients and FBC patients in Finland and breast cancer patients in Iceland suggests that modifying genetic and environmental factors may significantly influence the penetrance of MBC and FBC in individuals carrying germline BRCA2 mutations in some populations.

  17. AGR-2 Data Qualification Report for ATR Cycle 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh Pham; Jeff Einerson

    2014-01-01

    This report provides the data qualification status of Advanced Gas Reactor-2 (AGR-2) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycle 154B as recorded in the Nuclear Data Management and Analysis System (NDMAS). This is the last cycle of AGR-2 irradiation, as the test train was pulled from the ATR core during the outage portion of ATR Cycle 155A. The AGR-2 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates including new Fission Product Monitoring (FPM) downstream flows from Fission Product Monitoring System (FPMS) detectors, pressure, and moisture content), and FPMS data (release rates and release-to-birth rate ratios [R/Bs]) for each of the six capsules in the AGR-2 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) comprised of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The Data Review Committee reviewed the data acquisition process, considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) data collection plans, examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  18. Polypropylene oil as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-03-01

    The research focusses on converting polypropylene oil as pyrolysis product of polypropylene plastic into an electricity. The converter was a direct liquid fuel-solid oxide fuel cell (SOFC) with cerium oxide based material as electrolyte. The polypropylene vapor flowed into fuel cell, in the anode side and undergo oxidation reaction, meanwhile, the Oxygen in atmosphere reduced into oxygen ion at cathode. The fuel cell test was conducted at 400 - 600 °C. According to GC-MS analysis, the polypropylene oil consist of C8 to C27 hydrocarbon chain. The XRD analysis result shows that Na2CO3 did not change the crystal structure of SDC even increases the electrical conductivity. The maximum power density is 0.079 mW.cm-2 at 773 K. The open circuite voltage is 0.77 volt. Chemical stability test by analysing the single cell at before and after fuel cell test found that ionic migration occured during fuel cell operation. It is supported by the change of elemental composition in the point position of electrolyte and at the electrolyte-electrode interface

  19. Lanthanide(III) complexes are more active inhibitors of the Fenton reaction than pure ligands.

    Science.gov (United States)

    Martin, Jan; Mladěnka, Přemysl; Saso, Luciano; Kostova, Irena

    2016-03-01

    This study is an extension to our finding of direct anti-oxidant activities of lanthanide(III) complexes with the heterocyclic compound, 5-aminoorotic acid (AOA). In this experiment, we used AOA and coumarin-3-carboxylic acid as the two heterocyclic compounds with anti-oxidant potential, to produce the complexes with different lanthanides. Lanthanide(III) complexes were tested on the iron-driven Fenton reaction. The product of this reaction, the hydroxyl radical, was detected by HPLC. All complexes as well as their ligands had positive or neutral effect on the Fenton reaction but their behavior was different. Both pure ligands in low concentration ratio to iron were inefficient in contrast to some of their complexes. Complexes of neodymium, samarium, gadolinium, and partly of cerium blocked the Fenton reaction at very low ratios (in relation to iron) but the effect disappeared at higher ratios. In contrast, lanthanum complexes appeared to be the most promising. Both blocked the Fenton reaction in a dose-dependent manner. Lanthanide(III) complexes were proven to block the iron-driven production of the hydroxyl radical. Second, the lanthanide(III) element appears to be crucial for the anti-oxidant effect. Overall, lanthanum complexes may be promising direct anti-oxidants for future testing.

  20. CD154-CD40 interactions in the control of murine B cell hematopoiesis

    Science.gov (United States)

    Carlring, Jennifer; Altaher, Hala M.; Clark, Susan; Chen, Xi; Latimer, Sarah L.; Jenner, Tracey; Buckle, Anne-Marie; Heath, Andrew W.

    2011-01-01

    Interactions between CD40 and CD154 play a very important role in control of immune responses, including the delivery of T cell help to B cells and other APCs. Thus far, there has been no role postulated for CD40-CD154 interactions in hematopoiesis. We show here that CD40 is expressed on murine pro-B cells and that its ligation enhances pro-B cell proliferation in vitro and in vivo. In addition, CD154 mRNA is present in the BM. Moreover, we show that a deficiency in CD154 expression has effects on B cell hematopoiesis. Aged, CD154-deficient mice have significantly lower levels of B hematopoietic subsets downstream of pro-B cells in the BM. In addition, B lineage cells reconstitute more slowly following BMT into CD154-deficient recipients. We hypothesize that CD154 is expressed by radio-resistant cells in the BM and plays a role in fine-tuning B cell hematopoiesis. PMID:21330346

  1. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation.

    Science.gov (United States)

    Villeneuve, Julien; Desmoulière, Alexis; Dewitte, Antoine; Bordeau, Nelly; Costet, Pierre; Bassaganyas, Laia; Fricain, Jean-Christophe; Ripoche, Jean; Lepreux, Sébastien

    2017-01-01

    Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  2. The role of platelets CD40 ligand (CD154) in acute coronary syndromes.

    Science.gov (United States)

    Abu el-Makrem, Mona A; Mahmoud, Yehia Z; Sayed, Douaa; Nassef, Noussa M; Abd el-Kader, Samir S; Zakhary, Madiha; Ghazaly, Taghreed; Matta, Ragaa

    2009-12-01

    Despite of the proof of the biological function of CD154 on platelets, there has been little information about its role either in patients with stable angina or in those with acute coronary syndrome (ACS). This study aimed to investigate the expression of CD154 on platelets and its role in ACS. The study included 50 patients with ACS (24 patients with acute myocardial infarction (AMI) and 26 patients with unstable angina (UA)), 20 patients with stable angina (SA) and 18 healthy volunteers. CD154 and CD62 expression on platelets were analyzed by flow cytometry. Their relations to the clinical and laboratory data were assessed in the studied group. Patients with AMI and UA had higher levels of platelets CD154 and CD62 as compared to those with SA and among patients with AMI, UA and SA versus healthy volunteers. Platelets CD154 showed significant positive correlations with the studied pro-inflammatory markers (Ox-LDL, CRP and fibrinogen), segmental wall motion score and the studied risk factors. There were significant negative correlations between platelet CD154 and serum nitric oxide among patients. CD154 may be used as a marker of thrombo-embolic events. Nitric oxide may have an anti-atherogenic effect. There is an association between platelet activation and severity of coronary artery disease among patients with ACS.

  3. CD40/CD154 blockade inhibits dendritic cell expression of inflammatory cytokines but not costimulatory molecules.

    Science.gov (United States)

    Ferrer, Ivana R; Liu, Danya; Pinelli, David F; Koehn, Brent H; Stempora, Linda L; Ford, Mandy L

    2012-11-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonism on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor Ag (OVA). Adoptive transfer of OVA-specific CD4(+) and CD8(+) T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c(+) DCs compared with untreated controls. However, DCs isolated from anti-CD154-treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of Ag-specific CD4(+) and CD8(+) T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival.

  4. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation

    Directory of Open Access Journals (Sweden)

    Julien Villeneuve

    2017-01-01

    Full Text Available Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  5. Patients with acute coronary syndromes express enhanced CD40 ligand/CD154 on platelets.

    Science.gov (United States)

    Garlichs, C D; Eskafi, S; Raaz, D; Schmidt, A; Ludwig, J; Herrmann, M; Klinghammer, L; Daniel, W G; Schmeisser, A

    2001-12-01

    To investigate whether CD40L/CD154 on platelets and soluble CD40L/CD154 may play a role in the inflammatory process of acute coronary syndromes. Observational study in a university hospital. 15 patients with acute myocardial infarction, 25 patients with unstable angina, 15 patients with stable angina, and 12 controls. CD40L/CD154 on platelets, P-selectin/CD62P on platelets, soluble CD40L/CD154 serum concentrations. Mean (SD) CD40L/CD154 expression on platelets was 6.2 (2.8) MFI (mean fluorescence intensity) in the infarct group, 11 (3.3) MFI in the unstable angina group (p angina group (p angina), and 3.2 (1.0) MFI in the controls (p angina; NS v stable angina). Soluble CD40L/CD154 concentration was 5.2 (1.1) ng/ml in the infarct group, 4.2 (0.7) ng/ml in the unstable angina group (p angina group (p angina), and 3.0 (0.5) ng/ml in the controls (p angina; NS v stable angina). At a six months follow up, there was lower expression of CD40L/CD154 on platelets in patients with unstable angina (12.3 (3.6) v 3.8 (1.2) MFI, p angina who needed redo coronary angioplasty (PTCA) or who had recurrence of angina were characterised by increased CD40L/CD154 expression on platelets compared with the remainder of the study group (recurrence of angina: 12.7 (3.2) v 9.7 (1.6) MFI, p angina and myocardial infarction. These findings suggest that CD40-CD40L/CD154 interactions may play a pathogenic role in triggering and propagation of acute coronary syndromes.

  6. 33 CFR 154.106 - Incorporation by reference: Where can I get a copy of the publications incorporated by reference...

    Science.gov (United States)

    2010-07-01

    ... approved for § 154.735. (2) NFPA 70, National Electrical Code, 2008, IBR approved for § 154.812. (h) Oil..., IBR approved for § 154.812. (f) National Electrical Manufacturers Association (NEMA), 1300 North 17th... the public. All approved material is available for inspection at the National Archives and Records...

  7. Interest of uranium complexes for the mechanism study of the McMurry reaction; Interet des complexes de l`uranium pour l`etude du mecanisme de la reaction de McMurry

    Energy Technology Data Exchange (ETDEWEB)

    Maury, O

    1997-07-04

    The reducing coupling reactions of ketones in diols and olefins are generally carried out with titanium or samarium compounds. In this work uranium complexes have been used. They have allowed to study the chemical reaction mechanism. This thesis is divided into three parts: 1) the reduction mechanism of uranium tetrachloride by cyclic voltametry has been studied at first. It has been shown that this reduction is followed by a transfer reaction of chlorides between the reduced specie of the higher electronic density and UCl . 2) In the second part is described: the synthesis, the crystal structure, the reactivity of the chemical agents, the stereochemistry of diols and alkenes formation and the pinacolisation reaction catalysis. 3) In the last part, the limits of the McMurry reaction are given by the study of the aromatic ketones pinacolisation reaction by-products. The obtained results show that the complexes of the metals which present a high reducing and oxo-philic (Ti, Sm, U..) character react in a similar way with the carbonyl compounds. If the uranium compounds are less used than those of the titanium in the field of the organic synthesis applications, they are precious auxiliaries and excellent models for reactions mechanisms study and for the synthesis methods optimization. (O.M.). 284 refs.

  8. CD154 is a negative regulator of autoaggressive CD8+ T cells in type 1 diabetes

    OpenAIRE

    McGregor, Catrin M.; Schoenberger, Stephen P.; Green, E. Allison

    2004-01-01

    TNF/CD80 mice, a CD8+ T cell-mediated model for type 1 diabetes, transgenically express tumor necrosis factor α (TNF-α) and the costimulatory molecule CD80 in their pancreatic islets. Here we show that these molecules bypass the need for CD40–CD154 costimulatory interactions in activation of CD8+ T cells, allowing us to determine the role of CD40–CD154 signals in regulation of autoaggressive CD8+ T cells after their in vivo priming. TNF/CD80 CD154-deficient mice rapidly develop diabetes, wher...

  9. Enfoque terapéutico en 154 pacientes con acromegalia

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.

  10. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Science.gov (United States)

    2010-01-01

    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  11. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Science.gov (United States)

    Alaaeddine, Nada; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2) for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed. PMID:22110533

  12. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Nada Alaaeddine

    2012-01-01

    Full Text Available Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2 for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed.

  13. Detection of Foreign Antigen-specific CD4+Foxp3+ Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining

    Science.gov (United States)

    Choi, Jin Young

    2013-01-01

    The unrestricted population of CD4+Foxp3+ regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4+Foxp3+ Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4+Foxp3+ Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4+ T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4+ T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4+Foxp3+ Tregs using Foxp3GFP knock-in mouse, and found that LCMV GP66-77-specific CD4+Foxp3+ Tregs and polyclonal CD4+Foxp3+ Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4+Foxp3+ Treg in various models. PMID:24385945

  14. Detection of Foreign Antigen-specific CD4(+)Foxp3(+) Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining.

    Science.gov (United States)

    Choi, Jin Young; Eo, Seong Kug

    2013-12-01

    The unrestricted population of CD4(+)Foxp3(+) regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4(+)Foxp3(+) Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4(+)Foxp3(+) Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4(+) T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4(+) T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs using Foxp3(GFP) knock-in mouse, and found that LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs and polyclonal CD4(+)Foxp3(+) Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4(+)Foxp3(+) Treg in various models.

  15. Abnormal CD40 Ligand (CD154) Expression in Human Immunodeficiency Virus-Infected Children

    Science.gov (United States)

    O'Gorman, Maurice R. G.; DuChateau, Brian; Paniagua, Mary; Hunt, Janelle; Bensen, Nicolas; Yogev, Ram

    2001-01-01

    The CD40 ligand (CD154), expressed primarily on activated CD4-positive T cells, is a costimulatory molecule involved in B-cell proliferation, germinal center formation, and immunoglobulin class switching. Since B-cell abnormalities including hypergammaglobulinemia and abnormal antibody-specific immune responses are prominent and occur early during the course of pediatric human immunodeficiency virus (HIV) infection, we measured the baseline levels and the induced levels of expression of CD154 on CD3+ CD8− (T helper cells) in HIV-infected children and uninfected children born to HIV-positive mothers. The percentage of CD154+ T helper cells activated in vitro and the level of CD154 expressed per T helper cell (mean fluorescent channel [MFC]) were significantly lower in the HIV-infected children than in the uninfected control group (77% ± 3% versus 89% ± 1%, respectively [P CD154 expressed on resting T helper cells in the HIV-infected group were not significantly different from the levels observed in the control group. In the HIV-infected children, the level of CD154 on activated T helper cells correlated with the level of immunodeficiency, as assessed by the CD4 T-cell levels (correlation coefficient [r] = 0.707, P = 0.003), but did not correlate with the viral load or with any of the serum immunoglobulin concentrations measured in this group of HIV-infected children. The baseline level of CD154 expressed on T helper cells did, however, correlate with the concentration of immunoglobulin A in serum. We conclude that HIV-infected children have impaired regulation of CD154 expression which may contribute to the immune dysregulation commonly observed. PMID:11687447

  16. The CD40-CD154 co-stimulation pathway mediates innate immune injury in adriamycin nephrosis.

    Science.gov (United States)

    Lee, Vincent W S; Qin, Xiaohong; Wang, Yiping; Zheng, Guoping; Wang, Ya; Wang, Ying; Ince, Jon; Tan, Thian K; Kairaitis, Lukas K; Alexander, Stephen I; Harris, David C H

    2010-03-01

    Blockade of CD40-CD40 ligand (CD154) interactions protects against renal injury in adriamycin nephropathy (AN) in immunocompetent mice. To investigate whether this protection relied on adaptive or cognate immunity, we tested the effect of CD40-CD154 blockade in severe combined immunodeficient (SCID) mice. SCID mice were divided into three groups: normal, AN + hamster IgG (ADR+IgG group) and AN + anti-CD154 antibody (MR1) (ADR+MR1 group). AN was induced by tail vein injection of 5.2 mg/kg of adriamycin (ADR). Hamster IgG (control Ab) or MR1 was administered intraperitoneally on days 5, 7, 9 and 11 after ADR injection. Histological and functional data were collected 4 weeks after ADR injection. In vitro experiments tested the effect of soluble and cell-bound CD154 co-cultured with CD40-expressing cells [macrophages, mesangial cells and renal tubular epithelial cells (RTEC)]. All experimental animals developed nephropathy. Compared to the ADR+IgG group, ADR+MR1 animals had significantly less histological injury (glomerulosclerosis and tubular atrophy) and functional injury (creatinine clearance). Kidneys of ADR+MR1 animals had significantly less macrophage infiltration than those of ADR+IgG animals. Interestingly, expression of CD40 and CD41 (a platelet-specific marker) was significantly less in ADR+MR1 animals compared to ADR+IgG animals. In vitro, CD154 blockade significantly attenuated upregulation of CCL2 gene expression by RTEC stimulated by activated macrophage-conditioned medium. In contrast, platelet-induced upregulation of macrophage and mesangial cell proinflammatory cytokine gene expression were not CD154-dependent. CD40-CD154 blockade has a significant innate renoprotective effect in ADR nephrosis. This is potentially due to inhibition of macrophage-derived soluble CD154.

  17. Deficiencies in the CD40 and CD154 receptor-ligand system reduce experimental lung metastasis.

    Science.gov (United States)

    Ingersoll, Susan Blaydes; Langer, Florian; Walker, Jamie M; Meyer, Todd; Robson, Theresa; Amaya, Mildred; Desai, Hina; Francis, John L; Amirkhosravi, Ali

    2009-01-01

    It is established that experimental metastasis requires platelet activity. CD154 expressed on and released from activated platelets induces an inflammatory response in endothelial cells and monocytes, including tissue factor production. CD154 has also been shown to activate platelets in vitro and promote thrombus stability in vivo. These CD154 effects may be mediated, at least in part, by CD40 signaling on platelets and vascular endothelial cells. We have previously demonstrated prolonged bleeding and PFA-100 closure times in mice deficient for Cd154 or its receptor Cd40. In the present study, we hypothesized that Cd40 and Cd154 promote lung tumor formation in experimental metastasis in mice. We created mice doubly deficient in Cd40 and Cd154 (Dbl KO) and found them to be both fertile and viable. Injected tumor cells seeded poorly in mice deficient in Cd40 or Cd154, as well as Dbl KO, compared to wild-type mice. We sought to determine whether blood-borne Cd40 versus endothelial Cd40 contribute differentially to reduced experimental lung metastasis, as observed in Cd40 deficient mice. By bone marrow transplantation, we created mice deficient for Cd40 either in the blood compartment but not in the endothelium, or vice versa. We found that mice deficient in blood compartment Cd40 had fewer lung nodules compared to wild-type mice and mice deficient in endothelial Cd40. Our findings suggest an important contribution of the Cd40-Cd154 pathway to experimental lung metastasis. Furthermore, the data points to a selective role for peripheral blood cell Cd40 in this process.

  18. Cross sections of deuteron induced reactions on (nat)Sm for production of the therapeutic radionuclide ¹⁴⁵Sm and ¹⁵³Sm.

    Science.gov (United States)

    Tárkányi, F; Hermanne, A; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2014-09-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them (145)Sm and (153)Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the (nat)Sm(d,x)(145,153)Sm reactions were determined for deuteron energies up to 50 MeV using the stacked-foil technique and high-resolution γ-ray spectrometry. The measured cross sections and the contributing reactions were analyzed by comparison with results of the ALICE, EMPIRE and TALYS nuclear reaction codes. A short overview and comparison of possible production routes is given. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  20. cycloaddition reactions

    Indian Academy of Sciences (India)

    Unknown

    models of regioselectivity in pericyclic reactions. In addition, local hard and soft acid base (HSAB) princi- ples have been also employed to predict the observed regioselectivity.2 In recent years, the conceptual density functional theory has been remarkably successful in explaining the reactivity and site selectivity.3 The.

  1. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states

    Science.gov (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui

    2017-12-01

    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  2. Particle-γ coincidence spectroscopy of the N = 90 nucleus {sup 154}Gd by (p, tγ)

    Energy Technology Data Exchange (ETDEWEB)

    Allmond, J.M. [Oak Ridge National Laboratory, Physics Division, Oak Ridge, TN (United States); University of Richmond, Department of Physics, Richmond, VA (United States); Beausang, C.W.; Ross, T.J.; Brooks, W.; Darakchieva, B.K. [University of Richmond, Department of Physics, Richmond, VA (United States); Humby, P. [University of Richmond, Department of Physics, Richmond, VA (United States); University of Surrey, Department of Physics, Guildford, Surrey (United Kingdom); Basunia, M.S.; Fallon, P.; Jeppesen, H.B.; McMahan, M.A.; Phair, L.; Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bernstein, L.A. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Bleuel, D.L.; Burke, J.T.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Brown, N. [Georgia Institute of Technology, School of Physics, Atlanta, GA (United States); Dudziak, K.R.; LeBlanc, J.D.; Meyer, D.A. [Rhodes College, Department of Physics, Memphis, TN (United States); Evans, K.E. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Lesher, S.R. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of Wisconsin-La Crosse, Department of Physics, La Crosse, WI (United States); Stroberg, S.R. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); TRIUMF, Vancouver, British Columbia (Canada); Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, CA (United States); iThemba LABS, Department of Nuclear Physics, P.O. Box 722, Somerset West (South Africa)

    2017-03-15

    A segmented Si-telescope and HPGe array, STARS-LIBERACE, was used to study the {sup 156}Gd(p, tγ){sup 154}Gd direct reaction by particle-γ coincidence spectroscopy. New cross sections with a 25MeV proton beam are reported and compared to previous (p, t) and (t, p) studies. Furthermore, additional evidence for coexisting K{sup π} = 0{sub 1}{sup +}, 2{sub 1}{sup +} and 0{sub 2}{sup +}, 2{sub 2}{sup +} configurations at N = 90 is presented. Direct and indirect population patterns of the low-lying states are also explored. Review of the new and existing evidence favors an interpretation based on a configuration-dependent pairing interaction. The weakening of monopole pairing strength and an increase in quadrupole pairing strength could bring 2p-2h 0{sup +} states below 2Δ. This may account for a large number of the low-lying 0{sup +} states observed in two-nucleon transfer reactions. A hypothesis for the origin of the 0{sub 2}{sup +} and 0{sub 3}{sup +} states is provided. (orig.)

  3. A catalyst-free addition reaction of zinc amide enolates to N-sulfonyle imines

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Seong Ryu; Im, Pyeong Won; Kim, Jong Sung; Kim, Seung Hoi [Dept. of Chemistry, Dankook University, Cheonan (Korea, Republic of); Park Soo Youl [Interface Chemistry and Engineering Research Team, Korea Research Institute of Chemical Technology, Daejon (Korea, Republic of)

    2016-12-15

    Despite the remarkable expansion of the imino-Reformatsky reaction, one interesting aspect is that, to the best of our knowledge, zinc enolates derived solely from α-halo esters have been mainly used in the recent progress. In contrast, a few limited examples have been reported concerning the application of zinc enolates derived from α-halo amide to the imino-Reformatsky reaction. In recent years, Rodriguez-Solla and co-workers reported the addition reaction of samarium enolates derived from both α-halo esters and amides to imines, resulting in the synthe- sis of β-amino esters or amides. In conclusion, we established a potential synthetic proto- col for the preparation of β-amino amides. This work was accomplished by the direct addition of zinc amide enolates to N-sulfonyl imines in the absence of any metal-catalyst under mild conditions. Due to the operational simplicity of the proposed method, it can be further utilized in synthetic organic chemistry. Further studies to elucidate the scope of this approach are currently underway in our laboratory.

  4. [Effect of ICOS signaling on CD154/CD40 expressions in mice infected with Schistosoma japonicum].

    Science.gov (United States)

    Wang, Yu; Cai, Ru; Xia, Chao-ming

    2015-08-01

    To explore the effect of ICOS signaling on the CD154/CD40 expressions and immunopathology in mice infected with Schistosoma japonicum. ICOS transgenic (ICOS-Tg) mice and wildtype FVB/NJ mice were used as experimental schistosomiasis models. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of the liver in the mice infected with S. japonicuin were detected by flow cytometry and im- munohistochemical staining. HE staining was applied to observe the changes on the granulomatous of the mice liver. Compared with the wildtype FVB/NJ mice, the expressions of CD154 on CD4 T splenocytes and of CD40 on CD19' B splenocytes in the ICOS-Tg mice significantly increased in 12 and 16 weeks post-infection (all P CD154 on inflammatory cells around granulomatous infiltration in the liver of the ICOS-Tg mice were significantly higher than those of the wildtype FVB/NJ mice in 7, 12, 16 and 20 weeks post-infection (all P CD154/CD40 expressions, and may play an important role in the hepatic egg granuloma formation of schistosomiasis.

  5. 46 CFR 154.540 - Quick-closing shut-off valves: Emergency shut-down system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Quick-closing shut-off valves: Emergency shut-down... shut-down system. The quick-closing shut-off valves under §§ 154.530, 154.532, and 154.538 must have an emergency shut-down system that: (a) Closes all the valves; (b) Is actuated by a single control in at least...

  6. Novel insights into anti-CD40/CD154 immunotherapy in transplant tolerance.

    Science.gov (United States)

    Pinelli, David F; Ford, Mandy L

    2015-01-01

    Since the discovery of the CD40-CD154 costimulatory pathway and its critical role in the adaptive immune response, there has been considerable interest in therapeutically targeting this interaction with monoclonal antibodies in transplantation. Unfortunately, initial promise in animal models gave way to disappointment in clinical trials following a number of thromboembolic complications. However, recent mechanistic studies have identified the mechanism of these adverse events, as well as detailed a myriad of interactions between CD40 and CD154 on a wide variety of immune cell types and the critical role of this pathway in generating both humoral and cell-mediated alloreactive responses. This has led to resurgence in interest and the potential resurrection of anti-CD154 and anti-CD40 antibodies as clinically viable therapeutic options.

  7. A hydrophobic patch surrounding Trp154 in human neuroserpin controls the helix F dynamics with implications in inhibition and aggregation

    Science.gov (United States)

    Ali, Mohammad Farhan; Kaushik, Abhinav; Kapil, Charu; Gupta, Dinesh; Jairajpuri, Mohamad Aman

    2017-02-01

    Neuroserpin (NS) mediated inhibition of tissue-type plasminogen activator (tPA) is important for brain development, synapse formation and memory. Aberrations in helix F and β-sheet A movement during inhibition can directly lead to epilepsy or dementia. Conserved W154 residue in a hydrophobic patch between helix F and β-sheet A is ideally placed to control their movement during inhibition. Molecular Dynamics (MD) simulation on wild type (WT) NS and its two variants (W154A and W154P) demonstrated partial deformation in helix F and conformational differences in strands 1A and 2A only in W154P. A fluorescence and Circular Dichroism (CD) analysis with purified W154 variants revealed a significant red-shift and an increase in α-helical content in W154P as compared to W154A and WT NS. Kinetics of tPA inhibition showed a decline in association rates (ka) for W154A as compared to WT NS with indication of complex formation. Appearance of cleaved without complex formation in W154P indicates that the variant acts as substrate due to conformational misfolding around helix F. Both the variants however showed increased rate of aggregation as compared to WT NS. The hydrophobic patch identified in this study may have importance in helix F dynamics of NS.

  8. Barrier distribution from 28Si+154Sm quasielastic scattering: Coupling effects in the fusion process

    Directory of Open Access Journals (Sweden)

    Kaur Gurpreet

    2016-01-01

    Full Text Available Barrier distribution for the 28Si+154Sm system has been extracted from large angle quasielastic scattering measurement to investigate the role of various channel couplings on fusion dynamics. The coupled channel calculations, including the collective excitation of the target and projectile, are observed to reproduce the experimental BD rather well. It seems that the role of neutron transfer, relative to collective excitation, is in fact weak in the 28Si+154Sm system even though it has positive Q-value for neutron transfer channels.

  9. Spallation reactions; Reactions de spallation

    Energy Technology Data Exchange (ETDEWEB)

    Cugon, J.

    1996-12-31

    Spallation reactions dominate the interactions of hadrons with nuclei in the GeV range (from {approx} 0.1 to {approx} 10 GeV). They correspond to a sometimes important ejection of light particles leaving most of the time a residue of mass commensurate with the target mass. The main features of the experimental data are briefly reviewed. The most successful theoretical model, namely the intranuclear cascade + evaporation model, is presented. Its physical content, results and possible improvements are critically discussed. Alternative approaches are shortly reviewed. (author). 84 refs.

  10. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand expression in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Chien-Hsueh Tung

    Full Text Available CD154 (commonly referred to as CD40-ligand is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA. TNF-α blockade treatment had dramatic efficacy in RA.To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA.Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points.The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001. The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221. Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187.TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  11. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand) expression in rheumatoid arthritis.

    Science.gov (United States)

    Tung, Chien-Hsueh; Lu, Ming-Chi; Lai, Ning-Sheng; Wu, Shu-Fen

    2017-01-01

    CD154 (commonly referred to as CD40-ligand) is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA). TNF-α blockade treatment had dramatic efficacy in RA. To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA. Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points. The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001). The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221). Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187). TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  12. S-glutathionylation of glyceraldehyde-3-phosphate dehydrogenase induces formation of C150-C154 intrasubunit disulfide bond in the active site of the enzyme.

    Science.gov (United States)

    Barinova, K V; Serebryakova, M V; Muronetz, V I; Schmalhausen, E V

    2017-12-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic protein involved in numerous non-glycolytic functions. S-glutathionylated GAPDH was revealed in plant and animal tissues. The role of GAPDH S-glutathionylation is not fully understood. Rabbit muscle GAPDH was S-glutathionylated in the presence of H 2 O 2 and reduced glutathione (GSH). The modified protein was assayed by MALDI-MS analysis, differential scanning calorimetry, dynamic light scattering, and ultracentrifugation. Incubation of GAPDH in the presence of H 2 O 2 together with GSH resulted in the complete inactivation of the enzyme. In contrast to irreversible oxidation of GAPDH by H 2 O 2 , this modification could be reversed in the excess of GSH or dithiothreitol. By data of MALDI-MS analysis, the modified protein contained both mixed disulfide between Cys150 and GSH and the intrasubunit disulfide bond between Cys150 and Cys154 (different subunits of tetrameric GAPDH may contain different products). S-glutathionylation results in loosening of the tertiary structure of GAPDH, decreases its affinity to NAD + and thermal stability. The mixed disulfide between Cys150 and GSH is an intermediate product of S-glutathionylation: its subsequent reaction with Cys154 results in the intrasubunit disulfide bond in the active site of GAPDH. The mixed disulfide and the C150-C154 disulfide bond protect GAPDH from irreversible oxidation and can be reduced in the excess of thiols. Conformational changes that were observed in S-glutathionylated GAPDH may affect interactions between GAPDH and other proteins (ligands), suggesting the role of S-glutathionylation in the redox signaling. The manuscript considers one of the possible mechanisms of redox regulation of cell functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A microscopic study of deformation systematics in 154− 166Dy ...

    Indian Academy of Sciences (India)

    The Hartree–Bogoliubov (HB) framework of calculations has been applied for calculating various nuclear structure quantities for 154−166Dy mass chains. In this framework, the intrinsic quadrupole moments, the low-lying yrast states ( E 2 + and E 4 + ) and occupation numbers for various shell model orbits have been ...

  14. Dual function of the hemagglutinin H5 fused to chicken CD154 in a ...

    African Journals Online (AJOL)

    Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study. AG Pose, ES Rodriguez, AC Mendez, JN Gomez, AV Redondo, ER Rodriguez, EMG Ramos, AA Gutierrez, MPR Molto, DG Roche, YS Ugalde, AM Lopez ...

  15. 40 CFR 154.5 - Burden of persuasion in determinations under this part.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Burden of persuasion in determinations... (CONTINUED) PESTICIDE PROGRAMS SPECIAL REVIEW PROCEDURES General Provisions § 154.5 Burden of persuasion in... principle that the burden of persuasion that a pesticide product is entitled to registration or continued...

  16. A microscopic study of deformation systematics in 154−166Dy ...

    Indian Academy of Sciences (India)

    A microscopic study of deformation systematics in 154−166Dy isotopes. AMITA DUA, ARUN BHARTI. ∗ and S K KHOSA. Department of Physics, University of Jammu, Jammu & Kashmir 180 006, India. ∗. Corresponding Author. E-mail: arunbharti 2003@yahoo.co.in. MS received 30 March 2006; revised 9 March 2007; ...

  17. 5 CFR 1201.154 - Time for filing appeal; closing record in cases involving grievance decisions.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Time for filing appeal; closing record in... Allegations of Discrimination § 1201.154 Time for filing appeal; closing record in cases involving grievance... matter otherwise appealable to the Board must comply with the following time limits: (a) Where the...

  18. 32 CFR Appendix C to Part 154 - Tables for Requesting Investigations

    Science.gov (United States)

    2010-07-01

    ... the Award Forces Before appointment (after appointment for health professionals, chaplains, and attorneys, under conditions authorized by § 154.15(d) of this part). Naval Academy Midshipman, Military Academy Cadet, or Air Force Academy Cadet Enrollment To be initiated 90 days after entry. Reserve Officer...

  19. Characterization of human papillomavirus type 154 and tissue tropism of gammapapillomaviruses.

    Science.gov (United States)

    Ure, Agustín Enrique; Forslund, Ola

    2014-01-01

    The novel human papillomavirus type 154 (HPV154) was characterized from a wart on the crena ani of a three-year-old boy. It was previously designated as the putative HPV type FADI3 by sequencing of a subgenomic FAP amplicon. We obtained the complete genome by combined methods including rolling circle amplification (RCA), genome walking through an adapted method for detection of integrated papillomavirus sequences by ligation-mediated PCR (DIPS-PCR), long-range PCR, and finally by cloning of four overlapping amplicons. Phylogenetically, the HPV154 genome clustered together with members of the proposed species Gammapapillomavirus 11, and demonstrated the highest identity in L1 to HPV136 (68.6%). The HPV154 was detected in 3% (2/62) of forehead skin swabs from healthy children. In addition, the different detection sites of 62 gammapapillomaviruses were summarized in order to analyze their tissue tropism. Several of these HPV types have been detected from multiple sources such as skin, oral, nasal, and genital sites, suggesting that the gammapapillomaviruses are generalists with a broader tissue tropism than previously appreciated. The study expands current knowledge concerning genetic diversity and tropism among HPV types in the rapidly growing gammapapillomavirus genus.

  20. 33 CFR Appendix B to Part 154 - Standard Specification for Tank Vent Flame Arresters

    Science.gov (United States)

    2010-07-01

    ... be qualified in accordance with section IX of the ASME Code. 8.7The design of flame arresters shall... section VIII, Division 1, Pressure Vessels; section IX, Welding and Brazing Qualifications. 3.3... 1155 (incorporated by reference, see § 154.106), or section VIII, Division 1 of the ASME Boiler and...

  1. 32 CFR 154.8 - Types and scope of personnel security investigations.

    Science.gov (United States)

    2010-07-01

    ... in § 154.19(a) and other national directives, certain categories of duties, clearance, and access... Manager, S-2, Counterintelligence Specialist, Personnel Security Specialist, or Personnel Officer); or... “Personal Interview Conducted by (cite the duty assignment of the designated official (e.g., Commander...

  2. THE ANGULAR-MOMENTUM DEPENDENCE OF THE GIANT-DIPOLE RESONANCE IN DY-154

    NARCIS (Netherlands)

    NOORMAN, RF; BACELAR, JC; HARAKEH, MN; HESSELINK, WHA; HOFMANN, HJ; Kalantar-Nayestanaki, Nasser; VANSCHAGEN, JPS; STOLK, A; SUJKOWSKI, Z; DEVOIGT, MJA; VANDERWOUDE, A

    1994-01-01

    The statistical gamma-ray decay of the compound nucleus 154Dy* formed at an excitation energy of 69 MeV is studied in three angular-momentum windows [J] = 31,42 and 50h. The GDR strength function extracted from the data indicates a constant centroid energy for the resonance E(GDR) = 15.2 +/- 0.5

  3. CD154 Blockade Results in Transient Reduction in Theiler's Murine Encephalomyelitis Virus-Induced Demyelinating Disease

    OpenAIRE

    Howard, Laurence M.; Neville, Katherine L.; Haynes, Lia M.; Dal Canto, Mauro C.; Miller, Stephen D

    2003-01-01

    Transient CD154 blockade at the onset of Theiler's murine encephalomyelitis virus-induced demyelinating disease ameliorated disease progression for 80 days, reduced immune cell infiltration, and transiently increased viral loads in the central nervous system. Peripheral antiviral and autoimmune T-cell responses were normal, and disease severity returned to control levels by day 120.

  4. IL-2 and IL-15 regulate CD154 expression on activated CD4 T cells

    DEFF Research Database (Denmark)

    Skov, S; Bonyhadi, M; Odum, Niels

    2000-01-01

    activated CD4 T cells could respond to IL-2, or the related cytokine IL-15, by de novo CD154 production and expression without requiring an additional signal from CD3 and CD28. These results provide evidence that CD28 costimulation of CD4 T cells, through autocrine IL-2 production, maintains high levels...

  5. 38 CFR 17.154 - Dog-guides and equipment for blind.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Dog-guides and equipment... AFFAIRS MEDICAL Prosthetic, Sensory, and Rehabilitative Aids § 17.154 Dog-guides and equipment for blind... disability may be furnished a trained dog-guide. In addition, they may be furnished necessary travel expense...

  6. 32 CFR 154.35 - Personal data provided by the subject of the investigation.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Personal data provided by the subject of the... Investigations § 154.35 Personal data provided by the subject of the investigation. (a) To conduct the required investigation, it is necessary that the investigative agency be provided certain relevant data concerning the...

  7. 18 CFR 154.208 - Service of tariff filings on customers and other parties.

    Science.gov (United States)

    2010-04-01

    ... SCHEDULES AND TARIFFS Procedures for Changing Tariffs § 154.208 Service of tariff filings on customers and... customers and state regulatory commissions that have made a standing request for such service. (c) Within... section, service upon the designated recipient will be deemed service upon the customer or other party. (e...

  8. 30 CFR 250.154 - What identification signs must I display?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What identification signs must I display? 250... Facilities and Wells (does Not Include Modus) § 250.154 What identification signs must I display? (a) You... maintained in a legible condition. (1) You must display an identification sign that can be viewed from the...

  9. CD154 induces p73 to overcome the resistance to apoptosis of chronic lymphocytic leukemia cells lacking functional p53

    NARCIS (Netherlands)

    Dicker, Frank; Kater, Arnon P.; Prada, Carlos E.; Fukuda, Tetsuya; Castro, Januario E.; Sun, Guizhen; Wang, Jean Y.; Kipps, Thomas J.

    2006-01-01

    Intravenous infusion of autologous chronic lymphocytic leukemia (CLL) cells transduced with an adenovirus encoding CD40-ligand (CD154) caused rapid reductions in leukemia-cell counts and lymphnode size. We hypothesized that CD40-ligation via CD154 sensitized CLL cells to death-receptor-mediated

  10. 27 CFR 31.154 - Records to be kept by alcohol beverage producers, processors, and bonded warehousemen.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Records to be kept by alcohol beverage producers, processors, and bonded warehousemen. 31.154 Section 31.154 Alcohol, Tobacco... alcohol beverage producers, processors, and bonded warehousemen. Wholesale liquor dealer operations...

  11. 33 CFR 154.T150 - Temporary suspension of requirements to permit support of deepwater horizon spill response.

    Science.gov (United States)

    2010-07-01

    ... requirements to permit support of deepwater horizon spill response. 154.T150 Section 154.T150 Navigation and... support of deepwater horizon spill response. (a) Applicability. This section applies to— (1) Any facility... support of the response to the Deepwater Horizon Spill of National Significance; and (2) Any facility...

  12. 17 CFR 1.54 - Contract market rules submitted to and approved or not disapproved by the Secretary of Agriculture.

    Science.gov (United States)

    2010-04-01

    ... submitted to and approved or not disapproved by the Secretary of Agriculture. 1.54 Section 1.54 Commodity... Secretary of Agriculture. Notwithstanding any provision of these rules, any bylaw, rule, regulation, or resolution of a contract market that was submitted to the Secretary of Agriculture pursuant or § 1.38(a) or...

  13. A polymorphic CD40 ligand (CD154) molecule mediates CD40‐dependent signalling but interferes with the ability of soluble CD40 to functionally block CD154 : CD40 interactions

    Science.gov (United States)

    Barnhart, B; Ford, G S; Bhushan, A; Song, C; Covey, L R

    2000-01-01

    We report the characterization of a naturally occurring polymorphism in CD40 ligand (CD40L, CD154) expressed by activated T cells from a young female patient. This polymorphism encodes a nonconservative Gly → Arg substitution in amino acid 219 in the extracellular, CD40 binding domain of the molecule. Studies carried out with 293 epithelial cells ectopically expressing the polymorphic protein (CD154/G219R) revealed reduced levels of binding to different anti‐CD154 monoclonal antibodies (mAb) and CD40‐immunoglobulin (CD40‐Ig). However, recognition of the polymorphic and wild‐type CD154 molecules by a polyclonal antiserum was comparable, suggesting that the polymorphism affects the ability of the protein to interact with CD40 but does not significantly alter its surface expression. To determine if reduced cross‐linking of CD40 mediated decreased functional effects, three CD40‐dependent properties were measured. We found that pathways leading to the induction of surface CD23, CD80, and Iγ transcription were activated in response to CD154/G219R signalling. However, the decrease in affinity for CD40 by the mutated CD154 affected the ability of CD40‐Ig to efficiently interfere with the binding and effectively block induced CD80 expression. In contrast, we found that the 5c8 mAb, which recognized the polymorphic molecule to a similar extent as wild‐type CD154, effectively blocked the interaction between CD154/G219R and CD40 as measured by CD80 expression. These findings suggest that naturally occurring polymorphisms in the CD154 molecule may affect the ability of CD40‐mediated functions to be blocked by soluble CD40 or anti‐CD154 mAb in the therapeutic treatment of disease and graft rejection. PMID:10651941

  14. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)

    1999-10-01

    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  15. Activation cross-sections of deuteron induced reactions on (nat)Gd up to 50 MeV.

    Science.gov (United States)

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Hermanne, A; Ignatyuk, A V

    2014-01-01

    Activation cross-sections are presented for the first time for (nat)Gd(d,xn)(161,160,156(m+)), (154,154m1,154m2,153,152(m+),151(m+))Tb, (nat)Gd(d,x)(159,153,151)Gd and (nat)Gd(d,x)(156)Eu reactions from their respective thresholds up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and by using high resolution γ-ray spectrometry. The measured values were compared with the results of theoretical models calculated by the computer codes ALICE-D, EMPIRE-D and TALYS (data from TENDL library). Integral yields of the reaction products were deduced from the excitation functions. © 2013 Published by Elsevier Ltd.

  16. Activation cross-sections of deuteron induced reactions on natGd up to 50 MeV

    CERN Document Server

    Tárkányi, F; Ditrói, F; Csikai, J; Hermanne, A; Ignatyuk, A V

    2014-01-01

    Activation cross-sections are presented for the first time for natGd(d,xn)161,160,156(m+), 154,154m1,154m2,153,152(m+),151(m+)Tb, natGd(d,x)159,153,151Gd and natGd(d,x)156Eu reactions from their respective thresholds up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and by using high resolution gamma-ray spectrometry. The measured values were compared with the results of theoretical models calculated by the computer codes ALICE-D, EMPIRE-D and TALYS (data from TENDL library). Integral yields of the reaction products were deduced from the excitation functions.

  17. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  18. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  19. Lanthanide derivatives comprising arylhydrazones of β-diketones: cooperative E/Z isomerization and catalytic activity in nitroaldol reaction.

    Science.gov (United States)

    Mahmudov, Kamran T; Guedes da Silva, M Fátima C; Sutradhar, Manas; Kopylovich, Maximilian N; Huseynov, Fatali E; Shamilov, Nazim T; Voronina, Anna A; Buslaeva, Tatyana M; Pombeiro, Armando J L

    2015-03-28

    Two complexes [KLa(HL(1))2{(CH3)2NCHO}2(H2O)3] (1) and [Sm(H2O)9](E-H2L(2))3·2H2O (2) were synthesized by the reaction of lanthanum(III) and samarium(III) nitrates with potassium 3-(2-(2,4-dioxopentan-3-ylidene)hydrazinyl)-2-hydroxy-5-nitrobenzenesulfonate (KH2L(1)) and potassium (E,Z)-5-chloro-3-(2-(1,3-dioxo-1-phenylbutan-2-ylidene)hydrazinyl)-2-hydroxybenzenesulfonate (KH2L(2)), respectively. Both complexes were fully characterized by elemental analysis, IR, (1)H and (13)C NMR spectroscopy, ESI-MS and single-crystal X-ray diffraction. Cooperative E,Z→E isomerization of KH2L(2), induced by resonance assisted hydrogen bonding and ionic interactions, occurs upon the interaction with Sm(III). Catalytic activities of KH2L(1,2) and their lanthanide derivatives were evaluated in the Henry reaction of nitroethane with a variety of aromatic and aliphatic aldehydes. Good yields (up to 91%) and diastereoselectivities (syn/anti 3 : 1) were observed in the reactions catalyzed by 1 in water.

  20. Crystallographic and Mutational Analysis of the CD40-CD154 Complex and Its Implications for Receptor Activation*

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-01-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser132 loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40. PMID:21285457

  1. CD40/CD154 Blockade Inhibits Dendritic Cell Expression of Inflammatory Cytokines but not Costimulatory Molecules1

    Science.gov (United States)

    Ferrer, Ivana R.; Liu, Danya; Pinelli, David F.; Koehn, Brent H.; Stempora, Linda L.; Ford, Mandy L.

    2012-01-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonsim on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor antigen (OVA). Adoptive transfer of OVA-specific CD4+ and CD8+ T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c+ DC compared to untreated controls. However, DCs isolated from anti-CD154 treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of antigen-specific CD4+ and CD8+ T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival. PMID:23002440

  2. Platelet-associated CD40/CD154 mediates remote tissue damage after mesenteric ischemia/reperfusion injury.

    Directory of Open Access Journals (Sweden)

    Peter H Lapchak

    Full Text Available Several innate and adaptive immune cell types participate in ischemia/reperfusion induced tissue injury. Amongst them, platelets have received little attention as contributors in the process of tissue damage after ischemia reperfusion (I/R injury. It is currently unknown whether platelets participate through the immunologically important molecules including, CD40 and when activated, CD154 (CD40L, in the pathogenesis of I/R injury. We hypothesized that constitutive expression of CD40 and activation-induced expression of CD154 on platelets mediate local mesenteric and remote lung tissue damage after I/R injury. Wild type (WT; C57BL/6J, CD40 and CD154 deficient mice underwent mesenteric ischemia for 30 minutes followed by reperfusion for 3 hours. WT mice subjected to mesenteric I/R injury displayed both local intestinal and remote lung damage. In contrast, there was significantly less intestinal damage and no remote lung injury in CD40 and CD154 deficient mice when compared to WT mice. Platelet-depleted WT mice transfused with platelets from CD40 or CD154 deficient mice failed to reconstitute remote lung damage. In contrast, when CD40 or CD154 deficient mice were transfused with WT platelets lung tissue damage was re-established. Together, these findings suggest that multiple mechanisms are involved in local and remote tissue injury and also identify platelet-expressed CD40 and/or CD154 as mediators of remote tissue damage.

  3. Crystallographic and mutational analysis of the CD40-CD154 complex and its implications for receptor activation.

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-04-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser(132) loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40.

  4. Association between Serum Soluble CD154 Levels and Mortality in Patients with Malignant Middle Cerebral Artery Infarction

    Directory of Open Access Journals (Sweden)

    Leonardo Lorente

    2015-05-01

    Full Text Available Background: CD154 and its soluble counterpart (sCD154 are proteins of the tumor necrosis factor (TNF family and exhibit proinflamatory and procoagulant properties. Higher circulating sCD154 levels have been found in ischemic stroke patients than in controls. However, the association between circulating sCD154 levels and mortality in ischemic stroke patients has not been reported, and was the focus of this study. Methods: This was a multicenter, observational and prospective study carried out in six Spanish Intensive Care Units. We measured serum sCD154 from 50 patients with severe malignant middle cerebral artery infarction (MMCAI, defined as Glasgow Coma Scale (GCS lower than 9, at the moment of the severe MMCAI diagnosis and from 50 healthy controls. The end-point of the study was 30-day mortality. Results: We found higher serum sCD154 levels in patients with severe MMCAI than in healthy controls (p < 0.001. We found higher serum sCD154 levels (p < 0.001 in non-surviving (n = 26 than in surviving MMCAI patients (n = 24. Multiple binomial logistic regression analysis showed that serum sCD154 levels >1.41 ng/mmL were associated with 30-day mortality (OR = 10.25; 95% CI = 2.34–44.95; p = 0.002. Conclusions: The new more important finding of our study was that serum sCD154 levels in MMCAI patients were associated with mortality.

  5. Update on CD40 and CD154 blockade in transplant models.

    Science.gov (United States)

    Zhang, Tianshu; Pierson, Richard N; Azimzadeh, Agnes M

    2015-01-01

    Generation of an effective immune response against foreign antigens requires two distinct molecular signals: a primary signal provided by the binding of antigen-specific T-cell receptor to peptide-MHC on antigen-presenting cells and a secondary signal delivered via the engagement of costimulatory molecules. Among various costimulatory signaling pathways, the interactions between CD40 and its ligand CD154 have been extensively investigated given their essential roles in the modulation of adaptive immunity. Here, we review current understanding of the role CD40/CD154 costimulation pathway has in alloimmunity, and summarize recent mechanistic and preclinical advances in the evaluation of candidate therapeutic approaches to target this receptor-ligand pair in transplantation.

  6. Thermoregulation in unrestrained rats during and after exposure to 1.5-4 G

    Science.gov (United States)

    Giacchino, J.; Horwitz, B. A.; Horowitz, J. M.

    1979-01-01

    Unrestrained rats were exposed to cold for 1 h during and immediately after exposure to hypergravic fields (1.5-4 G) to determine if they recover their ability to thermoregulate on reentry to 1-G conditions. In contrast to the decreased body temperatures observed when cold exposure occurred concurrently with acceleration, hypothalamic, carotid, and brown fat temperatures did not fall when rats were exposed to cold immediately after return to 1 G. These results support the hypothesis that the thermoregulatory alterations seen under hypergravic conditions are manifestations of an effect of ongoing exposure to hypergravity and can be reversed on termination of acceleration. The reversibility of the thermoregulatory impairment is apparently unaffected by the magnitude of the acceleration field over a range of 1.5-4 G.

  7. Orbital ordering in {sup 154}SmNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Medarde, M.; Rosenkranz, S. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Rodrigeuez-Carvajal, J. [Laboratoire Leon Brillouin (LLB) - Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Lacorre, P. [Lab. Fluorures, LeMans (France); Trounov, V. [PNPI, Gatchina (Russian Federation); Fernandez-Diaz, M.T. [Institut Max von Laue - Paul Langevin, 75 - Paris (France)

    1997-09-01

    We have investigated the existence of a structural distortion associated to the k = (1/2 0 1/2) orbital ordering recently proposed to explain the magnetic structure of RNiO{sub 3} perovskites (R = rare earth). Our results on a {sup 154}SmNiO{sub 3} powder sample indicate that, if existing, the associated superstructure reflections are as a maximum 10{sup 4} times smaller than the largest nuclear reflection. (author) 2 figs., 3 refs.

  8. Yeast Interacting Proteins Database: YNL154C, YDR264C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YNL154C YCK2 Palmitoylated plasma membrane-bound casein kinase I isoform; shares re... gene name YCK2 Bait description Palmitoylated plasma membrane-bound casein kinase I isoform; shares redunda...ature on prey (YPD) 11 Literature shared by bait and prey 5 Literature sharing score 14 CuraGen (0 or 1) 0 S

  9. A metabolomic assessment of NAC154 transcription factor overexpression in field grown poplar stem wood.

    Science.gov (United States)

    Jervis, Judith; Hildreth, Sherry B; Sheng, Xiaoyan; Beers, Eric P; Brunner, Amy M; Helm, Richard F

    2015-07-01

    Several xylem-associated regulatory genes have been identified that control processes associated with wood formation in poplar. Prominent among these are the NAC domain transcription factors (NACs). Here, the putative involvement of Populus NAC154, a co-ortholog of the Arabidopsis gene SND2, was evaluated as a regulator of "secondary" biosynthetic processes in stem internode tissues by interrogating aqueous methanolic extracts from control and transgenic trees. Comprehensive untargeted metabolite profiling was accomplished with a liquid chromatography-mass spectrometry platform that utilized two different chromatographic supports (HILIC and reversed phase) and both positive and negative ionization modes. Evaluation of current and previous year tissues provided datasets for assessing the effects of NAC154 overexpression in wood maturation processes. Phenolic glycoside levels as well as those of oligolignols, sucrose and arginine were modulated with phenotypic and chemotypic traits exhibiting similar trends. Specifically, increased levels of arginine in the NAC154 overexpressing tissues supports a role for the transcription factor in senescence/dormancy-associated processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. AGR-3/4 Data Qualification Report for ATR Cycles 151A, 151B, 152A, 152B, 154A, and 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh T. Pham

    2014-02-01

    This data report provides the qualification status of Advanced Gas Reactor-3/4 (AGR-3/4) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycles 151A, 151B, 152A, 152B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Of these cycles, ATR Cycle 152A is a low power cycle that occurred when the ATR core was briefly at low power. The irradiation data are not used for physics and thermal calculation, but the qualification status of these cycle data is still covered in this report. On the other hand, during ATR Cycles 153A (unplanned Outage cycle) and 153B (Power Axial Locator Mechanism [PALM] cycle), the AGR-3/4 was pulled out from the ATR core and stored in the canal to avoid being overheated. Therefore, qualification of the AGR-3/4 irradiation data from these 2 cycles was excluded in this report. By the end of ATR Cycle 154B, AGR-3/4 was irradiated for a total of 264.1 effective full power days. The AGR-3/4 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates, pressure, and moisture content), and Fission Product Monitoring System (FPMS) data (release rates and release-to-birth rate ratios [R/Bs]) for each of the twelve capsules in the AGR-3/4 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) composed of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The DRC convened on February 12, 2014, reviewed the data acquisition process, and considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) Technology Development Office (TDO) data collection plans. The DRC also examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  11. Methanol Adsorption and Reaction on Samaria Thin Films on Pt(111

    Directory of Open Access Journals (Sweden)

    Jin-Hao Jhang

    2015-09-01

    Full Text Available We investigated the adsorption and reaction of methanol on continuous and discontinuous films of samarium oxide (SmOx grown on Pt(111 in ultrahigh vacuum. The methanol decomposition was studied by temperature programmed desorption (TPD and infrared reflection absorption spectroscopy (IRRAS, while structural changes of the oxide surface were monitored by low-energy electron diffraction (LEED. Methanol dehydrogenates to adsorbed methoxy species on both the continuous and discontinuous SmOx films, eventually leading to the desorption of CO and H2 which desorbs at temperatures in the range 400–600 K. Small quantities of CO2 are also detected mainly on as-prepared Sm2O3 thin films, but the production of CO2 is limited during repeated TPD runs. The discontinuous film exhibits the highest reactivity compared to the continuous film and the Pt(111 substrate. The reactivity of methanol on reduced and reoxidized films was also investigated, revealing how SmOx structures influence the chemical behavior. Over repeated TPD experiments, a SmOx structural/chemical equilibrium condition is found which can be approached either from oxidized or reduced films. We also observed hydrogen absence in TPD which indicates that hydrogen is stored either in SmOx films or as OH groups on the SmOx surfaces.

  12. 33 CFR 154.1047 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154...) Sonar, sampling equipment, or other methods for locating the petroleum oil on the bottom or suspended in...

  13. Anaphylaxis-Like Reactions

    Science.gov (United States)

    ... Home Conditions Anaphylaxis Anaphylaxis-Like Reactions Anaphylaxis-Like Reactions Make an Appointment Refer a Patient Ask a ... exposed to a foreign substance, some people suffer reactions identical to anaphylaxis, but no allergy (IgE antibody) ...

  14. Catalysis of Photochemical Reactions.

    Science.gov (United States)

    Albini, A.

    1986-01-01

    Offers a classification system of catalytic effects in photochemical reactions, contrasting characteristic properties of photochemical and thermal reactions. Discusses catalysis and sensitization, examples of catalyzed reactions of excepted states, complexing ground state substrates, and catalysis of primary photoproducts. (JM)

  15. Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques

    OpenAIRE

    Vida L. Hodara; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.

    2005-01-01

    Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that...

  16. 46 CFR 154.610 - Design temperature not colder than 0 °C (32 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature not colder than 0 °C (32 °F). 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Materials § 154.610 Design temperature not colder than 0 °C (32 °F). Materials for...

  17. Neutralizing interleukin-4 prevents transplant arteriosclerosis mediated by indirect pathway T cells under CD40-CD154 costimulation blockade.

    Science.gov (United States)

    Spriewald, Bernd M; Ensminger, Stephan M; Bushell, Andrew; Wood, Kathryn J

    2008-12-15

    Blockade of the CD40-CD154 costimulatory pathway can prolong allograft survival, but does not prevent the development of transplant arteriosclerosis in several models. In this study, we investigated the mechanisms of CD40-CD154-independent transplant arteriosclerosis in major histocompatibility complex (MHC)-class I-mismatched aortic allografts. MHC class I-mismatched CBK (H2k+Kb) donor aortas were transplanted into CBA (H2k) recipients who can only recognize the graft through CD8+ T cells and CD4+ T cells responding to the class I MHC mismatch through the indirect pathway of allorecognition. Recipients were treated with anti-CD154 antibody (MR1) alone or in combination with anti-CD8 (YTS169) or anti-interleukin (IL)-4 (11B11) antibodies. Grafts were analyzed by histology on days 30 and 60 and for intragraft mRNA expression on day 14 after transplantation. Repeated treatment with anti-CD154 alone or in combination with anti-CD8 antibody did not prevent intimal proliferation compared with untreated controls (65%+/-6%, 62%+/-9%, and 71%+/-7% luminal occlusion, respectively, 60 days after transplantation). In both treatment groups, the expression of IL-4, IL-5, and eotaxin was increased compared with control grafts, and an eosinophilic infiltration was observed. Neutralizing IL-4 in combination with CD40-CD154 blockade and CD8+ T-cell depletion abrogated transplant arteriosclerosis (9%+/-4% luminal occlusion 60 days after transplantation). Prolonged treatment with anti-CD154 was not able to prevent the development of transplant arteriosclerosis in MHC class I-mismatched aortic allografts, in the presence or absence of CD8+ T cells. This CD40-CD154 pathway resistant transplant arteriosclerosis was mediated by IL-4, because neutralizing IL-4 in addition to CD40-CD154 costimulation blockade and CD8+ T-cell depletion prevented its development.

  18. On Thermonuclear Reaction Rates

    OpenAIRE

    Haubold, H. J.; Mathai, A. M.

    1996-01-01

    Nuclear reactions govern major aspects of the chemical evolution of galaxies and stars. Analytic study of the reaction rates and reaction probability integrals is attempted here. Exact expressions for the reaction rates and reaction probability integrals for nuclear reactions in the cases of nonresonant, modified nonresonant, screened nonresonant and resonant cases are given. These are expressed in terms of H-functions, G-functions and in computable series forms. Computational aspects are als...

  19. Atmospheric gas phase reactions

    Science.gov (United States)

    Platt, Ulrich

    This chapter introduces the underlying physicochemical principles and the relevance of atmospheric gas phase reactions. In particular, reaction orders, the concept of elementary reactions, definition of and factors determining reaction rates (kinetic theory of chemical reactions), and photochemical reactions are discussed. Sample applications of the pertinent reaction pathways in tropospheric chemistry are presented, particularly reactions involving free radicals (OH, NO3, halogen oxides) and their roles in the self-cleaning of the troposphere. The cycles of nitrogen and sulfur species as well as the principles of tropospheric ozone formation are introduced. Finally, the processes governing the stratospheric ozone layer (Chapman Cycle and extensions) are discussed.

  20. Two regimes of galaxy dynamics: mass models of NGC 5055 and DDO 154

    Science.gov (United States)

    Jovanović, Milena

    2017-08-01

    We derive detailed dynamical models for two galaxies, the massive spiral galaxy NGC 5055 and the dwarf irregular DDO 154. We used Navarro, Frenk & White (NFW) and isothermal halo models for the dark matter (DM) distribution, along with the most recent and reliable radio observations of H i to determine the rotation curves of these galaxies. Contributions from the neutral gas and the luminous matter were accounted for. For NGC 5055, the latest stellar population synthesis (SPS) models, combining metallicity and age as indicators of the stellar mass-to-light ratio (M/L) were used to better constrain both the DM model and the contribution to the total mass from all components. The isothermal dark halo model successfully fitted both observed rotation curves with realistic values for stellar M/L, while the NFW model needed further constraints for M/L to fit the rotation curve of DDO 154. In the case of NGC 5055, we found the best-fitting M/L in the 3.6 μm band (M/L3.6) for stellar disc to be 0.57 ± 0.04 for isothermal, and 0.50 ± 0.05 for NFW DM model. The most probable value for M/L3.6 from SPS models is 0.46, which is in agreement within uncertainties with our best-fitting NFW model. In the case of DDO 154, we obtained the stellar disc M/L3.6 of 0.25 ± 0.20 for the isothermal DM model. The stellar disc M/L3.6 for the NFW model was fixed to 0.26, as best reasonable value. For NGC 5055, we derived radial profiles of stellar M/L for our best estimate for a particular DM model.

  1. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    OpenAIRE

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2008-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were cor...

  2. Friedreich's Ataxia Variants I154F and W155R Diminish Frataxin-Based Activation of the Iron-Sulfur Cluster Assembly Complex

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Chi-Lin; Bridwell-Rabb, Jennifer; Barondeau, David P

    2011-11-07

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease that has been linked to defects in the protein frataxin (Fxn). Most FRDA patients have a GAA expansion in the first intron of their Fxn gene that decreases protein expression. Some FRDA patients have a GAA expansion on one allele and a missense mutation on the other allele. Few functional details are known for the ~15 different missense mutations identified in FRDA patients. Here in vitro evidence is presented that indicates the FRDA I154F and W155R variants bind more weakly to the complex of Nfs1, Isd11, and Isu2 and thereby are defective in forming the four-component SDUF complex that constitutes the core of the Fe-S cluster assembly machine. The binding affinities follow the trend Fxn ~ I154F > W155F > W155A ~ W155R. The Fxn variants also have diminished ability to function as part of the SDUF complex to stimulate the cysteine desulfurase reaction and facilitate Fe-S cluster assembly. Four crystal structures, including the first for a FRDA variant, reveal specific rearrangements associated with the loss of function and lead to a model for Fxn-based activation of the Fe-S cluster assembly complex. Importantly, the weaker binding and lower activity for FRDA variants correlate with the severity of disease progression. Together, these results suggest that Fxn facilitates sulfur transfer from Nfs1 to Isu2 and that these in vitro assays are sensitive and appropriate for deciphering functional defects and mechanistic details for human Fe-S cluster biosynthesis.

  3. CD154+ CD4+ T-cell dependence for effective memory influenza virus-specific CD8+ T-cell responses.

    Science.gov (United States)

    Olson, Matthew R; Seah, Shirley Gk; Edenborough, Kathryn; Doherty, Peter C; Lew, Andrew M; Turner, Stephen J

    2014-08-01

    CD40-CD154 (CD40 ligand) interactions are essential for the efficient priming of CD8(+) cytotoxic T lymphocyte (CTL) responses. This is typically via CD4(+)CD154(+) T-cell-dependent 'licensing' of CD40(+) dendritic cells (DCs); however, DCs infected with influenza A virus (IAV) upregulate CD154 expression, thus enabling efficient CTL priming in the absence of CD4(+) T activation. Therefore, it is unclear whether CD4 T cells and DCs have redundant or unique roles in the priming of primary and secondary CTL responses after infection. Here we determine the precise cellular interactions involved in CD40-CD154 regulation of both primary and secondary IAV-specific CTL responses. Infection of both CD40 KO and CD154 KO mice resulted in diminished quantitative and qualitative CTL responses after both primary and secondary infection. Adoptive transfer of CD154(+), but not CD154 KO, CD4 T cells into CD154 KO mice restored both primary and secondary IAV-specific CD8 T-cell responses. These data show that, although CD154 expression on CD4 T cells and other cell types (that is, DCs) may be redundant for the priming of primary CTL responses, CD154 expression by CD4 T cells is required for the priming memory CD8 T cells that are capable of fully responding to secondary infection.

  4. Vaccination Produces CD4 T Cells with a Novel CD154-CD40-Dependent Cytolytic Mechanism.

    Science.gov (United States)

    Coler, Rhea N; Hudson, Thomas; Hughes, Sean; Huang, Po-Wei D; Beebe, Elyse A; Orr, Mark T

    2015-10-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust Th1 responses to a variety of vaccine Ags and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein Ag and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly, these in vivo CTLs were CD4 T cells, not CD8 T cells, and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs, the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the Fas ligand-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40L) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs, which kill through a previously unknown CD154-dependent mechanism. Copyright © 2015 by The American Association of Immunologists, Inc.

  5. Persistent Polyclonal B Cell Lymphocytosis B Cells Can Be Activated through CD40-CD154 Interaction

    Directory of Open Access Journals (Sweden)

    Emmanuelle Dugas-Bourdages

    2014-01-01

    Full Text Available Persistent polyclonal B cell lymphocytosis (PPBL is a rare disorder, diagnosed primarily in adult female smokers and characterized by an expansion of CD19+CD27+IgM+ memory B cells, by the presence of binucleated lymphocytes, and by a moderate elevation of serum IgM. The clinical course is usually benign, but it is not known whether or not PPBL might be part of a process leading to the emergence of a malignant proliferative disorder. In this study we sought to investigate the functional response of B cells from patients with PPBL by use of an optimal memory B cell culture model based on the CD40-CD154 interaction. We found that the proliferation of PPBL B cells was almost as important as that of B cells from normal controls, resulting in high immunoglobulin secretion with in vitro isotypic switching. We conclude that the CD40-CD154 activation pathway is functional in the memory B cell population of PPBL patients, suggesting that the disorder may be due to either a dysfunction of other cells in the microenvironment or a possible defect in another B cell activation pathway.

  6. Self-assembly in aqueous solution of wheel-shaped Mo154 oxide clusters into vesicles.

    Science.gov (United States)

    Liu, Tianbo; Diemann, Ekkehard; Li, Huilin; Dress, Andreas W M; Müller, Achim

    2003-11-06

    Surfactants and membrane lipids readily assemble into complex structures such as micelles, liposomes or hollow vesicles owing to their amphiphilic character-the fact that part of their structure is attracted to polar environments while another part is attracted to non-polar environments. The self-assembly of complex structures also occurs in polyoxometallate chemistry, as exemplified by the molybdenum blue solutions known for centuries. But while the presence of nanometre-sized metal oxide aggregates in these solutions has long been recognized, unravelling the composition and formation process of these aggregates proved difficult. Recent work has indicated that discrete, wheel-shaped mixed-valence polyoxomolybdate clusters of the type [Mo154] (refs 2-4) assemble into well-defined nanometre-sized aggregates, including spherical structures. Here we report light-scattering data and transmission electron microscopy images of hollow spherical structures with an average, almost monodisperse radius of about 45 nm and composed of approximately 1,165 [Mo154] wheel-shaped clusters. The clusters appear to lie flat and homogeneously distributed on the vesicle surface. Unlike conventional lipid vesicles, the structures we observe are not stabilized by hydrophobic interactions. Instead, we believe the polyoxomolybdate-based vesicles form owing to a subtle interplay between short-range van der Waals attraction and long-range electrostatic repulsion, with important further stabilization arising from hydrogen bonding involving water molecules encapsulated between the wheel-shaped clusters and in the vesicles' interior.

  7. Ultra-Sensitive Nano Optical Sensor Samarium-Doxycycline Doped in Sol Gel Matrix for Assessment of Glucose Oxidase Activity in Diabetics Disease.

    Science.gov (United States)

    Tharwat, Marwa M; Attia, M S; Alghamdi, M S; Mahros, Amr M

    2017-07-11

    A low cost and very sensitive method for the determination of the activity of glucose oxidase enzyme in different diabetics serum samples was developed. The method based on the assessment of the H2O2 concentration produced from the reaction of the glucose oxidase (GOx) enzyme with glucose as substrate in the serum of diabetics patients by nano optical sensor Sm-doxycycline doped in sol gel matrix. H2O2 enhances the luminescence intensity of all bands of the nano Sm-doxycycline complex [Sm-(DC)2](+) doped in sol-gel matrix, especially the 645 nm band at λex = 400 nm and pH 7.0 in water. The influence of the different analytical parameters that affect the luminescence intensity of the nano optical sensor, e.g. pH, H2O2 concentration and foreign ions concentrations were studied. The remarkable enhancement of the luminescence intensity of nano optical sensor [Sm-(DC)2](+) complex in water at 645 nm by the addition of various concentrations of H2O2 was successfully used as an optical sensor for the assessment of the activity of the glucose oxidase enzyme in different diabetics serum samples. The calibration plot was achieved over the activity range 0.1-240 U/L with a correlation coefficient of 0.999 and a detection limit of 0.05 U/L.

  8. Synthesis, spectroscopic, thermal and antimicrobial studies of neodymium(III) and samarium(III) complexes derived from tetradentate ligands containing N and S donor atoms

    Science.gov (United States)

    Ain, Qurratul; Pandey, S. K.; Pandey, O. P.; Sengupta, S. K.

    2015-04-01

    Trivalent lanthanide complexes of the type [Ln(L)Cl(H2O)2] (where Ln = Nd(III) or Sm(III) and LH2 = Schiff bases derived by the condensation of 3-(phenyl/substitutedphenyl)-4-amino-5-mercapto-1,2,4-triazole with diacetyl/benzil) have been synthesized by the reactions of anhydrous lanthanide(III) chloride with Schiff bases in methanol. The structures of the complexes have been proposed on the basis of elemental analysis, electrical conductance, magnetic moment, spectroscopic measurements (IR, 1H, 13C NMR and UV-vis spectra) and X-ray diffraction studies. The spectral data reveal that the Schiff base ligands behave as dibasic tetradentate chelating agents having coordination sites at two thiol sulfur atoms and two azomethine nitrogen atoms. The presence of coordinated water in metal complexes was confirmed by thermal and IR data of the complexes. All the Schiff bases and their metal complexes have also been screened for their antibacterial activity against Bacillus subtilis, Staphylococcus aureus and antifungal activities against Aspergillus niger, Curvularia pallescens and Colletotrichum capsici.

  9. [Adverse reactions to insulin].

    Science.gov (United States)

    Liñana, J J; Montoro, F J; Hernández, M D; Basomba, A

    1997-07-01

    The prevalence of allergic reactions to insuline has decreased during the last few years. Probably this is due to the use of the newly-developed recombinant human insuline. At present, adverse reactions to insuline occur in 5-10% of patients on therapy with insuline. Adverse reactions may be local (more frequent) or systemic (rare). Insuline resistance consists in a different type of immunological reaction. Diagnosis of allergy to insuline is based on clinical history and cutaneous and serological tests. Treatment depends upon the severity of the reaction. When insuline is indispensable despite a previous allergic reaction, a desensitization protocol may be implemented.

  10. Processing of composites based on NiO, samarium-doped ceria and carbonates (NiO-SDCC as anode support for solid oxide fuel cells

    Directory of Open Access Journals (Sweden)

    Lily Siong Mahmud

    2017-09-01

    Full Text Available NiO-SDCC composites consisting of NiO mixed with Sm-doped ceria (SDC and carbonates (Li2CO3 and Na2CO3 were sintered at different temperatures and reduced at 550 °C. The influence of reduction on structure of the NiO-SDCC anode support for solid oxide fuel cells (SOFCs was investigated. Raman spectra of the NiO-SDCC samples sintered at 500, 600 and 700 °C showed that after reducing at 550 °C NiO was reduced to Ni. In addition, SDC and carbonates (Li2CO3 and Na2CO3 did not undergo chemical transformation after reduction and were still detected in the samples. However, no Raman modes of carbonates were identified in the NiO-SDCC pellet sintered at 1000 °C and reduced at 550 °C. It is suspected that carbonates were decomposed at high sintering temperature and eliminated due to the reaction between the CO32– and hydrogen ions during reduction in humidified gases at 550 °C. The carbonate decomposition increased porosity in the Ni-SDCC pellets and consequently caused formation of brittle and fragile structure unappropriated for SOFC application. Because of that composite NiO-SDC samples without carbonates were also analysed to determine the factors affecting the crack formation. In addition, it was shown that the different reduction temperatures also influenced the microstructure and porosity of the pellets. Thus, it was observed that Ni-SDC pellet reduced at 800 °C has higher electrical conductivity of well-connected microstructures and sufficient porosity than the pellet reduced at 550 °C.

  11. Potential energy surface for the reaction Sm+ + CO2 → SmO+ + CO: guided ion beam and theoretical studies.

    Science.gov (United States)

    Armentrout, P B; Cox, Richard M

    2017-05-10

    The potential energy surface (PES) for the oxidation of samarium cations by carbon dioxide is explored both experimentally and theoretically. Using guided ion beam tandem mass spectrometry, several reactions are examined as a function of kinetic energy. These include the title reaction as well as its reverse along with the collision-induced dissociation of Sm+(CO2) and OSm+(CO) with Xe. Analysis of the kinetic energy dependent cross sections yields barriers for the forward and reverse oxidation reaction of 1.77 ± 0.11 and 2.04 ± 0.13 eV, respectively, and Sm+-OCO and OSm+-CO bond dissociation energies (BDEs) of 0.42 ± 0.03 and 0.97 ± 0.07 eV, respectively. BDEs for Sm+(CO2)x for x = 2 and 3 are also determined as 0.40 ± 0.13 and 0.48 ± 0.12 eV, respectively. The PESs for the title reaction along the sextet and octet spin surfaces are also examined theoretically at the MP2 and CCSD(T) levels using both effective core potential and all-electron basis sets. Reasonable agreement between theory and experiment is obtained for the experimentally characterized intermediates, although all-electron basis sets and spin-orbit effects are needed for quantitative agreement. The observed barrier for oxidation is shown to likely correspond to the energy of the crossing between surfaces corresponding to the ground state electronic configuration of Sm+ (8F,4f66s1) and an excited surface having two electrons in the valence space (excluding 4f), which are needed to form the strong SmO+ bond.

  12. Microfluidic chemical reaction circuits

    Science.gov (United States)

    Lee, Chung-cheng [Irvine, CA; Sui, Guodong [Los Angeles, CA; Elizarov, Arkadij [Valley Village, CA; Kolb, Hartmuth C [Playa del Rey, CA; Huang, Jiang [San Jose, CA; Heath, James R [South Pasadena, CA; Phelps, Michael E [Los Angeles, CA; Quake, Stephen R [Stanford, CA; Tseng, Hsian-rong [Los Angeles, CA; Wyatt, Paul [Tipperary, IE; Daridon, Antoine [Mont-Sur-Rolle, CH

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  13. Allergic reactions (image)

    Science.gov (United States)

    Allergic reaction can be provoked by skin contact with poison plants, chemicals and animal scratches, as well as ... mildew, dust, nuts and shellfish, may also cause allergic reaction. Medications such as penicillin and other antibiotics are ...

  14. Cosmetic tattoo pigment reaction

    National Research Council Canada - National Science Library

    Greywal, Tanya; Cohen, Philip R

    2016-01-01

    BackgroundCutaneous reactions to tattoos are most commonly granulomatous or lichenoid.PurposeWe describe a woman who developed a lymphocytic reaction following a cosmetic tattoo procedure with black dye...

  15. Chemical transport reactions

    CERN Document Server

    Schäfer, Harald

    2013-01-01

    Chemical Transport Reactions focuses on the processes and reactions involved in the transport of solid or liquid substances to form vapor phase reaction products. The publication first offers information on experimental and theoretical principles and the transport of solid substances and its special applications. Discussions focus on calculation of the transport effect of heterogeneous equilibria for a gas motion between equilibrium spaces; transport effect and the thermodynamic quantities of the transport reaction; separation and purification of substances by means of material transport; and

  16. Reaction Time (Polish language)

    OpenAIRE

    Iermakov, Sergii

    2014-01-01

    Reaction time is the interval time between the presentation of a stimulus and the initiation of the muscular response to that stimulus.If there is only one possible response (simple reaction time) it will only take a short time to react. If there are several possible responses (choice reaction time) then it will take longer to determine which response to carry out.

  17. Laser enhanced chemical reactions

    Science.gov (United States)

    Included is the discussion of infrared diode lasers used to study time dependent dynamic events. Also, hot atom excitation of vibrational states of polyatomic molecules, bimolecular quenching and reactions of O(sup 1)D, bimolecular reaction studies of the OH + CO yields H + CO2 system, and the chemical dynamics of the reaction between chlorine atoms and deuterated cyclohexane are covered briefly.

  18. (MIRC) reaction w

    Indian Academy of Sciences (India)

    Sudesh Kumari

    as eco-friendly reaction media in catalyst free organic synthesis.7 Ethylene glycol has promising physical ... these properties it is used as a promising green media in many catalysed/ uncatalysed organic reactions ..... Ruijter E, Scheffelaar R and Orru R V A 2011 Multi- component Reaction Design in the Quest for Molecular ...

  19. The Interaction of CD154 with the α5β1 Integrin Inhibits Fas-Induced T Cell Death.

    Directory of Open Access Journals (Sweden)

    Meriem Bachsais

    Full Text Available CD154, a critical regulator of the immune response, is usually associated with chronic inflammatory, autoimmune diseases as well as malignant disorders. In addition to its classical receptor CD40, CD154 is capable of binding other receptors, members of the integrin family, the αIIbβ3, αMβ2 and α5β1. Given the role attributed to integrins and particularly the β1 integrins in inhibiting apoptotic events in normal as well as malignant T cells, we were highly interested in investigating the role of the CD154/α5β1 interaction in promoting survival of malignant T cells contributing as such to tumor development and/or propagation. To support our hypothesis, we first show that soluble CD154 binds to the T-cell acute lymphoblastic leukemia cell line, Jurkat E6.1 in a α5β1-dependent manner. Binding of soluble CD154 to α5β1 integrin of Jurkat cells leads to the activation of key survival proteins, including the p38 and ERK1/2 mitogen-activated protein kinases (MAPKs, phosphoinositide 3 kinase (PI-3K, and Akt. Interestingly, soluble CD154 significantly inhibits Fas-mediated apoptosis in T cell leukemia-lymphoma cell lines, Jurkat E6.1 and HUT78 cells, an important hallmark of T cell survival during malignancy progression. These anti-apoptotic effects were mainly mediated by the activation of the PI-3K/Akt pathway but also involved the p38 and the ERK1/2 MAPKs cascades. Our data also demonstrated that the CD154-triggered inhibition of the Fas-mediated cell death response was dependent on a suppression of caspase-8 cleavage, but independent of de novo protein synthesis or alterations in Fas expression on cell surface. Together, our results highlight the impact of the CD154/α5β1 interaction in T cell function/survival and identify novel targets for the treatment of malignant disorders, particularly of T cell origin.

  20. The X-ray emission mechanism in the protostellar jet HH 154

    Science.gov (United States)

    Bonito, R.; Orlando, S.; Peres, G.; Favata, F.; Rosner, R.

    2004-09-01

    We study the mechanism causing the X-ray emission recently detected in protostellar jets, by performing a detailed modeling of the interaction between a supersonic jet originating from a young stellar object and the ambient medium, for various values of density contrast, ν, between the ambient density and the jet, and of Mach number, M; radiative losses and thermal conduction have been taken into account. Here we report a representative case which reproduces, without any ad hoc assumption, the characteristics of the X-ray emission recently observed in the protostellar jet HH 154. We find that the X-ray emission originates from a localized blob, consistent with observations, which moves with velocity v ˜ 500 km s-1; we therefore predict the X-ray source to have a detectable proper motion.

  1. Study of XK and {gamma} photon emission following decay of {sup 154}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Terechtchenko, E. E-mail: tee@vniim.ru; Rasko, M.; Sepman, S.; Zanevsky, A.; Tuan, A. Tran; Amiot, M.N.; Bobin, C.; Morel, J

    2004-04-01

    A joint project has been established between VNIIM (D.I. Mendeleyev Institute for Metrology) and LNHB (Laboratoire National Henri Becquerel) to determine as accurately as possible the X- and {gamma}-ray emission probabilities of {sup 154}Eu. Point sources were prepared by VNIIM, and absolute measurements of activity per unit mass were undertaken by both laboratories using coincidence, anti-coincidence and 4{pi}-{gamma} counting methods. Other point sources and one aliquot were also prepared for precise {gamma}-ray spectrometry measurements. Absolute photon emission probabilities were determined with a maximum uncertainty of 0.5% for the most intense lines, supporting the development of this nuclide as a multigamma standard.

  2. [Influence of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice].

    Science.gov (United States)

    Ye, Qi-Xiang; Xu, Lu-Hong; Xu, Wei; Fang, Jian-Pei

    2014-06-01

    This study was aimed to explore the effects of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice', and provide the evidences of acquired immune tolerance for allogeneic bone marrow transplantation. The mice sensitized on 7 day before transplant were divided into 4 groups: (1)CTLA4Ig+ anti-CD154 isotype control IgG; (2)anti-CD154 +CTLA4Ig isotype control IgG; (3)CTLA4Ig and anti-CD154; (4)isotype control IgG of CTLA4Ig and anti-CD154. CTLA4Ig and anti-CD154 used in normal BALB/c mice as isotype control IgG. Each mouse in all groups received CTLA4Ig and anti-CD154 (or corresponding isotype control IgG) 500 µg respectively, and was injected via tail vein on 7 day before transplant. There were 5 mice in each group. The mice were sacrificed on day 0, then the number of CD19(+)CD69(+)B cells, CD44(high)/CD62L(high) and CD44(high)/CD62L(low)/- T cells were measured by flow cytometry. Changes of cytokines and sensitized antibody were tested by ELISA or flow cytometry. The results showed that the numbers of CD19(+)CD69(+)B cells were significantly increased in comparison with the normal group (P CD154 co-stimulatory signals (P CD154 co-stimulatory signals. Blocking these two signals together, displayed a synergistic effect (P CD154 treated groups significantly decreased as compared with sensitized group (P CD154 co-stimulatory signal can inhibit the cellular and humoral immune function, whereas blocking these two signals together displays a synergistic effect.

  3. Hypersensitivity reactions to heparins.

    Science.gov (United States)

    Gonzalez-Delgado, Purificación; Fernandez, Javier

    2016-08-01

    This article provides an update on hypersensitivity reactions to heparins and novel oral anticoagulants, with special emphasis on diagnostic methods and management of patients. Although heparins are drugs widely used, hypersensitivity reactions are uncommon. Cutaneous delayed hypersensitivity reactions after subcutaneous administration affects up to 7.5% of patients. Heparin-induced thrombocytopenia is another unusual but severe condition in which early recognition is crucial. Immediate hypersensitivity reactions to heparins have been also reported, but with the novel oral anticoagulants are much more uncommon, although reports of exanthemas have been notified.Skin tests and subcutaneous provocation test are useful tools in the diagnosis of hypersensitivity reactions, except in heparin-induced thrombocytopenia in which biopsy of lesional skin and in-vitro tests are the modalities of choice to confirm the diagnosis.Management of hypersensitivity reactions includes finding an alternative depending on the type of reaction. Fondaparinux and novel oral anticoagulants may be safe alternatives. Delayed skin lesions after subcutaneous heparin are the most common type of hypersensitivity reactions, followed by life-threatening heparin-induced thrombocytopenia. Immediate reactions are uncommon. Allergologic studies may be useful to find an alternative option in patients with skin lesions in which heparin-induced thrombocytopenia has been previously excluded, as well as in heparin immediate reactions.

  4. Hyperexpression of CD40 ligand (CD154) in inflammatory bowel disease and its contribution to pathogenic cytokine production

    NARCIS (Netherlands)

    Liu, Z.; Colpaert, S.; D'Haens, G. R.; Kasran, A.; de Boer, M.; Rutgeerts, P.; Geboes, K.; Ceuppens, J. L.

    1999-01-01

    CD40 ligand (CD40L or CD154), a type II membrane protein with homology to TNF, is transiently expressed on activated T cells and known to be important for B cell Ig production and for activation and differentiation of monocytes and dendritic cells. Both Crohn's disease and ulcerative colitis are

  5. Antigen-specific induced Foxp3+ regulatory T cells are generated following CD40/CD154 blockade

    Science.gov (United States)

    Ferrer, Ivana R.; Wagener, Maylene E.; Song, Minqing; Kirk, Allan D.; Larsen, Christian P.; Ford, Mandy L.

    2011-01-01

    Blockade of the CD40/CD154 pathway potently attenuates T-cell responses in models of autoimmunity, inflammation, and transplantation. Indeed, CD40 pathway blockade remains one of the most powerful methods of prolonging graft survival in models of transplantation. But despite this effectiveness, the cellular and molecular mechanisms underlying the protective effects of CD40 pathway blockade are incompletely understood. Furthermore, the relative contributions of deletion, anergy, and regulation have not been measured in a model in which donor-reactive CD4+ and CD8+ T-cell responses can be assessed simultaneously. To investigate the impact of CD40/CD154 pathway blockade on graft-specific T-cell responses, a transgenic mouse model was used in which recipients containing ovalbumin-specific CD4+ and CD8+ TCR transgenic T cells were grafted with skin expressing ovalbumin in the presence or absence of anti-CD154 and donor-specific transfusion. The results indicated that CD154 blockade altered the kinetics of donor-reactive CD8+ T-cell expansion, delaying differentiation into IFN-γ+ TNF+ multifunctional cytokine producers. The eventual differentiation of cytokine-producing effectors in tolerant animals coincided with the emergence of an antigen-specific CD4+ CD25hi Foxp3+ T-cell population, which did not arise from endogenous natural Treg but rather were peripherally generated from naïve Foxp3− precursors. PMID:22143783

  6. 75 FR 64947 - 154th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2010-10-20

    ... Pension Benefit Plans; Notice of Meeting; Notice #0;#0;Federal Register / Vol. 75, No. 202 / Wednesday... Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Meeting Pursuant... (ERISA), 29 U.S.C. 1142, the 154th open meeting of the Advisory Council on Employee Welfare and Pension...

  7. 33 CFR 154.1240 - Specific requirements for animal fats and vegetable oils facilities that could reasonably be...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Specific requirements for animal fats and vegetable oils facilities that could reasonably be expected to cause substantial harm to the... Animal Fats and Vegetable Oils Facilities § 154.1240 Specific requirements for animal fats and vegetable...

  8. 42 CFR 84.154 - Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.154 Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements. (a) Airflow resistance shall be... diameter. (b) Airflow resistance shall not exceed 38 mm. (1.5 inches) of water-column height to air drawn...

  9. 33 CFR 154.1045 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ... the National Oil and Hazardous Substances Pollution Contingency Plan Product Schedule (which is contained in 40 CFR part 300, and available online from the U.S. Government Printing Office). (ii... or the annual plan review required under § 154.1065(a). Facility owners or operators are not required...

  10. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro

    NARCIS (Netherlands)

    Pasch, Marcel C.; Timár, Krisztina K.; van Meurs, Marjan; Heydendael, Vera M. R.; Bos, Jan D.; Laman, Jon D.; Asghar, Syed S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  11. Chimpanzee CD4+ T cells are relatively insensitive to HIV-1 envelope-mediated inhibition of CD154 up-regulation

    NARCIS (Netherlands)

    Rutjens, Erik; Vermeulen, Joost; Verstrepen, Babs; Hofman, Sam; Prins, Jan M.; Srivastava, Indresh; Heeney, Jonathan L.; Koopman, Gerrit

    2008-01-01

    CD40-CD154 interaction forms a key event in regulation of crosstalk between dendritic cells and CD4 T cells. In human immunodeficiency virus (HIV)-1 infected patients CD154 expression is impaired, and the resulting loss of immune responsiveness by CD4+ T cells contributes to a progressive state of

  12. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro.

    NARCIS (Netherlands)

    Pasch, M.C.; Timar, K.K.; Meurs, M. van; Heydendael, V.M.; Bos, J.D.; Laman, J.D.; Asghar, S.S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  13. Organic dyes as small molecule protein-protein interaction inhibitors for the CD40-CD154 costimulatory interaction.

    Science.gov (United States)

    Buchwald, Peter; Margolles-Clark, Emilio; Kenyon, Norma S; Ricordi, Camillo

    2010-01-01

    It is becoming increasingly clear that small molecules can often act as effective protein-protein interaction (PPI) inhibitors, an area of increasing interest for its many possible therapeutic applications. We have identified several organic dyes and related small molecules that (i) concentration-dependently inhibit the important CD40-CD154 costimulatory interaction with activities in the low micromolar (microM) range, (ii) show selectivity toward this particular PPI, (iii) seem to bind on the surface of CD154, and (iv) concentration-dependently inhibit the CD154-induced B cell proliferation. They were identified through an iterative activity screening/structural similarity search procedure starting with suramin as lead, and the best smaller compounds, the main focus of the present work, achieved an almost 3-fold increase in ligand efficiency (DeltaG(0)/nonhydrogen atom = 0.8 kJ/N(nHa)) approaching the average of known promising small-molecule PPI inhibitors (approximately 1.0 kJ/N(nHa)). Since CD154 is a member of the tumor necrosis factor (TNF) superfamily of cell surface interaction molecules, inhibitory activities on the TNF-R1-TNF-alpha interactions were also determined to test for specificity, and the compounds selected here all showed more than 30-fold selectivity toward the CD40-CD154 interaction. Because of their easy availability in various structural scaffolds and because of their good protein-binding ability, often explored for tissue-specific staining and other purposes, such organic dyes can provide a valuable addition to the chemical space searched to identify small molecule PPI inhibitors in general. (c) 2009 John Wiley & Sons, Ltd.

  14. Reaction kinetics of polybutylene terephthalate polycondensation reaction

    NARCIS (Netherlands)

    Darda, P. J.; Hogendoorn, J. A.; Versteeg, G. F.; Souren, F.

    2005-01-01

    The kinetics of the forward polycondensation reaction of polybutylene terephthalate (PBT) has been investigated using thermogravimetric analysis (TGA). PBT - prepolymer with an initial degree of polymerization of 5.5 was used as starting material. The PBT prepolymer was prepared from dimethyl

  15. Reactions at Solid Surfaces

    CERN Document Server

    Ertl, Gerhard

    2009-01-01

    Expanding on the ideas first presented in Gerhard Ertl's acclaimed Baker Lectures at Cornell University, Reactions at Solid Surfaces comprises an authoritative, self-contained, book-length introduction to surface reactions for both professional chemists and students alike. Outlining our present understanding of the fundamental processes underlying reactions at solid surfaces, the book provides the reader with a complete view of how chemistry works at surfaces, and how to understand and probe the dynamics of surface reactions. Comparing traditional surface probes with more modern ones, and brin

  16. Desosamine in multicomponent reactions

    NARCIS (Netherlands)

    Achatz, Sepp; Dömling, Alexander

    2006-01-01

    Desosamine occurring ubiquitously in natural products is introduced into isocyanide based multicomponent reaction chemistry. Corresponding products are of potential interest for the design of novel antibiotics. © 2006.

  17. Stimulation-dependent induction of CD154 on a subset of CD4+ FoxP3+ T-regulatory cells

    Science.gov (United States)

    Li, Wen; Carlson, Timothy L.; Green, William R.

    2013-01-01

    CD40-ligand/CD154 is predominantly expressed on activated CD4 T cells and plays a central role in regulating CD4 T-cell-dependent responses. To define the relative abilities of CD4 T-cell functional subsets in the induction of CD154—specifically FoxP3− effector, versus FoxP3+ regulatory, CD4 T cells—multiple CD4 T cell preparations were isolated from B6 and B6.FoxP3-GFP mice and stimulated in vitro to examine the kinetics of stimulation-dependent CD154 expression. CD154 was induced in 40–60% of total CD4 T cells in various cell preparations. However, despite similar kinetics of CD154-induced expression, the average percentage of CD154 expression among CD4+ FoxP3+ T regulatory (Treg) cells was only about 4–9%. Such differential, stimulation-dependent CD154 induction by total CD4+ T cells versus CD4+ FoxP3+ Treg cells was consistent, despite multiple stimulation conditions utilizing a variety of cell preparations of different composition. Similar induction of CD154 occurred irrespective of whether the CD4+ FoxP3+ Treg cells were first sorted to 98% purity and stimulated in vitro alone, or stimulated as non-purified cells in the presence of CD4+ FoxP3− T effector cells, suggesting that CD154 induction by CD4+ FoxP3+ Treg cells is regulated by cell-intrinsic mechanisms. Differential CD154 induction may be a key factor in determining the distinguishable functions of FoxP3− T-effector, versus FoxP3+ Treg, CD4+ T cells. PMID:21496498

  18. Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65MeV.

    Science.gov (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

    2015-04-01

    Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.

  19. Reactions to Attitudinal Deviancy.

    Science.gov (United States)

    Levine, John M.; Allen, Vernon L.

    This paper presents a critical review of empirical and theoretical treatments of group reaction to attitudinal deviancy. Inspired by Festinger's (1950) ideas on resolution of attitudinal discrepancies in groups, Schachter (1951) conducted an experiment that has greatly influenced subsequent research and theory concerning reaction to attitudinal…

  20. ORGANIC REACTION MECHANISM CONTROVERSY ...

    African Journals Online (AJOL)

    Preferred Customer

    Chemists, educators and students are entitled to their mental constructs about reaction mechanism in the classroom. What pedagogical implications have these knowledge claims for teaching and learning reaction mechanisms in organic chemistry? This is the main interest of the paper. Thus three questions were critically ...

  1. Hydrogen evolution reaction catalyst

    Science.gov (United States)

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  2. Applications of Reaction Rate

    Science.gov (United States)

    Cunningham, Kevin

    2007-01-01

    This article presents an assignment in which students are to research and report on a chemical reaction whose increased or decreased rate is of practical importance. Specifically, students are asked to represent the reaction they have chosen with an acceptable chemical equation, identify a factor that influences its rate and explain how and why it…

  3. Establishment of long-term CD154-dependent porcine B-cell cultures

    Science.gov (United States)

    Takamatsu, H; Andersen, J K; Denyer, M S; Parkhouse, R M E

    1999-01-01

    Cells of the B-cell lineage play an essential part in the immune response, not only as the producers of antigen-specific antibodies, but also as antigen-presenting cells. Unlike T cells, however, the establishment of long-term normal B-cell lines has proved to be exceedingly difficult. In this paper we demonstrate that cell membrane-expressed CD154 (CD40 ligand) is able to support the continual growth of porcine mesenteric lymph node B-cell cultures for more than 4 months without the addition of exogenous cytokines, such as interleukin-4 (IL-4). Addition of IL-4, but not interferon-γ (IFN-γ) or IL-13, to these cultures enhanced proliferation, as, to a lesser extent, did addition of IL-2. Interestingly, however, whilst IFN-γ-supplemented cultures largely consisted of immunoglobulin M (IgM)-positive cells, cultures with IL-13 or IL-4 contained a significantly increased proportion of IgG-positive cells. PMID:10447734

  4. Allospecific CD154 + T-cytotoxic memory cells as potential surrogate for rejection risk in pediatric intestine transplantation.

    Science.gov (United States)

    Sindhi, Rakesh; Ashokkumar, Chethan; Higgs, Brandon W; Gilbert, P B; Sun, Qing; Ranganathan, Sarangarajan; Jaffe, Ron; Snyder, Sara; Ningappa, Mylarappa; Soltys, Kyle A; Bond, Geoffrey J; Mazariegos, George V; Abu-Elmagd, Kareem; Zeevi, Adriana

    2012-02-01

    Clinical end-points dictate large trial enrollments and exclude children with the rare intestine transplant procedure (ITx), who experience higher drug-related morbidity. We evaluate the novel rejection-risk parameter, allo-(antigen)-specific CD154 + TcMs (i) as surrogates for ACR using Prentice's criteria, (ii) for association with immunosuppression targets to determine Fleming's surrogate end-point designation, and (iii) as time-to-event end-point in a simulated comparison of alemtuzumab (NCT#01208337, n = 14) and rabbit anti-human thymocyte globulin (rATG, n = 16) among 30 children with ITx. CD154 + TcM were measured in MLR before, and at 1-60 and 61-200 days after ITx (NCT#01163578). CD154 + TcM correlate significantly with rejection severity (Spearman r = 0.685, p = 2.03E-5) and associate with biopsy-proven ITx rejection with sensitivity/specificity of 94%/84% [corrected] independent of immunosuppressant. Previously stated sensitivity of 90% is incorrect. [corrected]. The rejection-risk threshold of CD154 + TcM resolves rapidly in 200-day follow-up (46 ± 20 vs. 158 ± 59 days, p = 0.009, K-M) with alemtuzumab, which demonstrates lower 90-day ACR incidence (50% vs. 69%, p=NS, Fisher's exact), and is associated with accelerated prednisone minimization to ≤2.5 mg/day, compared with rATG (120 ± 28 vs. 180 ± 30 days, p = 0.027, K-M). As a surrogate end-point, time-to-rejection-risk resolution measured with CD154 + TcM portends 50% reduction in sample sizes in a simulated trial of alemtuzumab vs. rATG. Rejection-risk assessment with CD154 + TcM may enable informed immunosuppression minimization, and preliminary efficacy comparisons in pediatric ITx. © 2011 John Wiley & Sons A/S.

  5. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  6. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  7. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  8. Respiratory transfusion reactions

    Directory of Open Access Journals (Sweden)

    Ivica Marić

    2017-11-01

    Full Text Available Respiratory transfusion-related reactions are not very frequent, partly also because recognition and reporting transfusion reactions is still underemphasized. Tis article describes the most important respiratory transfusion reactions, their pathophysiology, clinical picture and treatment strategies. Respiratory transfusion related reactions can be primary or secondary. The most important primary transfusion-related reactions are TRALI - transfusion-related acute lung injury, TACO – transfusion-associated circulatory overload, and TAD - transfusion-associated dyspnea. TRALI is immuneassociated injury of alveolar basal membrane, which becomes highly permeable and causes noncardiogenic pulmonary edema. Treatment of TRALI is mainly supportive with oxygen, fluids (in case of hypotension and in cases of severe acute respiratory failure also mechanic ventilation. TACO is caused by volume overload in predisposed individuals, such as patients with heart failure, the elderly, infants, patients with anemia and patients with positive fluid balance. Clinical picture is that of a typical pulmonary cardiogenic edema, and the therapy is classical: oxygen and diuretics, and in severe cases also non-invasive or invasive mechanical ventilation. TAD is usually a mild reaction of unknown cause and cannot be classified as TACO or TRALI, nor can it be ascribed to patient’s preexisting diseases. Although the transfusion-related reactions are not very common, knowledge about them can prevent serious consequences. On the one hand preventive measures should be sought, and on the other early recognition is beneficial, so that proper treatment can take place.

  9. Autocatalysis in Reaction Networks

    OpenAIRE

    Deshpande, Abhishek; Gopalkrishnan, Manoj

    2013-01-01

    The persistence conjecture is a long-standing open problem in chemical reaction network theory. It concerns the behavior of solutions to coupled ODE systems that arise from applying mass-action kinetics to a network of chemical reactions. The idea is that if all reactions are reversible in a weak sense, then no species can go extinct. A notion that has been found useful in thinking about persistence is that of "critical siphon." We explore the combinatorics of critical siphons, with a view to...

  10. The Reaction Wheel Pendulum

    CERN Document Server

    Block, Daniel J; Spong, Mark W

    2007-01-01

    This monograph describes the Reaction Wheel Pendulum, the newest inverted-pendulum-like device for control education and research. We discuss the history and background of the reaction wheel pendulum and other similar experimental devices. We develop mathematical models of the reaction wheel pendulum in depth, including linear and nonlinear models, and models of the sensors and actuators that are used for feedback control. We treat various aspects of the control problem, from linear control of themotor, to stabilization of the pendulum about an equilibrium configuration using linear control, t

  11. Electron transfer reactions

    CERN Document Server

    Cannon, R D

    2013-01-01

    Electron Transfer Reactions deals with the mechanisms of electron transfer reactions between metal ions in solution, as well as the electron exchange between atoms or molecules in either the gaseous or solid state. The book is divided into three parts. Part 1 covers the electron transfer between atoms and molecules in the gas state. Part 2 tackles the reaction paths of oxidation states and binuclear intermediates, as well as the mechanisms of electron transfer. Part 3 discusses the theories and models of the electron transfer process; theories and experiments involving bridged electron transfe

  12. T cells responding to Trypanosoma cruzi detected by membrane TNF-α and CD154 in chagasic patients.

    Science.gov (United States)

    Ripoll, Juan G; Giraldo, Nicolás A; Bolaños, Natalia I; Roa, Nubia; Rosas, Fernando; Cuéllar, Adriana; Puerta, Concepción J; González, John M

    2018-03-01

    Chagas disease is a parasitic infection whose pathogenesis is related to parasite persistence and a dysfunctional cellular immune response. Variability in cytokine secretion among chronic Trypanosoma cruzi-infected patients might preclude the identification of the pool of antigen specific T cells. The goal of this study was to determine the fraction of T cells responding to T. cruzi antigen measured by the expression of membrane TNF-α and CD154. A total of 21 chagasic patients, 11 healthy and 5 non-chagasic cardiomyopathy controls were analyzed. PBMCs were short-term cultured in the presence of anti-CD28, anti-CD49d, anti-TNF-α, and TACE (TNF-α converting enzyme) inhibitor either under T. cruzi-lysate or polyclonal stimuli. Cells were stained with anti-CD3, anti-CD4, anti-CD8, and anti-CD154, and analyzed with flow cytometry. CD4+ and CD8+ T cells in chagasic patients displayed higher percentages of membrane-bound TNF-α+ and CD154+ compared with controls after T. cruzi-antigen stimulation. Both markers displayed a positive correlation in the T cell subpopulations analyzed. Symptomatic chagasic patients were differentiated from asymptomatic patients based on the expression of CD154 and membrane TNF-α in TCD4+ and TCD8+ compartments, respectively. These results show that both markers could be useful for assessing the pool of antigen-specific T cells in chronic chagasic patients. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  13. Autocatalysis in reaction networks.

    Science.gov (United States)

    Deshpande, Abhishek; Gopalkrishnan, Manoj

    2014-10-01

    The persistence conjecture is a long-standing open problem in chemical reaction network theory. It concerns the behavior of solutions to coupled ODE systems that arise from applying mass-action kinetics to a network of chemical reactions. The idea is that if all reactions are reversible in a weak sense, then no species can go extinct. A notion that has been found useful in thinking about persistence is that of "critical siphon." We explore the combinatorics of critical siphons, with a view toward the persistence conjecture. We introduce the notions of "drainable" and "self-replicable" (or autocatalytic) siphons. We show that: Every minimal critical siphon is either drainable or self-replicable; reaction networks without drainable siphons are persistent; and nonautocatalytic weakly reversible networks are persistent. Our results clarify that the difficulties in proving the persistence conjecture are essentially due to competition between drainable and self-replicable siphons.

  14. [Adverse reactions to vaccines].

    Science.gov (United States)

    Ito Tsuchiya, F M; Rosas Vargas, M A; Zepeda Ortega, B; Río del Navarro, Blanca Estela; Sienra Monge, Juan José Luis

    2007-01-01

    Vaccination is one of the medicine's achievements to control and/or eradicate certain infectious diseases. Vaccines contain antigenic doses derived from microorganisms and/or its toxins, besides they are composed of other substances such as aluminum, gelatin, egg proteins, mercury components (as thimerosal), and antibiotics; therefore, these substances can produce hypersensitivity reactions. The above-mentioned reactions can be evidenced with itch, edema, hives, asthmatic crisis, hypotension and even anaphylactic shock. Due to the importance of vaccination, especially in childhood, it is essential to know the benefits of vaccines, their impact in morbidity and mortality decrease of certain infected-contagious diseases, as well as the adverse effects and the allergic reactions to their application. As immunizations prevent natural infections, they might contribute to a free infectious environment that would allow atopic response. This paper reviews the allergic reactions to vaccines and their influence on the development of atopic disease.

  15. Bad Reaction to Cosmetics?

    Science.gov (United States)

    ... Consumers Protect Yourself Health Fraud Bad Reactions to Cosmetics? Tell FDA! Share Tweet Linkedin Pin it More ... Radiation-Emitting Products Vaccines, Blood & Biologics Animal & Veterinary Cosmetics Tobacco Products

  16. Reactor for exothermic reactions

    Science.gov (United States)

    Smith, Jr., Lawrence A.; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  17. Firefighter Nozzle Reaction

    DEFF Research Database (Denmark)

    Chin, Selena K.; Sunderland, Peter B.; Jomaas, Grunde

    2017-01-01

    to anchor forces, the hose becomes straight. The nozzle reaction is found to equal the jet momentum flow rate, and it does not change when an elbow connects the hose to the nozzle. A forward force must be exerted by a firefighter or another anchor that matches the forward force that the jet would exert...... on a perpendicular wall. Three reaction expressions are derived, allowing it to be determined in terms of hose diameter, jet diameter, flow rate, and static pressure upstream of the nozzle. The nozzle reaction predictions used by the fire service are 56% to 90% of those obtained here for typical firefighting hand......Nozzle reaction and hose tension are analyzed using conservation of fluid momentum and assuming steady, inviscid flow and a flexible hose in frictionless contact with the ground. An expression that is independent of the bend angle is derived for the hose tension. If this tension is exceeded owing...

  18. Chemical burn or reaction

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000059.htm Chemical burn or reaction To use the sharing features on ... the burned area from pressure and friction. Minor chemical burns will generally heal without further treatment. However, if ...

  19. KLF10 Mediated Epigenetic Dysregulation of Epithelial CD40/CD154 Promotes Endometriosis.

    Science.gov (United States)

    Delaney, Abigail A; Khan, Zaraq; Zheng, Ye; Correa, Luiz F; Zanfagnin, Valentina; Shenoy, Chandra C; Schoolmeester, John K; Saadalla, Abdulrahman M; El-Nashar, Sherif; Famuyide, Abimbola O; Subramaniam, Malayannan; Hawse, John R; Khazaie, Khashayarsha; Daftary, Gaurang S

    2016-09-01

    Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human disease association, loss of the paralog Klf10 causes a unique inflammatory, cystic endometriosis phenotype in contrast to fibrotic progression seen with loss of Klf11. We identify here for the first time a novel role for KLF10 in endometriosis. In an animal endometriosis model, unlike wild-type controls, Klf10(-/-) animals developed cystic lesions with massive immune infiltrate and minimal peri-lesional fibrosis. The Klf10(-/-) disease progression phenotype also contrasted with prolific fibrosis and minimal immune cell infiltration seen in Klf11(-/-) animals. We further found that lesion genotype rather than that of the host determined each unique disease progression phenotype. Mechanistically, KLF10 regulated CD40/CD154-mediated immune pathways. Both inflammatory as well as fibrotic phenotypes are the commonest clinical manifestations in chronic fibro-inflammatory diseases such as endometriosis. The complementary, paralogous Klf10 and Klf11 models therefore offer novel insights into the mechanisms of inflammation and fibrosis in a disease-relevant context. Our data suggests that divergence in underlying gene dysregulation critically determines disease-phenotype predominance rather than the conventional paradigm of inflammation being precedent to fibrotic scarring. Heterogeneity in clinical progression and treatment response are thus likely from disparate gene regulation profiles. Characterization of disease phenotype-associated gene dysregulation offers novel approaches for developing targeted, individualized therapy for recurrent and recalcitrant chronic disease. © 2016 by the Society for the Study of Reproduction, Inc.

  20. Adverse reaction to tetrazepam.

    Science.gov (United States)

    Palacios Benito, R; Domínguez Ortega, J; Alonso Llamazares, A; Rodríguez Morales, A; Plaza Díaz, A; Chamorro Gómez, M; Martínez-Cócera, C

    2001-01-01

    Adverse reactions caused by benzodiazepines rarely occur. We present a case of a 70-year-old man who developed a maculopapular exanthema after the ingestion of tetrazepam. For his diagnosis, skin tests were performed, including prick and patch tests, not only with the benzodiazepine implicated in the reaction, but also with benzodiazepines of other groups. Single-blind oral challenge tests were also performed in the patient, in order to assess his tolerance to other benzodiazepines.

  1. Oxygen evolution reaction catalysis

    Science.gov (United States)

    Haber, Joel A.; Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Jones, Ryan J.; Guevarra, Dan W.; Shinde, Aniketa A.

    2016-09-06

    An Oxygen Evolution Reaction (OER) catalyst includes a metal oxide that includes oxygen, cerium, and one or more second metals. In some instances, the cerium is 10 to 80 molar % of the metals in the metal oxide and/or the catalyst includes two or more second metals. The OER catalyst can be included in or on an electrode. The electrode can be arranged in an oxygen evolution system such that the Oxygen Evolution Reaction occurs at the electrode.

  2. Photoinduced Multicomponent Reactions.

    Science.gov (United States)

    Garbarino, Silvia; Ravelli, Davide; Protti, Stefano; Basso, Andrea

    2016-12-12

    The combination of multicomponent approaches with light-driven processes opens up new scenarios in the area of synthetic organic chemistry, where the need for sustainable, atom- and energy-efficient reactions is increasingly urgent. Photoinduced multicomponent reactions are still in their infancy, but significant developments in this area are expected in the near future. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Negative reactions to monitoring: Do they undermine the ability of monitoring to protect adolescents?

    Science.gov (United States)

    Laird, Robert D; Zeringue, Megan M; Lambert, Emily S

    2017-12-21

    This study focused on adolescents' negative reactions to parental monitoring to determine whether parents should avoid excessive monitoring because adolescents find monitoring behaviors to be over-controlling and privacy invasive. Adolescents (n = 242, M age = 15.4 years; 51% female) reported monitoring, negative reactions, warmth, antisocial behavior, depressive symptoms, and disclosure. Adolescents additionally reported antisocial behavior, depressive symptoms, and disclosure one to two years later. In cross-sectional analyses, less monitoring but more negative reactions were linked with less disclosure, suggesting that negative reactions can undermine parents' ability to obtain information. Although monitoring behaviors were not related to depressive symptoms, more negative reactions were linked with more depressive symptoms, suggesting that negative reactions also may increase depressive symptoms as a side effect of monitoring behavior. Negative reactions were not linked to antisocial behavior. There were no longitudinal links between negative reactions and changes in disclosure, antisocial behavior, or depressive symptoms. Copyright © 2017. Published by Elsevier Ltd.

  4. Medications and Drug Allergic Reactions

    Science.gov (United States)

    ... drug allergic reactions TTR Share | Medications and Drug Allergic Reactions This article has been reviewed by Thanai Pongdee, ... your symptoms are severe, seek medical help immediately. Allergic Reactions Allergy symptoms are the result of a chain ...

  5. Chemical kinetics of gas reactions

    CERN Document Server

    Kondrat'Ev, V N

    2013-01-01

    Chemical Kinetics of Gas Reactions explores the advances in gas kinetics and thermal, photochemical, electrical discharge, and radiation chemical reactions. This book is composed of 10 chapters, and begins with the presentation of general kinetic rules for simple and complex chemical reactions. The next chapters deal with the experimental methods for evaluating chemical reaction mechanisms and some theories of elementary chemical processes. These topics are followed by discussions on certain class of chemical reactions, including unimolecular, bimolecular, and termolecular reactions. The rema

  6. CD154 blockade alters innate immune cell recruitment and programs alloreactive CD8+ T cells into KLRG-1(high short-lived effector T cells.

    Directory of Open Access Journals (Sweden)

    Ivana R Ferrer

    Full Text Available CD154/CD40 blockade combined with donor specific transfusion remains one of the most effective therapies in prolonging allograft survival. Despite this, the mechanisms by which these pathways synergize to prevent rejection are not completely understood. Utilizing a BALB/c (H2-K(d to B6 (H2-K(b fully allogeneic skin transplant model system, we performed a detailed longitudinal analysis of the kinetics and magnitude of CD8(+ T cell expansion and differentiation in the presence of CD154/CD40 pathway blockade. Results demonstrated that treatment with anti-CD154 vs. DST had distinct and opposing effects on activated CD44(high CD62L(low CD8(+ T cells in skin graft recipients. Specifically, CD154 blockade delayed alloreactive CD8(+ T cell responses, while DST accelerated them. DST inhibited the differentiation of alloreactive CD8(+ T cells into multi-cytokine producing effectors, while CD40/CD154 blockade led to the diminution of the KLRG-1(low long-lived memory precursor population compared with either untreated or DST treated animals. Moreover, only CD154 blockade effectively inhibited CXCL1 expression and neutrophil recruitment into the graft. When combined, anti-CD154 and DST acted synergistically to profoundly diminish the absolute number of IFN-γ producing alloreactive CD8(+ T cells, and intra-graft expression of inflammatory chemokines. These findings demonstrate that the previously described ability of anti-CD154 and DST to result in alloreactive T cell deletion involves both delayed kinetics of T cell expansion and differentiation and inhibited development of KLRG-1(low memory precursor cells.

  7. Exploratory computational assessment of possible binding modes for small molecule inhibitors of the CD40-CD154 co-stimulatory interaction.

    Science.gov (United States)

    Ganesan, L; Vidović, D; Schürer, S C; Buchwald, P

    2012-05-01

    Protein-protein interactions (PPI) tend to involve extensive, flat, and featureless interfaces that are difficult to disrupt by small molecule binding. However, recently, PPIs are being recognized as increasingly valuable 'druggable' targets. We have identified several small molecule inhibitors of the immunologically relevant CD40-CD154 co-stimulatory interaction that bind to the homotrimeric CD154, a member of the tumor necrosis factor superfamily (TNFSF). Recently, on the basis of the co-crystal structure of CD154 with another small molecule (BIO8898), it has been suggested that these PPIs could be particularly susceptible to small molecule blockade due to a subunit fracture mechanism resulting in a distortion of the trimeric structure. To investigate whether this mechanism can occur with our organic dye-related inhibitors, we performed exploratory computational docking experiments. Possible druggable pockets that can serve as binding sites for small molecule inhibitors were identified with the FFT map algorithm both along the CD154-CD40 binding interface (competitive, orthosteric model) and in the interior core of the CD154 trimer corresponding to the BIO8898 binding site (allosteric model). Docking experiments (using Glide) were performed at these sites using the PDB ID: 3QD6 (CD40-CD154) and 3LKJ (BIO8898-CD154) co-crystal structures, respectively. The docking algorithm was able to better discriminate binders from non-binders at the deeper allosteric site than at the competitive site. Accordingly, an allosteric inhibitory mechanism that involves intercalation between monomeric subunits seems feasible for our small molecules making the constitutively trimeric CD154 a likely druggable target.

  8. CD154 Is Released from T-cells by a Disintegrin and Metalloproteinase Domain-containing Protein 10 (ADAM10) and ADAM17 in a CD40 Protein-dependent Manner*

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-01-01

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders. PMID:24189063

  9. CD154 is released from T-cells by a disintegrin and metalloproteinase domain-containing protein 10 (ADAM10) and ADAM17 in a CD40 protein-dependent manner.

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-12-13

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders.

  10. Endoscopic repair in 154 cases of urethral occlusion: the promise of guided optical urethral reconstruction.

    Science.gov (United States)

    al-Ali, M; al-Shukry, M

    1997-01-01

    We determined whether optical urethral reconstruction, with the use of a Béniqué bougie in the proximal urethra and transrectal digital guidance, is effective for the treatment of long and severe urethral occlusions. However, with some skill the procedure can be done without the bougie for the treatment of short occlusions. During a 9-year period 154 men with complete urethral occlusion underwent core through optical urethrotomy via transrectal digital guidance, using the Béniqué bougie in 89 (58%). A total of 400 urethrotomies was performed. All lesions were in the posterior urethra except 8 in the pendulous portion. There were 64 war related injuries (41.6%). Combined voiding and retrograde urethrography was not useful to measure the length of the occlusion due to failure of proximal urethral filling. Guided optical urethral reconstruction consisted of optical urethrotomy performed with a Béniqué bougie introduced proximally through the suprapubic catheter site and into the proximal urethra with the index finger of the operator in the rectum. The same procedure was performed blindly without use of the bougie in 65 patients (42%), and in 43 with lesions shorter than 1 cm. and 4 with multiple annular lesions. We also used the blind technique successfully to reestablish 18 occlusions longer than 1 cm. For optimal epithelialization of the urethral tract we suggest leaving a silicone catheter indwelling for 3 months. No prophylactic antibiotics were given. Of the patients 54 (35%) were cured after 1 procedure, whereas the remaining 100 (65%) required 1 to 9 additional urethrotomies (mean 3). Patients with an uninstrumented urethra who were treated initially with suprapubic catheterization required 1 to 6 urethrotomies (mean 2), compared to 1 to 10 (mean 3) for those who had undergone a prior procedure. Hematuria occurred in 9% of the patients, symptomatic urinary tract infection in 7% and slight extravasation in 3.2%. One patient had stress incontinence. Our

  11. Protocol-based management of 154 cases of pediatric liver abscess.

    Science.gov (United States)

    Roy Choudhury, Subhasis; Khan, Niyaz Ahmed; Saxena, Rahul; Yadav, Partap Singh; Patel, Jigar N; Chadha, Rajiv

    2017-02-01

    Although liver abscess (LA) is prevalent worldwide, especially in developing countries, there is a paucity of data regarding the protocol for management of LA in children. The aim of this study was to analyze the outcome of a protocol-based management of pediatric LA from a single institution. This prospective observational study was conducted in a tertiary-care children's hospital and included all patients with LA managed over a 5-year period. Detailed clinical, laboratory, microbiological and imaging parameters were recorded, and the patients were treated according to a standardized management protocol. Small abscesses (managed with antimicrobial therapy alone. Liquefied abscesses on imaging were additionally subjected to US guided percutaneous needle aspirations (PNA). Large abscesses pointing to the surface were treated by percutaneous drainage (PCD). Ruptured LA, abscess inaccessible to image-guided drainage and those not responding to other modes of treatment were subjected to open surgical drainage (OSD). Pleural collections were treated by aspirations or intercostal tube drainage. Outcome was analyzed in terms of duration of recovery and complications including mortality. Over the 5-year period, 154 pediatric LA patients underwent protocol-based management. The mean age of the patients was 6.76 years with the male:female being 1.26:1. Medical management alone, PNA, PCD and OSD were successful in 38 (24.6%), 76 (49.3%), 11 (7.14%) and 29 (18.8%) cases, respectively. Pleural collections developed in 43 (27.9%) patients out of which aspiration/drainage was needed in 24 (55.81%) cases. The mean duration of hospital stay was 20.67 ± 9.52 days. Ongoing sepsis and multi-organ failure lead to mortality in 6 (3.8%) cases; rest of the patients were doing well on follow-up. Ultra-sonography was useful for the initial diagnosis, monitoring the progress and management of LA in children. The outcome of a protocol-based management of LA in children was favorable.

  12. Reaction Qualifications Revisited

    DEFF Research Database (Denmark)

    Lippert-Rasmussen, Kasper

    2009-01-01

    of merit. Specifically, it preserves symmetry between negative evaluations of antimeritocratic bases of selection and negative evaluations of qualifications rooted in comparable antimeritocratic reactions. So if employers should not select among applicants on the basis of their (the employers') racial...... preferences, recipients should not respond to the applicant actually hired on the basis of their (the recipients') racial preferences. My account decomposes the meritocratic ideal into four separate norms, one of which applies to recipients rather than to selectors. Finally, it defends the view that reaction...... reaction-qualifications are entirely irrelevant from the point of view of merit, the view expounded here implies that the ideal of meritocracy and the norm of non-discrimination are less closely tied than theorists like Andrew Mason and David Miller believe.  ...

  13. Allergic reactions in anaesthesia

    DEFF Research Database (Denmark)

    Krøigaard, M; Garvey, L H; Menné, T

    2005-01-01

    BACKGROUND: The aim of this retrospective survey of possible allergic reactions during anaesthesia was to investigate whether the cause suspected by anaesthetists involved corresponded with the cause found on subsequent investigation in the Danish Anaesthesia Allergy Centre (DAAC). METHODS: Case...... notes and anaesthetic charts from 111 reactions in 107 patients investigated in the DAAC were scrutinized for either suspicions of or warnings against specific substances stated to be the cause of the supposed allergic reaction. RESULTS: In 67 cases, one or more substances were suspected. In 49...... of these (73%) the suspected cause did not match the results of subsequent investigation, either a different substance being the cause or no cause being found. Only five cases (7%) showed a complete match between suspected cause and investigation result. In the remaining 13 cases (19%) there was a partial...

  14. Hipersensitivity Reactions to Corticosteroids.

    Science.gov (United States)

    Berbegal, L; DeLeon, F J; Silvestre, J F

    2016-03-01

    Corticosteroids are widely used drugs in the clinical practice, especially by topic application in dermatology. These substances may act as allergens and produce immediate and delayed hypersensitivity reactions. Allergic contact dermatitis is the most frequent presentation of corticosteroid allergy and it should be studied by patch testing in specific units. The corticosteroids included in the Spanish standard battery are good markers but not ideal. Therefore, if those makers are positive, it is useful to apply a specific battery of corticosteroids and the drugs provided by patients. Immediate reactions are relatively rare but potentially severe, and it is important to confirm the sensitization profile and to guide the use of alternative corticosteroids, because they are often necessary in several diseases. In this article we review the main concepts regarding these two types of hypersensitivity reactions in corticosteroid allergy, as well as their approach in the clinical practice. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.

  15. Nanoparticle Reactions on Chip

    Science.gov (United States)

    Köhler, J. M.; Kirner, Th.; Wagner, J.; Csáki, A.; Möller, R.; Fritzsche, W.

    The handling of heterogenous systems in micro reactors is difficult due to their adhesion and transport behaviour. Therefore, the formation of precipitates and gas bubbles has to be avoided in micro reaction technology, in most cases. But, micro channels and other micro reactors offer interesting possibilities for the control of reaction conditions and transport by diffusion and convection due to the laminar flow caused by small Reynolds numbers. This can be used for the preparation and modification of objects, which are much smaller than the cross section of microchannels. The formation of colloidal solutions and the change of surface states of nano particles are two important tasks for the application of chip reactors in nanoparticle technology. Some concepts for the preparation and reaction of nanoparticles in modular chip reactor arrangements will be discussed.

  16. Adverse reactions to cosmetics

    Directory of Open Access Journals (Sweden)

    Dogra A

    2003-03-01

    Full Text Available Adverse reaction to cosmetics constitute a small but significant number of cases of contact dermatitis with varied appearances. These can present as contact allergic dermatitis, photodermatitis, contact irritant dermatitis, contact urticaria, hypopigmentation, hyperpigmentotion or depigmentation, hair and nail breakage. Fifty patients were included for the study to assess the role of commonly used cosmetics in causing adverse reactions. It was found that hair dyes, lipsticks and surprisingly shaving creams caused more reaction as compared to other cosmetics. Overall incidence of contact allergic dermatitis seen was 3.3% with patients own cosmetics. Patch testing was also done with the basic ingredients and showed positive results in few cases where casual link could be established. It is recommended that labeling of the cosmetics should be done to help the dermatologists and the patients to identify the causative allergen in cosmetic preparation.

  17. Increased soluble CD154 (CD40 ligand) levels in xenograft recipients correlate with the development of de novo anti-pig IgG antibodies.

    Science.gov (United States)

    Ezzelarab, Mohamed B; Ekser, Burcin; Isse, Kumiko; Iwase, Hayato; Morelli, Adrian E; Ayares, David; Cooper, David K C

    2014-03-15

    De novo anti-pig antibodies are associated with acute humoral xenograft rejection. We explored the relative efficacy of CD40/CD154-pathway blockade versus CD28/B7-pathway blockade in the prevention of de novo anti-pig IgG antibodies in xenograft recipients. After α1,3-galactosyltransferase gene-knockout pig artery patch xenotransplantation, recipient baboons received no immunosuppression (IS; n=3), or anti-CD154mAb-based (n=5) or CTLA4-Ig-based (n=5) IS. CD4 T-cell and CD20 B-cell numbers in blood were determined. Serum anti-pig IgG antibodies and serum soluble (s)CD154 levels were measured. In lymph nodes, germinal center formation was examined and numbers of proliferating cells were evaluated by Ki-67 staining. After transplantation, with no IS, CD4 T-cell and CD20 B-cell numbers were increased, but were reduced by IS.In lymph nodes, with no IS, there was enhanced germinal center formation, which was significantly reduced by anti-CD154mAb-based (PCD154 and circulating sCD154, thus preventing subsequent stimulation of B cells and activation of lymphoid follicles in secondary lymphoid tissues.

  18. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Directory of Open Access Journals (Sweden)

    Ricky H Bhogal

    Full Text Available BACKGROUND: Hypoxia and hypoxia-reoxygenation (H-R are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. METHODS: Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. RESULTS: Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CONCLUSIONS: CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  19. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Science.gov (United States)

    Bhogal, Ricky H; Weston, Christopher J; Curbishley, Stuart M; Adams, David H; Afford, Simon C

    2012-01-01

    Hypoxia and hypoxia-reoxygenation (H-R) are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS) accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  20. Velocity pump reaction turbine

    Science.gov (United States)

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  1. Knockout reactions: experimental aspects

    Energy Technology Data Exchange (ETDEWEB)

    Cortina Gil, D. [Santiago de Compostela Univ. (Spain)

    2007-07-01

    The availability of radioactive beams has given rise to intense activity in the field of direct reactions. The removal of one(two)-nucleon (referred to as nucleon knockout in this text) from a fast exotic projectile has been extensively investigated. This lecture provides a general overview of the experimental results achieved using this technique. The sensitivity of the method to different experimental aspects is illustrated with a few examples. Special attention is given to the application of nucleon-knockout reactions as a general purpose spectroscopic tool. (author)

  2. Methods for Controlling Effects of Alkali-Silica Reaction in Concrete.

    Science.gov (United States)

    1987-02-01

    AD-536, AD-536(2). Silica fume from Alabama. 9. Standard chemical and physical tests were made on all 4 cements plus repeat shipments and 11...Engineers. 1983. "Alkali-Silica Aggregate Reactions," Appendix B, in " Standard Practice for Concrete," Engineer Manual 1110-2-2000, 5 Sep 1985...0.29 1.54 Total as Na7a % 0.00 0.74 0.32 1.46 4- PHYSICAL T.STS 4-, S-ecific Gravity: 2.58 Fineness: Z retained on 325 Sieve .- Surface Area: 12830

  3. cyclopropanation reaction with ketene

    Indian Academy of Sciences (India)

    Administrator

    Smith. 15. This has motivated a large number of research groups to develop new and wide-range methods to produce cyclopropanated products. Methylene insertion by a carbenoid species into the. C=C bond is one of the most widely used methods since the recognition of the Simmons–Smith reac- tion, which is a reaction ...

  4. Reaction product imaging

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  5. Reaction Formulation: A Bibliography.

    Science.gov (United States)

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  6. Explaining competitive reaction effects

    NARCIS (Netherlands)

    Leeflang, P.S.H.; Wittink, D.R.

    Changes in promotional expenditure decisions for a brand, as in other marketing decisions, should be based on the expected impact on purchase and consumption behavior as well as on the likely reactions by competitors. Purchase behavior may be predicted from estimated demand functions. Competitive

  7. Cluster knockout reactions

    Indian Academy of Sciences (India)

    2014-04-07

    Apr 7, 2014 ... Cluster knockout reactions are expected to reveal the amount of clustering (such as that of , d and even of heavier clusters such as 12C, 16O etc.) in the target nucleus. In simple terms, incident medium high-energy nuclear projectile interacts strongly with the cluster (present in the target nucleus) as if it ...

  8. Transfer reactions with HELIOS

    Science.gov (United States)

    Wuosmaa, Alan H.

    2011-04-01

    Nucleon-transfer reactions have formed the backbone of nuclear-structure studies for several decades, providing a wealth of information about the energies, quantum numbers, and wave functions of single-particle states in nuclei throughout the nuclear chart. Current trends in nuclear-structure physics and the modern emphasis on properties of neutron-rich nuclei far from stability have renewed interest in such transfer reactions with radioactive beams. Here, the usual combination of light beam and heavy target cannot be used, and measurements must be performed in ``inverse kinematics,'' with a heavy, unstable beam incident on a light target. This arrangement introduces several technical difficulties, including the identification of the reaction products and the resolution of the states of interest in the residual nuclei. A new device, HELIOS (the HELIcal Orbit Spectrometer) at the ATLAS facility at Argonne National Laboratory, solves many of the problems encountered with inverse kinematics including particle identification and energy resolution in the center-of-mass frame. The device utilizes the uniform magnetic field of a large, superconducting solenoid to transport light reaction products from the target to a linear array of position-sensitive silicon detectors. The properties of HELIOS will be described, and examples from the initial research program that focuses on neutron transfer with the (d,p) reaction, using both stable and unstable beams with mass A = 11 to 136, will be presented. Work supported by the U. S. Department of Energy, Office of Nuclear Physics under contract numbers DE-FG02-04ER41320 (WMU) and DE-AC02-06CH11357 (ANL).

  9. The Periplasmic Cavity of LacY Mutant Cys154→Gly: How Open is Open?

    Science.gov (United States)

    Jiang, Xiaoxu; Driessen, Arnold J. M.; Feringa, Ben L.; Kaback, H. Ronald

    2013-01-01

    The lactose permease from Escherichia coli (LacY) is a galactoside/H+ symporter that catalyzes the coupled stoichiometric transport of a sugar and an H + across the cytoplasmic membrane. x-ray crystal structures of WT LacY and the conformationally restricted mutant Cys154→Gly exhibit an inward-facing conformation with a tightly sealed periplasmic side and a deep central cleft or cavity open to the cytoplasm. Although the crystal structures may give the impression that LacY is a rigid molecule, multiple converging lines of evidence demonstrate that galactoside binding to WT LacY induces reciprocal opening and closing of periplasmic and cytoplasmic cavities, respectively. By this means, the sugar- and H+-binding sites in the middle of the molecule are exposed alternatively to either side of the membrane. In contrast to the crystal structure, biochemical/biophysical studies with mutant Cys154→Gly show that the periplasmic side is paralyzed in an open-outward conformation. In this study, a rigid, funnel-shaped, maleimide-containing molecule was used to probe the periplasmic cavity of a pseudo WT and the Cys154→Gly mutant by site-directed alkylation. The findings provide strong support for previous observations and indicate further that the external opening of the periplasmic cleft in the mutant is patent to the extent of at least 8.5 Å in the absence of sugar or about half that of the WT cavity with bound galactoside. PMID:23962108

  10. Multicomponent reactions in polymer synthesis.

    Science.gov (United States)

    Kakuchi, Ryohei

    2014-01-03

    More participants, yet efficient reactions: Multicomponent reactions (MCRs) have found application in polymer chemistry both in the synthesis of multifunctional monomers and in post-polymerization modification. Examples include the Passerini three-component reaction, the Ugi four-component reaction, and the copper-catalyzed MCR. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Kinetics of Bio-Reactions

    DEFF Research Database (Denmark)

    Villadsen, John

    2015-01-01

    his chapter predicts the specific rates of reaction by means of a mathematical expression, the kinetics of the reaction. This expression can be derived through a mechanistic interpretation of an enzymatically catalyzed reaction, but it is essentially of empirical nature for cell reactions. The mo...

  12. What Is a Reaction Rate?

    Science.gov (United States)

    Schmitz, Guy

    2005-01-01

    The definition of reaction rate is derived and demonstrations are made for the care to be taken while using the term. Reaction rate can be in terms of a reaction property, the extent of reaction and thus it is possible to give a definition applicable in open and closed systems.

  13. Nuclear structure effects of the nuclei {sup 152,154,156}Dy at high excitation energy and large angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain)

    1995-06-01

    Using the finite-temperature Hartree-Fock-Bogoliubov formalism we analyze the properties of the nuclei {sup 152,154,156}Dy at the quasicontinuum region from {ital I}=0{h_bar} to 70{h_bar} and excitation energy up to approximately 16 MeV. We discuss energy gaps, shapes, moments of inertia, and entropy among others. The role of shape fluctuations is studied in the frame of classical statistics and we find large effects on several observables. A very rich structure is found in terms of excitation energy and angular momentum.

  14. Reaction chemistry of cerium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  15. Reactions to dietary tartrazine.

    Science.gov (United States)

    David, T J

    1987-01-01

    Double blind challenges with tartrazine and benzoic acid were performed in hospital in 24 children whose parents gave a definite history of a purely behavioural immediate adverse reaction to one of these substances. The patients, whose ages ranged from 1.6 to 12.4 years, were on a diet that avoided these items, and in all there was a clear history that any lapse of the diet caused an obvious adverse behavioural reaction within two hours. In no patient was any change in behaviour noted either by the parents or the nursing staff after the administration of placebo or active substances. Twenty two patients returned to a normal diet without problems, but the parents of two children insisted on continuing the diet. While popular belief has it that additives may have harmful behavioural effects, objective verification is required to prevent overdiagnosis. PMID:3548601

  16. Enzyme catalysed tandem reactions.

    Science.gov (United States)

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-04-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a reversible process to become irreversible, to shift the equilibrium reaction in such a way that enantiopure compounds can be obtained from prochiral or racemic substrates, reduce or eliminate problems due to product inhibition or prevent the shortage of substrates by dilution or degradation in the bulk media, etc. In this review we want to illustrate the developments of recent studies involving in vitro multi-enzyme reactions for the synthesis of different classes of organic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. CMLSnap : Animated reaction mechanisms

    OpenAIRE

    Holliday, Gemma L; Mitchell, John BO; Murray-Rust, Peter

    2004-01-01

    The authors thank the EPSRC for financial support of this project and Unilever for their support of the Centre for Molecular Science Informatics. Reactions with many steps can be represented by a single XML-based table of the atoms, bonds and electrons. For each step the complete Chemical Markup Language 1 representation of all components is obtained and a snapshot representing the end point of the step is generated. These snapshots can then be combined to give an animated description of t...

  18. Exclusive reactions in QCD

    OpenAIRE

    Pire, Bernard

    1996-01-01

    We review the theory of hard exclusive scattering in Quantum Chromodynamics. After recalling the classical counting rules which describe the leading scale dependence of form factors and exclusive cross-sections at fixed angle, the pedagogical example of the pion form factor is developped in some detail in order to show explicitely what factorization means in the QCD framework. The picture generalizes to many hard reactions which are at the heart of the ELFE project. We briefly present the con...

  19. Photochemical reaction dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B.C. [Lawrence Berkeley Laboratory, Livermore, CA (United States)

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  20. Cryochemical chain reactions

    Science.gov (United States)

    Barkalov, I. M.; Kiryukhin, D. P.

    The possibility of a chemical reaction near absolute zero has appeared doubtful since the beginning of the 1970s. The existing ideas must be revised after the radiation polymerization of formaldehyde at 4.2 K has been observed. In glassy systems, we have examined chain processes that occur under sharp (by five to six orders) changes in molecular mobility of the medium in the region of matrix devitrification. Quite unusual mechano-energetic chains of chemical conversion arise in the studied systems submerged in liquid helium. The chemical transformation initiated by local brittle fracture travels over the sample as an autowave. A series of experimental and theoretical investigations devoted to this interesting phenomenon are described. There is no generalization in this new region of chemistry up to this time. Many journal articles and reviews have been previously published only in Russian. The cycles of investigations of chain cryochemical reactions are the subject of this review. We hope that the investigation of the extraordinary peculiarities of chain cryochemical reactions should produce new ideas in chemical theory and industry.

  1. Adverse cutaneous drug reaction

    Directory of Open Access Journals (Sweden)

    Nayak Surajit

    2008-01-01

    Full Text Available In everyday clinical practice, almost all physicians come across many instances of suspected adverse cutaneous drug reactions (ACDR in different forms. Although such cutaneous reactions are common, comprehensive information regarding their incidence, severity and ultimate health effects are often not available as many cases go unreported. It is also a fact that in the present world, almost everyday a new drug enters market; therefore, a chance of a new drug reaction manifesting somewhere in some form in any corner of world is unknown or unreported. Although many a times, presentation is too trivial and benign, the early identification of the condition and identifying the culprit drug and omit it at earliest holds the keystone in management and prevention of a more severe drug rash. Therefore, not only the dermatologists, but all practicing physicians should be familiar with these conditions to diagnose them early and to be prepared to handle them adequately. However, we all know it is most challenging and practically difficult when patient is on multiple medicines because of myriad clinical symptoms, poorly understood multiple mechanisms of drug-host interaction, relative paucity of laboratory testing that is available for any definitive and confirmatory drug-specific testing. Therefore, in practice, the diagnosis of ACDR is purely based on clinical judgment. In this discussion, we will be primarily focusing on pathomechanism and approach to reach a diagnosis, which is the vital pillar to manage any case of ACDR.

  2. Modelling Tethered Enzymatic Reactions

    Science.gov (United States)

    Solis Salas, Citlali; Goyette, Jesse; Coker-Gordon, Nicola; Bridge, Marcus; Isaacson, Samuel; Allard, Jun; Maini, Philip; Dushek, Omer

    Enzymatic reactions are key to cell functioning, and whilst much work has been done in protein interaction in cases where diffusion is possible, interactions of tethered proteins are poorly understood. Yet, because of the large role cell membranes play in enzymatic reactions, several reactions may take place where one of the proteins is bound to a fixed point in space. We develop a model to characterize tethered signalling between the phosphatase SHP-1 interacting with a tethered, phosphorylated protein. We compare our model to experimental data obtained using surface plasmon resonance (SPR). We show that a single SPR experiment recovers 5 independent biophysical/biochemical constants. We also compare the results between a three dimensional model and a two dimensional model. The work gives the opportunity to use known techniques to learn more about signalling processes, and new insights into how enzyme tethering alters cellular signalling. With support from the Mexican Council for Science and Technology (CONACyT), the Public Education Secretariat (SEP), and the Mexican National Autonomous University's Foundation (Fundacion UNAM).

  3. T cells interact with T cells via CD40-CD154 to promote autoimmunity in T1D

    Science.gov (United States)

    Baker, Rocky L; Mallevaey, Thierry; Gapin, Laurent; Haskins, Kathryn

    2013-01-01

    Summary We have investigated the role of CD40 signaling in islet-reactive, diabetogenic CD4 Th1 T cell clones. Using multispectral flow cytometry, we showed that CD40 and CD154 are co-expressed and form complexes on the surface of activated T cells. We also demonstrate that activated T cells can transactivate CD4+CD40+ T cells through the CD40-CD154 pathway. To investigate the role of CD40 signaling on Th1 cells, we used the diabetogenic clone BDC-5.2.9 retrovirally transduced with a truncated form of the CD40 molecule to produce a CD40 dominant-negative T cell clone. Upon challenge with antigen in vitro, the production of IFN-γ by BDC-5.2.9 CD40DN was greatly reduced and in vivo, the dominant-negative variant was unable to induce diabetes. Transduction with the CD40DN vector was also effective in preventing transfer of disease by primary NOD CD4 T cells. Ex vivo analysis of pancreatic infiltrates after transfer of BDC-5.2.9 CD40DN revealed an overall reduction of cell numbers and cytokine production by both T cells and macrophages. These data indicate that CD40 is an important signaling molecule on autoreactive CD4 T cells and contributes to their pathogenic effector function. PMID:22488364

  4. Vaccination produces CD4 T cells with a novel CD154-CD40 dependent cytolytic mechanism ¶

    Science.gov (United States)

    Coler, Rhea N.; Hudson, Thomas; Hughes, Sean; Huang, Po-wei D.; Beebe, Elyse A.; Orr, Mark T.

    2015-01-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust TH1 responses to a variety of vaccine antigens and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein antigen and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly these in vivo CTLs were CD4 T cells, not CD8 T cells and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the FasL-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40 ligand) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs which kill through a previously unknown CD154-dependent mechanism. PMID:26297758

  5. Method for the validation of immunohistochemical staining using SCID mouse xenografts: expression of CD40 and CD154 in human non-small cell lung cancer.

    Science.gov (United States)

    Ishikawa, Keidai; Miyamoto, Masaki; Yoshioka, Tatsuya; Kadoya, Masatoshi; Li, Li; Mishra, Roshan; Ichinokawa, Kazuomi; Shoji, Yasuhito; Matsumura, Yoshiyuki; Hida, Yasuhiro; Kaga, Kichizo; Kato, Tatsuya; Kaji, Mitsuhito; Ohbuchi, Toshiro; Itoh, Tomoo; Dosaka-Akita, Hirotoshi; Matsui, Yoshiro; Hirano, Satoshi

    2013-04-01

    This report proposes a concept for the standardization of immunohistochemical evaluation. Immunohistochemical staining has several problems associated with the sensitivity of the technical process and standardization of the assessment of potent staining. We provided data focusing on this concept through immunostaining for CD154 in non-small cell lung cancer (NSCLC). We used two types of anti-CD154 antibody as primary antibodies in immunohistochemical staining, as previously reported. Western blot analysis confirmed strong CD154 expression in the cultured cell line PC10, but not in LK2. We also assessed CD154 expression in SCID mouse xenografts of these cell lines. SCID xenograft data on western blot analysis were consistent with those of cultured cell lines. These xenografts could thus be used as positive or negative tissue controls for CD154 immunostaining. Primary antibodies should therefore be confirmed as recognizing target lesions, while control tissue specimens should be objectively confirmed as having target products using another experimental method. Our method would allow results to be unified at more than one laboratory and could act as an objective control assessment method in immunohistochemistry.

  6. NF-κB is involved in the regulation of CD154 (CD40 ligand) expression in primary human T cells

    Science.gov (United States)

    Srahna, M; Remacle, J E; Annamalai, K; Pype, S; Huylebroeck, D; Boogaerts, M A; Vandenberghe, P

    2001-01-01

    Cognate interactions between CD154 (CD40 ligand, CD40L) on activated T cells and its receptor CD40 on various antigen-presenting cells are involved in thymus-dependent humoral immune responses and multiple other cell-mediated immune responses. We have studied the regulation of CD154 expression in human T cells after activation with anti-CD3 and anti-CD28 antibodies or after pharmacological activation of protein kinase C with phorbol 12-myristate 13-acetate, and the calcium ionophore ionomycin. Under these conditions, transcription of the CD154 gene was rapidly induced without requiring de novo protein synthesis. Pharmacological inhibitors of NF-κB activation down-regulated CD154 mRNA and protein levels. Cyclosporin A, an inhibitor of NF-AT activation, acted similarly, and the effects of both inhibitors were additive. A potential NF-κB binding site is present within the CD154 promoter at positions −1190 to −1181. In electrophoretic mobility shift assays, this sequence was specifically bound by NF-κB present in nuclear extracts from activated T cells. Furthermore, in transient co-transfection of Jurkat T cells, p65 activated the transcription of a reporter construct containing a multimer of this NF-κB binding site. These observations demonstrate a role of NF-κB transcription factors in the regulation of CD40L expression in activated primary human T cells. PMID:11529914

  7. Separate cis-trans pathways post-transcriptionally regulate murine CD154 (CD40 ligand) expression: a novel function for CA repeats in the 3'-untranslated region.

    Science.gov (United States)

    Hamilton, B JoNell; Wang, Xiao-Wei; Collins, Jane; Bloch, Donald; Bergeron, Alan; Henry, Brian; Terry, Benjamin M; Zan, Moe; Mouland, Andrew J; Rigby, William F C

    2008-09-12

    We report a role for CA repeats in the 3'-untranslated region (3'-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3'-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3'-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3'-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3'-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease.

  8. CD4+ T helper cells use CD154-CD40 interactions to counteract T reg cell-mediated suppression of CD8+ T cell responses to influenza.

    Science.gov (United States)

    Ballesteros-Tato, André; León, Beatriz; Lund, Frances E; Randall, Troy D

    2013-07-29

    CD4(+) T cells promote CD8(+) T cell priming by licensing dendritic cells (DCs) via CD40-CD154 interactions. However, the initial requirement for CD40 signaling may be replaced by the direct activation of DCs by pathogen-derived signals. Nevertheless, CD40-CD154 interactions are often required for optimal CD8(+) T cell responses to pathogens for unknown reasons. Here we show that CD40 signaling is required to prevent the premature contraction of the influenza-specific CD8(+) T cell response. CD40 is required on DCs but not on B cells or T cells, whereas CD154 is required on CD4(+) T cells but not CD8(+) T cells, NKT cells, or DCs. Paradoxically, even though CD154-expressing CD4(+) T cells are required for robust CD8(+) T cell responses, primary CD8(+) T cell responses are apparently normal in the absence of CD4(+) T cells. We resolved this paradox by showing that the interaction of CD40-bearing DCs with CD154-expressing CD4(+) T cells precludes regulatory T cell (T reg cell)-mediated suppression and prevents premature contraction of the influenza-specific CD8(+) T cell response. Thus, CD4(+) T helper cells are not required for robust CD8(+) T cell responses to influenza when T reg cells are absent.

  9. C4b binding protein binds to CD154 preventing CD40 mediated cholangiocyte apoptosis: a novel link between complement and epithelial cell survival.

    Directory of Open Access Journals (Sweden)

    Kevin T Williams

    Full Text Available Activation of CD40 on hepatocytes and cholangiocytes is critical for amplifying Fas-mediated apoptosis in the human liver. C4b-Binding Protein (C4BP has been reported to act as a potential surrogate ligand for CD40, suggesting that it could be involved in modulating liver epithelial cell survival. Using surface plasmon resonance (BiaCore analysis supported by gel filtration we have shown that C4BP does not bind CD40, but it forms stable high molecular weight complexes with soluble CD40 ligand (sCD154. These C4BP/sCD154 complexes bound efficiently to immobilised CD40, but when applied to cholangiocytes they failed to induce apoptosis or proliferation or to activate NFkB, AP-1 or STAT 3, which are activated by sCD154 alone. Thus C4BP can modulate CD40/sCD154 interactions by presenting a high molecular weight multimeric sCD154/C4BP complex that suppresses critical intracellular signalling pathways, permitting cell survival without inducing proliferation. Immunohistochemistry demonstrated co-localisation and enhanced expression of C4BP and CD40 in human liver cancers. These findings suggest a novel pathway whereby components of the complement system and TNF ligands and receptors might be involved in modulating epithelial cell survival in chronic inflammation and malignant disease.

  10. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  11. Well sealing via thermite reactions

    Science.gov (United States)

    Lowry, William Edward; Dunn, Sandra Dalvit

    2016-11-15

    A platform is formed in a well below a target plug zone by lowering a thermite reaction charge into the well and igniting it, whereby the products of the reaction are allowed to cool and expand to form a platform or support in the well. A main thermite reaction charge is placed above the platform and ignited to form a main sealing plug for the well. In some embodiments an upper plug is formed by igniting an upper thermite reaction charge above the main thermite reaction charge. The upper plug confines the products of ignition of the main thermite reaction charge.

  12. An outbreak of food poisoning due to egg yolk reaction-negative Staphylococcus aureus.

    Science.gov (United States)

    Miwa, N; Kawamura, A; Masuda, T; Akiyama, M

    2001-03-20

    An outbreak of staphylococcal food poisoning due to an egg yolk (EY) reaction-negative strain occurred in Japan. Twenty-one of 53 dam construction workers who ate boxed lunches prepared at their company cafeteria became ill, and eight required hospital treatment. The outbreak showed a typical incubation time (1.5-4 h with a median time of 2.7 h) and symptoms (vomiting and diarrhea) of staphylococcal food poisoning. Staphylococcus aureus, which produces staphylococcal enterotoxin (SE) A, was isolated from four fecal specimens of eight patients tested. Scrambled egg in the boxed lunches contained 20-40 ng/g of SEA, and 3.0 x 10(9)/g of viable S. aureus cells that produced this toxin. All isolates from patients and the food were EY reaction-negative, coagulase type II, and showed the same restriction fragment length polymorphism (RFLP) pattern. We concluded that the outbreak was caused by scrambled egg contaminated with EY reaction-negative S. aureus. In Japan, outbreaks of staphylococcal food poisoning are mainly caused by EY reaction-positive S. aureus, and EY reaction-negative colonies grown on agar plates containing EY are usually not analyzed further for detection of S. aureus. The present outbreak suggested that EY reaction-negative isolates should be subjected to further analysis to detect the causative agents of staphylococcal food poisoning.

  13. Insect bite reactions

    Directory of Open Access Journals (Sweden)

    Sanjay Singh

    2013-01-01

    Full Text Available Insects are a class of living creatures within the arthropods. Insect bite reactions are commonly seen in clinical practice. The present review touches upon the medically important insects and their places in the classification, the sparse literature on the epidemiology of insect bites in India, and different variables influencing the susceptibility of an individual to insect bites. Clinical features of mosquito bites, hypersensitivity to mosquito bites Epstein-Barr virus NK (HMB-EBV-NK disease, eruptive pseudoangiomatosis, Skeeter syndrome, papular pruritic eruption of HIV/AIDS, and clinical features produced by bed bugs, Mexican chicken bugs, assassin bugs, kissing bugs, fleas, black flies, Blandford flies, louse flies, tsetse flies, midges, and thrips are discussed. Brief account is presented of the immunogenic components of mosquito and bed bug saliva. Papular urticaria is discussed including its epidemiology, the 5 stages of skin reaction, the SCRATCH principle as an aid in diagnosis, and the recent evidence supporting participation of types I, III, and IV hypersensitivity reactions in its causation is summarized. Recent developments in the treatment of pediculosis capitis including spinosad 0.9% suspension, benzyl alcohol 5% lotion, dimethicone 4% lotion, isopropyl myristate 50% rinse, and other suffocants are discussed within the context of evidence derived from randomized controlled trials and key findings of a recent systematic review. We also touch upon a non-chemical treatment of head lice and the ineffectiveness of egg-loosening products. Knockdown resistance (kdr as the genetic mechanism making the lice nerves insensitive to permethrin is discussed along with the surprising contrary clinical evidence from Europe about efficacy of permethrin in children with head lice carrying kdr-like gene. The review also presents a brief account of insects as vectors of diseases and ends with discussion of prevention of insect bites and some

  14. Low Energy Nuclear Reactions?

    CERN Multimedia

    CERN. Geneva; Faccini, R.

    2014-01-01

    After an introduction to the controversial problem of Low Energy Nuclear Reactions (LENR) catalyzed by neutrons on metallic hydride surfaces we present the results of an experiment, made in collaboration with ENEA Labs in Frascati, to search neutrons from plasma discharges in electrolytic cells. The negative outcome of our experiment goes in the direction of ruling out those theoretical models expecting LENR to occur in condensed matter systems under specific conditions. Our criticism on the theoretical foundations of such models will also be presented.

  15. Human circulating group 2 innate lymphoid cells can express CD154 and promote IgE production.

    Science.gov (United States)

    Maggi, Laura; Montaini, Gianni; Mazzoni, Alessio; Rossettini, Beatrice; Capone, Manuela; Rossi, Maria Caterina; Santarlasci, Veronica; Liotta, Francesco; Rossi, Oliviero; Gallo, Oreste; De Palma, Raffaele; Maggi, Enrico; Cosmi, Lorenzo; Romagnani, Sergio; Annunziato, Francesco

    2017-03-01

    Protection against helminths consists of adaptive responses by T H 2 cells and innate responses by group 2 innate lymphoid cells (ILC2s), with these latter being well characterized in mice but less so in human subjects. We sought to characterize human circulating ILC2s and compare their functional profile with that of autologous T H 2 cells. Circulating ILC2s and T H 2 cells were isolated by means of fluorescence-activated cell sorting and magnetic cell sorting and expanded in vitro. ILC2s were then stimulated with phorbol 12-myristate 13-acetate plus ionomycin, IL-25 plus IL-33 (IL-25/IL-33), or a mixture of Toll-like receptor ligands to evaluate their ability to produce cytokines, express CD154, and induce IgE production by autologous B cells. Cytokines and transcription factor gene methylation were assessed. ILC2s expressed GATA-3, retinoic acid orphan receptor (RORC) 2, and RORα; were able to produce IL-5, IL-13, and IL-4; and, accordingly, were characterized by demethylation of IL4, IL13, IL5, GATA3, and RORC2, whereas the IFNG, IFNG promoter, and TBX21 regions of interest were methylated. ILC2s expressed TLR1, TLR4, and TLR6, and TLR stimulation induced IL-5 and IL-13 production. Moreover, ILC2s expressed CD154 in response to phorbol 12-myristate 13-acetate plus ionomycin, IL-25/IL-33, or a mixture of TLR ligands. Stimulated ILC2s also induced IgM, IgG, IgA, and IgE production by B cells. Finally, circulating ILC2s from atopic patients were not different in numbers and frequency but expressed higher IL-4 levels than those from nonatopic subjects. This study provides the first evidence that human ILC2s can express CD154 and stimulate the production of IgE by B lymphocytes through IL-25/IL-33 stimulation or TLR triggering. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  16. Mass Transfer with Chemical Reaction.

    Science.gov (United States)

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  17. Anaphylactic reactions to novel foods

    DEFF Research Database (Denmark)

    Ballardini, Natalia; Nopp, Anna; Hamsten, Carl

    2017-01-01

    an anaphylactic reaction. Cross-reactivity between chicken and crocodile meat was suspected to have triggered this reaction. Basophil activation and immunoglobulin E testing confirmed the boy's allergic reaction to crocodile meat proteins. Molecular analysis identified a crocodile a-parvalbumin, with extensive...

  18. Reactions inside nanoscale protein cages

    NARCIS (Netherlands)

    Bode, Saskia A.; Minten, Inge J.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria

    2011-01-01

    Chemical reactions are traditionally carried out in bulk solution, but in nature confined spaces, like cell organelles, are used to obtain control in time and space of conversion. One way of studying these reactions in confinement is the development and use of small reaction vessels dispersed in

  19. Numerical simulation of the electromagnetic decay of the nuclei {sup 152,154,156}Dy with self-consistent collective strength functions

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain); Khoo, T.L.; Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    1995-06-01

    The electromagnetic decay of the nuclei {sup 152,154,156}Dy is analyzed using microscopic Hartree-Fock calculations at finite temperature. The theoretical collective transition probabilities are implemented in numerical simulations to produce theoretical spectra. Thermal shape fluctuations are also taken into account. The inclusion of these correlation is crucial in order to understand the main features of the collective {ital E}2 spectra of these isotopes at different energies. The theoretical calculations suggest a shape change as responsible for the unusual features of the spectrum of the nucleus {sup 154}Dy at high energy.

  20. Low-energy dipole modes in the heavy deformed nucleus 154Sm via inelastic polarized proton scattering at 0°

    Directory of Open Access Journals (Sweden)

    Poltoratska I.

    2012-12-01

    Full Text Available A high resolution proton scattering experiment has been performed on the heavy deformed nucleus 154Sm at extreme forward angles with 300 MeV polarized protons at RCNP, Osaka. Our scientific goal is to investigate the impact of ground state deformation on the properties of the pygmy dipole resonance and on the spin-M1 resonance showing a double-humped structure in heavy deformed nuclei. The (p, p′ cross sections can be decomposed into E1 and M1 parts in two independent ways based either on a multipole decomposition of the cross sections or on spin-transfer observables as has been demonstrated for the case of 208Pb. We present the method and preliminary results from the analysis of polarization transfer observables.

  1. Experimental investigation of the 0{sub 2}{sup +} band in {sup 154}Sm as a β-vibrational band

    Energy Technology Data Exchange (ETDEWEB)

    Smallcombe, J., E-mail: james.smallcombe@outlook.com [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Davies, P.J.; Barton, C.J.; Jenkins, D.G. [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Andersson, L.L.; Butler, P.A.; Cox, D.M.; Herzberg, R.-D.; Mistry, A.; Parr, E. [Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 9ZE (United Kingdom); Grahn, T.; Greenlees, P.T. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); Hauschild, K. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); CSNSM-IN2P3-CNRS, Université Paris-Sud, 91406 Orsay (France); Herzan, A.; Jakobsson, U.; Jones, P.; Julin, R.; Juutinen, S.; Ketelhut, S.; Leino, M. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); and others

    2014-05-01

    A study of {sup 154}Sm through γ-ray and internal conversion electron coincidence measurements was performed using the Silicon And GErmanium spectrometer (SAGE). An upper limit for the ρ{sup 2}(E0;2{sub 2}{sup +}→2{sub 1}{sup +}) and measurement of the ρ{sup 2}(E0;4{sub 2}{sup +}→4{sub 1}{sup +}) monopole transitions strengths were determined. The extracted transition strength for each is significantly lower than that predicted by either the Bohr and Mottelson β-vibration description or the interacting boson model. Hence, the long standing interpretation of these states as a collective band built on the 0{sub 2}{sup +} state, which is conventionally assigned as a Bohr and Mottelson β vibration is questionable.

  2. Photoluminescence around 1.54 mu m wavelength from Erbium-doped silicon dependence on annealing temperature

    CERN Document Server

    Xu Fei; Cheng Guo An; ZengYuXin; XiaoZhiSong; YiZhongZhen; ZhangTongHe

    2002-01-01

    Er ions were implanted into Si substrates using metal vapor vacuum arc (MEVVA) ion source implanter, and Er-doped Si thin films have been formed after rapid thermal annealing (RTA). It was analyzed by Rutherford back-scattering spectroscopy (RBS) that Er concentrations in the thin films were close to 10 at% corresponding to the level of approx 10 sup 2 sup 1 atoms/cm sup 3 and Er segregation in the surface layer of the thin films appeared with increasing the temperature of RTA. The recovery of irradiation damage, Er segregation and Si solid phase epitaxy of Si amorphous layers were closely dependent on annealing temperature, which would influence on photoluminescence around 1.54 mu m from Er-doped Si thin film

  3. Optical amplification and electroluminescence at 1.54 μm in Er-doped zinc silicate germanate on silicon

    Science.gov (United States)

    Baker, C. C.; Heikenfeld, J.; Yu, Z.; Steckl, A. J.

    2004-03-01

    Optical amplification and electroluminescence at 1.5 μm is reported in Er-doped Zn2Si0.5Ge0.5O4 (ZSG:Er) on silicon. ZSG:Er films were deposited by rf sputtering from a composite target in Ar/O2 mixtures. Channel waveguides were fabricated by plasma etching with Cl/Ar. The refractive index of ZSG:Er was found to be 1.75 at 1.54 μm. Signal enhancement greater than 13 dB and an internal gain of ˜2 dB have been achieved by optically pumping a 4.7 cm ZSG:Er amplifier. Electroluminescence at 1.5 μm was achieved using an ac device structure with a ZSG:Er central layer and upper and lower dielectric layers.

  4. AGR-2 Final Data Qualification Report for U.S. Capsules - ATR Cycles 147A Through 154B

    Energy Technology Data Exchange (ETDEWEB)

    Pham, Binh T. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office; Einerson, Jeffrey J. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office

    2014-07-01

    This report provides the data qualification status of AGR-2 fuel irradiation experimental data in four U.S. capsules from all 15 Advanced Test Reactor (ATR) Cycles 147A, 148A, 148B, 149A, 149B, 150A, 150B, 151A, 151B, 152A, 152B, 153A, 153B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Thus, this report covers data qualification status for the entire AGR-2 irradiation and will replace four previously issued AGR-2 data qualification reports (e.g., INL/EXT-11-22798, INL/EXT-12-26184, INL/EXT-13-29701, and INL/EXT-13-30750). During AGR-2 irradiation, two cycles, 152A and 153A, occurred when the ATR core was briefly at low power, so AGR-2 irradiation data are not used for physics and thermal calculations. Also, two cycles, 150A and 153B, are Power Axial Locator Mechanism (PALM) cycles when the ATR power is higher than during normal cycles. During the first PALM cycle, 150A, the experiment was temporarily moved from the B-12 location to the ATR water canal and during the second PALM cycle, 153B, the experiment was temporarily moved from the B-12 location to the I-24 location to avoid being overheated. During the “Outage” cycle, 153A, seven flow meters were installed downstream from seven Fission Product Monitoring System (FPMS) monitors to measure flows from the monitors and these data are included in the NDMAS database.

  5. Nuclear reactions an introduction

    CERN Document Server

    Paetz gen. Schieck, Hans

    2014-01-01

    Nuclei and nuclear reactions offer a unique setting for investigating three (and in some cases even all four) of the fundamental forces in nature. Nuclei have been shown – mainly by performing scattering experiments with electrons, muons, and neutrinos – to be extended objects with complex internal structures: constituent quarks; gluons, whose exchange binds the quarks together; sea-quarks, the ubiquitous virtual quark-antiquark pairs and, last but not least, clouds of virtual mesons, surrounding an inner nuclear region, their exchange being the source of the nucleon-nucleon interaction.   The interplay between the (mostly attractive) hadronic nucleon-nucleon interaction and the repulsive Coulomb force is responsible for the existence of nuclei; their degree of stability, expressed in the details and limits of the chart of nuclides; their rich structure and the variety of their interactions. Despite the impressive successes of the classical nuclear models and of ab-initio approaches, there is clearly no ...

  6. Reaction Time for Trimolecular Reactions in Compartment-based Reaction-Diffusion Models

    OpenAIRE

    Li, F; Chen, M; Erban, R; Cao, Y

    2016-01-01

    Trimolecular reaction models are investigated in the compartment-based (lattice-based) framework for stochastic reaction-diffusion modelling. The formulae for the first collision time and the mean reaction time are derived for the case where three molecules are present in the solution.

  7. The Glaser–Hay reaction

    DEFF Research Database (Denmark)

    Vilhelmsen, Mie Højer; Jensen, Jonas; Tortzen, Christian

    2013-01-01

    . This unfavorable change in reaction profile could be avoided by adding molecular sieves to the reaction mixture, thereby removing the water that is accumulated from the air and produced in the reaction in which dioxygen acts as the oxidizing agent. Not unexpectedly, the stirring rate, and hence uptake of air (O2......), was found to have a significant effect on the rate of the reaction: The percentage of alkyne remaining after a certain time decreased linearly with the rate of stirring. On the basis of systematic studies, the optimized conditions for the coupling reaction using CuCl/TMEDA as the catalyst system......The oxidative Glaser–Hay coupling of two terminal alkynes to furnish a butadiyne is a key reaction for acetylenic scaffolding. Although the reaction is performed under rather simple conditions [CuCl/TMEDA/O2 (air)], the mechanism is still under debate. Herein we present detailed studies...

  8. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  9. ZNT7 binds to CD40 and influences CD154-triggered p38 MAPK activity in B lymphocytes-a possible regulatory mechanism for zinc in immune function

    Science.gov (United States)

    Zinc deficiency impairs immune system leading to frequent infections. Although it is known that zinc plays critical roles in maintaining healthy immune function, the underlying molecular targets are largely unknown. In this study, we showed that zinc is important for the CD154-CD40-mediated activati...

  10. Prevention of experimental colitis in SCID mice reconstituted with CD45RBhigh CD4+ T cells by blocking the CD40-CD154 interactions

    NARCIS (Netherlands)

    Liu, Z.; Geboes, K.; Colpaert, S.; Overbergh, L.; Mathieu, C.; Heremans, H.; de Boer, M.; Boon, L.; D'Haens, G.; Rutgeerts, P.; Ceuppens, J. L.

    2000-01-01

    Increased expression of CD40 and CD40 ligand (CD40L or CD154) has been found in inflamed mucosa of human inflammatory bowel disease (IBD), and interactions between these molecules seem to be involved in local cytokine production by macrophages. However, the precise role of CD40 signaling in the

  11. Blockade of CD40-CD154 at the time of donor-specific blood transfusion does not lead to prolonged kidney allograft survival in nonhuman primates

    NARCIS (Netherlands)

    Ringers, J; Haanstra, KG; Kroczek, RA; Kliem, K; Kuhn, EM; Wubben, J; Ossevoort, MA; Volk, HD; Jonker, M

    2002-01-01

    Background. In rodents it has been demonstrated that blockade of the CD40-CD154 (CD40L) pathway at the time of donor-specific blood transfusion (DST) can result in indefinite graft survival. Because it has been reported in the past that DST in monkeys can have a favorable effect on graft outcome and

  12. LHC dipoles flood into CERN : the dipole nr 154 crowns the efforts of the LHC teams for increasing the fabrication rate of the magnets.

    CERN Multimedia

    Maximilien Brice

    2003-01-01

    On 3 December the "tableau" on the 4th floor in building 30 indicated 1078 dipoles to completion - or in other words, 154 dipoles had by this day been delivered to CERN, enough to complete the first octant of the machine. CERN has also now received enough superconducting cable - the "heart" of the magnets - for 600 dipoles, nearly half the total number of 1232.

  13. Suppression effect of silicon (Si on Er3+ 1.54μm excitation in ZnO thin films

    Directory of Open Access Journals (Sweden)

    Bo Xu

    2016-08-01

    Full Text Available We have investigated the photoluminescence (PL characteristics of ZnO:Er thin films on Si (100 single crystal and SiO2-on-silicon (SiO2 substrates, synthesized by radio frequency magnetron sputtering. Rutherford backscattering/channeling spectrometry (RBS, X-ray diffraction (XRD and atomic force microscope (AFM were used to analyze the properties of thin films. The diffusion depth profiles of Si were determined by second ion mass spectrometry (SIMS. Infrared spectra were obtained from the spectrometer and related instruments. Compared with the results at room temperature (RT, PL (1.54μm intensity increased when samples were annealed at 250°C and decreased when at 550°C. A new peak at 1.15μm from silicon (Si appeared in 550°C samples. The Si dopants in ZnO film, either through the diffusion of Si from the substrate or ambient, directly absorbed the energy of pumping light and resulted in the suppression of Er3+ 1.54μm excitation. Furthermore, the energy transmission efficiency between Si and Er3+ was very low when compared with silicon nanocrystal (Si-NC. Both made the PL (1.54μm intensity decrease. All the data in experiments proved the negative effects of Si dopants on PL at 1.54μm. And further research is going on.

  14. Preaggregation reactions of platelets.

    Science.gov (United States)

    Gear, A R

    1981-09-01

    Whether platelet volume increases during the morphological changes preceding aggregation has been investigated. Previous research is controversial; resistive-counting techniques reveal an increase, centrifugal methods do not. Platelets were sized with a computerized, resistive-particle counter before and after incubation with adenosine diphosphate (ADP). Resistive volume increased by 14% (p less than 0.001) in the absence of EDTA, and only 7% in its presence (ADP, 10 micro M). EDTA inhibited platelet volume changes, whether these were shrinking induced by warming or swelling by ADP. Handling of platelets, such as during centrifugation, also caused particle swelling. Particle density decreased after ADP exposure, without release of serotonin, suggesting uptake of water. Platelet shape was experimentally manipulated to test the hypothesis that resistive volume changes stem from artifacts of particle shape. Scanning electron microscopy confirmed that colchicine, chlorpromazine, and a temperature cycle of 0 degrees to 37 degrees all caused extensive alteration from the disc shape. Subsequent exposure to ADP increased resistive volume, and in the case of chlorpromazine, no long pseudopodia were extruded. It is concluded that preaggregation reactions of platelets can be associated with an increase in particle volume, and that earlier research based on centrifugation and the presence of ETA failed to reveal the increase because of inhibitory and apparent swelling effects.

  15. Adverse Reactions to Biologic Therapy.

    Science.gov (United States)

    Patel, Sheenal V; Khan, David A

    2017-05-01

    Biologic therapies are emerging as a significant therapeutic option for many with debilitating inflammatory and autoimmune conditions. As expansion in the number of FDA-approved agents continue to be seen, more unanticipated adverse reactions are likely to occur. Currently, the diagnostic tools, including skin testing and in vitro testing, to evaluate for immediate hypersensitivity reactions are insufficient. In this review, management strategies for common acute infusion reactions, injection site reactions, and immediate reactions suggestive of IgE-mediated mechanisms are discussed. Desensitization can be considered for reactions suggestive of IgE-mediated mechanisms, but allergists/immunologists should be involved in managing these patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. The Progression of Sequential Reactions

    Directory of Open Access Journals (Sweden)

    Jack McGeachy

    2010-01-01

    Full Text Available Sequential reactions consist of linked reactions in which the product of the first reaction becomes the substrate of a second reaction. Sequential reactions occur in industrially important processes, such as the chlorination of methane. A generalized series of three sequential reactions was analyzed in order to determine the times at which each chemical species reaches its maximum. To determine the concentration of each species as a function of time, the differential rate laws for each species were solved. The solution of each gave the concentration curve of the chemical species. The concentration curves of species A1 and A2 possessed discreet maxima, which were determined through slope-analysis. The concentration curve of the final product, A3, did not possess a discreet maximum, but rather approached a finite limit.

  17. The Paterno-Buchi reaction

    DEFF Research Database (Denmark)

    Brogaard, Rasmus Yding; Schalk, Oliver; Boguslavskiy, Andrey E.

    2012-01-01

    The Paternò-Büchi (PB) reaction between an excited carbonyl compound and an alkene has been widely studied, but so far little is known about the excited-state dynamics of the reaction. In this investigation, we used a compound in which a formyl and a vinyl group are attached to a [2.......2]paracyclophane in order to obtain a model system in pre-reactive conformation for the PB reaction. We studied the excited-state dynamics of the isolated molecule in a molecular beam using femtosecond time-resolved photoelectron spectroscopy and ab initio calculations. The results show that inter-system crossing...... within two picoseconds competes efficiently with the reaction in the singlet manifold. Thus, the PB reaction in this model system takes place in the triplet state on a time scale of nanoseconds. This result stresses the importance of triplet states in the excited-state pathway of the PB reaction...

  18. Functional Interaction of CD154 Protein with α5β1 Integrin Is Totally Independent from Its Binding to αIIbβ3 Integrin and CD40 Molecules*

    Science.gov (United States)

    El Fakhry, Youssef; Alturaihi, Haydar; Yacoub, Daniel; Liu, Lihui; Guo, Wenyan; Leveillé, Claire; Jung, Daniel; Khzam, Lara Bou; Merhi, Yahye; Wilkins, John A.; Li, Hongmin; Mourad, Walid

    2012-01-01

    In addition to its classical CD40 receptor, CD154 also binds to αIIbβ3, α5β1, and αMβ2 integrins. Binding of CD154 to these receptors seems to play a key role in the pathogenic processes of chronic inflammation. This investigation was aimed at analyzing the functional interaction of CD154 with CD40, αIIbβ3, and α5β1 receptors. We found that the binding affinity of CD154 for αIIbβ3 is ∼4-fold higher than for α5β1. We also describe the generation of sCD154 mutants that lost their ability to bind CD40 or αIIbβ3 and show that CD154 residues involved in its binding to CD40 or αIIbβ3 are distinct from those implicated in its interaction to α5β1, suggesting that sCD154 may bind simultaneously to different receptors. Indeed, sCD154 can bind simultaneously to CD40 and α5β1 and biologically activate human monocytic U937 cells expressing both receptors. The simultaneous engagement of CD40 and α5β1 activates the mitogen-activated protein kinases, p38, and extracellular signal-related kinases 1/2 and synergizes in the release of inflammatory mediators MMP-2 and -9, suggesting a cross-talk between these receptors. PMID:22461623

  19. Nuclear astrophysics from direct reactions

    Energy Technology Data Exchange (ETDEWEB)

    Bertulani, C. [Department of Physics, Texas A and M University, Commerce, TX 75429 (United States)]. e-mail: carlos_bertulani@tamu-commerce.edu

    2008-12-15

    Accurate nuclear reaction rates are needed for primordial nucleosynthesis and hydrostatic burning in stars. The relevant reactions are extremely difficult to measure directly in the laboratory at the small astrophysical energies. In recent years direct reactions have been developed and applied to extract low-energy astrophysical S-factors. These methods require a combination of new experimental techniques and theoretical efforts, which are the subject of this presentation. (Author)

  20. Stochastic Modeling Of Biochemical Reactions

    Science.gov (United States)

    2006-11-01

    STOCHASTIC MODELING OF BIOCHEMICAL REACTIONS Abhyudai Singh and João Pedro Hespanha* Department of Electrical and Computer Engineering University of...procedure for con- structing approximate stochastic models for chemical reactions used for modeling biochemical processes such as gene regulatory networks... biochemical reactions , the modeling tools developed in this paper can be applied to a very general class of stochastic systems, in particular