WorldWideScience

Sample records for samarium 149 target

  1. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  2. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  3. Folate Receptor Targeted Alpha-Therapy Using Terbium-149

    CERN Document Server

    Müller, Cristina; Haller, Stephanie; Dorrer, Holger; Köster, Ulli; Johnston, Karl; Zhernosekov, Konstantin; Türler, Andreas; Schibli, Roger

    2014-01-01

    Terbium-149 is among the most interesting therapeutic nuclides for medical applications. It decays by emission of short-range α-particles (Eα = 3.967 MeV) with a half-life of 4.12 h. The goal of this study was to investigate the anticancer efficacy of a 149Tb-labeled DOTA-folate conjugate (cm09) using folate receptor (FR)-positive cancer cells in vitro and in tumor-bearing mice. 149Tb was produced at the ISOLDE facility at CERN. Radiolabeling of cm09 with purified 149Tb resulted in a specific activity of ~1.2 MBq/nmol. In vitro assays performed with 149Tb-cm09 revealed a reduced KB cell viability in a FR-specific and activity concentration-dependent manner. Tumor-bearing mice were injected with saline only (group A) or with 149Tb-cm09 (group B: 2.2 MBq; group C: 3.0 MBq). A significant tumor growth delay was found in treated animals resulting in an increased average survival time of mice which received 149Tb-cm09 (B: 30.5 d; C: 43 d) compared to untreated controls (A: 21 d). Analysis of blood parameters rev...

  4. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  5. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  6. Investigation on the production and isolation of {sup 149,150,151}Tb from {sup 12}C irradiation natural praseodymium target

    Energy Technology Data Exchange (ETDEWEB)

    Maiti, M.; Lahiri, S. [Saha Institute of Nuclear Physics, Kolkata (India). Chemical Sciences Div.; Tomar, B.S. [Bhabha Atomic Research Centre, Mumbai (India). Radiochemistry Div.

    2011-07-01

    Short lived {alpha}-emitting radionuclides have enormous potential to be used in the targeted therapy. 149Tb (4.118 h) is among the few {alpha}-emitting radionuclides which are projected for human clinical use. Therefore, direct production of {sup 149}Tb was aimed from the {sup 12}C induced reaction on natural praseodymium target of 15 mg/cm{sup 2} thickness at 71.5 MeV incident beam energy. No-carrier-added (nca) {sup 149,150,151}Tb radionuclides were produced in the target matrix along with {sup 149}Gd, which is also the decay product of {sup 149}Tb, with relatively high yield of {sup 149}Tb. An efficient radiochemical separation method was developed to separate nca {sup 149-151}Tb from bulk praseodymium and coproduced Gd by liquid-liquid extraction (LLX) using aqueous HCl and liquid cation extracting agent di-(2-ethylhexyl)phosphoric acid (HDEHP) dissolved in cyclohexane. Quantitative extraction of nca {sup 149-151}Tb was achieved from bulk target with a high separation factor of 4.7 x 10{sup 5}. (orig.)

  7. Targeting of GIT1 by miR-149* in breast cancer suppresses cell proliferation and metastasis in vitro and tumor growth in vivo

    Directory of Open Access Journals (Sweden)

    Dong Y

    2017-12-01

    Full Text Available Yan Dong,1,* Cai Chang,2,* Jingtian Liu,3 Jinwei Qiang4 1Department of Ultrasonography, Jinshan Hospital, 2Department of Ultrasonography, Cancer Center, 3Department of General Surgery, 4Department of Radiology, Jinshan Hospital, Fudan University, Shanghai, China *These authors contributed equally to this work Abstract: Breast cancer remains a major cause of cancer-related death in women worldwide. Dysregulation of microRNAs (miRNAs is involved in the initiation and progression of breast cancer. Moreover, it was found that GIT1 was widely involved in the development of many human cancers. Herein, we aimed to investigate the expression changes of miR-149* and GIT1 and the functional effects of miR-149*/GIT1 link in breast cancer. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR and Western blot (WB were used to examine the expression levels of miR-149* and GIT1. Dual luciferase reporter assay was utilized to confirm the target interaction between miR-149* and GIT1. The biological functions, including cell proliferation, invasion, and migration, of miR-149* and GIT1 were determined by MTT assay and Transwell assays, respectively. Eventually, the tumor xenograft model in nude mice injected with stable transfected MDA-MB-231 cells was established to verify the effects of miR-149* and GIT1 on tumor growth. Our results showed that miR-149* expression was decreased, whereas GIT1 expression was increased in clinical samples of breast cancer. Based on the inverse expression trend between miR-149* and GIT1, we further demonstrated that miR-149* indeed directly targets GIT1. Subsequently, it was observed that inhibition of miR-149* significantly promoted cell proliferation, invasion, and migration, but the ability of cell proliferation, invasion, and migration was obviously declined after silencing of GIT1 in MDA-MB-231 cells transfected with miR-149* mimic and/or si-GIT1. Finally, it was also found that elevated miR-149* decelerated

  8. EphB3-targeted regulation of miR-149 in the migration and invasion of human colonic carcinoma HCT116 and SW620 cells.

    Science.gov (United States)

    Zhang, Guodong; Liu, Xiaozhu; Li, Yinfeng; Wang, Yan; Liang, Huankun; Li, Kangyan; Li, Laiqing; Chen, Cuicui; Sun, Wenqiao; Ren, Shoulei; Zhu, Pengfei; Zhang, Licheng

    2017-03-01

    microRNAs play key roles during various crucial cell processes such as proliferation, migration, invasion and apoptosis. Also, microRNAs have been shown to possess oncogenic and tumor-suppressive functions in human cancers. Here, we describe the regulation and function of miR-149 in colorectal cancer cell lines. miR-149 expression patterns were detected in human colorectal cell lines and tissue samples, and then focused on its role in regulation of cell growth, migration, invasion, and its target gene identification. Furthermore, the function of the target gene of miR-149 was analyzed in vitro and in vivo. miR-149 expression was downregulated in human colorectal cancer HCT116 and SW620 cell lines compared to the normal colon epithelial NCM460 cell line using quantitative real-time polymerase chain reaction methods. Further studies indicated that introduction of miR-149 was able to suppress cell migration and invasion. Then, EphB3 was identified as a direct target gene of miR-149 in colorectal cancer cells. Moreover, experiments in vitro showed that knockdown expression of EphB3 could suppress cell proliferation and invasion, and ectopic expression of EphB3 restored the phenotypes of CRC cell lines transfected with miR149. In addition, silencing of EphB3 significantly affected cycle progression distribution and increased apoptosis in CRC cell lines. Finally, in vivo results demonstrated that knockdown of EphB3 by siRNA inhibited tumor growth. In conclusion,the important role of miR-149 in colorectal cancer progression suggesting that miR-149 may serve as a therapeutic target for colorectal cancer treatment. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  9. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  10. Xe-135 and Sm-149 Isotopic Evolution Analysis Xesamo code; Analisis de la Evolucion Isotopica del Xe-135 y Sm-149. Programa Xesamo

    Energy Technology Data Exchange (ETDEWEB)

    Caro, R.; Gallego, J.; Martinez Fanegas, R.

    1977-07-01

    In this report the time evolution analysis of the nuclides concentration Xe-135 and Sm-149 as a function of the neutron flux is carried out. The neutron flux may be any function of time. It is analyzed as well the reactivity changes associated with the xenon and samarium concentration variations. (Author) 5 refs.

  11. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  12. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  13. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  14. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  15. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  16. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  17. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  18. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  19. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  20. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  2. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  3. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  4. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  5. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  6. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  7. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  8. 21 CFR 133.149 - Gruyere cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Gruyere cheese. 133.149 Section 133.149 Food and... CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.149 Gruyere cheese. (a) Description. (1) Gruyere cheese is the food prepared by the...

  9. 19 CFR 149.3 - Data elements.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Data elements. 149.3 Section 149.3 Customs Duties... (CONTINUED) IMPORTER SECURITY FILING § 149.3 Data elements. (a) Shipments intended to be entered into the... provided for in paragraph (b) of this section, the following elements must be provided for each good listed...

  10. 21 CFR 131.149 - Dry cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dry cream. 131.149 Section 131.149 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.149 Dry cream. (a) Description. Dry cream is the product obtained by removal of water only from pasteurized milk or cream or a...

  11. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  12. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  13. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  14. 9 CFR 149.2 - Program participation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Program participation. 149.2 Section... AGRICULTURE LIVESTOCK IMPROVEMENT VOLUNTARY TRICHINAE CERTIFICATION PROGRAM § 149.2 Program participation. A producer's initial enrollment and continued participation in the Trichinae Certification Program requires...

  15. 9 CFR 149.6 - Slaughter facilities.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Slaughter facilities. 149.6 Section... AGRICULTURE LIVESTOCK IMPROVEMENT VOLUNTARY TRICHINAE CERTIFICATION PROGRAM § 149.6 Slaughter facilities. Only slaughter facilities that are under continuous inspection by the Food Safety and Inspection Service or under...

  16. 17 CFR 149.140 - Employment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Employment. 149.140 Section... COMMISSION § 149.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment under any program or activity conducted by the agency. The...

  17. Dicty_cDB: SFK149 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFK149 (Link to dictyBase) - - - Contig-U16471-1 SFK149F (Link to Original site) SF...K149F 545 - - - - - - Show SFK149 Library SF (Link to library) Clone ID SFK149 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SF/SFK1-C/SFK149Q.Seq.d/ Representative seq. ID SFK14...9F (Link to Original site) Representative DNA sequence >SFK149 (SFK149Q) /CSM/SF/SFK1-C/SFK149Q.Seq.d/ AAATA...ted Amino Acid sequence nnkftik*lfflfflfkv*iieiikinikkkerlkkkrflflflklv*LKMYSKKYTSFV IVLILSCIISTCXSNQISEDVGK

  18. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  20. Lanthanides in Nuclear Medicine. The Production of Terbium-149 by Heavy Ion Beams

    CERN Document Server

    Dmitriev, S N; Zaitseva, N G; Maslov, O D; Molokanova, L G; Starodub, G Ya; Shishkin, S V; Shishkina, T V

    2001-01-01

    Among radioactive isotopes of lanthanide series elements, finding the increasing using in nuclear medicine, alpha-emitter {149}Tb (T_{1/2} = 4.118 h; EC 76.2 %; beta^+ 7.1 %; alpha 16.7 %) is considered as a perspective radionuclide for radioimmunotherapy. The aim of the present work is to study experimental conditions of the {149}Tb production in reactions Nd({12}C, xn){149}Dy (4.23 min; beta^+, EC)\\to {149}Tb when the Nd targets have been irradiated by heavy ions of carbon. On the basis of results of formation and decay of {149}Dy\\to{149}Tb evaluation of the {149}Tb activity, is made which can be received under optimum conditions (enriched {142}Nd target, {12}C ions with the energy 120 MeV and up to current 100 mu A, time of irradiating 8-10 hours). Under these conditions {149}Tb can be obtained up to 30 GBq (up to 0.8 Ci).

  1. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  2. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  3. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. 41 CFR 101-26.4901-149 - Standard Form 149, U.S. Government National Credit Card.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Standard Form 149, U.S. Government National Credit Card. 101-26.4901-149 Section 101-26.4901-149 Public Contracts and Property... 149, U.S. Government National Credit Card. Note: The form illustrated in § 101-26.4901-149 is filed as...

  5. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  6. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  7. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  8. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  9. Dicty_cDB: SLJ149 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ149 (Link to dictyBase) - - - Contig-U13849-1 SLJ149Z (Link... to Original site) - - SLJ149Z 280 - - - - Show SLJ149 Library SL (Link to library) Clone ID SLJ149 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLJ1-C/SLJ149Q.Seq.d/ Representative seq. ID SLJ14...9Z (Link to Original site) Representative DNA sequence >SLJ149 (SLJ149Q) /CSM/SL/SLJ1-C/SLJ149Q.Seq.d/ XXXXX...ue SSH808 (SSH808Q) /CSM/SS/SSH8-A/SSH808Q.Seq.d/ 466 e-131 SLJ730 (SLJ730Q) /CSM/SL/SLJ7-B/SLJ730Q.Seq.d/ 466 e-131 SLJ149 (SLJ

  10. Dicty_cDB: CHR149 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR149 (Link to dictyBase) - G21933 DDB0233312 Contig-U11933-1 CHR...149P (Link to Original site) CHR149F 592 CHR149Z 594 CHR149P 1166 - - Show CHR149 Library CH (Link to library) Clone ID CHR...Contig-U11933-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-C/CHR...149Q.Seq.d/ Representative seq. ID CHR149P (Link to Original site) Representative DNA sequence >CHR149 (CHR149Q) /CSM/CH/CHR...1-C/CHR149Q.Seq.d/ TATAATACAATTAAAAACAGAAACAGATTATGTTAAAAATTTAAATATATGTATAAAATT TTATATG

  11. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  12. Syndecan-1 responsive microRNA-126 and 149 regulate cell proliferation in prostate cancer

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tomomi; Shimada, Keiji [Department of Pathology, Nara Medical University School of Medicine, Nara (Japan); Tatsumi, Yoshihiro [Department of Pathology, Nara Medical University School of Medicine, Nara (Japan); Department of Urology, Nara Medical University School of Medicine, Nara (Japan); Fujimoto, Kiyohide [Department of Urology, Nara Medical University School of Medicine, Nara (Japan); Konishi, Noboru, E-mail: nkonishi@naramed-u.ac.jp [Department of Pathology, Nara Medical University School of Medicine, Nara (Japan)

    2015-01-02

    Highlights: • Syndecan-1 is highly expressed in androgen independent prostate cancer cells, PC3. • Syndecan-1 regulates the expression of miR-126 and -149 in prostate cancer cells. • MiR-126 and 149 control cell growth via p21 induction and senescence mechanism. • MiR-126 and 149 promote cell proliferation by suppressing SOX2, NANOG, and Oct4. - Abstract: MicroRNAs (miRNAs) are short (19–24 nt), low molecular weight RNAs that play important roles in the regulation of target genes associated with cell proliferation, differentiation, and development, by binding to the 3′-untranslated region of the target mRNAs. In this study, we examined the expression of miRNA-126 (miR-126) and miR-149 in prostate cancer, and investigated the molecular mechanisms by which they affect syndecan-1 in prostate cancer. Functional analysis of miR-126 and miR-149 was conducted in the prostate cancer cell lines, PC3, Du145, and LNCaP. The expression levels of SOX2, NANOG, Oct4, miR-126 and miR-149 were evaluated by quantitative RT-PCR. After silencing syndecan-1, miR-126, and/or miR-149 in the PC3 cells, cell proliferation, senescence, and p21 induction were assessed using the MTS assay, senescence-associated β-galactosidase (SA-β-Gal) assay, and immunocytochemistry, respectively. Compared to the Du145 and LNCaP cells, PC3 cells exhibited higher expression of syndecan-1. When syndecan-1 was silenced, the PC3 cells showed reduced expression of miR-126 and miR-149 most effectively. Suppression of miR-126 and/or miR-149 significantly inhibited cell growth via p21 induction and subsequently, induced senescence. The mRNA expression levels of SOX2, NANOG, and Oct4 were significantly increased in response to the silencing of miR-126 and/or miR-149. Our results suggest that miR-126 and miR-149 are associated with the expression of syndecan-1 in prostate cancer cells. These miRNAs promote cell proliferation by suppressing SOX2, NANOG, and Oct4. The regulation of these factors by mi

  13. Study of the sub 64 sup 149 Gd yields sub 63 sup 149 Eu yields sub 62 sup 149 Sm decay chain

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera, J.A.; Ortiz, M. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Shaw, M.; Williart, A. (Dept. Fisica de Materiales, UNED, Madrid (Spain)); Gomez del Campo, J.C.; Campos, J. (Catedra de Fisica Atomica, Univ. Complutense, Madrid (Spain))

    1992-02-01

    A study has been made of the gamma-ray and conversion-electron spectra in the decay chain {sup 149}Gd(9.4 d){yields}{sup 149}Eu(93.1 d){yields}{sup 149}Sm, following the electron-capture decay of {sup 149}Tb. Gamma-ray and conversion-electron emission probabilities were measured with a double-focussing magnetic spectrometer, and internal conversion coefficients, multipolarities and mixing ratios were deduced for several transitions of {sup 149}Eu and {sup 149}Sm. These values have been compared with previously published data. Gamma-ray emission probabilities have also been measured for {sup 145}Sm, {sup 145}Pm and {sup 145}Nd, which originated via the alpha-decay branch of {sup 149}Tb. (orig.).

  14. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  15. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  16. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  17. Emission channeling experiments from the decay of $^{149}$Gd to $^{149}$Eu in GaN

    CERN Document Server

    De Vries, B; Vantomme, A; Correia, J G

    2003-01-01

    The lattice site location of excited states of $^{149}$Eu was studied by means of the emission channeling technique. 60 keV implantation of $^{149}$Tb into a GaN thin film was performed at room temperature up to a dose of 2.0 $\\times 10^{13}$ cm$^{-2}$. This radioactive isotope eventually decays into short-lived excited states of $^{149}$Eu. The conversion electrons emitted in the subsequent decay to the $^{149}$Eu ground state were detected with a position sensitive detector. We measured their angular distributions around the [0001], [1102], [1101] and [2113] axes in the as-implanted state and after 600°C and 900°C vacuum annealing. Already in the as-implanted state around 65% of $^{149^{*}}$Eu atoms were found on substitutional Ga sites. The root mean square (rms) displacements from the substitutional sites in the as-implanted state were found to be around 0.13-0.16 . Annealing up to 600$^\\circ$C increased the substitutional fraction by a few percent and slightly reduced the rms displacements, most likely...

  18. Dicty_cDB: CHF149 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF149 (Link to dictyBase) - - - Contig-U12194-1 - (Link to Original site) - - CHF1...49Z 641 - - - - Show CHF149 Library CH (Link to library) Clone ID CHF149 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHF1-C/CHF149Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHF149 (CHF149Q) /CSM/CH/CHF1-C/CHF149Q.Seq.d/ XXXXXXXXXXGAAGAAA...vks *kh*ylpir*yccs**ik*rinsfttlxd**x Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHF1

  19. 45 CFR 149.300 - General reimbursement rules.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false General reimbursement rules. 149.300 Section 149.300 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS REQUIREMENTS FOR THE EARLY RETIREE REINSURANCE PROGRAM Reimbursement Methods § 149.300 General reimbursement...

  20. 40 CFR 1.49 - Office of Water.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Office of Water. 1.49 Section 1.49... INFORMATION Headquarters § 1.49 Office of Water. The Office of Water, under the supervision of the Assistant Administrator for Water who serves as the principal adviser to the Administrator in matters pertaining to water...

  1. 19 CFR 149.4 - Bulk and break bulk cargo.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Bulk and break bulk cargo. 149.4 Section 149.4... TREASURY (CONTINUED) IMPORTER SECURITY FILING § 149.4 Bulk and break bulk cargo. (a) Bulk cargo exempted.... (b) Break bulk cargo exempted from time requirement. For break bulk cargo that is exempt from the...

  2. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  3. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  4. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  5. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  6. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  7. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  8. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  9. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  10. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  11. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  12. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  13. 7 CFR 1260.149 - Powers of the Board.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Powers of the Board. 1260.149 Section 1260.149 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... United States or any agency thereof, in general obligations of any State or any political subdivision...

  14. 24 CFR 9.149 - Program accessibility: discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Program accessibility: discrimination prohibited. 9.149 Section 9.149 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF DISABILITY IN...

  15. Dicty_cDB: VSH149 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ii* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSH149 (VSH149Q) /...ogy vs DNA Score E Sequences producing significant alignments: (bits) Value N X52...ology vs Protein Score E Sequences producing significant alignments: (bits) Value (Q2LCR4) RecName: Full=NAD

  16. 7 CFR 929.149 - Determination of sales history.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Determination of sales history. 929.149 Section 929.149 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE CRANBERRIES...

  17. 9 CFR 149.0 - Purpose and scope.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Purpose and scope. 149.0 Section 149.0 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... slaughter facilities and other persons that handle or process swine from pork production sites that have...

  18. 22 CFR 1600.149 - Program accessibility: Discrimination prohibited.

    Science.gov (United States)

    2010-04-01

    .... 1600.149 Section 1600.149 Foreign Relations JAPAN-UNITED STATES FRIENDSHIP COMMISSION ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE JAPAN-UNITED STATES FRIENDSHIP... unusable by handicapped persons, be denied the benefits of, be excluded from participation in, or otherwise...

  19. 40 CFR 149.3 - Critical Aquifer Protection Areas.

    Science.gov (United States)

    2010-07-01

    ....3 Section 149.3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) SOLE SOURCE AQUIFERS Criteria for Identifying Critical Aquifer Protection Areas § 149.3 Critical... ground-water quality protection plan was approved, under section 208 of the Clean Water Act, prior to...

  20. Synthesis and Preliminary Biological Evaluations of Fluorescent or 149Promethium Labeled Trastuzumab-Polyethylenimine

    Directory of Open Access Journals (Sweden)

    Jonathan Fitzsimmons

    2015-12-01

    Full Text Available Background: Radioimmunotherapy utilize a targeting antibody coupled to a therapeutic isotope to target and treat a tumor or disease. In this study we examine the synthesis and cell binding of a polymer scaffold containing a radiotherapeutic isotope and a targeting antibody. Methods: The multistep synthesis of a fluorescent or 149Promethium-labeled Trastuzumab-polyethyleneimine (PEI, Trastuzumab, or PEI is described. In vitro uptake, internalization and/or the binding affinity to the Her2/neu expressing human breast adenocarcinoma SKBr3 cells was investigated with the labeled compounds. Results: Fluorescent-labeled Trastuzumab-PEI was internalized more into cells at 2 and 18 h than fluorescent-labeled Trastuzumab or PEI. The fluorescent-labeled Trastuzumab was concentrated on the cell surface at 2 and 18 h and the labeled PEI had minimal uptake. DOTA-PEI was prepared and contained an average of 16 chelates per PEI; the compound was radio-labeled with 149Promethium and conjugated to Trastuzumab. The purified 149Pm-DOTA-PEI-Trastuzumab had a radiochemical purity of 96.7% and a specific activity of 0.118 TBq/g. The compound demonstrated a dissociation constant for the Her2/neu receptor of 20.30 ± 6.91 nM. Conclusion: The results indicate the DOTA-PEI-Trastuzumab compound has potential as a targeted therapeutic carrier, and future in vivo studies should be performed.

  1. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  2. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  3. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  4. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  5. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  6. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  7. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  8. Phenotype abnormality: 149 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 149 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u655i decreased efficiency... in organ named hypocotyl during process named growth ... hypocotyl ... decreased efficiency ... growth ...

  9. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  10. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  11. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  12. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  13. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  14. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  15. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  16. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  17. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  18. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. 38 CFR 17.149 - Sensori-neural aids.

    Science.gov (United States)

    2010-07-01

    ... medical treatment. (c) VA will furnish needed hearing aids to those veterans who have service-connected... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Sensori-neural aids. 17... Prosthetic, Sensory, and Rehabilitative Aids § 17.149 Sensori-neural aids. (a) Notwithstanding any other...

  20. 40 CFR 149.106 - Notice of review.

    Science.gov (United States)

    2010-07-01

    ....106 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... Source Aquifer in the San Antonio, Texas Area § 149.106 Notice of review. (a) Notice to Federal agency... deems appropriate. The notice shall set forth the availability for public review of all data and...

  1. 33 CFR 149.405 - How are fire extinguishers classified?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false How are fire extinguishers... Fire Protection Equipment Firefighting Requirements § 149.405 How are fire extinguishers classified? (a) Portable and semi-portable extinguishers on a manned deepwater port must be classified using the Coast...

  2. 17 CFR 149.150 - Program accessibility: Existing facilities.

    Science.gov (United States)

    2010-04-01

    ... of achieving program accessibility include— (i) Using audio-visual materials and devices to depict...) Require the agency to take any action that it can demonstrate would result in a fundamental alteration in... proving that compliance with § 149.150(a) would result in such alteration or burdens. The decision that...

  3. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  4. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  5. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  6. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  7. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  8. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  9. 33 CFR 149.323 - What are the requirements for first aid kits?

    Science.gov (United States)

    2010-07-01

    ... first aid kits? 149.323 Section 149.323 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... Lifesaving Equipment Manned Deepwater Port Requirements § 149.323 What are the requirements for first aid kits? (a) Each manned deepwater port must have an industrial first aid kit, approved by an appropriate...

  10. 33 CFR 149.336 - What are the requirements for lifejackets?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the requirements for lifejackets? 149.336 Section 149.336 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Equipment Unmanned Deepwater Port Requirements § 149.336 What are the requirements for lifejackets? (a...

  11. 40 CFR 61.149 - Standard for waste disposal for asbestos mills.

    Science.gov (United States)

    2010-07-01

    ... asbestos mills. 61.149 Section 61.149 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Standard for Asbestos § 61.149 Standard for waste disposal for asbestos mills. Each owner or operator of any source covered under the provisions of § 61.142 shall: (a) Deposit all asbestos-containing waste...

  12. 33 CFR 149.319 - What additional lifejackets must I have?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What additional lifejackets must I have? 149.319 Section 149.319 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Equipment Manned Deepwater Port Requirements § 149.319 What additional lifejackets must I have? For each...

  13. 33 CFR 149.580 - What are the requirements for a radar beacon?

    Science.gov (United States)

    2010-07-01

    ... radar beacon? 149.580 Section 149.580 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... Navigation Miscellaneous § 149.580 What are the requirements for a radar beacon? (a) A radar beacon (RACON... Morse code character, the length of which does not exceed 25 percent of the radar range expected to be...

  14. 33 CFR 149.335 - When are people prohibited from being on an unmanned deepwater port?

    Science.gov (United States)

    2010-07-01

    ... being on an unmanned deepwater port? 149.335 Section 149.335 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Unmanned Deepwater Port Requirements § 149.335 When are people prohibited...

  15. 33 CFR 149.325 - What emergency communications equipment must be on a manned deepwater port?

    Science.gov (United States)

    2010-07-01

    ... equipment must be on a manned deepwater port? 149.325 Section 149.325 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Manned Deepwater Port Requirements § 149.325 What emergency...

  16. 33 CFR 149.321 - How many ring life buoys must be on each deepwater port?

    Science.gov (United States)

    2010-07-01

    ... on each deepwater port? 149.321 Section 149.321 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Manned Deepwater Port Requirements § 149.321 How many ring life buoys must be...

  17. 33 CFR 149.334 - Who must ensure compliance with the requirements for unmanned deepwater ports?

    Science.gov (United States)

    2010-07-01

    ... the requirements for unmanned deepwater ports? 149.334 Section 149.334 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Unmanned Deepwater Port Requirements § 149.334 Who must ensure...

  18. 33 CFR 149.308 - What are the requirements for liferafts?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the requirements for liferafts? 149.308 Section 149.308 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND..., must be davit-launched or served by a marine evacuation system complying with § 149.309 to this subpart. ...

  19. 45 CFR 149.320 - Universe of claims that must be submitted.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Universe of claims that must be submitted. 149.320 Section 149.320 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH... Universe of claims that must be submitted. (a) Claims submitted for an early retiree, as defined in § 149.2...

  20. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  1. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  2. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  3. Hydrates removal during the exploration evaluation of the 3-SES-149A well; Remocao de hidrato na avaliacao exploratoria do poco 3-SES-149A

    Energy Technology Data Exchange (ETDEWEB)

    Barros Filho, Armando F.; Franco, Marcus L. de A. [PETROBRAS, Rio de Janeiro, RJ (Brazil); Gomes, Luiz A.Q.M. [Schlumberger, Rio de Janeiro, RJ (Brazil)

    2004-07-01

    The 3-SES-149A well, at a water depth of 1164 meters, is part of the SEAL-100 block located offshore of the State of Sergipe. The objective of the intervention was to evaluate the 3674-3682 meters interval of the Riachuelo Formation. Bottom hole gauges and real time data transmission to the surface were deployed for this test, during which the target interval produced gas and condensate, without any evidence of formation of hydrate at the surface. After the test, while pulling out the electrical cable with the Link Running Tool, it got stuck close to the subsea well-test tree at a depth of 1257 meters. The formation of hydrate not only kept the cable from moving up, but also rendered impossible the reverse circulation in the column and consequently pulling out the test string. Removing the hydrate would allow releasing the logging cable, thus enabling fluid circulation in the string and its safe retrieval. The goal was achieved via the injection of solvent through the subsea well-test tree, drilling fluid circulation through the annulus above the BOP, and fluid circulation on the top of the hydrate plug through Coiled Tubing. The greatest challenge was running the Coiled Tubing in the string with the electrical cable inside. (author)

  4. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  5. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  6. Theoretical evaluation of the production of the poisons Xe-135 and Sm-149 of the TRIGA Mark III reactor with mixed core; Evaluacion teorica de la produccion de los venenos Xe-135 y Sm-149 del reactor TRIGA Mark III con nucleo mixto

    Energy Technology Data Exchange (ETDEWEB)

    Paredes G, L.C

    1991-11-15

    It was theoretically determined the accumulation of the Xe{sup 135} and Sm {sup 149} in function, of the time during a stationary state of 72 h. continuous for the reactor TRIGA Mark III to 1 MW of thermal power with mixed core. The values of negative reactivity due to these isotopes are of 2.04 dollars and 0.694 dollars to the 72 h, quantities that will have to be compensated if wants that the reactor continues working to this power. Under the same conditions but considering a core with standard fuel, it was found a value of {rho} = 1.70 dollars, resulting a difference of 0.30 dollars of negative reactivity in function of the type of analyzed core. This difference is important for the calculations of fuel management of a reactor. The concentration in balance of the xenon was reaches after an operation to constant power of 1 MW by 50 h, contrary to the samarium that reaches it balance after 3 weeks of operation starting from the initial start up and it stays constant along the useful life of the reactor while a change of fuel doesn't exist. It was obtained that for operation times greater to 60 h. at 1 MW, a peak of negative reactivity of the Xe{sup 135} is generated between the 7 and 11 h after the instantaneous shut down, with a value of 2.43 dollars, that is to say 0.39 additional dollars to those taken place during the continuous irradiation. (Author)

  7. [Burnout in Tunisian medical residents: About 149 cases].

    Science.gov (United States)

    Ben Zid, A; Homri, W; Ben Romdhane, I; Bram, N; Labbane, R

    2017-09-01

    Burnout is a professional psychological chronic stress-induced syndrome defined by three dimensions: emotional exhaustion, depersonalization, and low personal accomplishment. This syndrome concerns all professions but especially healthcare staff. Numerous studies have attempted to document the impact of work activities on the doctor's mental health. According to the literature, junior doctors are more vulnerable to develop this syndrome. Are to determine the prevalence of severe burnout among residents of different specialties: anesthesiology, general surgery, emergency medicine, psychiatry, basic sciences. The secondary end points are to analyze risk factors, causes and consequences associated with burnout. A cross-sectional study conducted among medical residents working in hospitals located in the governorates of Tunis. Three instruments were used: an anonymous self-administered questionnaire, Maslach Burnout Inventory (MBI) to assess burnout, and Abstract Beck Depression Inventory to evaluate the intensity of depression. Severe burnout was defined as a severely high level of both emotional exhaustion and depersonalization associated with a severely low level of personal accomplishment. A total of 149 participants (response rate=76.8%) participated in the survey. Among participants, 17.14% (n=26) had a severe burnout. The emergency medicine residents had the highest rate of emotional exhaustion and depersonalization and severe depression. Overall, resident respondents, 31% (n=46), had moderate to severe depression. Among stress factors, those significantly correlated to burnout were: lack of hobbies (Pburnout were: Antecedents of specialty change (P=0.017) and desire for a specialty change (Pburnout was not found. Medical residents in all specialties are at risk of burnout. Nevertheless, this study revealed that some specialties are more exhausting, which is consistent with the results reported in the literature. Moreover, it is shown that several stress factors

  8. 16 CFR 14.9 - Requirements concerning clear and conspicuous disclosures in foreign language advertising and...

    Science.gov (United States)

    2010-01-01

    ...” disclosure of certain information in an advertisement or sales material in a newspaper, magazine, periodical... conspicuous disclosures in foreign language advertising and sales materials. 14.9 Section 14.9 Commercial... and conspicuous disclosures in foreign language advertising and sales materials. The Federal Trade...

  9. Interaction of antimicrobial peptide Plantaricin149a and four analogs with lipid bilayers and bacterial membranes

    Directory of Open Access Journals (Sweden)

    José Luiz de Souza Lopes

    2013-12-01

    Full Text Available The amidated analog of Plantaricin149, an antimicrobial peptide from Lactobacillus plantarum NRIC 149, directly interacts with negatively charged liposomes and bacterial membranes, leading to their lysis. In this study, four Pln149-analogs were synthesized with different hydrophobic groups at their N-terminus with the goal of evaluating the effect of the modifications at this region in the peptide's antimicrobial properties. The interaction of these peptides with membrane models, surface activity, their hemolytic effect on red blood cells, and antibacterial activity against microorganisms were evaluated. The analogs presented similar action of Plantaricin149a; three of them with no hemolytic effect (< 5% until 0.5 mM, in addition to the induction of a helical element when binding to negative liposomes. The N-terminus difference between the analogs and Plantaricin149a retained the antibacterial effect on S. aureus and P. aeruginosa for all peptides (MIC50 of 19 µM and 155 µM to Plantaricin149a, respectively but resulted in a different mechanism of action against the microorganisms, that was bactericidal for Plantaricin149a and bacteriostatic for the analogs. This difference was confirmed by a reduction in leakage action for the analogs. The lytic activity of Plantaricin149a is suggested to be a result of the peptide-lipid interactions from the amphipathic helix and the hydrophobic residues at the N-terminus of the antimicrobial peptide.

  10. 47 CFR 87.149 - Special requirements for automatic link establishment (ALE).

    Science.gov (United States)

    2010-10-01

    ... establishment (ALE). 87.149 Section 87.149 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED... a radio channel and thereafter establishing communication shall be permitted within the 2 MHz-30 MHz... exceed 100 W ERP; (b) Transmissions must sweep linearly in frequency at a rate of at least 60 kHz per...

  11. 9 CFR 149.5 - Offsite identification and segregation of certified swine.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Offsite identification and segregation of certified swine. 149.5 Section 149.5 Animals and Animal Products ANIMAL AND PLANT HEALTH... otherwise maintain their identity as certified swine in such a way that they could be readily traced back to...

  12. 33 CFR 149.135 - What should be marked on the cargo transfer system alarm switch?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What should be marked on the cargo transfer system alarm switch? 149.135 Section 149.135 Navigation and Navigable Waters COAST GUARD... switch? Each switch for activating an alarm, and each audio or visual device for signaling an alarm, must...

  13. 33 CFR 149.693 - What are the requirements for personnel landings on manned deepwater ports?

    Science.gov (United States)

    2010-07-01

    ... personnel landings on manned deepwater ports? 149.693 Section 149.693 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION... personnel landings on manned deepwater ports? (a) On manned deepwater ports, sufficient personnel landings...

  14. 33 CFR 149.406 - What are the approval requirements for a fire extinguisher?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the approval requirements for a fire extinguisher? 149.406 Section 149.406 Navigation and Navigable Waters COAST GUARD... approval requirements for a fire extinguisher? All portable and semi-portable fire extinguishers must be of...

  15. 33 CFR 149.410 - Where must portable and semi-portable fire extinguishers be located?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Where must portable and semi-portable fire extinguishers be located? 149.410 Section 149.410 Navigation and Navigable Waters COAST GUARD... and semi-portable fire extinguishers be located? All portable and semi-portable fire extinguishers...

  16. 33 CFR 149.407 - Must fire extinguishers be on the deepwater port at all times?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Must fire extinguishers be on the... Firefighting and Fire Protection Equipment Firefighting Requirements § 149.407 Must fire extinguishers be on the deepwater port at all times? (a) The fire extinguishers required by § 149.409 of this subpart must...

  17. 33 CFR 149.408 - What are the maintenance requirements for fire extinguishers?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the maintenance requirements for fire extinguishers? 149.408 Section 149.408 Navigation and Navigable Waters COAST GUARD... maintenance requirements for fire extinguishers? All fire extinguishers must be maintained in good working...

  18. 33 CFR 149.695 - What are the requirements for stairways?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the requirements for stairways? 149.695 Section 149.695 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... have at least two courses of rails. The top course must serve as a handrail and be at least 34 inches...

  19. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  20. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  1. Flight test report Focke Wulf Piaggio P149D-TP 2015

    CSIR Research Space (South Africa)

    Barker, D

    2015-09-01

    Full Text Available Service. • Acquired and imported into RSA Werner Heiml. • Flight test NTCA 2013. From This! To This!! Focke Wulf Piaggio P149D - TP Piaggio P149D Objectives To demonstrate the modified Piaggio P149D TP aircraft’s... compliance with the requirements of Part 24 of the CAR’s and certain applicable requirements of FAR- 23 Subpart B: Flight. The aircraft is a Non-Type Certificated Aircraft (NTCA) Ex-Military in terms of Part 24 of the SA Civil Aviation Regulations...

  2. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  3. 19 CFR 149.6 - Entry and entry summary documentation and Importer Security Filing submitted via a single...

    Science.gov (United States)

    2010-04-01

    ... Security Filing submitted via a single electronic transmission. 149.6 Section 149.6 Customs Duties U.S... submitted via a single electronic transmission. If the Importer Security Filing is filed pursuant to § 149.2 of this part via the same electronic transmission as entry or entry/entry summary documentation...

  4. 33 CFR 149.417 - What firefighting equipment must a helicopter landing deck on a manned deepwater port have?

    Science.gov (United States)

    2010-07-01

    ... a helicopter landing deck on a manned deepwater port have? 149.417 Section 149.417 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS... § 149.417 What firefighting equipment must a helicopter landing deck on a manned deepwater port have...

  5. 33 CFR 149.339 - What is the requirement for previously approved lifesaving equipment on a deepwater port?

    Science.gov (United States)

    2010-07-01

    ... previously approved lifesaving equipment on a deepwater port? 149.339 Section 149.339 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Unmanned Deepwater Port Requirements § 149.339...

  6. 33 CFR 149.303 - What survival craft and rescue boats may be used on a manned deepwater port?

    Science.gov (United States)

    2010-07-01

    ... boats may be used on a manned deepwater port? 149.303 Section 149.303 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Manned Deepwater Port Requirements § 149.303 What survival...

  7. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  8. Contribution of the Tyr-1 in Plantaricin149a to Disrupt Phospholipid Model Membranes

    Directory of Open Access Journals (Sweden)

    Georgina Tonarelli

    2013-06-01

    Full Text Available Plantaricin149a (Pln149a is a cationic antimicrobial peptide, which was suggested to cause membrane destabilization via the carpet mechanism. The mode of action proposed to this antimicrobial peptide describes the induction of an amphipathic α-helix from Ala7 to Lys20, while the N-terminus residues remain in a coil conformation after binding. To better investigate this assumption, the purpose of this study was to determine the contributions of the Tyr1 in Pln149a in the binding to model membranes to promote its destabilization. The Tyr to Ser substitution increased the dissociation constant (KD of the antimicrobial peptide from the liposomes (approximately three-fold higher, and decreased the enthalpy of binding to anionic vesicles from −17.2 kcal/mol to −10.2 kcal/mol. The peptide adsorption/incorporation into the negatively charged lipid vesicles was less effective with the Tyr1 substitution and peptide Pln149a perturbed the liposome integrity more than the analog, Pln149S. Taken together, the peptide-lipid interactions that govern the Pln149a antimicrobial activity are found not only in the amphipathic helix, but also in the N-terminus residues, which take part in enthalpic contributions due to the allocation at a lipid-aqueous interface.

  9. Repression of Toll-like receptor-4 by microRNA-149-3p is associated with smoking-related COPD.

    Science.gov (United States)

    Shen, Wen; Liu, Jia; Zhao, Guohou; Fan, Minjuan; Song, Gao; Zhang, Yang; Weng, Zhiying; Zhang, You

    2017-01-01

    Smoking is the leading cause of COPD. Exploring molecular markers and understanding the pathogenic mechanisms of smoking-related COPD are helpful for early clinical diagnosis and treatment of the disease. This study aims to identify specific circulating microRNAs (miRNAs) from the blood of COPD patients with a long history of smoking. Blood samples from four different groups were collected, and miRNA microarray was performed. Differential expression of miRNAs was verified by quantitative polymerase chain reaction. In vitro, THP-1 cells were cultured and stimulated with cigarette smoke extract (CSE) or transfected with miR-149-3p inhibitor/mimics. Protein levels of Toll-like receptor 4 (TLR-4) and nuclear factor κB (NF-κB) were detected using Western blot and immunofluorescence. Interleukin (IL)-1β and tumor necrosis factor (TNF)-α levels were determined by an enzyme-linked immunosorbent assay. miRNA profiling revealed that the expression of 56 miRNAs was changed between the four groups. Expression of miR-149-3p in group C (non-smoker non-COPD) was higher than in group S (smoker non-COPD), S-COPD (smoker with stable COPD) and AE-COPD (smoker with acute exacerbation COPD). CSE stimulation down-regulated the expression of miR-149-3p and up-regulated the TLR-4 and NF-κB levels in THP-1 cells. Transfecting miR-149-3p inhibitors in THP-1 cells also increased the expression of its target genes. Furthermore, overexpression of miR-149-3p inhibited the TLR-4/NF-κB signaling pathways and reduced the secretion of IL-1β and TNF-α. This study found that smoking can induce differential expression of circulating miR-NAs, such as down-regulation of miR-149-3p. Reducing miR-149-3p may increase the inflammatory response in COPD patients through the regulation of the TLR-4/NF-κB signaling pathway.

  10. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)

    2010-07-01

    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  11. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  12. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  13. Calculation and comparison of xenon and samarium reactivities of the HEU, LEU core in the low power research reactor.

    Science.gov (United States)

    Dawahra, S; Khattab, K; Saba, G

    2015-07-01

    Comparative studies for the conversion of the fuel from HEU to LEU in the Miniature Neutron Source Reactor (MNSR) have been performed using the MCNP4C and GETERA codes. The precise calculations of (135)Xe and (149)Sm concentrations and reactivities were carried out and compared during the MNSR operation time and after shutdown for the existing HEU fuel (UAl4-Al, 90% enriched) and the potential LEU fuels (U3Si2-Al, U3Si-Al, U9Mo-Al, 19.75% enriched and UO2, 12.6% enriched) in this paper using the MCNP4C and GETERA codes. It was found that the (135)Xe and (149)Sm reactivities did not reach their equilibrium reactivities during the daily operating time of the reactor. The (149)Sm reactivities could be neglected compared to (135)Xe reactivities during the reactor operating time and after shutdown. The calculations for the UAl4-Al produced the highest (135)Xe reactivity in all the studied fuel group during the reactor operation (0.39 mk) and after the reactor shutdown (0.735 mk), It followed by U3Si-Al (0.34 mk, 0.653 mk), U3Si2-Al (0.33 mk, 0.634 mk), U9Mo-Al (0.3 mk, 0.568 mk) and UO2 (0.24 mk, 0.448 mk) fuels, respectively. Finally, the results showed that the UO2 was the best candidate for fuel conversion to LEU in the MNSR since it gave the lowest (135)Xe reactivity during the reactor operation and after shutdown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Association of miR-149 (RS2292832 Variant with the Risk of Coronary Artery Disease

    Directory of Open Access Journals (Sweden)

    Ghaffarzadeh Maryam

    2017-09-01

    Full Text Available Background: Coronary artery disease (CAD is the most common cause of mortality and disability from incommunicable disease in the world. Although the association between the single nucleotide polymorphisms (SNPs in protein-coding genes and the risk of CAD has been investigated extensively, very few heart-disease associated studies concerning the SNPs in miRNA genes have been reported. The present study was performed to elucidate the association between the pre-microRNA-149 (miR-149 SNP rs2292832 and the risk of CAD in an Iranian population.

  15. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  16. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  17. LANTERN: a randomized study of QVA149 versus salmeterol/fluticasone combination in patients with COPD

    Directory of Open Access Journals (Sweden)

    Zhong N

    2015-06-01

    Full Text Available Nanshan Zhong,1 Changzheng Wang,2 Xiangdong Zhou,3 Nuofu Zhang,1 Michael Humphries,4 Linda Wang,4 Chau Thach,5 Francesco Patalano,6 Donald Banerji5On behalf of the LANTERN Investigators 1State Key Laboratory of Respiratory Diseases, First Affiliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong, 2Institute of Respiratory Disease, Xin Qiao Hospital, 3Department of Respiratory Medicine, Southwest Hospital, Third Military Medical University, Chongqing City, Chongqing, 4Beijing Novartis Pharma Co. Ltd., Shanghai, People’s Republic of China; 5Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA; 6Novartis Pharma AG, Basel, SwitzerlandBackground: The current Global initiative for chronic Obstructive Lung Disease (GOLD treatment strategy recommends the use of one or more bronchodilators according to the patient’s airflow limitation, their history of exacerbations, and symptoms. The LANTERN study evaluated the effect of the long-acting β2-agonist (LABA/long-acting muscarinic antagonist (LAMA dual bronchodilator, QVA149 (indacaterol/glycopyrronium, as compared with the LABA/inhaled corticosteroid, salmeterol/fluticasone (SFC, in patients with moderate-to-severe COPD with a history of ≤1 exacerbation in the previous year.Methods: In this double-blind, double-dummy, parallel-group study, 744 patients with moderate-to-severe COPD with a history of ≤1 exacerbations in the previous year were randomized (1:1 to QVA149 110/50 µg once daily or SFC 50/500 µg twice daily for 26 weeks. The primary endpoint was noninferiority of QVA149 versus SFC for trough forced expiratory volume in 1 second (FEV1 at week 26.Results: Overall, 676 patients completed the study. The primary objective of noninferiority between QVA149 and SFC in trough FEV1 at week 26 was met. QVA149 demonstrated statistically significant superiority to SFC for trough FEV1 (treatment difference [∆]=75 mL; P<0.001. QVA149 demonstrated a statistically significant

  18. Page 1 > Proc. Indian Acad. Sci., Vol. C 2, Pt. 2, May 1979, pp. 149 ...

    Indian Academy of Sciences (India)

    Proc. Indian Acad. Sci., Vol. C 2, Pt. 2, May 1979, pp. 149–177. (C) Printed in India. Cavitation inception. VIJAY HARAKERI. Department of Mechanical Engineering, Indian Institute of Science,. Bangalore 560 012. MS received 19 June 1978; revised 26 September 1978. Abstract. In this paper, some general aspects of ...

  19. Flight test report: Focke wulf PIAGGIO P149D-TP

    CSIR Research Space (South Africa)

    Barker, D

    2015-12-01

    Full Text Available It’s a story of following one’s dream. Belonging to Werner Heiml, ZU-SFP originated from Germany where it was used as a basic trainer in the Luftwaffe. The P149D was originally developed and manufactured by Piaggio & Co, Italy, in 1953...

  20. Yeast Interacting Proteins Database: YOL149W, YEL015W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YOL149W DCP1 Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes the...nit of the Dcp1p-Dcp2p decapping enzyme complex, which removes the 5' cap structure from mRNAs prior to thei

  1. Yeast Interacting Proteins Database: YOR167C, YOL149W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available is bait as prey (0) YOL149W DCP1 Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes the 5' c... DCP1 Prey description Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes

  2. Yeast Interacting Proteins Database: YBR094W, YOL149W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available is bait as bait (1) Rows with this bait as prey (0) YOL149W DCP1 Subunit of the Dcp1p-Dcp2p decapping enzyme complex, which removes...2p decapping enzyme complex, which removes the 5' cap structure from mRNAs prior to their degradation; enhan

  3. 7 CFR 905.149 - Procedure for permitting growers to ship tree run citrus fruit.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Procedure for permitting growers to ship tree run... AGRICULTURE ORANGES, GRAPEFRUIT, TANGERINES, AND TANGELOS GROWN IN FLORIDA Rules and Regulations Non-Regulated Fruit § 905.149 Procedure for permitting growers to ship tree run citrus fruit. (a) Tree run citrus...

  4. 7 CFR 58.149 - Alternate quality control programs for dairy products.

    Science.gov (United States)

    2010-01-01

    ...) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS... and Grading Service 1 Operations and Operating Procedures § 58.149 Alternate quality control programs...

  5. 75 FR 12726 - Expansion/Reorganization of Foreign-Trade Zone 149; Port Freeport, TX

    Science.gov (United States)

    2010-03-17

    ... Foreign-Trade Zones Board Expansion/Reorganization of Foreign-Trade Zone 149; Port Freeport, TX Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as amended (19 U.S.C. 81a-81u), the Foreign-Trade Zones Board (the Board) adopts the following Order: Whereas, Port Freeport, grantee...

  6. 77 FR 54891 - Reorganization of Foreign-Trade Zone 149 Under Alternative Site Framework Freeport, TX

    Science.gov (United States)

    2012-09-06

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Reorganization of Foreign-Trade Zone 149 Under Alternative Site Framework Freeport, TX Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as amended (19 U.S.C. 81a-81u), the Foreign-Trade Zones Board ...

  7. 41 CFR 109-38.801 - Obtaining SF 149, U.S. Government National Credit Card.

    Science.gov (United States)

    2010-07-01

    .... Government National Credit Card. 109-38.801 Section 109-38.801 Public Contracts and Property Management..., U.S. Government National Credit Card § 109-38.801 Obtaining SF 149, U.S. Government National Credit Card. DOE offices electing to use national credit cards shall request the assignment of billing address...

  8. 149 Seaweeds

    Indian Academy of Sciences (India)

    IAS Admin

    GENERALARTICLES. 109 Norman Borlaug and a Hunger-Free World. M S Swaminathan. 116 Why Some Pool Shots are More Difficult Than Others. Justin Jankunas and Richard N Zare. 122 Some Physics Inside Drying Droplets. Dileep Mampallil. 135 From the Triangle Inequality to the Isoperimetric. Inequality. S Kesavan.

  9. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  10. 19 CFR 149.2 - Importer security filing-requirement, time of transmission, verification of information, update...

    Science.gov (United States)

    2010-04-01

    ... transmission, verification of information, update, withdrawal, compliance date. 149.2 Section 149.2 Customs..., verification of information, update, withdrawal, compliance date. (a) Importer security filing required. For...) Verification of information. Where the party electronically presenting to CBP the Importer Security Filing...

  11. 33 CFR 149.415 - What are the requirements for a fire main system on a manned deepwater port?

    Science.gov (United States)

    2010-07-01

    ... fire main system on a manned deepwater port? 149.415 Section 149.415 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN... are the requirements for a fire main system on a manned deepwater port? (a) Each pumping platform...

  12. 33 CFR 149.700 - What kind of portable lights may be used on a deepwater port?

    Science.gov (United States)

    2010-07-01

    ... be used on a deepwater port? 149.700 Section 149.700 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND... deepwater port? Each portable light and its supply cord on a deepwater port must be designed for the...

  13. Disruption of Saccharomyces cerevisiae by Plantaricin 149 and investigation of its mechanism of action with biomembrane model systems.

    Science.gov (United States)

    Lopes, José Luiz S; Nobre, Thatyane M; Siano, Alvaro; Humpola, Verónica; Bossolan, Nelma R S; Zaniquelli, Maria E D; Tonarelli, Georgina; Beltramini, Leila M

    2009-10-01

    The action of a synthetic antimicrobial peptide analog of Plantaricin 149 (Pln149a) against Saccharomyces cerevisiae and its interaction with biomembrane model systems were investigated. Pln149a was shown to inhibit S. cerevisiae growth by more than 80% in YPD medium, causing morphological changes in the yeast wall and remaining active and resistant to the yeast proteases even after 24 h of incubation. Different membrane model systems and carbohydrates were employed to better describe the Pln149a interaction with cellular components using circular dichroism and fluorescence spectroscopies, adsorption kinetics and surface elasticity in Langmuir monolayers. These assays showed that Pln149a does not interact with either mono/polysaccharides or zwitterionic LUVs, but is strongly adsorbed to and incorporated into negatively charged surfaces, causing a conformational change in its secondary structure from random-coil to helix upon adsorption. From the concurrent analysis of Pln149a adsorption kinetics and dilatational surface elasticity data, we determined that 2.5 muM is the critical concentration at which Pln149a will disrupt a negative DPPG monolayer. Furthermore, Pln149a exhibited a carpet-like mechanism of action, in which the peptide initially binds to the membrane, covering its surface and acquiring a helical structure that remains associated to the negatively charged phospholipids. After this electrostatic interaction, another peptide region causes a strain in the membrane, promoting its disruption.

  14. 33 CFR 149.15 - What is the process for submitting alterations and modifications affecting the design and...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What is the process for submitting alterations and modifications affecting the design and construction of a deepwater port? 149.15...) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT General § 149.15 What is the process...

  15. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  16. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  17. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  18. Expression of insect (Microdera puntipennis dzungarica) antifreeze protein MpAFP149 confers the cold tolerance to transgenic tobacco.

    Science.gov (United States)

    Wang, Yan; Qiu, Liming; Dai, Chunying; Wang, Jing; Luo, Jianmin; Zhang, Fuchun; Ma, Ji

    2008-08-01

    To elucidate the function of antifreeze protein from Microdera puntipennis dzhungarica for freezing stress tolerance in plant, the construct of MpAFP149 gene with the signal peptide sequence responsible for secreting the native MpAFP149 into the apoplast space under control of a cauliflower mosaic virus 35S promoter was introduced into tobacco by Agrobacterium tumefaciens-mediated transformation. The observation of immunogold localization by TEM (transmission electron microscope) showed that the heterologous MpAFP149 protein was mainly distributed on the cell wall in apoplast of the transgenic tobacco plant. T1 generation transgenic tobacco plants displayed a more frost resistant phenotype and kept the lower ion leakage ratio and MDA (malondialdehyde) content in the leaves compared with wild-type ones at -1 degrees C for 3 days. The results showed that MpAFP149 provided protection and conferred cold tolerance to transgenic tobacco plant during freezing stress.

  19. 20 CFR 1002.149 - What is the employee's status with his or her civilian employer while performing service in the...

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What is the employee's status with his or her civilian employer while performing service in the uniformed services? 1002.149 Section 1002.149 Employees... Furlough and Leave of Absence § 1002.149 What is the employee's status with his or her civilian employer...

  20. 33 CFR 149.304 - What type and how many survival craft and rescue boats must a manned deepwater port have?

    Science.gov (United States)

    2010-07-01

    ... craft and rescue boats must a manned deepwater port have? 149.304 Section 149.304 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Lifesaving Equipment Manned Deepwater Port Requirements § 149.304...

  1. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  2. Acrylonitrile irreversibly inactivates glyceraldehyde-3-phosphate dehydrogenase by alkylating the catalytically active cysteine 149.

    Science.gov (United States)

    Campian, E Cristian; Cai, Jian; Benz, Frederick W

    2002-08-15

    Acrylonitrile (AN) is a vinyl monomer used in the production of synthetic fibers, rubber and plastics. AN is acutely toxic but its mechanism of toxicity remains to be established. AN is metabolized to cyanide in vivo but cyanide production alone cannot explain acute AN toxicity. Previous work in our laboratory has shown that AN can alkylate highly reactive cysteine residues in proteins. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a critical enzyme involved in glycolysis, has a catalytically active cysteine 149 in its active site. We report that AN irreversibly inhibits GAPDH with second-order rate constants, at pH 7.4, of 3.7 and 9.2 M(-1) s(-1) at 25 and 37 degrees C, respectively. A combination of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) and electrospray ionization-mass spectrometry-mass spectrometry (ESI-MS-MS) was used to show that AN inactivates GAPDH by covalently binding to cysteine 149 in the active site of the enzyme. Inactivation of GAPDH by AN would be expected to impair glycolytic ATP production and when coupled with the inhibition of mitochondrial ATP synthesis by the AN metabolite cyanide would result in metabolic arrest. The brain can withstand metabolic arrest for only a few minutes thus these combined actions may account for the acute toxicity of AN in vivo.

  3. Familial splenomegaly: macrophage hypercatabolism of lipoproteins associated with apolipoprotein E mutation [apolipoprotein E (delta149 Leu)].

    Science.gov (United States)

    Nguyen, T T; Kruckeberg, K E; O'Brien, J F; Ji, Z S; Karnes, P S; Crotty, T B; Hay, I D; Mahley, R W; O'Brien, T

    2000-11-01

    Splenomegaly with sea-blue histiocytes is not associated with dyslipidemia, except in severe cases of hypertriglyceridemia, Tangier disease, or lecithin cholesterol acyltransferase deficiency. We describe two kindreds in which the sea-blue histiocyte syndrome was associated with an apoE variant in the absence of severe dyslipidemia. Both patients presented with mild hypertriglyceridemia and splenomegaly. After splenectomy both patients developed severe hypertriglyceridemia. Pathological evaluation of the spleen revealed the presence of sea-blue histiocytes. A mutation of apoE was demonstrated, with a 3-bp deletion resulting in the loss of a leucine at position 149 in the receptor-binding region of the apoE molecule [apoE (delta149 Leu)]. Although both probands were unrelated, they were of French Canadian ancestry, suggesting the possibility of a founder effect. In summary, we describe two unrelated probands with primary sea-blue histiocytosis who had normal or mildly elevated serum triglyceride concentrations that markedly increased after splenectomy. In addition, we provide evidence linking the syndrome to an inherited dominant mutation in the apoE gene, a 3-bp deletion on the background of an apoE 3 allele that causes a derangement in lipid metabolism and leads to splenomegaly in the absence of severe hypertriglyceridemia.

  4. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  5. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  6. EEI reports 149 stack gas scrubbers in operation in the United States

    Energy Technology Data Exchange (ETDEWEB)

    1989-05-01

    The United States operates 149 power plant stack gas scrubbers up from146 a year ago, representing 65,888 megawatts of generating capacity. Forty-two additional units are planned or under construction. Neither Canada nor Mexico has any scrubbers in operation or under construction. Stack gas scrubbers, also known as flue gas desulfurization systems, control sulfur dioxide emissions at coal-fired power plants. According to the US Environmental Protection Agency, from the peak year of 1973, up to 1987, total SO{sub 2} emissions dropped 29.4 percent. Electric power plant SO{sub 2} emissions were down 21.5 percent during the same period while utility coal use soared by 87.8 percent. In addition, the average sulfur content of coal used by utilities decreased approximately 37 percent.

  7. Analysis on 149 consecutive cases of intervertebral disc prolapse operated with microendoscopic (Metr’X tecnique

    Directory of Open Access Journals (Sweden)

    C. Forni Niccolai Gamba

    2011-09-01

    Full Text Available Herniated disc patients represent a limited subset of patients with low back pain. Incidence of surgical intervention for lumbar disc pathology is 3% to 4%. The goal of surgery is to achieve neural decompression and relief neurological symptoms. Discectomy through laminotomy is the most common approach. More recently percutaneous approaches to lumbar discectomy, include the use of suction, laser and spinal endoscopy have evolved with mixed results. Microendoscopic discectomy (MED combines endoscopic technology with the principles of microdiscectomy: open surgical principles are used through a tubular retractor using endoscopic visualization. We present our experience with MED in 149 patients who underwent this procedure. The patient population consisted of 83 men and 66 women aged 18 to 88 years. All patients had substantial rilief of their radiculopathy.

  8. A functional variant of miRNA-149 confers risk for allergic rhinitis and comorbid asthma in Chinese children.

    Science.gov (United States)

    Hu, D; Zhang, Z; Ke, X; Kang, H; Hong, S

    2017-04-01

    The prevalence of allergic rhinitis (AR) and asthma has been increasing, and the comorbidity rates of these diseases are very high. Here, 176 AR patients, 124 patients with comorbid AR and asthma (AR-A) and 206 healthy Chinese children as controls were included in a case-control study. Six single-nucleotide polymorphisms (SNPs), miR-146a (rs2910164, rs57095329 and rs6864584), miR-196a2 (rs11614913), miR-499 (rs3746444) and miR-149 (rs2292832), were genotyped. The prevalence of homozygous miR-149 (rs2292832) CC genotype and C allele were considerably increased in AR and AR-A patients, compared with the controls. AR-A group showed higher frequencies of CC genotype and C allele of rs2292832 than AR group. No significant difference in the genotypic and allelic frequencies of other miRNA SNPs was found between the groups. MiR-149 levels in peripheral blood mononuclear cells (PBMCs) were significantly lower in CC (variant type) cases compared with TT (wild-type) cases. In further experiments, PBMCs obtained from the healthy controls with CC, CT and TT genotypes were stimulated by house dust mite extracts, which led to a significant decrease in the levels of miR-149 in PBMCs obtained from CC and TT individuals. This decrease was more pronounced in CC compared with TT cases. Our results demonstrate that miR-149 rs2292832 variant is not only strongly associated with AR and AR-A, but it may lead to an increase in the susceptibility to allergies following the stimulation with an allergen, through the changes in miR149 expression. Additionally, AR patients with CC genotypes were shown to be more susceptible to asthma. © 2017 John Wiley & Sons Ltd.

  9. Clinical use of bone-targeting radiopharmaceuticals with focus on alpha-emitters.

    Science.gov (United States)

    Wieder, Hinrich A; Lassmann, Michael; Allen-Auerbach, Martin S; Czernin, Johannes; Herrmann, Ken

    2014-07-28

    Various single or multi-modality therapeutic options are available to treat pain of bone metastasis in patients with prostate cancer. Different radionuclides that emit β-rays such as (153)Samarium and (89)Strontium and achieve palliation are commercially available. In contrast to β-emitters, (223)Radium as a α-emitter has a short path-length. The advantage of the α-emitter is thus a highly localized biological effect that is caused by radiation induced DNA double-strand breaks and subsequent cell killing and/or limited effectiveness of cellular repair mechanisms. Due to the limited range of the α-particles the bone surface to red bone marrow dose ratio is also lower for (223)Radium which is expressed in a lower myelotoxicity. The α emitter (223)Radium dichloride is the first radiopharmaceutical that significantly prolongs life in castrate resistant prostate cancer patients with wide-spread bone metastatic disease. In a phase III, randomized, double-blind, placebo-controlled study 921 patients with castration-resistant prostate cancer and bone metastases were randomly assigned. The analysis confirmed the (223)Radium survival benefit compared to the placebo (median, 14.9 mo vs 11.3 mo; P US Food and Drug Administration.

  10. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  11. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Science.gov (United States)

    2010-01-01

    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  12. 33 CFR 165.T13-149 - Safety Zone; McNary-John Day Transmission Line Project, Columbia River, Hermiston, OR.

    Science.gov (United States)

    2010-07-01

    ... Transmission Line Project, Columbia River, Hermiston, OR. 165.T13-149 Section 165.T13-149 Navigation and... Areas Thirteenth Coast Guard District § 165.T13-149 Safety Zone; McNary-John Day Transmission Line... Columbia River between two lines with the first line starting at the north bank at 45° 56′ 16.5″ N/119° 19...

  13. 47 CFR 25.149 - Application requirements for ancillary terrestrial components in the mobile-satellite service...

    Science.gov (United States)

    2010-10-01

    ... Stations § 25.149 Application requirements for ancillary terrestrial components in the mobile-satellite... Services devices. Applications for equipment authorization of mobile or portable devices operating under... 47 Telecommunication 2 2010-10-01 2010-10-01 false Application requirements for ancillary...

  14. Light-induced electron transfer and charge transport in mesoporous ZnO/D149 hybrid films

    Energy Technology Data Exchange (ETDEWEB)

    Rudolph, Melanie; Schlettwein, Derck [Institute of Applied Physics, Justus-Liebig-University Giessen (Germany); Miura, Hidetoshi [Chemicrea Co., Ltd., 2-1-6 Sengen, Tsukuba, Ibaraki 305-0047 (Japan)

    2011-07-01

    Dye-sensitized solar cells (DSC) consist of a nanostructured semiconductor/dye hybrid layer as light absorbing and electron conducting phase, permeated by a liquid phase ensuring transfer of positive charges to a counter electrode. In this study, nanostructured ZnO was electrodeposited on fluorine-doped tin oxide (FTO) and loaded with the fully organic dye D149. The ZnO/D149 electrodes were analyzed in contact with a liquid iodide/triiodide electrolyte. Steady-state photocurrent and photovoltage measurements were performed to derive basic photovoltaic parameters like short-circuit photocurrent, open-circuit photovoltage and external quantum efficiency (IPCE). Open-circuit photovoltage decay measurements (OCVD) as well as intensity-modulated photovoltage spectroscopy (IMVS) were utilized to obtain information about the extent and mechanisms of recombination, i.e. unwanted back transfer of electrons from ZnO to D149 or to the liquid contact phase. Intensity-modulated photocurrent spectroscopy (IMPS) served to gain an insight into electron transport within the porous zinc oxide films. The interplay between light-induced charge transfer from D149 to ZnO, electron transport within the porous ZnO matrix and recombination of photoinjected electrons is discussed.

  15. 42 CFR 413.149 - Depreciation: Allowance for depreciation on assets financed with Federal or public funds.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Depreciation: Allowance for depreciation on assets... SKILLED NURSING FACILITIES Capital-Related Costs § 413.149 Depreciation: Allowance for depreciation on assets financed with Federal or public funds. (a) Principle. Depreciation is allowed on assets financed...

  16. Food Insecurity and Mental Health Status: A Global Analysis of 149 Countries.

    Science.gov (United States)

    Jones, Andrew D

    2017-08-01

    This study sought to determine the association of individual-level food insecurity (FI) with mental health status across all global regions. Cross-sectional data were analyzed in 2016 from the 2014 Gallup World Poll, a series of globally implemented, nationally representative surveys. FI was assessed using the Food Insecurity Experience Scale Survey Module for Individuals, an eight-question psychometric scale reporting individuals' experiences of FI. Individual-level composite indices of mental health, the Negative Experience Index and Positive Experience Index (0-100 scale), were calculated based on responses to five questions of respondents' recent negative and positive experiences, respectively, associated with depression and mental distress. The prevalence of any FI ranged from 18.3% in East Asia to 76.1% in Sub-Saharan Africa. In global analyses (149 countries) using adjusted multiple regression analyses, FI was associated in a dose-response fashion with poorer scores on the mental health indices (coefficient [95% CI]: Negative Experience Index: mild FI, 10.4 [9.5, 11.2]; moderate FI, 17.7 [16.4, 19.0]; severe FI, 24.5 [22.7, 26.3]; Positive Experience Index: mild FI, -8.3 [-9.3, -7.4]; moderate FI, -12.6 [-13.8, -11.3]; severe FI, -16.2 [-17.9, -14.5]). Within-region analyses (11 regions) consistently demonstrated the same trends. FI is associated with poorer mental health and specific psychosocial stressors across global regions independent of SES. The numerous pathways via which FI may contribute to common mental disorders, and the broad social implications of FI linked to cultural norms and self-efficacy, may contribute to the cross-cultural consistency of the findings. Copyright © 2017 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  17. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  18. Efficacy and safety of QVA149 compared to the concurrent administration of its monocomponents indacaterol and glycopyrronium: the BEACON study

    Directory of Open Access Journals (Sweden)

    Dahl R

    2013-10-01

    Full Text Available Ronald Dahl,1 Dalal Jadayel,2 Vijay KT Alagappan,3 Hungta Chen,3 Donald Banerji31Department of Dermatology, Allergy Centre, Odense University Hospital, Odense, Denmark; 2Novartis Horsham Research Centre, Horsham, UK; 3Novartis Pharmaceuticals Corporation, East Hanover, NJ, USAIntroduction: The BEACON study evaluated the efficacy and safety of QVA149, a once-daily dual bronchodilator containing a fixed-dose combination of the long-acting β2-agonist (LABA indacaterol and long-acting muscarinic antagonist (LAMA glycopyrronium (NVA237, in development for the treatment of patients with chronic obstructive pulmonary disease (COPD, compared with the free-dose concurrent administration of indacaterol plus glycopyrronium (IND+GLY.Methods: In this multicenter, double-blind, parallel group study, patients with stage II or stage III COPD (Global initiative for chronic Obstructive Lung Disease [GOLD] 2010 were randomized (1:1 to once-daily QVA149 (110 µg indacaterol/50 µg glycopyrronium or concurrent administration of indacaterol (150 µg and glycopyrronium (50 µg via the Breezhaler® device (Novartis AG, Basel, Switzerland for 4 weeks. The primary endpoint was to evaluate the noninferiority of QVA149 as compared with concurrent administration of IND+GLY, for trough forced expiratory volume in 1 second (FEV1 after 4 weeks of treatment. The other assessments included FEV1 area under the curve from 0 to 4 hours (AUC0–4 hours at day 1 and week 4, symptom scores, rescue medication use, safety, and tolerability over the 4-week study period.Results: Of 193 patients randomized, 187 (96.9% completed the study. Trough FEV1 at week 4 for QVA149 and IND+GLY was 1.46 L ± 0.02 and 1.46 L ± 0.18, respectively. The FEV1 AUC0–4 hours at day 1 and week 4 were similar between the two treatment groups. Both treatment groups had a similar reduction in symptom scores and rescue medication use for the 4-week treatment period. Overall, 25.6% of patients in QVA149 group

  19. 33 CFR 149.421 - What is the requirement for a previously approved fire detection and alarm system on a deepwater...

    Science.gov (United States)

    2010-07-01

    ... previously approved fire detection and alarm system on a deepwater port? 149.421 Section 149.421 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DEEPWATER PORTS DEEPWATER PORTS: DESIGN, CONSTRUCTION, AND EQUIPMENT Firefighting and Fire Protection Equipment Firefighting...

  20. 33 CFR 149.419 - Can the water supply for the helicopter deck fire protection system be part of a fire water system?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Can the water supply for the... § 149.419 Can the water supply for the helicopter deck fire protection system be part of a fire water system? (a) The water supply for the helicopter deck fire protection system required under § 149.420 or...

  1. Helium production cross section Measurement of Pb and Sn for 14.9 MeV neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Takao, Yoshiyuki; Fujimoto, Toshihiro; Ozaki, Shuji; Muramasu, Masatomo; Nakashima, Hideki [Kyushu Univ., Fukuoka (Japan); Kanda, Yukinori; Ikeda, Yujiro

    1998-03-01

    Helium production cross sections of lead and tin for 14.9 MeV neutrons were measured by helium accumulation method. Lead and tin samples were irradiated with FNS, an intense d-T neutron source of JAERI. The amount of helium produced in the samples by the neutron irradiation was measured with the Helium Atoms Measurement System (HAMS) at Kyushu University. As the samples contained a small amount of helium because of their small helium production cross sections at 14.9 MeV, the samples were evaporated by radiation from a tungsten filament to decrease background gases at helium measurement. Uncertainties of the present results were less than {+-}4.4%. The results were compared with other experimental data in the literature and also compared with the evaluated values in JENDL-3.2. (author)

  2. Circulating miR-765 and miR-149: Potential Noninvasive Diagnostic Biomarkers for Geriatric Coronary Artery Disease Patients

    Directory of Open Access Journals (Sweden)

    Md Sayed Ali Sheikh

    2015-01-01

    Full Text Available The purpose of this study was to evaluate the diagnostic value of circulating miR-765 and miR-149 as noninvasive early biomarkers for geriatric coronary artery disease (CAD patients. A total of 69 angiographically documented CAD patients including 37 stable CAD (72.9 ± 4.2 years and 32 unstable CAD (72.03 ± 4.3 years and 20 healthy subjects (71.7 ± 5.2 years, matched for age, sex, smoking habit, hypertension, and diabetes, were enrolled in this study. Compared with healthy subjects, circulating miR-765 levels were increased by 2.9-fold in stable CAD and 5.8-fold in unstable CAD patients, respectively, while circulating miR-149 levels were downregulated by 3.5-fold in stable CAD and 4.2-fold in unstable CAD patients, respectively. Furthermore, plasma levels of miR-765 were found to be positively correlated with ages within control, stable, and unstable groups. The ROC curves of miR-765 and miR-149 represented significant diagnostic values with an area under curve (AUC of 0.959, 0.972 and 0.938, 0.977 in stable CAD patients and unstable CAD patients as compared with healthy subjects, respectively. Plasma levels of miR-765 and miR-149 might be used as noninvasive biomarkers for the diagnosis of CAD in geriatric people.

  3. The clinical features of burns resulting from two aerial devices set off in a public fireworks display: 149 case reports.

    Science.gov (United States)

    He, Xiaosheng; Sun, Dongjie; Zhong, Xiaochun; Liu, Maolin; Ni, Youdi

    2014-12-01

    We report the clinical features of 149 cases with aerial devices burns in a public fireworks display. The characteristic features included sudden onset, masses of terrified burn victims, small and deep wounds, mild disease conditions, and favorable prognosis. Unlike in home or illegal fireworks displays, the body areas most often involved were the extremity, chest, abdomen, and back, and most of the victims were adults in these public fireworks displays. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  4. Target Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  5. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  6. The Association between Genetic Polymorphism and the Processing Efficiency of miR-149 Affects the Prognosis of Patients with Head and Neck Squamous Cell Carcinoma

    Science.gov (United States)

    Tu, Hsi-Feng; Liu, Chung-Ji; Chang, Che-Lun; Wang, Pei-Wen; Kao, Shou-Yen; Yang, Cheng-Chieh; Yu, En-Hao; Lin, Shu-Chun; Chang, Kuo-Wei

    2012-01-01

    MicroRNAs (miRNAs) play important roles in modulating the neoplastic process of cancers including head and neck squamous cell carcinoma (HNSCC). A genetic polymorphism (rs2292832, C>T) has been recently identified in the precursor of miR-149; nevertheless its clinicopathological implications remain obscure. In this study, we showed that miR-149 is down-regulated in HNSCC compared to normal mucosa and this is associated with a poorer patient survival. In addition, HNSCC patients with the T/T genotype have more advanced tumors and a worse prognosis. Multivariate analysis indicated that patients carried the T/T genotype have a 2.81-fold (95% CI: 1.58–4.97) increased risk of nodal metastasis and 1.66-fold (95% CI: 1.05–2.60) increased risk of mortality compared to other groups. T/T genotype also predicted the worse prognosis of buccal mucosa carcinoma subset of HNSCC. In vitro analysis indicated that exogenous miR-149 expression reduces the migration of HNSCC cells. Moreover, HNSCC cell subclones carrying the pri-mir-149 sequence containing the T variant show a low processing efficacy when converting the pre-mir-149 to mature miR-149. These findings suggest that miR-149 suppresses tumor cell mobility, and that the pre-mir-149 polymorphism may affect the processing of miR-149, resulting in a change in the abundance of the mature form miRNA, which, in turn, modulates tumor progression and patient survival. PMID:23272122

  7. A 27/2$^{-}$ three-particle isomer on the doubly closed shell nucleus $^{146}$Gd identified in $^{149}$Dy

    CERN Document Server

    Kleinheinz, P; Maier, M R; Stefanini, A M

    1976-01-01

    The authors have produced the nucleus /sub 66//sup 149/Dy/sub 83/ through the /sup 152/Gd( alpha ,7n) reaction at 106 MeV and have investigated its previously unknown level structure in an in-beam gamma -ray experiment. The results establish a very low-lying 27/2/sup -/ isomer, and such an isomer is expected to occur as the lowest lying three-particle configuration on the doubly closed shell nucleus /sub 64//sup 146/Gd/sub 82/.

  8. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  9. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  10. Temporal and elevation trends in rainfall erosivity on a 149 km2 watershed in a semi-arid region of the American Southwest

    Directory of Open Access Journals (Sweden)

    Mark A. Nearing

    2015-06-01

    Full Text Available Temporal changes in rainfall erosivity can be expected to occur with changing climate, and because rainfall amounts are known to be in part of a function of elevation, erosivity can be expected to be influenced by elevation as well. This is particularly true in mountainous regions such as are found over much of the western United States. The objective of this study was to identify temporal and elevation trends in rainfall erosivity on a 149 km2 (58 miles2 watershed in a semi-arid region of southeastern Arizona. Data from 84 rain gages for the years 1960–2012 at elevations ranging from 1231 to 1644 m (4038–5394 ft were used in the analyses. The average annual erosivity over the watershed as a whole was 1104 MJ mm ha−1 h−1 yr−1 (65 hundreds of foot ton inch acre−1 h−1 yr−1, and ranged from approximately 950 to 1225 MJ mm ha−1 h−1 yr−1 (56–72 hundreds of foot ton inch acre−1 h−1 yr−1, with a statistical trend showing greater erosivity at the higher elevations. No statistically significant temporal changes in annual or summer erosivities were found. This result stands in contrast to recent modeling studies of runoff and erosion in the area based on downscaled GCM information that project significant levels of erosivity changes over coming decades. These results are consistent with known orographic rainfall effects, but contrast with recent studies that presented projections of significant trends of increasing erosivity in the future based on downscaled GCM outputs for the area. The results illustrate the need for testing and developing improved techniques to evaluate future erosion scenarios for purposes of making targeted soil conservation decisions.

  11. Determination of breath acetone in 149 type 2 diabetic patients using a ringdown breath-acetone analyzer.

    Science.gov (United States)

    Sun, Meixiu; Chen, Zhuying; Gong, Zhiyong; Zhao, Xiaomeng; Jiang, Chenyu; Yuan, Yuan; Wang, Zhennang; Li, Yingxin; Wang, Chuji

    2015-02-01

    Over 90% of diabetic patients have Type 2 diabetes. Although an elevated mean breath acetone concentration has been found to exist in Type 1 diabetes (T1D), information on breath acetone in Type 2 diabetes (T2D) has yet to be obtained. In this study, we first used gas chromatography-mass spectrometry (GC-MS) to validate a ringdown breath-acetone analyzer based on the cavity-ringdown-spectroscopy technique, through comparing breath acetone concentrations in the range 0.5-2.5 ppm measured using both methods. The linear fitting of R = 0.99 suggests that the acetone concentrations obtained using both methods are consistent with a largest standard deviation of ±0.4 ppm in the lowest concentration of the range. Next, 620 breath samples from 149 T2D patients and 42 healthy subjects were collected and tested using the breath analyzer. Four breath samples were taken from each subject under each of four different conditions: fasting, 2 h post-breakfast, 2 h post-lunch, and 2 h post-dinner. Simultaneous blood glucose levels were also measured using a standard diabetic-management blood-glucose meter. For the 149 T2D subjects, their exhaled breath acetone concentrations ranged from 0.1 to 19.8 ppm; four different ranges of breath acetone concentration, 0.1-19.8, 0.1-7.1, 0.1-6.3, and 0.1-9.5 ppm, were obtained for the subjects under the four different conditions, respectively. For the 42 healthy subjects, their breath acetone concentration ranged from 0.1 to 2.6 ppm; four different ranges of breath acetone concentration, 0.3-2.6, 0.1-2.6, 0.1-1.7, and 0.3-1.6 ppm, were obtained for the four different conditions. The mean breath acetone concentration of the 149 T2D subjects was determined to be 1.5 ± 1.5 ppm, which was 1.5 times that of 1.0 ± 0.6 ppm for the 42 healthy subjects. No correlation was found between the breath acetone concentration and the blood glucose level of the T2D subjects and the healthy volunteers. This study using a relatively large number of

  12. [Analysis on 149 consecutive cases of intervertebral lumbar and cervical disc prolapse operated with microendoscopic (Metr'X) technique].

    Science.gov (United States)

    Latorraca, A; Forni Niccolai Gamba, C

    2004-01-01

    Herniated disc patients represent a limited subset of patients with low back pain. Incidence of surgical intervention for lumbar disc pathology is 3% to 4%. The goal of surgery is to achieve neural decompression and relief neurological symptoms. Discectomy through laminotomy is the most common approach. More recently percutaneous approaches to lumbar discectomy, include the use of suction, laser and spinal endoscopy have evolved with mixed results. Microendoscopic discectomy (MED) combines endoscopic technology with the principles of microdiscectomy: open surgical principles are used through a tubular retractor using endoscopic visualization. We present our experience with MED in 149 patients who underwent this procedure. The patient population consisted of 83 men and 66 women aged 18 to 88 years. All patients had substantial relief of their radiculopathy.

  13. Stellar Population and Star Formation History of the Distant Galactic H II Regions NGC 2282 and Sh2-149

    Science.gov (United States)

    Dutta, S.; Mondal, S.; Jose, J.; Das, R. K.

    2017-06-01

    We present here the recent results on two distant Galactic H II regions, namely NGC 2282 and Sh2-149, obtained with multiwavelength observations. Our optical spectroscopic analysis of the bright sources have been used to identify the massive members, and to derive the fundamental parameters such as age and distance of these regions. Using IR color-color criteria and Hα-emission properties, we have identified and classified the candidate young stellar objects (YSOs) in these regions. The 12CO(1-0) continuum maps along with the K-band extinction maps, and spatial distribution of YSOs are used to investigate the structure and morphology of the molecular cloud associated with these H II regions. Overall analysis of these regions suggests that the star formation occurs at the locations of the denser gas, and we also find possible evidences of the induced star formation due to the feedback from massive stars to its surrounding molecular medium.

  14. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  15. Multiparticle excitations in the {sup 149} Gd superdeformed nucleus. Signature of new C{sub 4} nucleus symmetry; Excitations multiparticules dans le noyau superdeforme {sup 149}Gd. Signature d`une symetrie nouvelle C{sub 4} du noyau

    Energy Technology Data Exchange (ETDEWEB)

    Theisen, C.

    1995-01-01

    The use of 8 {pi} and EUROGAM phase I multi-detectors for the study of high spin states of {sup 149} Gd nucleus has revealed unexpected new phenomenons about the superdeformation in this nucleus. The new excited bands confirm the omnipresence of twin bands phenomenon. A new multi-particle excitation (two protons and one neutron) has been discovered. Thanks to the second generation EUROGAM detector, unexpected discoveries such as C{sub 4} symmetry, level interactions, complete backbending were obtained for the second potential well. The knowledge of interacting levels gives informations about the nucleon-nucleon residual interaction and could allow the determination of SD bands excitation energy. The complex processing and analysis of high multiplicity events has led to the development of new computing tools. An automatic band research program has been written for the discovery of new excited bands, and an exact method for the elimination of uncorrected events has been developed. The improvements of multi-detector performances should allow the discovery of more exceptional phenomenons and new anomalies in the SD bands. (J.S.). 222 refs., 86 figs., 38 tabs.

  16. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  17. X-ray emission from Au-Sm alloy target irradiated with high power sub nanosecond laser

    Science.gov (United States)

    Chaurasia, S.; Munda, D. S.; Tripathi, S.; Kumar, M.; Gupta, N. K.; Dhareshwar, L. J.; Bajaj, P. N.

    2010-02-01

    The hohlraum cavity is generally made out of gold (Au) and recently it has been shown that laser-target coupling efficiency can be increased by using cocktail or mixed targets such as gold-samarium (Au-Sm). We report here results of experiments performed on Au-Sm alloy in various spectral regions for various compositions. In these experiments, a 12 Joule/500ps Nd:glass laser has been used. It is observed that the soft x-ray emission in the spectral region 0.7 -1.56 keV is enhanced by about 40-50% by using a composition of Au:Sm:: 3:7 as compared to pure Au .However, in case of hard x-ray emission (3.2 -5 keV), there is a reduction in x-ray emission from Au-Sm target as compared to pure gold. This behaviour, that enhancement occurs in soft x-rays in the case of mixed Au-Sm targets is desirable in the ICF scheme.

  18. Real world CO2and NOxemissions from 149 Euro 5 and 6 diesel, gasoline and hybrid passenger cars.

    Science.gov (United States)

    O'Driscoll, Rosalind; Stettler, Marc E J; Molden, Nick; Oxley, Tim; ApSimon, Helen M

    2018-04-15

    In this study CO 2 and NO x emissions from 149 Euro 5 and 6 diesel, gasoline and hybrid passenger cars were compared using a Portable Emissions Measurement System (PEMS). The models sampled accounted for 56% of all passenger cars sold in Europe in 2016. We found gasoline vehicles had CO 2 emissions 13-66% higher than diesel. During urban driving, the average CO 2 emission factor was 210.5 (sd. 47) gkm -1 for gasoline and 170.2 (sd. 34) gkm -1 for diesel. Half the gasoline vehicles tested were Gasoline Direct Injection (GDI). Euro 6 GDI engines cars. The average urban NO x emission from Euro 6 diesel vehicles 0.44 (sd. 0.44) gkm -1 was 11 times higher than for gasoline 0.04 (sd. 0.04) gkm -1 . We also analysed two gasoline-electric hybrids which out-performed both gasoline and diesel for NO x and CO 2 . We conclude action is required to mitigate the public health risk created by excessive NO x emissions from modern diesel vehicles. Replacing diesel with gasoline would incur a substantial CO 2 penalty, however greater uptake of hybrid vehicles would likely reduce both CO 2 and NO x emissions. Discrimination of vehicles on the basis of Euro standard is arbitrary and incentives should promote vehicles with the lowest real-world emissions of both NO x and CO 2 . Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Who is counseled to lose weight? Survey results and anthropometric data from 3,149 lower socioeconomic women.

    Science.gov (United States)

    Breitkopf, Carmen Radecki; Egginton, Jason S; Naessens, James M; Montori, Victor M; Jatoi, Aminah

    2012-02-01

    Because obesity is a grave public health concern, this study examined the percentage of disadvantaged women who recalled ever having received weight loss advice from a healthcare provider and factors associated with such advice. This study was part of a 5-clinic, cervical cancer prevention trial. Patients not immediately post-partum completed a Spanish/English survey; height and weight were also obtained. Of the 3,149 respondents (response rate 83%), 2,138 (68%) were overweight or obese (body mass index (BMI) ≥ 25); 94% reported a household income of lose weight. Based on BMI, these rates were 15% in the 25-29.9 range (overweight); 34% within 30-34.9; 57% within 35-39.9; and 73% ≥ 40. In univariate analyses, among overweight women, diabetes or English-speaking was associated with weight loss advice. In multivariate analyses, being older, more educated, and diabetic were associated with such advice. 48% of non-Hispanic whites, 31% of non-Hispanic blacks, and 29% of Hispanic had a home scale. Among disadvantaged women, obesity alone does not determine who recalls weight loss advice. Language barriers and lack of a home scale merit further study to address obesity.

  20. Multidisciplinary cancer conferences for gastrointestinal malignancies result in measureable treatment changes: a prospective study of 149 consecutive patients.

    Science.gov (United States)

    Oxenberg, Jacqueline; Papenfuss, Wesley; Esemuede, Iyare; Attwood, Kristopher; Simunovic, Marko; Kuvshinoff, Boris; Francescutti, Valerie

    2015-05-01

    In most jurisdictions, a minority of patients are discussed at multidisciplinary cancer conference (MCC) despite recommendations for such reviews. We assessed the impact of MCC review of gastrointestinal (GI) cancers at a stand-alone cancer center. Patient data were prospectively collected on consecutive cases presented at a GI MCC during a 6-month period. Original treatment plans were collected confidentially before presentation and compared to post-MCC treatment plans. We defined changes in management plans as major (change in treatment modality) or minor (testing prior to original plan). A total of 149 cases were evaluated: 115 upper GI (gastric/small bowel-10 %, liver-32 %, pancreaticobiliary-36 %), and 34 lower GI (23 %). Reasons for presentation were: questions regarding progression/metastases (44 %), management (26 %), diagnosis (21 %), pathology (15 %), and resectability (7 %). Physicians were certain of their original plans being the final recommendations in 84 % (n = 125). Change in management was recommended in 36 %; 72 % were major and 28 % were minor. Patients underwent all recommended treatments at our institution in 77 % of cases, a portion in 5 %, and no recommended treatments in 18 %. On multivariate analysis, physician degree of certainty for original management plan was not predictive of a change in management plan (p = 0.61). Although certainty of prediscussion treatment plan is high, changes in treatment recommendations occurred in more than one-third of patients after GI MCC. This prospective study demonstrates the value of MCC in GI cancer sites, even at a stand-alone cancer center.

  1. Characteristics of cirrhosis undiagnosed during life: a comparative analysis of 73 undiagnosed cases and 149 diagnosed cases of cirrhosis, detected in 4929 consecutive autopsies

    DEFF Research Database (Denmark)

    Graudal, Niels; Leth, Peter Mygind; Mårbjerg, Lone

    1991-01-01

    In 4929 consecutive autopsies performed during a period of 4 years, 222 cases (4.5%) of cirrhosis were found, of which 149 (3%) were detected while the patients were alive (diagnosed cirrhosis) and 73 (1.5%) were not detected while the patients were living (undiagnosed cirrhosis). Fifty-three of ......In 4929 consecutive autopsies performed during a period of 4 years, 222 cases (4.5%) of cirrhosis were found, of which 149 (3%) were detected while the patients were alive (diagnosed cirrhosis) and 73 (1.5%) were not detected while the patients were living (undiagnosed cirrhosis). Fifty......-three of the 73 undiagnosed patients appeared to be completely without signs of cirrhosis (silent cirrhosis). In the diagnosed group, 70% of patients died from hepatic causes, in contrast to 16% in the undiagnosed group. At autopsy, the following complications of cirrhosis were found more frequently...

  2. Two apolipoprotein E mimetic peptides, ApoE(130-149) and ApoE(141-155)2, bind to LRP1.

    Science.gov (United States)

    Croy, Johnny E; Brandon, Theodore; Komives, Elizabeth A

    2004-06-15

    LRP1 is a cell surface receptor responsible for clearing some 30 known ligands. We have previously shown that each of the three complete LDL receptor-homology domains of the LRP1 extracellular domain (sLRPs) binds apoE-enriched beta-VLDL particles. Here we show that two peptides from the N-terminal receptor binding domain of apoE, which are known to elicit a number of different cellular responses, bind to LRP1. Solution binding assays show that the two peptides, apoE(130-149) and apoE(141-155)(2), interact with each of the sLRPs (2, 3, and 4). Each peptide was found to exhibit the same solution binding characteristics as apoE-enriched beta-VLDL particles. Surface plasmon resonance analyses of the sLRP-apoE peptide interaction show that both peptides bind the sLRPs with K(D) values in the 100 nM range, a value similar to the effective concentration required for observation of the cellular responses. Consistent with results from mutagenesis studies of binding of apoE to LDLR, apoE(130-149,Arg142Glu) bound with a K(D) similar to that of the wild-type sequence, while apoE(130-149,Lys143Glu) showed a 10-fold decrease in K(D). Each of the peptides bound heparin, and heparin competed for sLRP binding.

  3. Genome-wide profiling of micro-RNA expression in gefitinib-resistant human lung adenocarcinoma using microarray for the identification of miR-149-5p modulation.

    Science.gov (United States)

    Hu, Yong; Qin, Xiaobing; Yan, Dali; Cao, Haixia; Zhou, Leilei; Fan, Fan; Zang, Jialan; Ni, Jie; Xu, Xiaoyue; Sha, Huanhuan; Liu, Siwen; Yu, Shaorong; Wu, Jianzhong; Ma, Rong; Feng, Jifeng

    2017-03-01

    To understand the mechanism involved in gefitinib resistance, we established gefitinib-resistant human HCC827/GR-8-1 cell line from the parental HCC827 cell line. We compared the micro-RNA expression profiles of the HCC827 cells HCC827/GR-8-1 using Agilent micro-RNA microarrays. The micro-RNAs, such as the miR-149-5p, were up- or downregulated and associated with acquired gefitinib resistance. Quantitative real-time polymerase chain reaction was then performed to verify the expression patterns of different micro-RNAs. The result showed that miR-149-5p was upregulated in the HCC827/GR-8-1 cell line. To investigate the biological function of miR-149-5p in non-small cell lung cancer cells acquired gefitinib resistance, we examined cell proliferation using a cell counting kit-8 assay. Cell viability was evaluated after the miR-149-5p mimics, inhibitors, and negative control were separately transfected into the non-small cell lung cancer cells. The results showed that the non-small cell lung cancer cells transfected with miR-149-5p mimics exhibited reduced cell motility. The drug-sensitivity assay results revealed that the overexpression of miR-149-5p effectively evaluates the half maximal inhibitory concentration values of the cell in response to gefitinib, and the downregulation of miR-149-5p can attenuate the half maximal inhibitory concentration values of the cell lines in response to gefitinib. Furthermore, the levels of miR-149-5p in the HCC827 and HCC827/GR-8-1 cells were inversely correlated with caspase-3 expression. In conclusion, this study revealed that miR-149-5p is upregulated in the HCC827/GR-8-1 cells and involved in the acquired gefitinib resistance.

  4. Downregulated expression of miRNA-149 promotes apoptosis in side population cells sorted from the TSU prostate cancer cell line.

    Science.gov (United States)

    Chen, Yatong; Zhao, Jiahui; Luo, Yong; Wang, Yongxing; Jiang, Yongguang

    2016-11-01

    The objective of the present study was to identify prostate cancer stem cells and determine the effects of modulating specific miRNAs on prostate CSC proliferation and apoptosis. We applied flow cytometry sorting of side population cells to cultures of prostate cancer cell lines (TSU, DU145, PC-3 and LNCaP). The proportion of SP cells in the TSU line was 1.60±0.40% (mean ± SD), while that of the DU145, PC-3 and LNCaP lines was 0.60±0.05, 0.80±0.05 and 0.60±0.20%, respectively. Because the proportion of SP cells derived from TSU cells is greater, these cells were selected to sort side population cells and non-side population cells. The stem-like properties of SP cells had been identified by in vivo and in vitro experiments, and the related study was published. RNA was extracted from the SP cells and non-SP cells and analyzed using miRNA microarray technology. Fifty-three miRNAs with significant differences in their expression were detected in total. Furthermore, 20 of these miRNAs were validated by qPCR. We found that hsa-miR‑149 expression in SP cells and non-SP cells was significantly different; hsa-miR-149 was significantly upregulated in SP cells. By constructing a vector for lentiviral infection, we found that the downregulation of hsa-miR-149 leads to a reduction in proliferation, an increase in apoptosis, and a significant reduction in the colony formation potential, thus, inhibiting tumor growth in vivo of SP cells from the TSU cell line. The present study will provide new avenues toward understanding the function of prostate cancer stem cells (PCSCs) in tumorigenicity and metastasis.

  5. The association between two microRNA variants (miR-499, miR-149 and gastrointestinal cancer risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Li Li

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are small RNA molecules that regulate the expression of corresponding messenger RNAs (mRNAs. Single nucleotide polymorphisms (SNPs in miRNAs may contribute to cancer susceptibility due to changes in the microRNA's properties and/or maturation. The present study aimed to investigate the association between two miRNA polymorphisms (miR-499 rs3746444 and miR-149 rs2292832 and gastrointestinal (GI cancer risk. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a search of case-control studies in PubMed, Wiley Online Library, Web of Science and the CNKI database. Eleven rs3746444 studies and six rs2292832 studies were included in our meta-analysis. The only obvious association between the miR-499 polymorphism and colorectal cancer susceptibility was found in the homozygote comparison (GG vs. AA: OR = 1.66, 95% CI: 1.02-2.70, P(h = 0.10, P = 0.04. No significant association was found in the subgroup analysis for ethnicity and risk of hepatocellular and gastric cancer. A marginally elevated GI cancer risk was discovered in the recessive model for miR-149 (TT vs. TC+CC: OR = 1.15, 95% CI: 1.03-1.30, P(h = 0.68, P = 0.02. Stratifying the results by ethnicity revealed a slight association between the recessive model and the Asian population (TT vs. TC+CC: OR = 1.14, 95% CI: 1.01-1.29, P(h = 0.79, P = 0.03. CONCLUSIONS/SIGNIFICANCE: The present meta-analysis indicates that miR-499 may be associated with the risk to colorectal cancer. MiR-149 may confer a marginally increased risk of susceptibility to gastrointestinal cancer, especially for Asians.

  6. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  7. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  8. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  9. An investigation of the presence of Escherichia coli O149:K91:F4 on pig farms in southern Ontario and the use of antimicrobials and risk factors associated with the presence of this serogroup

    Science.gov (United States)

    Amezcua, Rocio; Friendship, Robert M.; Dewey, Catherine E.

    2008-01-01

    Prevalence, causative factors, treatment, and preventative measures for O149:K91:F4 Escherichia coli infection of postweaning pigs was determined by using a cross-sectional study including 70 farms in Ontario. Surveys were distributed and samples cultured bacteriologically, resulting in 30% of farms testing positive to E. coli O149:K91:F4. Possible causative factors, such as housing or nutrition, were not significantly different between positive and negative farms. Use of injectable antibiotics (P = 0.05) and zinc oxide (P = 0.003) was higher on E. coli O149:K91:K88 (F4)-positive farms. A higher level of biosecurity and the presence of other diseases may be associated with an increased risk of isolating E. coli O149:K91:F4 from weanling pigs. PMID:18320976

  10. MEET ISOLDE - Target Production

    CERN Multimedia

    2017-01-01

    MEET ISOLDE - Target Production. Everything at ISOLDE starts with a target and the target production team realise on more then 50 years of experience to build and develop new targets for ISOLDE’s wide physics program.

  11. Evaluation of the immunological profile of antibody-functionalized metal-filled single-walled carbon nanocapsules for targeted radiotherapy

    Science.gov (United States)

    Perez Ruiz de Garibay, Aritz; Spinato, Cinzia; Klippstein, Rebecca; Bourgognon, Maxime; Martincic, Markus; Pach, Elzbieta; Ballesteros, Belén; Ménard-Moyon, Cécilia; Al-Jamal, Khuloud T.; Tobias, Gerard; Bianco, Alberto

    2017-02-01

    This study investigates the immune responses induced by metal-filled single-walled carbon nanotubes (SWCNT) under in vitro, ex vivo and in vivo settings. Either empty amino-functionalized CNTs [SWCNT-NH2 (1)] or samarium chloride-filled amino-functionalized CNTs with [SmCl3@SWCNT-mAb (3)] or without [SmCl3@SWCNT-NH2 (2)] Cetuximab functionalization were tested. Conjugates were added to RAW 264.7 or PBMC cells in a range of 1 μg/ml to 100 μg/ml for 24 h. Cell viability and IL-6/TNFα production were determined by flow cytometry and ELISA. Additionally, the effect of SWCNTs on the number of T lymphocytes, B lymphocytes and monocytes within the PBMC subpopulations was evaluated by immunostaining and flow cytometry. The effect on monocyte number in living mice was assessed after tail vein injection (150 μg of each conjugate per mouse) at 1, 7 and 13 days post-injection. Overall, our study showed that all the conjugates had no significant effect on cell viability of RAW 264.7 but conjugates 1 and 3 led to a slight increase in IL-6/TNFα. All the conjugates resulted in significant reduction in monocyte/macrophage cell numbers within PBMCs in a dose-dependent manner. Interestingly, monocyte depletion was not observed in vivo, suggesting their suitability for future testing in the field of targeted radiotherapy in mice.

  12. SU-D-304-02: Magnetically Focused Proton Irradiation of Small Field Targets

    Energy Technology Data Exchange (ETDEWEB)

    McAuley, GA; Slater, JM [Loma Linda University, Loma Linda, CA (United States); Slater, JD; Wroe, AJ [Loma Linda University Medical Center, Loma Linda, CA (United States)

    2015-06-15

    Purpose: To investigate the use of magnetic focusing for small field proton irradiations. It is hypothesized that magnetic focusing will provide significant dose distribution benefits over standard collimated beams for fields less than 10 mm diameter. Methods: Magnets consisting of 24 segments of radiation hard samarium-cobalt adhered into hollow cylinders were designed and manufactured. Two focusing magnets were placed on a positioning track on our Gantry 1 treatment table. Proton beams with energies of 127 and 157 MeV, 15 and 30 mm modulation, and 8 mm initial diameters were delivered to a water tank using single-stage scattering. Depth dose distributions were measured using a PTW PR60020 diode detector and transverse profiles were measured with Gafchromic EBT3 film. Monte Carlo simulations were also performed - both for comparison with experimental data and to further explore the potential of magnetic focusing in silica. For example, beam spot areas (based on the 90% dose contour) were matched at Bragg depth between simulated 100 MeV collimated beams and simulated beams focused by two 400 T/m gradient magnets. Results: Preliminary experimental results show 23% higher peak to entrance dose ratios and flatter spread out Bragg peak plateaus for 8 mm focused beams compared with uncollimated beams. Monte Carlo simulations showed 21% larger peak to entrance ratios and a ∼9 fold more efficient dose to target delivery compared to spot-sized matched collimated beams. Our latest results will be presented. Conclusion: Our results suggest that rare earth focusing magnet assemblies could reduce skin dose and beam number while delivering dose to nominally spherical radiosurgery targets over a much shorter time compared to unfocused beams. Immediate clinical applications include those associated with proton radiosurgery and functional radiosurgery of the brain and spine, however expanded treatment sites can be also envisaged.

  13. Non-CpG island promoter hypomethylation and miR-149 regulate the expression of SRPX2 in colorectal cancer

    DEFF Research Database (Denmark)

    Oster, Bodil; Linnet, Lene; Christensen, Lise Lotte

    2012-01-01

    Gene silencing by DNA hypermethylation of CpG islands is a well-characterized phenomenon in cancer. The effect of hypomethylation in particular of non-CpG island genes is much less well described. By genome-wide screening, we identified 105 genes in microsatellite stable (MSS) colorectal adenocar......Gene silencing by DNA hypermethylation of CpG islands is a well-characterized phenomenon in cancer. The effect of hypomethylation in particular of non-CpG island genes is much less well described. By genome-wide screening, we identified 105 genes in microsatellite stable (MSS) colorectal......, MSS, BRAF wt, undifferentiated and of adenocarcinoma histosubtype. Demethylation experiments supported SRPX2 being epigenetically regulated via DNA methylation, whereas other mechanisms in addition to DNA methylation seem to be involved in the regulation of APOLD1. We further identified miR-149...

  14. Volumetric Heat Generation and Consequence Raise in Temperature Due to Absorption of Neutrons from Thermal up to 14.9 MeV Energies

    CERN Document Server

    Massoud, E

    2003-01-01

    In this work, the heat generation rate and the consequence rise in temperature due to absorption of all neutrons from thermal energies (E<0.025) up to 14.9 MeV in water, paraffin wax, ordinary concrete and heavy concrete and heavy concrete as some selected hydrogenous materials are investigated. The neutron flux distributions are calculated by both ANISN-code and three group method in which the fast neutrons are expressed by the removal cross section concept while the other two groups (epithermal and thermal) are treated by the diffusion equation. The heat generation can be calculated from the neutron macroscopic absorption of each material or mixture multiplied by the corresponding neutron fluxes. The rise in temperature is then calculated by using both of the heat generation and the thermal conductivity of the selected materials. Some results are compared with the available experimental and theoretical data and a good agreement is achieved.

  15. Determination of the enantiomer ratio of PBB 149 by GC/NICI-tandem mass spectrometry in the selected reaction monitoring mode

    Energy Technology Data Exchange (ETDEWEB)

    Recke, R. von der; Goetsch, A.; Vetter, W. [Hohenheim Univ., Stuttgart (Germany). Inst. fuer Lebensmittelchemie; Mariussen, E. [Norwegian Inst. for Air Research, Kjeller (Norway); Berger, U.; Herzke, D. [NILU, The Polar Environmental Centre, Tromso (Norway)

    2004-09-15

    Technical mixtures of polybrominated biphenyls (PBBs) have been extensively used as flameretardants in textile and electronic industries and as additives in plastics. Despite a continuous reduction of the worldwide annual production in the last decade, the presence of PBBs in the environment was recently confirmed in a wide range of samples. PBBs exist in a theoretical variety of 209 congeners. Many di-ortho, tri-ortho, and tetra-ortho PBBs form stable pairs of enantiomers, which was experimentally confirmed by enantioselective HPLC separation of chiral PBB in a technical mixture. It is known from the literature, that chiral organohalogen compounds can be degraded enantioselectively. In this work we used a chiral GC stationary phase and developed a method using GC/NICI-MSMS in the single reaction monitoring mode for the determination of the enantioratio of PBB 149 in extracts from Norwegian bird of prey eggs.

  16. Pharmacokinetics of amoxicillin administered in drinking water to recently weaned 3- to 4-week-old pigs with diarrhea experimentally induced by Escherichia coli O149 : F4

    DEFF Research Database (Denmark)

    Jensen, G.M.; Lykkesfeldt, J.; Frydendahl, K.

    2006-01-01

    Objective-To measure effects of Escherichia coli 0149:F4-induced diarrhea on water consumption and pharmacokinetics of amoxicillin after administration in drinking water. Animals-24 recently weaned 24- to 28-day-old crossbred pigs. Procedure-10 pigs were inoculated with E coli O149:F4; all 10 pigs...... subsequently developed diarrhea. Pigs were medicated by administration of amoxicillin in the drinking water (0.75 mg/mL) for a 4-hour period on 2 consecutive days. Fourteen age-matched noninfected healthy pigs (control group) were medicated in a similar manner. Blood samples were obtained from both groups...... daily, and plasma concentrations of amoxicillin were analyzed by use of high-performance liquid chromatography. Results-Diarrhea reduced the area under the plasma concentration-versus-time curve (AUC) and maximum plasma concentration (C-max) of amoxicillin on the first day of medication by 56% and 63...

  17. Targeted Alpha Therapy Using Components of the Plasminogen Activation System for the Control of Micrometastatic Breast Cancer

    Science.gov (United States)

    2000-08-01

    cancers. 14 The alpha emitters Bismuth -213 and Tb-149 are chelated to these molecules. to form alpha emitting alpha-immunoconjugates (AIC) and alpha-PAI...399 [23] Jurcic JG, McDevitt MR, Sgouris G et al, Targeted alpha particle therapy for myeloid leukaemias: a phase 1 trial of Bismuth -213-HuM195 (anti...of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride

  18. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  19. Targeted therapies for cancer

    Science.gov (United States)

    ... so they cannot spread. How Does Targeted Therapy Work? Targeted therapy drugs work in a few different ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  20. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590...

  1. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590 spectrophotometer

  2. Diabetes Mellitus Increased Mortality Rates More in Gender-Specific than in Nongender-Specific Cancer Patients: A Retrospective Study of 149,491 Patients

    Directory of Open Access Journals (Sweden)

    Wen-Ko Chiou

    2012-01-01

    Full Text Available Aims. Hyperinsulinemia in overweight status, obesity, and type 2 diabetes mellitus (DM is often accompanied by cancer. Gender is important in cancer epidemiology, clinical presentation, and response to therapy in different histological types of malignancy. Insufficient information is available concerning gender differences in DM with organ-specific and nonorgan-specific cancers. This study aimed to analyze gender differences in hospitalized cancer patients with or without type 2 DM. Methods. We retrospectively reviewed ten years of patients hospitalized in one institution, enrolling 36,457 female and 50,004 male cancer patients of which 5,992 females and 8,345 males were diagnosed as type 2 DM. Results. Statistically significant increases in incidence of type 2 DM were found in patients of both genders with pancreatic, liver, and urinary tract cancer. Increased incidence of type 2 DM was found in lung and hematologic malignancies in females and prostate cancer in males. Increases in mortality rates of females with type 2 DM (2.98% were higher than those in males. DM increased mortality rates in gender-specific cancers from 1.91% (uterus, HR: 1.33 to 5.04% (ovary, HR: 1.49. Conclusion. Type 2 DM increased mortality of cancer patients of both genders, with higher increases in gender-specific than in nongender-specific cancers.

  3. Recovery following adult spinal deformity surgery: the effect of complications and reoperation in 149 patients with 2-year follow-up.

    Science.gov (United States)

    Scheer, Justin K; Mundis, Gregory M; Klineberg, Eric; Hart, Robert A; Deviren, Vedat; Burton, Douglas C; Protopsaltis, Themistocles S; Gupta, Munish; Rolston, John D; Bess, Shay; Shaffrey, Christopher I; Schwab, Frank; Lafage, Virginie; Smith, Justin S; Ames, Christopher P

    2016-08-01

    To identify the effect of complications and reoperation on the recovery process following adult spinal deformity (ASD) surgery by examining health-related quality of life (HRQOL) measures over time via an integrated health state analysis (IHS). A retrospective review of a multicenter, prospective ASD database was conducted. Complication number, type, and need for reoperation (REOP) or not (NOREOP) were recorded. Patients were stratified as having no complication (NOCOMP), any complication (COMP), only minor complications (MINOR) and any major complications (MAJOR). HRQOL measures included Oswestry Disability Index (ODI), Short Form-36 (SF-36), and Scoliosis Research Society-22 (SRS22) at baseline, 6 weeks, 1 and 2 years postoperatively. All HRQOL scores were normalized to each patient's baseline scores and an IHS was then calculated. 149 patients were included. COMP, MINOR, and MAJOR had significantly lower normalized SRS mental scores at 1 and 2 years than NOCOMP (p analysis suggests there was a significantly protracted mental recovery phase associated with patients that had at least one complication, as well as either a minor and major complication. The addition of a reoperation also adversely affected the mental recovery as well as overall satisfaction.

  4. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)

    1999-10-01

    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  5. Activation cross section measurement at neutron energy from 13.3 to 14.9 MeV using FNS facility

    Energy Technology Data Exchange (ETDEWEB)

    Kasugai, Yoshimi; Ikeda, Yujiro; Uno, Yoshitomo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Yamamoto, Hiroshi; Kawade, Kiyoshi [Nagoya Univ. (Japan)

    2001-03-01

    Sixty activation cross sections have been measured in the neutron energy between 13.4 and 14.9 MeV using intense D-T neutrons source (Fusion Neutronics Source, FNS) at JAERI. The following reactions are included in this work: (1) 32 reactions mainly for lanthanide isotopes, (2) 19 reactions for short-lived products (the half-lives are from 1 s to 20 min) and (3) 9 (n, n{alpha}) reactions. The experimental results were compared with the data reported previously and the evaluated data of ENDF/B-VI Rev. 4, JENDL-3.2 and FENDL/A-2.0. The present data for the (n, p) and (n, {alpha}) reactions were compared with the values estimated by using the empirical formulae proposed by our group in order to validate the systematics for the reactions for the lanthanide isotopes. Systematic trend of (n, n{alpha}) reactions were discussed based on the present data. (author)

  6. 142 - 149_Safiyanu et al.,

    African Journals Online (AJOL)

    User

    Cytochrome P450 (Monooxygenase) assay. This was measured by the method of Borgdon et al. (1998). The monooxygenase catalyses the reduction of hydrogen peroxide and oxidation of tetramethylbenzedine to form water and oxidized blue color tetramethylbenzidine which absorbs light at. 630nm. Twenty microliter of ...

  7. 142 - 149_Safiyanu et al.,

    African Journals Online (AJOL)

    User

    Pimsamurna et al., 2009) and resistance to DDT and deltamethrin was reported in. China. Induction of detoxification enzymes in response to xenobiotic exposure have been well documented in many insects (David et al., 2013). The elevated activity of ...

  8. Targets for Precision Measurements

    Science.gov (United States)

    Loveland, W.; Yao, L.; Asner, D. M.; Baker, R. G.; Bundgaard, J.; Burgett, E.; Cunningham, M.; Deaven, J.; Duke, D. L.; Greife, U.; Grimes, S.; Heffner, M.; Hill, T.; Isenhower, D.; Klay, J. L.; Kleinrath, V.; Kornilov, N.; Laptev, A. B.; Massey, T. N.; Meharchand, R.; Qu, H.; Ruz, J.; Sangiorgio, S.; Selhan, B.; Snyder, L.; Stave, S.; Tatishvili, G.; Thornton, R. T.; Tovesson, F.; Towell, D.; Towell, R. S.; Watson, S.; Wendt, B.; Wood, L.

    2014-05-01

    The general properties needed in targets (sources) for high precision, high accuracy measurements are reviewed. The application of these principles to the problem of developing targets for the Fission TPC is described. Longer term issues, such as the availability of actinide materials, improved knowledge of energy losses and straggling and the stability of targets during irradiation are also discussed.

  9. Setting Asset Performance Targets

    NARCIS (Netherlands)

    Green, D.; Hodkiewicz, M.; Masschelein, S.; Schoenmaker, R.; Muruvan, S.

    2015-01-01

    Setting targets is a common way for organisations to establish performance expectations. However the validity of targets is challenged when performance is influenced by factors beyond the control of the manager. This project examines the issue of target setting for a single asset performance measure

  10. Development of distributed target

    CERN Document Server

    Yu Hai Jun; Li Qin; Zhou Fu Xin; Shi Jin Shui; Ma Bing; Chen Nan; Jing Xiao Bing

    2002-01-01

    Linear introduction accelerator is expected to generate small diameter X-ray spots with high intensity. The interaction of the electron beam with plasmas generated at the X-ray converter will make the spot on target increase with time and debase the X-ray dose and the imaging resolving power. A distributed target is developed which has about 24 pieces of thin 0.05 mm tantalum films distributed over 1 cm. due to the structure adoption, the distributed target material over a large volume decreases the energy deposition per unit volume and hence reduces the temperature of target surface, then reduces the initial plasma formalizing and its expansion velocity. The comparison and analysis with two kinds of target structures are presented using numerical calculation and experiments, the results show the X-ray dose and normalized angle distribution of the two is basically the same, while the surface of the distributed target is not destroyed like the previous block target

  11. Estudo comparativo entre a síndrome antifosfolípide primária e a secundária: características clínico-laboratoriais em 149 pacientes Comparative study between primary and secondary antiphospholipid syndrome: clinic and laboratorial characteristics of 149 patients

    OpenAIRE

    Caio Robledo D'Angioli Costa Quaio; Paulo Eduardo Daruge Grando; Jozélio Freire de Carvalho

    2008-01-01

    OBJETIVOS: O presente estudo tem como objetivo analisar as características clínicas, laboratoriais e imunológicas dos pacientes com síndrome antifosfolípide (SAF) e comparar indivíduos portadores da síndrome primária com portadores da secundária. PACIENTES E MÉTODOS: Foi analisado o banco de dados de 149 pacientes com SAF do Serviço de Reumatologia do HC-FMUSP que satisfaziam os critérios de classificação para SAF. RESULTADOS: A amostra consistiu de 140 (94%) mulheres e 9 (6%) homens, com méd...

  12. Long-term risks after splenectomy among 8,149 cancer-free American veterans: a cohort study with up to 27 years follow-up

    Science.gov (United States)

    Kristinsson, Sigurdur Y.; Gridley, Gloria; Hoover, Robert N; Check, David; Landgren, Ola

    2014-01-01

    Although preservation of the spleen following abdominal trauma and spleen-preserving surgical procedures have become gold standards, about 22,000 splenectomies are still conducted annually in the USA. Infections, mostly by encapsulated organisms, are the most well-known complications following splenectomy. Recently, thrombosis and cancer have become recognized as potential adverse outcomes post-splenectomy. Among more than 4 million hospitalized USA veterans, we assessed incidence and mortality due to infections, thromboembolism, and cancer including 8,149 cancer-free veterans who underwent splenectomy with a follow-up of up to 27 years. Relative risk estimates and 95% confidence intervals were calculated using time-dependent Poisson regression methods for cohort data. Splenectomized patients had an increased risk of being hospitalized for pneumonia, meningitis, and septicemia (rate ratios=1.9–3.4); deep venous thrombosis and pulmonary embolism (rate ratios=2.2); certain solid tumors: buccal, esophagus, liver, colon, pancreas, lung, and prostate (rate ratios =1.3–1.9); and hematologic malignancies: non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and any leukemia (rate ratios =1.8–6.0). They also had an increased risk of death due to pneumonia and septicemia (rate ratios =1.6–3.0); pulmonary embolism and coronary artery disease (rate ratios =1.4–4.5); any cancer: liver, pancreas, and lung cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, and any leukemia (rate ratios =1.3–4.7). Many of the observed risks were increased more than 10 years after splenectomy. Our results underscore the importance of vaccination, surveillance, and thromboprophylaxis after splenectomy. PMID:24056815

  13. Inertial Confinement fusion targets

    Science.gov (United States)

    Hendricks, C. D.

    1982-01-01

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  14. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  15. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice

    2002-01-01

    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  16. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.

    2006-11-07

    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  17. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  18. Target visibility for multiple maneuvering target tracking

    Science.gov (United States)

    Sabordo, Madeleine G.; Aboutanios, Elias

    2015-05-01

    We present a recursion of the probability of target visibility and its applications to analysis of track life and termination in the context of Global Nearest Neighbour (GNN) approach and Probability Hypothesis Density (PHD) filter. In the presence of uncertainties brought about by clutter; decisions to retain a track, terminate it or initialise a new track are based on probability, rather than on distance criterion or estimation error. The visibility concept is introduced into a conventional data-association-oriented multitarget tracker, the GNN; and a random finite set based-tracker, the PHD filter, to take into account instances when targets become invisible or occluded by obstacles. We employ the natural logarithmof the Dynamic Error Spectrum to assess the performance of the trackers with and without probability of visibility incorporated. Simulation results show that the performance of the GNN tracker with visibility concept incorporated is significantly enhanced.

  19. Frozen spin targets

    CERN Document Server

    Parsons, A S L

    1976-01-01

    Describes six projects which use the frozen-spin principle: Helium-3 R.M.S. and longitudinally polarized frozen spin targets at Rutherford Laboratory, and the frozen spin targets at KEK, Saclay and the one used by the CERN-Helsinki collaboration. (7 refs).

  20. Seedling root targets

    Science.gov (United States)

    Diane L. Haase

    2011-01-01

    Roots are critical to seedling performance after outplanting. Although root quality is not as quick and simple to measure as shoot quality, target root characteristics should be included in any seedling quality assessment program. This paper provides a brief review of root characteristics most commonly targeted for operational seedling production. These are: root mass...

  1. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)

    2003-01-01

    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit

  2. Segmented Target Design

    Science.gov (United States)

    Merhi, Abdul Rahman; Frank, Nathan; Gueye, Paul; Thoennessen, Michael; MoNA Collaboration

    2013-10-01

    A proposed segmented target would improve decay energy measurements of neutron-unbound nuclei. Experiments like this have been performed at the National Superconducting Cyclotron Laboratory (NSCL) located at Michigan State University. Many different nuclei are produced in such experiments, some of which immediately decay into a charged particle and neutron. The charged particles are bent by a large magnet and measured by a suite of charged particle detectors. The neutrons are measured by the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). With the current target setup, a nucleus in a neutron-unbound state is produced with a radioactive beam impinged upon a beryllium target. The resolution of these measurements is very dependent on the target thickness since the nuclear interaction point is unknown. In a segmented target using alternating layers of silicon detectors and Be-targets, the Be-target in which the nuclear reaction takes place would be determined. Thus the experimental resolution would improve. This poster will describe the improvement over the current target along with the status of the design. Work supported by Augustana College and the National Science Foundation grant #0969173.

  3. The CNGS target

    CERN Multimedia

    Patrice Loïez

    2005-01-01

    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  4. Chemical and biological evaluation of {sup 153}Sm and {sup 46/47}Sc complexes of indazolebisphosphonates for targeted radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Maria, E-mail: mneves@itn.p [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Teixeira, Fatima C.; Antunes, Ines [INETI-Departamento de Tecnologia de Industrias Quimicas, Lisboa (Portugal); Majkowska, Agnieszka [Institute of Nuclear Chemistry and Technology, Warsaw (Poland); Gano, Lurdes [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Santos, Ana Cristina [IBB-Instituto de Biofisica e Biomatematica, Coimbra (Portugal)

    2011-01-15

    Introduction: Novel 1-hydroxy-1,1-bisphosphonates derived from indazole and substituted at the C-3 position were labeled with the radionuclides {sup 46}Sc and {sup 153}Sm. Several parameters such as molar ligand concentration, pH, reaction time and temperature were studied. The radiolabelling yield, reaction kinetics and stability were assessed and radiocomplexes were evaluated by in vitro and in vivo experiments. Methods: The radionuclides {sup 46}Sc and {sup 153}Sm were obtained by neutron irradiation of natural Sc{sub 2}O{sub 3} and enriched {sup 152}Sm{sub 2}O{sub 3} (98.4%) targets at the neutron flux of 3x10{sup 14} n cm{sup -2} s{sup -1}. The radiolabelling yield, reaction kinetics and stability were accomplished by ascending instant thin layer chromatography. The radiocomplexes were submitted to in vitro experiments (hydroxyapatite binding and lipophilicity) and biodistribution studies in animal models. Results: The radionuclides {sup 46}Sc and {sup 153}Sm were produced with specific activities of 100 and 430 MBq mg{sup -1}, respectively. High radiochemical yields were achieved and the hydrophilic radiocomplexes have shown high degree of binding to hydroxyapatite. Biodistribution studies at 1, 3 and 24 h of the 4 radiocomplexes under study, have showed a similar biodistribution profile with a relatively high bone uptake, slow clearance from blood and a very slow rate of total radioactivity excretion from the whole animal body. Conclusion: We have developed a new class of indazolebisphosphonates complexes with radioisotopes of samarium and scandium. All complexes have shown high degree of binding to hydroxyapatite, which could be attributed to the ionized phosphonate groups. The bone uptake and the bone-to-muscle ratios were relatively low.

  5. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco

    2010-11-01

    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  6. Targets and teamwork

    DEFF Research Database (Denmark)

    Skinner, Timothy C; Lange, Karin S; Hoey, Hilary

    2017-01-01

    with less disagreement about recommended targets. Multiple regression analysis indicated that teams reporting higher HbA1c targets and more target disagreement had parents reporting higher treatment targets. This seemed to partially account for center differences in Hb1Ac. Conclusions: The diabetes care....... Research Design and Methods: Children, under the age of 11 with type 1 diabetes and their parents treated at the study centers participated. Clinical, medical, and demographic data were obtained, along with blood sample for centralized assay. Parents and all members of the diabetes care team completed...... questionnaires on treatment targets for hemoglobin A1c (HbA1c) and recommended frequency of blood glucose monitoring. Results: Totally 1113 (53% male) children (mean age 8.0±2.1years) from 18 centers in 17 countries, along with parents and 113 health-care professionals, participated. There were substantial...

  7. Solvent hold tank sample results for MCU-17-122-124 (March 2017), MCU-17-130-132 (April 2017), MCU-17-133-135 (May 2017), and MCU-17-141-149 (June 2017): Quarterly Report

    Energy Technology Data Exchange (ETDEWEB)

    Fondeur, F. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Jones, D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2017-09-13

    A trend summary of four Solvent Hold Tank (SHT) monthly samples; MCU-16-122-124 (March 2017), MCU-17-130-132 (April 2017), MCU-17-133-135 (May 2017), and MCU-17-141-149 (June 2017) are reported. Analyses of the June SHT sample (MCU-17-141-149) indicated that the modifier (CS-7SB) and the extractant (MaxCalix) concentrations were slightly below (4% each) their nominal recommended levels (169,000 mg/L and 46,400 mg/L respectively). The suppressor (TiDG) level has decreased since the January 2017 measurement but has remained steady in the range of 666 to 705 mg/L, well above the minimum recommended level (479 mg/L), but below the nominal level. The “flat” trends observed in the TiDG, MaxCalix, modifier, and Gamma measurement are consistent with the solvent being idle since January 10, 2017.

  8. Association of miR-146a, miR-149, miR-196a2, and miR-499 Polymorphisms with Ossification of the Posterior Longitudinal Ligament of the Cervical Spine.

    Directory of Open Access Journals (Sweden)

    Jae Joon Lim

    Full Text Available Ossification of the posterior longitudinal ligament (OPLL of the spine is considered a multifactorial and polygenic disease. We aimed to investigate the association between four single nucleotide polymorphisms (SNPs of pre-miRNAs [miR-146aC>G (rs2910164, miR-149T>C (rs2292832, miR-196a2T>C (rs11614913, and miR-499A>G (rs3746444] and the risk of cervical OPLL in the Korean population.The genotypic frequencies of these four SNPs were analyzed in 207 OPLL patients and 200 controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay.For four SNPs in pre-miRNAs, no significant differences were found between OPLL patients and controls. However, subgroup analysis based on OPLL subgroup (continuous: continuous type plus mixed type, segmental: segmental and localized type showed that miR-499GG genotype was associated with an increased risk of segmental type OPLL (adjusted odds ratio = 4.314 with 95% confidence interval: 1.109-16.78. In addition, some allele combinations (C-T-T-G, G-T-T-A, and G-T-C-G of miR-146a/-149/-196a2/-499 and combined genotypes (miR-149TC/miR-196a2TT were associated with increased OPLL risk, whereas the G-T-T-G and G-C-C-G allele combinations were associated with decreased OPLL risk.The results indicate that GG genotype of miR-499 is associated with significantly higher risks of OPLL in the segmental OPLL group. The miR-146a/-149/-196a2/-499 allele combinations may be a genetic risk factor for cervical OPLL in the Korean population.

  9. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  10. Target Price Accuracy

    Directory of Open Access Journals (Sweden)

    Alexander G. Kerl

    2011-04-01

    Full Text Available This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio. However, target price accuracy is positively related to the level of detail of each report, company size and the reputation of the investment bank. The potential conflicts of interests between an analyst and a covered company do not bias forecast accuracy.

  11. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available This research describes a quantitative methodology for deriving optimal exploration target zones based on a probabilistic mineral prospectivity map. In order to arrive at out objective, we provide a plausible answer to the following question: "Which...

  12. Delays in thick targets

    CERN Document Server

    Bennett, J R J

    2002-01-01

    The delays in the emission of radioactive particles from a thick target bombarded by high-energy protons is discussed in relation to the basic physical processes of diffusion and effusion through the target and ioniser. The delay time, relative to the decay time, is crucial to the efficiency of particle release at the exit of the ioniser. The principles of minimizing the delay times are discussed with reference to a mathematical model of the process, and some experimental examples are given.

  13. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  14. Burglar Target Selection

    Science.gov (United States)

    Townsley, Michael; Bernasco, Wim; Ruiter, Stijn; Johnson, Shane D.; White, Gentry; Baum, Scott

    2015-01-01

    Objectives: This study builds on research undertaken by Bernasco and Nieuwbeerta and explores the generalizability of a theoretically derived offender target selection model in three cross-national study regions. Methods: Taking a discrete spatial choice approach, we estimate the impact of both environment- and offender-level factors on residential burglary placement in the Netherlands, the United Kingdom, and Australia. Combining cleared burglary data from all study regions in a single statistical model, we make statistical comparisons between environments. Results: In all three study regions, the likelihood an offender selects an area for burglary is positively influenced by proximity to their home, the proportion of easily accessible targets, and the total number of targets available. Furthermore, in two of the three study regions, juvenile offenders under the legal driving age are significantly more influenced by target proximity than adult offenders. Post hoc tests indicate the magnitudes of these impacts vary significantly between study regions. Conclusions: While burglary target selection strategies are consistent with opportunity-based explanations of offending, the impact of environmental context is significant. As such, the approach undertaken in combining observations from multiple study regions may aid criminology scholars in assessing the generalizability of observed findings across multiple environments. PMID:25866418

  15. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  16. Setting reference targets

    Energy Technology Data Exchange (ETDEWEB)

    Ruland, R.E.

    1997-04-01

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets.

  17. Targeted Therapy of CLL.

    Science.gov (United States)

    Al-Sawaf, Othman; Fischer, Kirsten; Eichhorst, Barbara; Hallek, Michael

    2016-01-01

    The landscape of chronic lymphocytic leukemia (CLL) has undergone profound changes in the past years. First, the addition of CD20-targeting antibodies to conventional chemotherapy has improved the therapeutic outcome in the majority of CLL patients. Since the establishment of the critical role of the B cell receptor signaling pathway in the pathogenesis of CLL, several agents have been developed to target this pathway. Ibrutinib and idelalisib, 2 potent kinase inhibitors, have both become available for CLL therapy in the first and second line. Additionally, the observation of high expression levels of the anti-apoptotic mitochondrial protein Bcl-2 in CLL has led to the development of venetoclax, a BH3 mimetic compound that inhibits Bcl-2 and has shown high efficacy in CLL. This short review summarizes preclinical and clinical data on currently available agents in CLL and provides an outlook on upcoming new challenges in the targeted therapy of CLL. © 2016 S. Karger GmbH, Freiburg.

  18. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses how...... the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...

  19. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma

    2006-10-01

    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  20. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available , Carranza, Stein, van der Meer Introduction to Remote Sensing Background and Objective of the study Methodology Results Optimal Exploration Target Zones Pravesh Debba1, Emmanual M.J. Carranza2, Alfred Stein2, Freek D. van der Meer2 1CSIR, Logistics... and Quantitative Methods, CSIR Built Environment 2International Institute for Geo-Information Science and Earth Observation (ITC), Hengelosestraat 99, P.O. Box 6, 7500AA Enschede, The Netherlands Optimal Exploration Target Zones Debba, Carranza, Stein, van der Meer...

  1. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  2. Imbalanced target prediction with pattern discovery on clinical data repositories.

    Science.gov (United States)

    Chan, Tak-Ming; Li, Yuxi; Chiau, Choo-Chiap; Zhu, Jane; Jiang, Jie; Huo, Yong

    2017-04-20

    Clinical data repositories (CDR) have great potential to improve outcome prediction and risk modeling. However, most clinical studies require careful study design, dedicated data collection efforts, and sophisticated modeling techniques before a hypothesis can be tested. We aim to bridge this gap, so that clinical domain users can perform first-hand prediction on existing repository data without complicated handling, and obtain insightful patterns of imbalanced targets for a formal study before it is conducted. We specifically target for interpretability for domain users where the model can be conveniently explained and applied in clinical practice. We propose an interpretable pattern model which is noise (missing) tolerant for practice data. To address the challenge of imbalanced targets of interest in clinical research, e.g., deaths less than a few percent, the geometric mean of sensitivity and specificity (G-mean) optimization criterion is employed, with which a simple but effective heuristic algorithm is developed. We compared pattern discovery to clinically interpretable methods on two retrospective clinical datasets. They contain 14.9% deaths in 1 year in the thoracic dataset and 9.1% deaths in the cardiac dataset, respectively. In spite of the imbalance challenge shown on other methods, pattern discovery consistently shows competitive cross-validated prediction performance. Compared to logistic regression, Naïve Bayes, and decision tree, pattern discovery achieves statistically significant (p-values data and tweaking, the prediction performance of pattern discovery is consistently comparable to the best achievable performance. Pattern discovery has demonstrated to be robust and valuable for target prediction on existing clinical data repositories with imbalance and noise. The prediction results and interpretable patterns can provide insights in an agile and inexpensive way for the potential formal studies.

  3. Aquaporin-2 membrane targeting

    DEFF Research Database (Denmark)

    Olesen, Emma T B; Fenton, Robert A

    2017-01-01

    The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...

  4. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  5. Microenvironmental targets in sarcoma

    Directory of Open Access Journals (Sweden)

    Monika eEhnman

    2015-11-01

    Full Text Available Sarcomas are rare malignant tumors affecting all age groups. They are typically classified according to their resemblance to corresponding normal tissue. Their heterogeneous features, for example in terms of disease-driving genetic aberrations and body location, complicate both disease classification and development of novel treatment regimens. Many years of failure of improved patient outcome in clinical trials has lead to the conclusion that novel targeted therapies are likely needed in combination with current multimodality regimens. Sarcomas have not, in contrast to the common carcinomas, been the subject for larger systematic studies on how tumor behavior relates to characteristics of the tumor microenvironment. There is consequently an urgent need for identifying suitable molecular targets, not only in tumor cells, but also in the tumor microenvironment. This review discusses preclinical and clinical data about potential molecular targets in sarcomas. Studies on targeted therapies involving the tumor microenvironment are prioritized. A greater understanding of the biological context is expected to facilitate more successful design of future clinical trials in sarcoma.

  6. Target Heart Rates

    Science.gov (United States)

    ... is your level of intensity? When is the best time of day to work out? Target Heart Rates Warm Up, Cool Down See More >> Getting Active Getting Started - Tips for Long-term Exercise Success Get Moving: Easy Tips to Get Active! ...

  7. Targeted Therapy for Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, Thomas [Alphamed, Jackson, TN (United States); Moore, Herbert [Alphamed, Jackson, TN (United States)

    2016-12-05

    The research project, entitled ”Targeted Therapy for Melanoma,” was focused on investigating the use of kidney protection measures to lower the non-specific kidney uptake of the radiolabeled Pb-DOTA-ReCCMSH peptide. Previous published work demonstrated that the kidney exhibited the highest non-target tissue uptake of the 212Pb/203Pb radiolabeled melanoma targeting peptide DOTA-ReCCMSH. The radiolabeled alpha-melanocyte stimulating hormone (α-MSH) peptide analog DOTA-Re(Arg11)CCMSH, which binds the melanocortin-1 receptor over-expressed on melanoma tumor cells, has shown promise as a PRRT agent in pre-clinical studies. High tumor uptake of 212Pb labeled DOTA-Re(Arg11)CCMSH resulted in tumor reduction or eradication in melanoma therapy studies. Of particular note was the 20-50% cure rate observed when melanoma mice were treated with alpha particle emitter 212Pb. However, as with most PRRT agents, high radiation doses to the kidneys where observed. To optimize tumor treatment efficacy and reduce nephrotoxicity, the tumor to kidney uptake ratio must be improved. Strategies to reduce kidney retention of the radiolabeled peptide, while not effecting tumor uptake and retention, can be broken into several categories including modification of the targeting peptide sequence and reducing proximal tubule reabsorption.

  8. Target Chamber Manipulator

    Science.gov (United States)

    Tantillo, Anthony; Watson, Matthew

    2015-11-01

    A system has been developed to allow remote actuation of sensors in a high vacuum target chamber used with a particle accelerator. Typically, sensors of various types are placed into the target chamber at specific radial and angular positions relative to the beam line and target. The chamber is then evacuated and the experiments are performed for those sensor positions. Then, the chamber is opened, the sensors are repositioned to new angles or radii, and the process is repeated, with a separate pump-down cycle for each set of sensor positions. The new sensor positioning system allows scientists to pre-set the radii of up to a dozen sensors, and then remotely actuate their angular positions without breaking the vacuum of the target chamber. This reduces the time required to reposition sensors from 6 hours to 1 minute. The sensors are placed into one of two tracks that are separately actuated using vacuum-grade stepping motors. The positions of the sensors are verified using absolute optical rotary encoders, and the positions are accurate to 0.5 degrees. The positions of the sensors are electronically recorded and time-stamped after every change. User control is through a GUI using LabVIEW.

  9. Active Target Simulation

    Science.gov (United States)

    Smith, Nathan; Draznik, Peter; Frank, Nathan

    2012-10-01

    We have simulated an existing experimental design to determine the resolution improvement upon energy measurements of neutron unbound nuclei. A number of experiments of this type have been performed at the National Superconducting Cyclotron Laboratory (NSCL), located at Michigan State University. An excited nucleus is typically produced with a radioactive beam interacting with a passive Beryllium target. Many different nuclei are produced in experiment, each of which immediately decays into a charged particle and neutron. The charged particles are detected and the neutrons interact in scintillation detectors such as the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). In our simulation, we have constructed an active target that provides additional information such that the point of nuclear interaction within the target may be determined. This information improves the resolution in decay energy measurements of neutron unbound isotopes. This presentation will cover some aspects of the simulation process, as well as showing some of the results that demonstrate the simulated improvement over a passive target.

  10. Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from time series observations using Bubble type equilibrator for autonomous carbon dioxide (CO2) measurement, Carbon dioxide (CO2) gas analyzer and other instruments from MOORING_GAKOA_149W_60N in the Gulf of Alaska from 2011-05-19 to 2016-03-01 (NODC Accession 0116714)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0116714 includes chemical, meteorological, physical and time series data collected from MOORING_GAKOA_149W_60N in the Gulf of Alaska from 2011-05-19...

  11. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  12. Emerging Targets in Photopharmacology.

    Science.gov (United States)

    Lerch, Michael M; Hansen, Mickel J; van Dam, Gooitzen M; Szymanski, Wiktor; Feringa, Ben L

    2016-09-05

    The field of photopharmacology uses molecular photoswitches to establish control over the action of bioactive molecules. It aims to reduce systemic drug toxicity and the emergence of resistance, while achieving unprecedented precision in treatment. By using small molecules, photopharmacology provides a viable alternative to optogenetics. We present here a critical overview of the different pharmacological targets in various organs and a survey of organ systems in the human body that can be addressed in a non-invasive manner. We discuss the prospects for the selective delivery of light to these organs and the specific requirements for light-activatable drugs. We also aim to illustrate the druggability of medicinal targets with recent findings and emphasize where conceptually new approaches have to be explored to provide photopharmacology with future opportunities to bring "smart" molecular design ultimately to the realm of clinical use. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Inflation Targeting: Provisional Results

    Directory of Open Access Journals (Sweden)

    Cerna, Silviu

    2010-06-01

    Full Text Available Inflation targeting monetary policy framework that requires the central bank to achieve a low inflation has contributed to price stability in industrialized countries. As well as the other developing countries, ex communist countries have also tried to apply this strategy, which was susceptible to increase monetary policy transparency and to determine authorities to make necessary reforms in order to pass from a planned to a market economy. In Romania, inflation targeting has contributed, to a large extent, to price increase smoothening, without affecting economic growth. Knowing the factors that have determined this unquestionable success allows for not only understanding the Romanian transition process, but also draw some useful conclusions in view of the necessary actions for adopting the euro.

  14. Foucault on targets.

    Science.gov (United States)

    Lynch, John

    2004-01-01

    This paper seeks to gain an insight into the behavior of a large NHS trust, in its attempt to meet a 90 percent patient access target, in a week long national audit in March 2003. Why did individuals act in dramatically different ways to their norm over this period. The work of Michel Foucault is used to explore these issues. The discourses of power, knowledge, discipline and governmentality are identified as key foucaudian themes that offer an alternative interpretation of how individuals behave in their place of work. The importance of the historical context of discourse within the NHS cannot be underestimated in shaping the behavior of individuals and groups today. Power and knowledge permeate NHS organizations through disciplinary practices and dressage. Governmentality seeks to maintain the status quo through disciplinary processes such as national healthcare targets. The natural response of NHS organizations is therefore, to seek order and conformity rather than disorder and conflict.

  15. Antibodies Targeting EMT

    Science.gov (United States)

    2017-10-01

    VLDL uptake and redistribution of lipids to cells for energy metabolism and cell signaling. ApoE overexpression has shown to be associated with a...involved in testosterone and estradiol biosynthesis, as well as prostaglandin F synthesis and has previously been implicated in cancer progression, AKR1C2...is involved in androgen metabolism and is a potential drug target for prostate cancer. AKR1C4 is involved in bile acid synthesis but has not yet

  16. Explosive Target Balances

    OpenAIRE

    Potrafke, Niklas; Reischmann, Markus

    2013-01-01

    Using the new unit root test by Phillips et al. (2011) we show that the Target balances of the German Bundesbank have been exploding from the beginning of 2009 to the beginning of 2013. By implementing a full-allotment policy and reducing the required minimum quality of collaterals in October 2008, the European Central Bank (ECB) refinanced credits in the GIIPS countries to a large extent. Private capital flowed out of the GIIPS countries (Greece, Italy, Ireland, Portugal and Spain), and the ...

  17. Implementing Target Value Design.

    Science.gov (United States)

    Alves, Thais da C L; Lichtig, Will; Rybkowski, Zofia K

    2017-04-01

    An alternative to the traditional way of designing projects is the process of target value design (TVD), which takes different departure points to start the design process. The TVD process starts with the client defining an allowable cost that needs to be met by the design and construction teams. An expected cost in the TVD process is defined through multiple interactions between multiple stakeholders who define wishes and others who define ways of achieving these wishes. Finally, a target cost is defined based on the expected profit the design and construction teams are expecting to make. TVD follows a series of continuous improvement efforts aimed at reaching the desired goals for the project and its associated target value cost. The process takes advantage of rapid cycles of suggestions, analyses, and implementation that starts with the definition of value for the client. In the traditional design process, the goal is to identify user preferences and find solutions that meet the needs of the client's expressed preferences. In the lean design process, the goal is to educate users about their values and advocate for a better facility over the long run; this way owners can help contractors and designers to identify better solutions. This article aims to inform the healthcare community about tools and techniques commonly used during the TVD process and how they can be used to educate and support project participants in developing better solutions to meet their needs now as well as in the future.

  18. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  19. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  20. Meeting the Aichi targets

    DEFF Research Database (Denmark)

    Funk, Stephan M; Conde, Dalia Amor; Lamoreux, John

    2017-01-01

    &s), is an excellent opportunity to achieve the Aichi 2020 Targets T11 (protected areas) and T12 (preventing species extinctions). AZE taxa have small, single-site populations that are especially vulnerable to human-induced extinctions, particularly for the many amphibians. We show that AZEs&s can be protected...... feasibly and cost-effectively, but action is urgent. We argue that the Alliance, whose initial main aim was to identify AZEs&s, must be followed up by a second-generation initiative that directs and co-ordinates AZE conservation activities on the ground. The prominent role of zoos, conservation NGOs...

  1. Polarized scintillator targets

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2000-05-01

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as "live" polarized targets in nuclear physics experiments.

  2. Polarized scintillator targets

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, B. van den E-mail: vandenbrandt@psi.ch; Bunyatova, E.I.; Hautle, P.; Konter, J.A.; Mango, S

    2000-05-21

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as 'live' polarized targets in nuclear physics experiments.

  3. Targeting Prostate Cancer Metastasis

    Science.gov (United States)

    2015-09-01

    achieve this goal, we cultured high-invasive prostate cancer PC3 cells and treated them with the drugs/inhibitors that were proposed to target WASF3...groups (treated by DMSO), either treated by 100 μM CYT997 or 10 μM Dasatinib suppressed the cells to spread throughout the fish body (Fig. 4). As...have scr eened t he e f fect s o f mor e t han 40 drugs on invasion using cul tur ed prost ate cancer cells and f ound t hat tar geting multiple

  4. Targeting Nuclear Thymidylate Biosynthesis

    Science.gov (United States)

    Chon, James; Stover, Patrick J.; Field, Martha S.

    2016-01-01

    Thymidylate (dTMP) biosynthesis plays an essential and exclusive function in DNA synthesis and proper cell division, and therefore has been an attractive therapeutic target. Folate analogues, known as antifolates, and nucleotide analogs that inhibit the enzymatic action of the de novo thymidylate biosynthesis pathway and are commonly used in cancer treatment. In this review, we examine the mechanisms by which the antifolate 5-fluorouracil, as well as other dTMP synthesis inhibitors, function in cancer treatment in light of emerging evidence that dTMP synthesis occurs in the nucleus. Nuclear localization of the de novo dTMP synthesis pathway requires modification of the pathway enzymes by the small ubiquitin-like modifier (SUMO) protein. SUMOylation is required for nuclear localization of the de novo dTMP biosynthesis pathway, and disruption in the SUMO pathway inhibits cell proliferation in several cancer models. We summarize evidence that the nuclear localization of the dTMP biosynthesis pathway is a critical factor in the efficacy of antifolate-based therapies that target dTMP synthesis. PMID:27876557

  5. Targeted corneal transplantation.

    Science.gov (United States)

    Jhanji, Vishal; Mehta, Jod S; Sharma, Namrata; Sharma, Bhavana; Vajpayee, Rasik B

    2012-07-01

    Corneal transplantation surgery has moved from an era of conventional penetrating keratoplasty to selective replacement of the diseased corneal layer with complementary healthy donor corneal tissue. Anterior lamellar transplantation surgeries do not involve replacement of corneal endothelium, consequently eliminating the occurrence of endothelial rejection. Similarly, in diseases affecting the corneal endothelium, selective replacement with a lamellar lenticule bearing healthy endothelium provides better outcomes in terms of ocular surface, lesser astigmatism and quick visual recovery. In addition to the advantages of enhanced surgical outcomes, targeted corneal transplantation allows the use of one donor cornea for more than one recipient, thereby offering a viable solution to the problem of paucity of donor corneas. Evolving techniques of corneal transplantation have enabled better utilization of donor corneal tissue. Anterior lamellar as well as endothelial keratoplasty surgeries have become first-choice surgeries in appropriately selected cases. This review briefly discusses some of these novel surgical techniques. A better understanding of targeted corneal transplantation would lead to adaptation of the concept of component corneal surgery. This would further enable the corneal surgeons to circumvent the problem of donor corneal shortage especially in the developing world.

  6. Fixed target beams

    CERN Document Server

    Kain, V; Cettour-Cave, S; Cornelis, K; Fraser, M A; Gatignon, L; Goddard, B; Velotti, F

    2017-01-01

    The CERN SPS (Super Proton Synchrotron) serves asLHC injector and provides beam for the North Area fixedtarget experiments. At low energy, the vertical acceptancebecomes critical with high intensity large emittance fixed tar-get beams. Optimizing the vertical available aperture is a keyingredient to optimize transmission and reduce activationaround the ring. During the 2016 run a tool was developed toprovide an automated local aperture scan around the entirering.The flux of particles slow extracted with the1/3inte-ger resonance from the Super Proton Synchrotron at CERNshould ideally be constant over the length of the extractionplateau, for optimum use of the beam by the fixed target ex-periments in the North Area. The extracted intensity is con-trolled in feed-forward correction of the horizontal tune viathe main SPS quadrupoles. The Mains power supply noiseat 50 Hz and harmonics is also corrected in feed-forwardby small amplitude tune modulation at the respective fre-quencies with a dedicated additional quad...

  7. Old Drug, New Target

    Science.gov (United States)

    Andrews, William J.; Panova, Tatiana; Normand, Christophe; Gadal, Olivier; Tikhonova, Irina G.; Panov, Konstantin I.

    2013-01-01

    Transcription by RNA polymerase I (Pol-I) is the main driving force behind ribosome biogenesis, a fundamental cellular process that requires the coordinated transcription of all three nuclear polymerases. Increased Pol-I transcription and the concurrent increase in ribosome biogenesis has been linked to the high rates of proliferation in cancers. The ellipticine family contains a number of potent anticancer therapeutic agents, some having progressed to stage I and II clinical trials; however, the mechanism by which many of the compounds work remains unclear. It has long been thought that inhibition of Top2 is the main reason behind the drugs antiproliferative effects. Here we report that a number of the ellipticines, including 9-hydroxyellipticine, are potent and specific inhibitors of Pol-I transcription, with IC50 in vitro and in cells in the nanomolar range. Essentially, the drugs did not affect Pol-II and Pol-III transcription, demonstrating a high selectivity. We have shown that Pol-I inhibition occurs by a p53-, ATM/ATR-, and Top2-independent mechanism. We discovered that the drug influences the assembly and stability of preinitiation complexes by targeting the interaction between promoter recognition factor SL1 and the rRNA promoter. Our findings will have an impact on the design and development of novel therapeutic agents specifically targeting ribosome biogenesis. PMID:23293027

  8. Quantum state targeting

    Science.gov (United States)

    Rudolph, Terry; Spekkens, Robert W.

    2004-11-01

    We introduce a primitive for quantum cryptography that we term “state targeting.” We show that increasing one’s probability of success in this task above a minimum amount implies an unavoidable increase in the probability of a particular kind of failure. This is analogous to the unavoidable disturbance to a quantum state that results from gaining information about its identity, and can be shown to be a purely quantum effect. We solve various optimization problems for state targeting that are useful for the security analysis of two-party cryptographic tasks implemented between remote antagonistic parties. Although we focus on weak coin flipping, the results are significant for other two-party protocols, such as strong coin flipping, partially binding and concealing bit commitment, and bit escrow. Furthermore, the results have significance not only for the traditional notion of security in cryptography, that of restricting a cheater’s ability to bias the outcome of the protocol, but also for a different notion of security that arises only in the quantum context, that of cheat sensitivity. Finally, our analysis leads to some interesting secondary results, namely, a generalization of Uhlmann’s theorem and an operational interpretation of the fidelity between two mixed states.

  9. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  10. Targeting adipose tissue

    Directory of Open Access Journals (Sweden)

    Haas Bodo

    2012-10-01

    Full Text Available Abstract Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT is generally known and stores excess energy in the form of triacylglycerol (TG, insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP. The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET, however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs, activators of peroxisome proliferator-activated receptor γ (PPARγ a ‘master’ regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  11. Targeting adipose tissue.

    Science.gov (United States)

    Haas, Bodo; Schlinkert, Paul; Mayer, Peter; Eckstein, Niels

    2012-10-27

    Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT) is generally known and stores excess energy in the form of triacylglycerol (TG), insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT) helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP). The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET), however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs), activators of peroxisome proliferator-activated receptor γ (PPARγ) a 'master' regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  12. Low intensity beam target unit

    CERN Multimedia

    CERN PhotoLab

    1976-01-01

    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  13. Issues in Target Tracking

    Science.gov (United States)

    2010-05-01

    simulations we take as ground truth that the target moves at 10m/s heading west and 5m/s heading north, starting from ( 5000m , 35000m). The emitted frequency is... runs , the estimated initial and final positions fall into the 99% confidence region. −1 −0.8 −0.6 −0.4 −0.2 0 0.2 0.4 0.6 0.8 1 x 10 4 0 0.5 1 1.5 2 2.5...position of trajectories. “F”: final position of trajectories. Right: The true and estimated trajectories from 100 Monte Carlo runs for Johnson noise

  14. Bradycardia During Targeted Temperature Management

    DEFF Research Database (Denmark)

    Thomsen, Jakob Hartvig; Nielsen, Niklas; Hassager, Christian

    2016-01-01

    OBJECTIVES: Bradycardia is common during targeted temperature management, likely being a physiologic response to lower body temperature, and has recently been associated with favorable outcome following out-of-hospital cardiac arrest in smaller observational studies. The present study sought...... to confirm this finding in a large multicenter cohort of patients treated with targeted temperature management at 33°C and explore the response to targeted temperature management targeting 36°C. DESIGN: Post hoc analysis of a prospective randomized study. SETTING: Thirty-six ICUs in 10 countries. PATIENTS......: We studied 447 (targeted temperature management = 33°C) and 430 (targeted temperature management = 36°C) comatose out-of-hospital cardiac arrest patients with available heart rate data, randomly assigned in the targeted temperature management trial from 2010 to 2013. INTERVENTIONS: Targeted...

  15. Characterization of solid hydrogen targets

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, M.C. [British Columbia Univ., Vancouver, BC (Canada); Bailey, J.M.; Mulhauser, F. [Chester Technology (United Kingdom); Beer, G.A.; Douglas, J.L.; Knowles, P.E.; Maier, M.; Mason, G.R.; Olin, A.; Porcelli, T.A. [Victoria Univ., BC (Canada); Beveridge, J.L.; Marshall, G.M. [British Columbia Univ., Vancouver, BC (Canada). TRIUMF Facility; Huber, T.M. [Gustavus Adolphus Coll., St. Peter, MN (United States); Jacot-Guillarmod, R. [Fribourg Univ. (Switzerland); Kammel, P. [Lawrence Berkeley Lab., CA (United States); Kim, S.K. [Jeonbuk National Univ., Jeonju City (Korea, Republic of); Kunselman, A.R. [Wyoming Univ., Laramie, WY (United States); Martoff, C.J. [Temple Univ., Philadelphia, PA (United States); Petitjean, C. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Zmeskal, J. [Oesterreichische Akademie der Wissenschaften, Vienna (Austria)

    1996-10-01

    In experiments using the TRIUMF solid hydrogen target system, the knowledge of the target thickness and uniformity is often essential in order to extract physical parameters from the data. We have characterized the thickness and uniformity of frozen targets using the energy loss of alpha particles. An accuracy of {approx}5% was achieved, a limit imposed by the uncertainty in the stopping powers. The details of the method are described, and the thickness calibration of the target is presented. (orig.). 11 refs.

  16. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    2016-10-07

    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  17. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  18. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  19. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)

    2014-02-08

    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  20. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  1. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-02-01

    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  2. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-07-01

    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  3. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-08-08

    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  4. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry

    1997-03-01

    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  5. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  6. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System

    Science.gov (United States)

    1978-12-01

    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  7. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  8. Estudo comparativo entre a síndrome antifosfolípide primária e a secundária: características clínico-laboratoriais em 149 pacientes

    OpenAIRE

    Quaio,Caio Robledo D'Angioli Costa; Grando,Paulo Eduardo Daruge; Carvalho,Jozélio Freire de

    2008-01-01

    OBJETIVOS: O presente estudo tem como objetivo analisar as características clínicas, laboratoriais e imunológicas dos pacientes com síndrome antifosfolípide (SAF) e comparar indivíduos portadores da síndrome primária com portadores da secundária. PACIENTES E MÉTODOS: Foi analisado o banco de dados de 149 pacientes com SAF do Serviço de Reumatologia do HC-FMUSP que satisfaziam os critérios de classificação para SAF. RESULTADOS: A amostra consistiu de 140 (94%) mulheres e 9 (6%) homens, com méd...

  9. Target noise in overlay metrology

    Science.gov (United States)

    Seligson, Joel L.; Adel, Mike E.; Izikson, Pavel; Levinski, Vladimir; Yaffe, Dan

    2004-05-01

    We have developed a method for calculating the statistical effects of spatial noise on the overlay measurement extracted from a given overlay target. The method has been applied to two kinds of overlay targets on three process layers, and the new metric, Target Noise, has been shown to correlate well to the random component of Overlay Mark Fidelity. A significant difference in terms of robustness has been observed between AIM targets and conventional Frame-in-Frame targets. The results fit well into the spatial noise hierarchy presented in this paper.

  10. EURISOL High Power Targets

    CERN Document Server

    Kadi, Y; Lindroos, M; Ridikas, D; Stora, T; Tecchio, L; CERN. Geneva. BE Department

    2009-01-01

    Modern Nuclear Physics requires access to higher yields of rare isotopes, that relies on further development of the In-flight and Isotope Separation On-Line (ISOL) production methods. The limits of the In-Flight method will be applied via the next generation facilities FAIR in Germany, RIKEN in Japan and RIBF in the USA. The ISOL method will be explored at facilities including ISAC-TRIUMF in Canada, SPIRAL-2 in France, SPES in Italy, ISOLDE at CERN and eventually at the very ambitious multi-MW EURISOL facility. ISOL and in-flight facilities are complementary entities. While in-flight facilities excel in the production of very short lived radioisotopes independently of their chemical nature, ISOL facilities provide high Radioisotope Beam (RIB) intensities and excellent beam quality for 70 elements. Both production schemes are opening vast and rich fields of nuclear physics research. In this article we will introduce the targets planned for the EURISOL facility and highlight some of the technical and safety cha...

  11. The target effect: visual memory for unnamed search targets.

    Science.gov (United States)

    Thomas, Mark D; Williams, Carrick C

    2014-01-01

    Search targets are typically remembered much better than other objects even when they are viewed for less time. However, targets have two advantages that other objects in search displays do not have: They are identified categorically before the search, and finding them represents the goal of the search task. The current research investigated the contributions of both of these types of information to the long-term visual memory representations of search targets. Participants completed either a predefined search or a unique-object search in which targets were not defined with specific categorical labels before searching. Subsequent memory results indicated that search target memory was better than distractor memory even following ambiguously defined searches and when the distractors were viewed significantly longer. Superior target memory appears to result from a qualitatively different representation from those of distractor objects, indicating that decision processes influence visual memory.

  12. Guidance and targeting for the Strategic Target System

    Science.gov (United States)

    White, John E.

    Guidance algorithms and targeting procedures for the Strategic Target System (STARS) launch vehicle are described. The STARS vehicle is a three stage booster, based partly upon retired Polaris A3 missile assets, which is intended to support development and testing of the Strategic Defense Initiative by delivering target payloads to the vicinity of the Kwajalein Atoll. STARS will be launched from the Kauai Test Facility located on Kauai, Hawaii. The STARS guidance objective is to deliver payloads to a prescribed target location with maximum accuracy at intercontinental ballistic missile velocities. Mission objectives are achieved with a combination of guidance algorithms.

  13. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  14. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger

    2016-07-01

    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  15. Target Acquisition Methodology Enhancement (TAME)

    Science.gov (United States)

    1989-03-01

    acquisition probability from COMINT, PCOM , against all communications type targets, is determined offline by a stochastic model for subsequent...of PN over all replications. F-4 f. Computes overall acquisition probability, PCOM , against all communications type targets as C: PCOM = (1. - PN...NNET where NNET denotes the number of nets which the target is in. F-6. TOTAL ACQUISITION PROBABILITY. With PNCj and PCOM computed as above, the

  16. Guidance system for laser targets

    Science.gov (United States)

    Porter, Gary D.; Bogdanoff, Anatoly

    1978-01-01

    A system for guiding charged laser targets to a predetermined focal spot of a laser along generally arbitrary, and especially horizontal, directions which comprises a series of electrostatic sensors which provide inputs to a computer for real time calculation of position, velocity, and direction of the target along an initial injection trajectory, and a set of electrostatic deflection means, energized according to a calculated output of said computer, to change the target trajectory to intercept the focal spot of the laser which is triggered so as to illuminate the target of the focal spot.

  17. Targeted nanotechnology for cancer imaging.

    Science.gov (United States)

    Toy, Randall; Bauer, Lisa; Hoimes, Christopher; Ghaghada, Ketan B; Karathanasis, Efstathios

    2014-09-30

    Targeted nanoparticle imaging agents provide many benefits and new opportunities to facilitate accurate diagnosis of cancer and significantly impact patient outcome. Due to the highly engineerable nature of nanotechnology, targeted nanoparticles exhibit significant advantages including increased contrast sensitivity, binding avidity and targeting specificity. Considering the various nanoparticle designs and their adjustable ability to target a specific site and generate detectable signals, nanoparticles can be optimally designed in terms of biophysical interactions (i.e., intravascular and interstitial transport) and biochemical interactions (i.e., targeting avidity towards cancer-related biomarkers) for site-specific detection of very distinct microenvironments. This review seeks to illustrate that the design of a nanoparticle dictates its in vivo journey and targeting of hard-to-reach cancer sites, facilitating early and accurate diagnosis and interrogation of the most aggressive forms of cancer. We will report various targeted nanoparticles for cancer imaging using X-ray computed tomography, ultrasound, magnetic resonance imaging, nuclear imaging and optical imaging. Finally, to realize the full potential of targeted nanotechnology for cancer imaging, we will describe the challenges and opportunities for the clinical translation and widespread adaptation of targeted nanoparticles imaging agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Targets and Secondary Beam Extraction

    Science.gov (United States)

    Noah, Etam

    2014-02-01

    Several applications make use of secondary beams of particles generated by the interaction of a primary beam of particles with a target. Spallation neutrons, bremsstrahlung photon-produced neutrons, radioactive ions and neutrinos are available to users at state-of-the-art facilities worldwide. Plans for even higher secondary beam intensities place severe constraints on the design of targets. This article reports on the main targetry challenges and highlights a variety of solutions for targetry and secondary beam extraction. Issues related to target station layout, instrumentation at the beam-target interface, safety and radioprotection are also discussed.

  19. Achieving Plant CRISPR Targeting that Limits Off-Target Effects

    Directory of Open Access Journals (Sweden)

    Jeffrey D. Wolt

    2016-11-01

    Full Text Available The CRISPR-Cas9 system (clustered regularly interspaced short palindromic repeats with associated Cas9 protein has been used to generate targeted changes for direct modification of endogenous genes in an increasing number of plant species; but development of plant genome editing has not yet fully considered potential off-target mismatches that may lead to unintended changes within the genome. Assessing the specificity of CRISPR-Cas9 for increasing editing efficiency as well as the potential for unanticipated downstream effects from off-target mutations is an important regulatory consideration for agricultural applications. Increasing genome-editing specificity entails developing improved design methods that better predict the prevalence of off-target mutations as a function of genome composition and design of the engineered ribonucleoprotein (RNP. Early results from CRISPR-Cas9 genome editing in plant systems indicate that the incidence of off-target mutation frequencies is quite low; however, by analyzing CRISPR-edited plant lines and improving both computational tools and reagent design, it may be possible to further decrease unanticipated effects at potential mismatch sites within the genome. This will provide assurance that CRISPR-Cas9 reagents can be designed and targeted with a high degree of specificity. Improved and experimentally validated design tools for discriminating target and potential off-target positions that incorporate consideration of the designed nuclease fidelity and selectivity will help to increase confidence for regulatory decision making for genome-edited plants.

  20. Literature evidence in open targets - a target validation platform.

    Science.gov (United States)

    Kafkas, Şenay; Dunham, Ian; McEntyre, Johanna

    2017-06-06

    We present the Europe PMC literature component of Open Targets - a target validation platform that integrates various evidence to aid drug target identification and validation. The component identifies target-disease associations in documents and ranks the documents based on their confidence from the Europe PMC literature database, by using rules utilising expert-provided heuristic information. The confidence score of a given document represents how valuable the document is in the scope of target validation for a given target-disease association by taking into account the credibility of the association based on the properties of the text. The component serves the platform regularly with the up-to-date data since December, 2015. Currently, there are a total number of 1168365 distinct target-disease associations text mined from >26 million PubMed abstracts and >1.2 million Open Access full text articles. Our comparative analyses on the current available evidence data in the platform revealed that 850179 of these associations are exclusively identified by literature mining. This component helps the platform's users by providing the most relevant literature hits for a given target and disease. The text mining evidence along with the other types of evidence can be explored visually through https://www.targetvalidation.org and all the evidence data is available for download in json format from https://www.targetvalidation.org/downloads/data .

  1. Transverse target spin asymmetries on a proton target at COMPASS

    CERN Document Server

    Richter, Andreas

    2009-01-01

    Transversity and transverse momentum-dependent parton distribution functions (TMDs) are been measured in semi-inclusive deep inelastic scattering (SIDIS) by using a transversely polarized target at the COMPASS experiment. COMPASS is a fixed target experiment at the CERN M2 beamline, which provides a 160GeV/c polarized m+ beam. In the years 2002-2004 COMPASS has collected data with a transversely polarized deuteron 6LiD target. In 2007, COMPASS has used for the first time a proton NH3 target. To access transversity COMPASS has used three different quark polarimeters: the Collins effect, responsible for an azimuthal asymmetry in the single hadron distribution, azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of L hyperons. Beside this also the Sivers asymmetry arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum was measured. European

  2. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J

    2010-01-01

    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  3. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R

    2016-01-01

    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this t...

  4. Saccadic adaptation to moving targets.

    Directory of Open Access Journals (Sweden)

    Katharina Havermann

    Full Text Available Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  5. Saccadic adaptation to moving targets.

    Science.gov (United States)

    Havermann, Katharina; Volcic, Robert; Lappe, Markus

    2012-01-01

    Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  6. Target recognition by wavelet transform

    CERN Document Server

    Li Zheng Dong; He Wu Liang; Pei Chun Lan; Peng Wen; SongChen; Zheng Xiao Dong

    2002-01-01

    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  7. ISOLDE target zone control room

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  8. The role of individually targeted information to reduce anxiety before colposcopy: a randomised controlled trial.

    Science.gov (United States)

    de Bie, R P; Massuger, L F A G; Lenselink, C H; Derksen, Y H M; Prins, J B; Bekkers, R L M

    2011-07-01

    We investigated whether providing targeted information on an individual level by mail and by phone reduces anxiety in women referred to the colposcopy clinic. Randomised controlled trial. Women referred to the colposcopy clinic. Between December 2007 and April 2010, 169 patients with abnormal smear results were randomised into two study arms. Group A received individually targeted information about the diagnosis and procedure by mail and phone. Group B received the standard folder about colposcopies alone. Patients were requested to fill out a questionnaire prior to their first colposcopy appointment. The questionnaire included the hospital anxiety and depression scale (HADS), and the Spielberger state-trait anxiety inventory (STAI), as well as a short self-administered questionnaire. Twenty women were excluded from further analyses after randomisation, leaving 149 women for evaluation. The median STAI state anxiety score was high (50.0), but there was no significant difference in median STAI state anxiety and HADS anxiety scores between both groups. However, knowledge about human papillomavirus and the colposcopy procedure did significantly increase in group A (P = 0.004). Anxiety levels before primary colposcopy are surprisingly high, and are not reduced following individually targeted information given before colposcopy. © 2011 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2011 RCOG.

  9. Targeted marketing and public health.

    Science.gov (United States)

    Grier, Sonya A; Kumanyika, Shiriki

    2010-01-01

    Targeted marketing techniques, which identify consumers who share common needs or characteristics and position products or services to appeal to and reach these consumers, are now the core of all marketing and facilitate its effectiveness. However, targeted marketing, particularly of products with proven or potential adverse effects (e.g., tobacco, alcohol, entertainment violence, or unhealthful foods) to consumer segments defined as vulnerable raises complex concerns for public health. It is critical that practitioners, academics, and policy makers in marketing, public health, and other fields recognize and understand targeted marketing as a specific contextual influence on the health of children and adolescents and, for different reasons, ethnic minority populations and other populations who may benefit from public health protections. For beneficial products, such understanding can foster more socially productive targeting. For potentially harmful products, understanding the nature and scope of targeted marketing influences will support identification and implementation of corrective policies.

  10. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some...... contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils......, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process...

  11. The Bering Target Tracking Instrumentation

    DEFF Research Database (Denmark)

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio

    2003-01-01

    The key science instrument on the Bering satellite mission is a relative small telescope with an entrance aperture of 300 mm and a focal length between 500 and 1000 mm. The detection of potential targets is performed by one of the target scanning advanced stellar compasses (ASCs). This procedure...... results in a simple prioritized list of right ascension, declination, proper motion and intensity of each prospective target. The telescope itself has a dedicated ASC Camera Head Unit (CHU) mounted on the secondary mirror, largely co-aligned with the telescope. This CHU accurately determines the telescope......'s pointing direction. To achieve fast tracking over a large solid angle, the telescope pointing is achieved by means of a folding mirror in the optical pathway. When a prospective target approaches the telescope FOV, the ASC on the secondary will guide the folding mirror into position such that the target...

  12. High speed cryogenic monodisperse targets

    Science.gov (United States)

    Boukharov, A.; Vishnevkii, E.

    2017-11-01

    The basic possibility of creation of high speed cryogenic monodisperse targets is shown. According to calculations at input of thin liquid cryogenic jets with a velocity of bigger 100 m/s in vacuum the jets don’t manage to freeze at distance to 1 mm and can be broken into monodisperse drops. Drops due to evaporation are cooled and become granules. High speed cryogenic monodisperse targets have the following advantages: direct input in vacuum (there is no need for a chamber of a triple point chamber and sluices), it is possible to use the equipment of a cluster target, it is possible to receive targets with a diameter of D 100m/s), exact synchronization of the target hitting moment in a beam with the moment of sensors turning on.

  13. Physical and transcript map of the region between D6S264 and D6S149 on chromosome 6q27, the minimal region of allele loss in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Liu, Ying; Emilion, Gracy; Mungall, Andrew J

    2002-01-01

    We have previously shown a high frequency of allele loss at D6S193 (62%) on chromosomal arm 6q27 in ovarian tumours and mapped the minimal region of allele loss between D6S297 and D6S264 (3 cM). We isolated and mapped a single non-chimaeric YAC (17IA12, 260-280 kb) containing D6S193 and D6S297....... A further extended bacterial contig (between D6S264 and D6S149) has been established using PACs and BACs and a transcript map has been established. We have mapped six new markers to the YAC; three of them are ESTs (WI-15078, WI-8751, and TCP10). We have isolated three cDNA clones of EST WI-15078 and one....... The gene encodes for a 40 kDa protein. Direct sequencing of the gene in all the eight ovarian cancer cell lines did not identify any mutations. Clonogenic assays were performed by transfecting the full-length gene in to ovarian cancer cell lines and no suppression of growth was observed....

  14. Case report: A novel apolipoprotein A-I missense mutation apoA-I (Arg149Ser)Boston associated with decreased lecithin-cholesterol acyltransferase activation and cellular cholesterol efflux.

    Science.gov (United States)

    Anthanont, Pimjai; Asztalos, Bela F; Polisecki, Eliana; Zachariah, Benoy; Schaefer, Ernst J

    2015-01-01

    We report a novel heterozygous apolipoprotein A-I (apoA-I) missense mutation (c.517C>A, p.Arg149Ser, designated as apoA-IBoston) in a 67-year-old woman and her 2 sons, who had mean serum high-density lipoprotein (HDL) cholesterol, apoA-I, and apoA-I in very large α-1 HDL that were 10%, 35%, and 16% of normal, respectively (all P cholesterol in the esterified form was also significantly (P values. Cholesteryl ester tranfer protein (CETP) activity was normal. The mean global, adenosine triphosphate (ATP)-binding cassette transporter A1 and scavenger receptor B type I-mediated cellular cholesterol efflux capacity in apoB-depleted serum from affected family members were 41%, 37%, 47%, 54%, and 48% of control values, respectively (all P cholesterol acyltransferase (LCAT) activity in plasma was 71% of controls, whereas in the cell-based assay, it was 73% of control values (P cholesterol and very large α-1 HDL, as well as decreased serum cellular cholesterol efflux and LCAT activity, but not with premature coronary heart disease, similar to other apoA-I mutations that have been associated with decreased LCAT activity. Copyright © 2015 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  15. 9 CFR 149.3 - Site audit.

    Science.gov (United States)

    2010-01-01

    ... fresh rodent droppings, fresh gnawing marks, new structural damage, rodent urine, rodent blood, rodent..., domesticated animals, including pets such as dogs and cats, must be excluded from the confinement unit and feed...

  16. Publications | Page 149 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  17. Reference: 149 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ne ATHB7 , which is active specifically under water deficit conditions, is proposed to act as a negative reg...., 2003, Plant Cell Environ 26: 1127 1136). In this report we demonstrate that the paralogous gene, ATHB12 , has a similar expre...ssion pattern and function. ATHB12 ,like ATHB7 ,was up-regulated during water deficit conditions, the up-re...ivity of the Ser/Thr phosphatases ABI1 and ABI2. Plants that are mutant for ATHB12 , as a result of T-DNA in...sertions in the ATHB12 gene, showed a reduced sensitivity to ABA in root elongation assays, whereas transgen

  18. Publications | Page 149 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Everyday life information seeking behaviour of urban homeless youth (restricted access). In an environment of limited access to information resources, people rely on their social networks to meet their information needs. The findings of this thesis study on homeless youth in Accra, reveal eleven categories participants ...

  19. 78 FR 149 - Proposed Collection: Comment Request

    Science.gov (United States)

    2013-01-02

    ... Bureau of the Public Debt Proposed Collection: Comment Request ACTION: Notice and request for comments... 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A). Currently the Bureau of the Public Debt within the... to Bureau of the Public Debt, Bruce A. Sharp, 200 Third Street A4-A, Parkersburg, WV 26106-1328, or...

  20. 32 CFR 149.2 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... Protection Committee (FPC), for appropriate dissemination, all-source intelligence that concerns technical..., test, and evaluation programs. (2) Promote and foster joint procurement of TSCM equipment. (3) Evaluate... recommend policy changes as needed. (4) Develop guidance for use in obtaining intelligence information on...

  1. Publications | Page 149 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Water, energy, and climate change: what's the link? Could decentralized renewable energy technologies for water services help poor communities in developing countries better adapt to climate change? Could they promote equitable access under increasingly uncertain conditions? ... Arab women continue rights struggle.

  2. 7 CFR 762.149 - Liquidation.

    Science.gov (United States)

    2010-01-01

    ... balance sheets from all liable parties or, if the parties are not cooperative, the best information... liquidation; (v) An estimated loss claim must be filed no later than 150 days past the payment due date unless... bankruptcy, the lender shall send the borrower notice that the loan is in default and the entire debt has...

  3. 45 CFR 149.2 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... respect to any structure or function of the body. Health benefits do not include benefits specified at 45... DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS REQUIREMENTS FOR THE.... Secretary means the Secretary of the United States Department of Health & Human Services or the Secretary's...

  4. 9 CFR 149.1 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... describes methods for the removal and disposal of dead swine or swine remains from a pork production site... audits for renewal of Stage III certified status. Sterile zone. An open area immediately adjacent to and surrounding the confinement unit that serves as both a buffer and detection zone for rodent and wildlife...

  5. 149-IJBCS-Article-Dr Zongo

    African Journals Online (AJOL)

    RHUMSIKI

    République Démocratique du Congo, Soudan,. Tanzanie, Tchad, Tunisie. Cosmarium connatum (Bréb.) Ralfs var. africanum Fritsch et Rich fig. 47, éch.: F 11/95. [Syn.: Cosmarium connatum Bréb. ex. Ralfs]. La cellule, plus longue que large, a une constriction médiane modérée, un sinus peu marqué et un isthme très large.

  6. 17 CFR 149.103 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... example, auxiliary aids useful for persons with impaired vision include readers, brailled materials, audio... persons with impaired hearing include telephone handset amplifiers, telephones compatible with hearing... handicapped person who is a member of a class of persons otherwise entitled by statute, regulation, or agency...

  7. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads

    2002-01-01

    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  8. Targeted intraoperative radiotherapy in oncology

    CERN Document Server

    Keshtgar, Mohammed; Wenz, Frederik

    2014-01-01

    Targeted intraoperative radiotherapy is a major advance in the management of cancer patients. With an emphasis on practical aspects, this book offers an ideal introduction to this innovative  technology for clinicians.

  9. Hyperspectral-Augmented Target Tracking

    National Research Council Canada - National Science Library

    Soliman, Neil A

    2008-01-01

    ... air with the capability to seek, monitor, and destroy mobile terrorist targets in hostile territory. One such capability recognizes and persistently tracks multiple moving vehicles in complex, highly ambiguous urban environments...

  10. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  11. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network--the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  12. Targeted therapy for pediatric glioma

    NARCIS (Netherlands)

    Olow, A.K.

    2015-01-01

    This thesis assesses molecular underpinnings of responses to promising targeted agents for pediatric tumors of Central Nervous System (CNS), incorporating preclinical testing of novel and translatable combination therapies to define the best therapy for each tumor cell specific molecular aberration.

  13. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz

    2007-01-01

    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  14. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J

    2000-10-05

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  15. Theoretical aspects of inflation targeting

    Directory of Open Access Journals (Sweden)

    Obradović Jelena

    2014-01-01

    Full Text Available Inflation targeting is one of the possible strategies used by central banks during conducting monetary policy. The basic characteristics, advantages and disadvantages of inflation targeting will be presented in this paper. The focus is on the the presentation and interpretation of the understanding of this strategy from the perspective of monetarist and Keynesian theory, the theory of rational expectations, and methodological analysis of the strategy in light of the game theory using payoff matrix.

  16. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin

    2015-01-01

    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  17. Targeting the nuclear RNA exosome

    DEFF Research Database (Denmark)

    Meola, Nicola; Jensen, Torben Heick

    2017-01-01

    Centrally positioned in nuclear RNA metabolism, the exosome deals with virtually all transcript types. This 3'-5' exo- and endo-nucleolytic degradation machine is guided to its RNA targets by adaptor proteins that enable substrate recognition. Recently, the discovery of the 'Poly(A) tail exosome...... targeting (PAXT)' connection as an exosome adaptor to human nuclear polyadenylated transcripts has relighted the interest of poly(A) binding proteins (PABPs) in both RNA productive and destructive processes....

  18. Coccolithophores as proxy of seawater changes at orbital-to-millennial scale during middle Pleistocene Marine Isotope Stages 14-9 in North Atlantic core MD01-2446

    Science.gov (United States)

    Marino, Maria; Maiorano, Patrizia; Tarantino, Francesca; Voelker, Antje; Capotondi, Lucilla; Girone, Angela; Lirer, Fabrizio; Flores, José-Abel; Naafs, B. David A.

    2014-06-01

    Quantitative coccolithophore analyses were performed in core MD01-2446, located in the midlatitude North Atlantic, to reconstruct climatically induced sea surface water conditions throughout Marine Isotope Stages (MIS) 14-9. The data are compared to new and available paleoenvironmental proxies from the same site as well as other nearby North Atlantic records that support the coccolithophore signature at glacial-interglacial to millennial climate scale. Total coccolithophore absolute abundance increases during interglacials but abruptly drops during the colder glacial phases and deglaciations. Coccolithophore warm water taxa (wwt) indicate that MIS11c and MIS9e experienced warmer and more stable conditions throughout the whole photic zone compared to MIS13. MIS11 was a long-lasting warmer and stable interglacial characterized by a climate optimum during MIS11c when a more prominent influence of the subtropical front at the site is inferred. The wwt pattern also suggests distinct interstadial and stadial events lasting about 4-10 kyr. The glacial increases of Gephyrocapsa margereli-G. muellerae 3-4 µm along with higher values of Corg, additionally supported by the total alkenone abundance at Site U1313, indicate more productive surface waters, likely reflecting the migration of the polar front into the midlatitude North Atlantic. Distinctive peaks of G. margereli-muellerae (>4 µm), C. pelagicus pelagicus, Neogloboquadrina pachyderma left coiling, and reworked nannofossils, combined with minima in total nannofossil accumulation rate, are tracers of Heinrich-type events during MIS12 and MIS10. Additional Heinrich-type events are suggested during MIS12 and MIS14 based on biotic proxies, and we discuss possible iceberg sources at these times. Our results improve the understanding of mid-Brunhes paleoclimate and the impact on phytoplankton diversity in the midlatitude North Atlantic region.

  19. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...... autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...

  20. Pharmacogenomics of GPCR Drug Targets

    DEFF Research Database (Denmark)

    Hauser, Alexander Sebastian; Chavali, Sreenivas; Masuho, Ikuo

    2017-01-01

    Natural genetic variation in the human genome is a cause of individual differences in responses to medications and is an underappreciated burden on public health. Although 108 G-protein-coupled receptors (GPCRs) are the targets of 475 (∼34%) Food and Drug Administration (FDA)-approved drugs...... and account for a global sales volume of over 180 billion US dollars annually, the prevalence of genetic variation among GPCRs targeted by drugs is unknown. By analyzing data from 68,496 individuals, we find that GPCRs targeted by drugs show genetic variation within functional regions such as drug......- and effector-binding sites in the human population. We experimentally show that certain variants of μ-opioid and Cholecystokinin-A receptors could lead to altered or adverse drug response. By analyzing UK National Health Service drug prescription and sales data, we suggest that characterizing GPCR variants...

  1. INFLATION TARGETING IN EASTERN EUROPE

    Directory of Open Access Journals (Sweden)

    Laurian Lungu

    2006-05-01

    Full Text Available This paper addresses the inflation targeting approach in three transition economies, namely Hungary, Poland and the Czech Republic with the use of Taylor rules as benchmarks. The three economies considered have been successful at achieving disinflation, but deviations of inflation from its target have been persistent in all cases. Except for the Czech Republic, deviations from the Taylor rule are large and persistent, with Hungary displaying the largest fluctuations. Polish interest rates have consistently exceeded those suggested by the Taylor rule and given the prevalence of high unemployment, these undershootings do not augur well for the stability of monetary policy. Finally, the behaviour of Czech interest rates can be remarkably captured by the simple Taylor rule proposed in this paper, suggesting that the Czech National Bank has been the most successful at stabilising inflation and output around their target levels.

  2. Targeting Angiogenesis in Childhood Sarcomas

    Directory of Open Access Journals (Sweden)

    Hemant K. Bid

    2011-01-01

    Full Text Available Angiogenesis and vasculogenesis constitute two processes in the formation of new blood vessels and are essential for progression of solid tumors. Consequently, targeting angiogenesis, and to a lesser extent vasculogenesis, has become a major focus in cancer drug development. Angiogenesis inhibitors are now being tested in pediatric populations whereas inhibitors of vasculogenesis are in an earlier stage of development. Despite the initial enthusiasm for targeting angiogenesis for treatment of cancer, clinical trials have shown only incremental increases in survival, and agents have been largely cytostatic rather than inducing tumor regressions. Consequently, the role of such therapeutic approaches in the context of curative intent for childhood sarcomas is less clear. Here we review the literature on blood vessel formation in sarcomas with a focus on pediatric sarcomas and developments in targeting angiogenesis for treatment of these rare cancers.

  3. Ribosome Assembly as Antimicrobial Target

    Directory of Open Access Journals (Sweden)

    Rainer Nikolay

    2016-05-01

    Full Text Available Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors.

  4. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, R.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T.

    1997-09-01

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. The goal of these experiments is to demonstrate plasma conditions meeting the minimum requirements for a MTF initial target plasma. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Thus far, the diagnostics include an array of 12 B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, filtered silicon photodiodes, neutron yield, and plasma-density interferometer. These diagnostics show that a plasma is produced in the containment region that lasts roughly 10 to 20 {micro}s with a maximum plasma density exceeding 10{sup 18} cm{sup {minus}3}. The experimental design and data are presented.

  5. Targeted Therapies for Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Idoroenyi Amanam

    2018-01-01

    Full Text Available Pancreatic cancer is the third leading cause of cancer related death and by 2030, it will be second only to lung cancer. We have seen tremendous advances in therapies for lung cancer as well as other solid tumors using a molecular targeted approach but our progress in treating pancreatic cancer has been incremental with median overall survival remaining less than one year. There is an urgent need for improved therapies with better efficacy and less toxicity. Small molecule inhibitors, monoclonal antibodies and immune modulatory therapies have been used. Here we review the progress that we have made with these targeted therapies.

  6. Harnessing off-target effects

    DEFF Research Database (Denmark)

    Saginc, Gaye; Voellmy, Franziska; Linding, Rune

    2017-01-01

    The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action.......The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action....

  7. The OPERA experiment Target Tracker

    CERN Document Server

    Adam, T; Borer, K.; Campagne, Jean-Eric; Con-Sen, N.; de La Taille, C.; Dick, N.; Dracos, M.; Gaudiot, G.; Goeltzenlichter, T.; Gornushkin, Y.; Grapton, J.-N.; Guyonnet, J.-L.; Hess, M.; Igersheim, R.; Janicsko Csathy, J.; Jollet, C.; Juget, F.; Kocher, H.; Krasnoperov, A.; Krumstein, Z.; Martin-Chassard, G.; Moser, U.; Nozdrin, A.; Olchevski, A.; Porokhovoi, S.; Raux, L.; Sadovski, A.; Schuler, J.; Schutz, H.-U.; Schwab, C.; Smolnikov, A.; Van Beek, G.; Vilain, P.; Walchli, T.; Wilquet, G.; Wurtz, J.

    2007-01-01

    The main task of the Target Tracker detector of the long baseline neutrino oscillation OPERA experiment is to locate in which of the target elementary constituents, the lead/emulsion bricks, the neutrino interactions have occurred and also to give calorimetric information about each event. The technology used consists in walls of two planes of plastic scintillator strips, one per transverse direction. Wavelength shifting fibres collect the light signal emitted by the scintillator strips and guide it to both ends where it is read by multi-anode photomultiplier tubes. All the elements used in the construction of this detector and its main characteristics are described.

  8. Target-Centric Network Modeling

    DEFF Research Database (Denmark)

    Mitchell, Dr. William L.; Clark, Dr. Robert M.

    In Target-Centric Network Modeling: Case Studies in Analyzing Complex Intelligence Issues, authors Robert Clark and William Mitchell take an entirely new approach to teaching intelligence analysis. Unlike any other book on the market, it offers case study scenarios using actual intelligence......, and collaborative sharing in the process of creating a high-quality, actionable intelligence product. The case studies reflect the complexity of twenty-first century intelligence issues by dealing with multi-layered target networks that cut across political, economic, social, technological, and military issues....... Working through these cases, students will learn to manage and evaluate realistic intelligence accounts....

  9. TARGET Imbalances at Record Levels

    DEFF Research Database (Denmark)

    Hallett, Andrew Hughes

    TARGET is the payments system for making settlements between euro area economies and five other EU economies. Cross-border transactions generate claims/surpluses and liabilities/deficits among national central banks which “net out” for the system as a whole. These imbalances are manageable in rel...

  10. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could...

  11. Communicating to heterogeneous target groups

    DEFF Research Database (Denmark)

    Pedersen, Karsten

    very often have to communicate to rather heterogeneous target groups that have little more in common than a certain geographical habitat. That goes against most schoolbook teaching in the field of communication, but is none the less the terms with which that kind of communication has to live...

  12. Emerging targets in treating pain.

    Science.gov (United States)

    Chang, David S; Raghavan, Rahul; Christiansen, Sandy; Cohen, Steven P

    2015-08-01

    To provide an overview on drug targets and emerging pharmacological treatment options for chronic pain. Chronic pain poses an enormous socioeconomic burden for the more than 30% of people who suffer from it, costing over $600 billion per year in the USA. In recent years, there has been a surge in preclinical and clinical research endeavors to try to stem this epidemic. Preclinical studies have identified a wide array of potential targets, with some of the most promising translational research being performed on novel opioid receptors, cannabinoid receptors, selective ion channel blockers, cytokine inhibitors, nerve growth factor inhibitors, N-methyl-D-aspartate receptor antagonists, glial cell inhibitors, and bisphosphonates. There are many obstacles for the development of effective medications to treat chronic pain, including the inherent challenges in identifying pathophysiological mechanisms, the overlap and multiplicity of pain pathways, and off-target adverse effects stemming from the ubiquity of drug target receptor sites and the lack of highly selective receptor ligands. Despite these barriers, the number and diversity of potential therapies have continued to grow, to include disease-modifying and individualized drug treatments.

  13. Tumor targeting via integrin ligands

    Directory of Open Access Journals (Sweden)

    Udaya Kiran eMarelli

    2013-08-01

    Full Text Available Selective and targeted delivery of drugs to tumors is a major challenge for an effective cancer therapy and also to overcome the side effects associated with current treatments. Overexpression of various receptors on tumor cells is a characteristic structural and biochemical aspect of tumors and distinguishes them from physiologically normal cells. This abnormal feature is therefore suitable for selectively directing anticancer molecules to tumors by using ligands that can preferentially recognize such receptors. Several subtypes of integrin receptors that are crucial for cell adhesion, cell signaling, cell viability and motility have been shown to have an upregulated expression on cancer cells. Thus, ligands that recognize specific integrin subtypes represent excellent candidates to be conjugated to drugs or drug carrier systems and be targeted to tumors. In this regard, integrins recognizing the RGD cell adhesive sequence have been extensively targeted for tumor specific drug delivery. Here we review key recent examples on the presentation of RGD-based integrin ligands by means of distinct drug delivery systems, and discuss the prospects of such therapies to specifically target tumor cells.

  14. How are inflation targets set?

    Czech Academy of Sciences Publication Activity Database

    Horváth, R.; Matějů, Jakub

    -, č. 426 (2010), s. 1-35 ISSN 1211-3298 Grant - others:MŠk(CZ) SVV-2010-261801 Institutional research plan: CEZ:MSM0021620846 Keywords : inflation targeting * central bank * credibility Subject RIV: AH - Economics http://www.cerge-ei.cz/pdf/wp/Wp426.pdf

  15. High power neutron production targets

    Energy Technology Data Exchange (ETDEWEB)

    Wender, S. [Los Alamos National Lab., NM (United States)

    1996-06-01

    The author describes issues of concern in the design of targets and associated systems for high power neutron production facilities. The facilities include uses for neutron scattering, accelerator driven transmutation, accelerator production of tritium, short pulse spallation sources, and long pulse spallation sources. Each of these applications requires a source with different design needs and consequently different implementation in practise.

  16. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could ...

  17. Targeted Therapies in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Selen Dogan

    2014-04-01

    Full Text Available Endometrial cancer is the most common genital cancer in developed world. It is generally diagnosed in early stage and it has a favorable prognosis. However, advanced staged disease and recurrences are difficult to manage. There are some common genetic alterations related to endometrial carcinogenesis in similar fashion to other cancers. Personalized medicine, which means selection of best suited treatment for an individual, has gain attention in clinical care of patients in recent years. Targeted therapies were developed as a part of personalized or %u201Ctailored%u201D medicine and specifically acts on a target or biologic pathway. There are quite a number of molecular alteration points in endometrial cancer such as PTEN tumor suppressor genes, DNA mismatch repair genes, PI3K/AKT/mTOR pathway and p53 oncogene which all might be potential candidates for tailored targeted therapy. In recent years targeted therapies has clinical application in ovarian cancer patients and in near future with the advent of new agents these %u201Ctailored%u201D drugs will be in market for routine clinical practice in endometrial cancer patients, in primary disease and recurrences as well.

  18. The Automatic Measurement of Targets

    DEFF Research Database (Denmark)

    Höhle, Joachim

    1997-01-01

    The automatic measurement of targets is demonstrated by means of a theoretical example and by an interactive measuring program for real imagery from a réseau camera. The used strategy is a combination of two methods: the maximum correlation coefficient and the correlation in the subpixel range...

  19. Polarized Scintillating Targets at Psi

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2001-02-01

    Scintillating polarized targets are now routinely available: blocks of 18×18×5 mm scintillating organic polymer, doped with TEMPO, polarized dynamically in a field of 2.5 T in a vertical 3He-4He dilution refrigerator. A 19 mm diameter plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat.

  20. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  1. Targeted Advertising and Social Status

    NARCIS (Netherlands)

    N. Vikander (Nick)

    2010-01-01

    textabstractThis paper shows how a firm can use non-targeted advertising to exploit consumers' desire for social status. A monopolist sells multiple varieties of a good to consumers who each care about what others believe about his wealth. Advertising allows consumers both to buy different varieties

  2. Polarimetric imaging of underwater targets

    Science.gov (United States)

    Gilerson, Alex; Carrizo, Carlos; Tonizzo, Alberto; Ibrahim, Amir; El-Habashi, Ahmed; Foster, Robert; Ahmed, Samir

    2013-06-01

    Underwater imaging is challenging because of the significant attenuation of light due to absorption and scattering of light in water. Using polarization properties of light is one of the options for improving image quality. We present results of imaging of a polarized target in open ocean (Curacao) and coastal (NY Bight) waters. The target in the shape of a square is divided into several smaller squares, each of which is covered with a polarizing film with different polarization orientations or transmission coefficients was placed on a mirror and imaged under water by a green-band full-Stokes polarimetric video camera at the full range of azimuth angles against the Sun. The values of the Stokes vector components from the images are compared with the modeled image of the target using radiative transfer code for the atmosphere-ocean system combined with the simple imaging model. It is shown that even in clear water the impact of the water body on the polarized underwater image is very significant and retrieval of target polarization characteristics from the image is extremely challenging.

  3. Target selection for direct marketing.

    NARCIS (Netherlands)

    Bult, Jan Roelf

    1993-01-01

    In this thesis we concentrated on the use ol direct mail for targeting potential buyers. The major characteristics that influences the success of a plomotional direct mail campaign are the of-fbr,the communication elements, the timing or sequence of these communication elements, and the list of

  4. Uranium briquettes for irradiation target

    Energy Technology Data Exchange (ETDEWEB)

    Saliba-Silva, Adonis Marcelo; Garcia, Rafael Henrique Lazzari; Martins, Ilson Carlos; Carvalho, Elita Fontenele Urano de; Durazzo, Michelangelo, E-mail: saliba@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Direct irradiation on targets inside nuclear research or multiple purpose reactors is a common route to produce {sup 99}Mo-{sup 99m}Tc radioisotopes. Nevertheless, since the imposed limits to use LEU uranium to prevent nuclear armament production, the amount of uranium loaded in target meats has physically increased and new processes have been proposed for production. Routes using metallic uranium thin film and UAl{sub x} dispersion have been used for this purpose. Both routes have their own issues, either by bringing difficulties to disassemble the aluminum case inside hot cells or by generating great amount of alkaline radioactive liquid rejects. A potential route might be the dispersion of powders of LEU metallic uranium and nickel, which are pressed as a blend inside a die and followed by pulse electroplating of nickel. The electroplating provides more strength to the briquettes and creates a barrier for gas evolution during neutronic disintegration of {sup 235}U. A target briquette platted with nickel encapsulated in an aluminum case to be irradiated may be an alternative possibility to replace other proposed targets. This work uses pulse Ni-electroplating over iron powder briquette to simulate the covering of uranium by nickel. The following parameters were applied 10 times for each sample: 900Hz, -0.84A/square centimeters with duty cycle of 0.1 in Watts Bath. It also presented the optical microscopy analysis of plated microstructure section. (author)

  5. Collisional disruptions of rotating targets

    Science.gov (United States)

    Ševeček, Pavel; Broz, Miroslav

    2017-10-01

    Collisions are key processes in the evolution of the Main Asteroid Belt and impact events - i.e. target fragmentation and gravitational reaccumulation - are commonly studied by numerical simulations, namely by SPH and N-body methods. In our work, we extend the previous studies by assuming rotating targets and we study the dependence of resulting size-distributions on the pre-impact rotation of the target. To obtain stable initial conditions, it is also necessary to include the self-gravity already in the fragmentation phase which was previously neglected.To tackle this problem, we developed an SPH code, accelerated by SSE/AVX instruction sets and parallelized. The code solves the standard set of hydrodynamic equations, using the Tillotson equation of state, von Mises criterion for plastic yielding and scalar Grady-Kipp model for fragmentation. We further modified the velocity gradient by a correction tensor (Schäfer et al. 2007) to ensure a first-order conservation of the total angular momentum. As the intact target is a spherical body, its gravity can be approximated by a potential of a homogeneous sphere, making it easy to set up initial conditions. This is however infeasible for later stages of the disruption; to this point, we included the Barnes-Hut algorithm to compute the gravitational accelerations, using a multipole expansion of distant particles up to hexadecapole order.We tested the code carefully, comparing the results to our previous computations obtained with the SPH5 code (Benz and Asphaug 1994). Finally, we ran a set of simulations and we discuss the difference between the synthetic families created by rotating and static targets.

  6. Cellular Targets of Dietary Polyphenol Resveratrol

    National Research Council Canada - National Science Library

    Wu, Joseph M

    2006-01-01

    To test the hypothesis that resveratrol, a grape derived polyphenol, exerts its chemopreventive properties against prostate cancer by interacting with specific cellular targets, denoted resveratrol targeting proteins (RTPs...

  7. North Pacific Targets Program Environmental Assessment

    National Research Council Canada - National Science Library

    2001-01-01

    .... The STPO would provide the Strategic Target System launch vehicle for strategic target launch services from Kodiak Launch Complex, Kodiak Island, Alaska, a commercial rocket launch facility operated...

  8. Targeted nanosystems: Advances in targeted dendrimers for cancer therapy.

    Science.gov (United States)

    Yang, Hu

    2016-02-01

    Dendrimers possess discrete highly compact nanostructures constituted of successive branched layers. Soon after the inception of dendrimers, recognition of their tunable structures and biologically favorable properties provoked a great enthusiasm in delving deeply into the utility of dendrimers for biomedical and pharmaceutical applications. One of the most important nanotechnology applications is the development of nanomedicines for targeted cancer therapies. Tremendous success in targeted therapies has been achieved with the use of dendrimer-based nanomedicines. This article provides a concise review on latest advances in the utility of dendrimers in immunotherapies and hormone therapies. Much basic and clinical research has been done since the invention of dendrimers, which are highly branched nano-sized molecules with the ability to act as carriers in nanomedicine. In this concise review article, the authors highlighted the current use of dendrimers in immunotherapies and hormone therapies in the fight against cancers. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Emerging targets in human lymphoma: targeting the MYD88 mutation

    Directory of Open Access Journals (Sweden)

    Wang JQ

    2013-08-01

    Full Text Available James Q Wang,* Yogesh S Jeelall,* Keisuke Horikawa* Department of Immunology, The John Curtin School of Medical Research, Australian National University, Canberra, ACT, Australia *All authors contributed equally to this manuscript Abstract: B cell neoplasms co-opt the molecular machinery of normal B cells for their survival. Technological advances in cancer genomics has significantly contributed to uncovering the root cause of aggressive lymphomas, revealing a previously unknown link between TLR signaling and B cell neoplasm. Recurrent oncogenic mutations in MYD88 have been found in 39% of the activated B cell-like subtype of diffuse large B cell lymphoma (ABC DLBCL. Interestingly, 29% of ABC DLBCL have a single amino acid substitution of proline for the leucine at position 265 (L265P, and the exact same variant has also been identified in a number of lymphoid malignancies. The MYD88 L265P variant was recently identified in 90% of Wadenstrom's macroglobulinemia patients. These recent developments warrant the need for novel diagnostic tools as well as targeted therapeutics. In this review, we discuss the physiological functions of MYD88 and focus on its role in B cell lymphomas, evaluating the potential for targeting oncogenic MYD88 in lymphoma. Keywords: MYD88, L265P mutation, lymphoma, targeted therapy

  10. Targeting an efficient target-to-target interval for P300 speller brain–computer interfaces

    Science.gov (United States)

    Sellers, Eric W.; Wang, Xingyu

    2013-01-01

    Longer target-to-target intervals (TTI) produce greater P300 event-related potential amplitude, which can increase brain–computer interface (BCI) classification accuracy and decrease the number of flashes needed for accurate character classification. However, longer TTIs requires more time for each trial, which will decrease the information transfer rate of BCI. In this paper, a P300 BCI using a 7 × 12 matrix explored new flash patterns (16-, 18- and 21-flash pattern) with different TTIs to assess the effects of TTI on P300 BCI performance. The new flash patterns were designed to minimize TTI, decrease repetition blindness, and examine the temporal relationship between each flash of a given stimulus by placing a minimum of one (16-flash pattern), two (18-flash pattern), or three (21-flash pattern) non-target flashes between each target flashes. Online results showed that the 16-flash pattern yielded the lowest classification accuracy among the three patterns. The results also showed that the 18-flash pattern provides a significantly higher information transfer rate (ITR) than the 21-flash pattern; both patterns provide high ITR and high accuracy for all subjects. PMID:22350331

  11. Activation cross-sections of deuteron induced reactions on {sup nat}Sm up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Csikai, J. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2014-08-15

    Highlights: •Deuteron induced reactions on natural samarium up to 50 MeV. •Stacked foil irradiation at different energies and accelerators. •Comparison of experimental results with the ALICE-D, EMPIRE-D and TALYS theoretical codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for {sup nat}Sm(d,xn){sup 155,154,152m2,152m1,152g,150m,150g,149,148,147,146}Eu, {sup nat}Sm(d,x) {sup 153,145}Sm and {sup nat}Sm(d,x){sup 151,150,149,145,144,143}Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution γ-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  12. Activation cross-sections of proton induced reactions on {sup nat}Sm up to 65 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2015-03-01

    Highlights: •Proton induced reactions on natural samarium up to 65 MeV. •Stacked foil irradiation technique. •Comparison of experimental results with the ALICE, EMPIRE and TALYS theoretical model codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross sections for proton induced reactions on Sm are presented for the first time for {sup nat}Sm(p,xn){sup 154,152m2,152m1,152g,150m,150g,149,148,147,146,145}Eu, {sup nat}Sm(p,x){sup 153,145}Sm, {sup nat}Sm(p,x){sup 151,150,149,148g,148m,146,144,143}Pm and {sup nat}Sm(p,x){sup 141}Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  13. Newer targeted therapies in psoriasis

    Directory of Open Access Journals (Sweden)

    Sujay Khandpur

    2013-01-01

    Full Text Available Psoriasis is a common, chronic, inflammatory skin disease that can have a significant impact on the quality of life of those who are afflicted due to chronicity of the disease and frequent remissions and relapses. Many available systemic therapies, however, are unsuitable for chronic administration due to the risk of cumulative toxicity. Recent advances in the understanding of the pathophysiology of psoriasis have led to the development of new, genetically engineered, targeted therapies for this disease. These include approaches targeting antigen presentation and co-stimulation, T-cell activation and leukocyte adhesion, action on pro-inflammatory mediators, and modulating the cytokine balance. Although only preliminary data are available so far and there is limited data supporting their use, these trials contribute to a further understanding of the disease and will eventually lead to new therapeutic options for psoriasis.

  14. Moulding calixarenes for biomacromolecule targeting.

    Science.gov (United States)

    Giuliani, Marta; Morbioli, Ilaria; Sansone, Francesco; Casnati, Alessandro

    2015-09-28

    After their successful use as a preorganized platform for the preparation of receptors for metal ions and small neutral molecules over the last 15 years, calixarenes are enjoying a renaissance of popularity as scaffolds for ligands that are able to efficiently and selectively target macromolecules such as proteins/enzymes, nucleic acids and lipids. This feature article summarizes the peculiar factors characterizing the calixarene structure and properties, as well as outlines the main rules that can be used to turn such macrocycles into efficient and successful ligands for these classes of biomacromolecules. Factors that affect the multivalent properties of calixarenes, such as the size, conformation and stereochemical presentation of binding groups or their amphiphilicity and hybrid character, are described in detail with the use of a few selected examples from the literature. Perspectives and applications of these ligands in bionanotechnology and nanomedicine, such as protein sensing and inhibition, gene-delivery, targeted drug-delivery and cell imaging, are also discussed.

  15. Swimbladder on Fish Target Strength

    Directory of Open Access Journals (Sweden)

    Sunardi

    2008-08-01

    Full Text Available This paper discusses of target strength (TS for the Selar boops (Oxeye scad and Megalaspis cordyla (Torpedo scad, the most commercially fish in Malaysia. TS can be determined from in situ measurements and acoustic calculation of fish model. TS value, depth, and position (x-y-z of targeted fish can be viewed from echogram using FQ-80 Analyzer by in situ measurement. X-ray imaged can be deployed to develop the acoustic fish model. The percentage of length and upper surface area for swimbladder to body fish of Selar boops more than Megalaspis cordyla can be measured after X-ray process. The percentage of width and volume of swimbladders to its each body are no significantly difference for both fish. These data of swimbladder physic support the result of in situ measurement which TS of Megalaspis cordyla stronger Selar boops.

  16. Recurring Utterances - Targeting a Breakthrough

    Directory of Open Access Journals (Sweden)

    Jacqueline Stark

    2014-05-01

    The most interesting phenomenon is KB’s production of words from former sessions indicating that they are still ‘active’ and the production of completely novel incorrect words. The observable features indicate that immediate auditory processing is possible in the form of repeating target words. However, as soon as KB must retrieve information from the (semantic lexicon, even after being able to correctly ‘repeat’ the target word several times, he responds with a RU, perseveration, or paraphasia. Several of his productions can be characterized as aphasic confabulations which stem from a memory gap. Thus, although KB’s language impairment is severe, his responses across time indicate that step-by-step a breakthrough is being made.

  17. Remote moving target indication assessment

    Energy Technology Data Exchange (ETDEWEB)

    Canavan, G.H.

    1996-10-01

    The objective of this project was to design and test key components of a sensor to be used on remotely piloted vehicles, aircraft, or satellites for the detection of moving vehicles in cluttered backgrounds. The proposed sensor uses modern large-array focal planes to provide multiple infrared observations of moving targets and capable on-board computers to integrate multiple observations to detect moving targets in background clutter. This combination reduces the size, weight, and cost of the sensor to levels that can be flown on many small unmanned platforms. This effort selected the actual components, integrated them into a test bed, tested the performance of the sensor against realistic generated scenes, and designed a proof-of-concept prototype.

  18. Targeting vaccines to dendritic cells

    DEFF Research Database (Denmark)

    Foged, Camilla; Sundblad, Anne; Hovgaard, Lars

    2002-01-01

    to be far superior to that of B-cells and macrophages. DC are localized at strategic places in the body at sites used by pathogens to enter the organism, and are thereby in an optimal position to capture antigens. In general, vaccination strategies try to mimic the invasiveness of the pathogens. DC...... are considered to play a central role for the provocation of primary immune responses by vaccination. A rational way of improving the potency and safety of new and already existing vaccines could therefore be to direct vaccines specifically to DC. There is a need for developing multifunctional vaccine drug...... delivery systems (DDS) with adjuvant effect that target DC directly and induce optimal immune responses. This paper will review the current knowledge of DC physiology as well as the progress in the field of novel vaccination strategies that directly or indirectly aim at targeting DC....

  19. Poverty, inequality, and geographic targeting

    OpenAIRE

    Simler, Kenneth R.; Nhate, Virgulino

    2005-01-01

    "This paper applies small area estimation techniques to Mozambican data to develop high resolution (subdistrictlevel) poverty and inequality maps...The picture that emerges is one of considerable local-level economic heterogeneity, with the poor living alongside the nonpoor. Rather than finding stark pockets of intense poverty traps in one part of the country and a relative absence of poverty in other parts, the situation is much more nuanced. This suggests that targeting antipoverty efforts ...

  20. Targeting phenotypically tolerant Mycobacterium tuberculosis

    Science.gov (United States)

    Gold, Ben; Nathan, Carl

    2016-01-01

    While the immune system is credited with averting tuberculosis in billions of individuals exposed to Mycobacterium tuberculosis, the immune system is also culpable for tempering the ability of antibiotics to deliver swift and durable cure of disease. In individuals afflicted with tuberculosis, host immunity produces diverse microenvironmental niches that support suboptimal growth, or complete growth arrest, of M. tuberculosis. The physiological state of nonreplication in bacteria is associated with phenotypic drug tolerance. Many of these host microenvironments, when modeled in vitro by carbon starvation, complete nutrient starvation, stationary phase, acidic pH, reactive nitrogen intermediates, hypoxia, biofilms, and withholding streptomycin from the streptomycin-addicted strain SS18b, render M. tuberculosis profoundly tolerant to many of the antibiotics that are given to tuberculosis patients in a clinical setting. Targeting nonreplicating persisters is anticipated to reduce the duration of antibiotic treatment and rate of post-treatment relapse. Some promising drugs to treat tuberculosis, such as rifampicin and bedaquiline, only kill nonreplicating M. tuberculosis in vitro at concentrations far greater than their minimal inhibitory concentrations against replicating bacilli. There is an urgent demand to identify which of the currently used antibiotics, and which of the molecules in academic and corporate screening collections, have potent bactericidal action on nonreplicating M. tuberculosis. With this goal, we review methods of high throughput screening to target nonreplicating M. tuberculosis and methods to progress candidate molecules. A classification based on structures and putative targets of molecules that have been reported to kill nonreplicating M. tuberculosis revealed a rich diversity in pharmacophores. However, few of these compounds were tested under conditions that would exclude the impact of adsorbed compound acting during the recovery phase of

  1. Medium size polarised deuteron target

    Energy Technology Data Exchange (ETDEWEB)

    Kiselev, Yu.F.; Polyakov, V.V.; Kovalev, A.I.; Bunyatova, E.I.; Borisov, N.S.; Trautman, V.Yu.; Werner, K.; Kozlenko, N.G.

    1984-03-01

    A frozen polarised deuteron target based on ethanediol with a high percentage of deuterium is described. Analytical expressions for the NMR spectrum correction for non-linearity of the Q-meter are obtained and a method for the determination of the asymmetry is developed. Experimental results confirm the thermal mixing theory for deuteron and proton spin systems with a dipole-dipole reservoir of electron spins.

  2. Peptide-targeted polymer cancerostatics

    Czech Academy of Sciences Publication Activity Database

    Böhmová, Eliška; Pola, Robert

    2016-01-01

    Roč. 65, Suppl. 2 (2016), S153-S164 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LO1507 Institutional support: RVO:61389013 Keywords : HPMA copolymers * tumor targeting * peptides Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.461, year: 2016 http://www.biomed.cas.cz/physiolres/pdf/65%20Suppl%202/65_S153.pdf

  3. Coherent Communications, Imaging and Targeting

    Energy Technology Data Exchange (ETDEWEB)

    Stappaerts, E; Baker, K; Gavel, D; Wilks, S; Olivier, S; Brase, J; Olivier, S; Brase, J

    2003-10-03

    Laboratory and field demonstration results obtained as part of the DARPA-sponsored Coherent Communications, Imaging and Targeting (CCIT) program are reviewed. The CCIT concept uses a Phase Conjugation Engine based on a quadrature receiver array, a hologram processor and a spatial light modulator (SLM) for high-speed, digital beam control. Progress on the enabling MEMS SLM, being developed by a consortium consisting of LLNL, academic institutions and small businesses, is presented.

  4. Theranostics Targeting Metastatic Breast Cancer

    Science.gov (United States)

    2016-10-01

    What opportunities for training and professional development has the project provided? Two graduate students and one postdoctoral research associate...hostile immune reaction toward FR-expressing tumors. A series of vaccinations with hapten fluorescein (EC90 vaccine ) admin- istrated with an adjuvant...FITC-conjugated (FITC is flu - orescein isothiocyanate) CA inhibitor acetalozamide (AAZ) targeted CA-IX positive cells (Kd = 12.6 nM). The biodistribution

  5. Targeting inflammation in metabolic syndrome.

    Science.gov (United States)

    Welty, Francine K; Alfaddagh, Abdulhamied; Elajami, Tarec K

    2016-01-01

    The metabolic syndrome (MetS) is comprised of a cluster of closely related risk factors, including visceral adiposity, insulin resistance, hypertension, high triglyceride, and low high-density lipoprotein cholesterol; all of which increase the risk for the development of type 2 diabetes and cardiovascular disease. A chronic state of inflammation appears to be a central mechanism underlying the pathophysiology of insulin resistance and MetS. In this review, we summarize recent research which has provided insight into the mechanisms by which inflammation underlies the pathophysiology of the individual components of MetS including visceral adiposity, hyperglycemia and insulin resistance, dyslipidemia, and hypertension. On the basis of these mechanisms, we summarize therapeutic modalities to target inflammation in the MetS and its individual components. Current therapeutic modalities can modulate the individual components of MetS and have a direct anti-inflammatory effect. Lifestyle modifications including exercise, weight loss, and diets high in fruits, vegetables, fiber, whole grains, and low-fat dairy and low in saturated fat and glucose are recommended as a first line therapy. The Mediterranean and dietary approaches to stop hypertension diets are especially beneficial and have been shown to prevent development of MetS. Moreover, the Mediterranean diet has been associated with reductions in total and cardiovascular mortality. Omega-3 fatty acids and peroxisome proliferator-activated receptor α agonists lower high levels of triglyceride; their role in targeting inflammation is reviewed. Angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, and aldosterone blockers comprise pharmacologic therapies for hypertension but also target other aspects of MetS including inflammation. Statin drugs target many of the underlying inflammatory pathways involved in MetS. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Targeting distress in rheumatic diseases

    OpenAIRE

    Vriezekolk, J.E.

    2011-01-01

    Psychological distress is highly prevalent in patients with rheumatic diseases. It is associated with a variety of negative outcomes, including pain, fatigue, disability, and maladaptive cognitive behavioural coping strategies. In this thesis, psychological distress was studied both as an outcome measure and as a therapeutic target in the context of multidisciplinary rehabilitation. The longitudinal role of coping in psychological distress was systematically reviewed, a questionnaire to asses...

  7. Novel therapies targeting vascular endothelium.

    Science.gov (United States)

    Tousoulis, Dimitris; Antoniades, Charalambos; Koumallos, Nikolaos; Marinou, Kyriakoula; Stefanadi, Elli; Latsios, George; Stefanadis, Christodoulos

    2006-01-01

    Endothelial dysfunction has been identified as a major mechanism involved in all the stages of atherogenesis. Evaluation of endothelial function seems to have a predictive role in humans, and therapeutic interventions improving nitric oxide bioavailability in the vasculature may improve the long-term outcome in healthy individuals, high-risk subjects, or patients with advanced atherosclerosis. Several therapeutic strategies are now available, targeting both the synthesis and oxidative inactivation of nitric oxide (NO) in human vasculature. Statins seem to be currently the most powerful category of these agents, improving endothelial function and decreasing cardiovascular risk after long-term administration. Other cardiovascular agents improving endothelial function in humans are angiotensin-converting enzyme inhibitors/angiotensin receptors blockers, which increase NO bioavailability by modifying the rennin-angiotensin-aldosterone system. Newer therapeutic approaches targeting endothelial dysfunction in specific disease states include insulin sensitizers, L-arginine (the substrate for endothelial NO synthase [eNOS]) as well as substances that target eNOS "coupling," such as folates or tetrahydrobiopterin. Although there are a variety of strategies to improve NO bioavailability in human endothelium, it is still unclear whether they have any direct benefit at a clinical level.

  8. Targeted gene flow for conservation.

    Science.gov (United States)

    Kelly, Ella; Phillips, Ben L

    2016-04-01

    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. © 2015 Society for Conservation Biology.

  9. Targeted Treatment Options in Mastocytosis

    Directory of Open Access Journals (Sweden)

    Mélanie Vaes

    2017-07-01

    Full Text Available Mastocytosis refers to a heterogeneous group of disorders resulting from the clonal proliferation of abnormal mast cells and their accumulation in the skin (cutaneous mastocytosis when only in the skin, CM or in various organs (systemic mastocytosis, SM. This leads to a wide variety of clinical manifestations resulting from excessive mediator release in CM and benign forms of SM (indolent SM, ISM and from tissue mast cell infiltration causing multiorgan dysfunction and failure in more aggressive subtypes (aggressive SM, ASM, or mast cell leukemia. In addition, SM may be associated with hematological neoplasms (AHN. While treatment of ISM primarily aims at symptom management with anti-mediator therapies, cytoreductive and targeted therapies are needed to control the expansion of neoplastic mast cells in advanced forms of SM, in order to improve overall survival. Mast cell accumulation results from a gain-of-function mutation (mostly the D816V mutation within the KIT tyrosine kinase domain expressed by mast cells and additional genetic and epigenetic mutations may further determine the features of the disease (ASM and AHN. Consequently, tyrosine kinase inhibitors and targeted therapies directed against the oncogenic signaling machinery downstream of KIT are attractive therapeutic approaches. A better understanding of the relative contribution of these genetic and epigenetic events to the molecular pathogenesis of mastocytosis is of particular interest for the development of targeted therapies and therefore to better choose patient subgroups that would best benefit from a given therapeutic strategy.

  10. Unmanned Aircraft Systems (UAS) Sensor and Targeting

    Science.gov (United States)

    2010-07-27

    mission, a pre-determined number of different targets should be shuffled between the target locations in the array. Example targets for this subtest are...UNFOV Ultra Narrow Field of View UTM Universal Transverse Mercator VBLSS Video-Based Laser Scoring System VRT Vertical Reference Target WFOV

  11. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, B.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T. [Los Alamos National Lab., NM (United States)

    1997-12-31

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Follow-on experiments will use a frozen deuterium fiber along the axis (without a gas-fill). The diagnostics include B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, silicon photodiodes, neutron yield, and plasma-density interferometer. Operation to date has been with drive current ranging from 0.8 MA to 1.9 MA. Optical diagnostics show that the plasma produced in the containment region lasts roughly 20 to 30 {micro}s, and the B-dot probes show a broad current-profile in the containment region. The experimental design and data will be presented.

  12. Targeted advertising, platform competition and privacy

    OpenAIRE

    Henk Kox; Bas Straathof; Gijsbert Zwart

    2014-01-01

    Targeted advertising can benefit consumers through lower prices for access to websites. Yet, if consumers dislike that websites collect their personal information, their welfare may go down. We study competition for consumers between websites that can show targeted advertisements. We find that more targeting increases competition and reduces the websites' profits, but yet in equilibrium websites choose maximum targeting as they cannot credibly commit to low targeting. A privacy protection pol...

  13. BCG vaccination induces HIV target cell activation in HIV-exposed infants in a randomized trial.

    Science.gov (United States)

    Gasper, Melanie A; Hesseling, Anneke C; Mohar, Isaac; Myer, Landon; Azenkot, Tali; Passmore, Jo-Ann S; Hanekom, Willem; Cotton, Mark F; Crispe, I Nicholas; Sodora, Donald L; Jaspan, Heather B

    2017-04-06

    BACKGROUND. Bacillus Calmette-Guérin (BCG) vaccine is administered at birth to protect infants against tuberculosis throughout Africa, where most perinatal HIV-1 transmission occurs. We examined whether BCG vaccination alters the levels of activated HIV target T cells in HIV-exposed South African infants. METHODS. HIV-exposed infants were randomized to receive routine (at birth) or delayed (at 8 weeks) BCG vaccination. Activated and CCR5-expressing peripheral blood CD4+ T cell, monocyte, and NK cell frequencies were evaluated by flow cytometry and immune gene expression via PCR using Biomark (Fluidigm). RESULTS. Of 149 infants randomized, 92% (n = 137) were retained at 6 weeks: 71 in the routine BCG arm and 66 in the delayed arm. Routine BCG vaccination led to a 3-fold increase in systemic activation of HIV target CD4+CCR5+ T cells (HLA-DR+CD38+) at 6 weeks (0.25% at birth versus 0.08% in delayed vaccination groups; P = 0.029), which persisted until 8 weeks of age when the delayed arm was vaccinated. Vaccination of the infants in the delayed arm at 8 weeks resulted in a similar increase in activated CD4+CCR5+ T cells. The increase in activated T cells was associated with increased levels of MHC class II transactivator (CIITA), IL12RB1, and IFN-α1 transcripts within peripheral blood mononuclear cells but minimal changes in innate cells. CONCLUSION. BCG vaccination induces immune changes in HIV-exposed infants, including an increase in the proportion of activated CCR5+CD4+ HIV target cells. These findings provide insight into optimal BCG vaccine timing to minimize the risks of HIV transmissions to exposed infants while preserving potential benefits conferred by BCG vaccination. TRIAL REGISTRATION. ClinicalTrials.gov NCT02062580. FUNDING. This trial was sponsored by the Elizabeth Glaser Pediatric AIDS Foundation (MV-00-9-900-01871-0-00) and the Thrasher Foundation (NR-0095); for details, see Acknowledgments.

  14. Hospitals: Soft Target for Terrorism?

    Science.gov (United States)

    De Cauwer, Harald; Somville, Francis; Sabbe, Marc; Mortelmans, Luc J

    2017-02-01

    In recent years, the world has been rocked repeatedly by terrorist attacks. Arguably, the most remarkable were: the series of four coordinated suicide plane attacks on September 11, 2001 on buildings in New York, Virginia, and Pennsylvania, USA; and the recent series of two coordinated attacks in Brussels (Belgium), on March 22, 2016, involving two bombings at the departure hall of Brussels International Airport and a bombing at Maalbeek Metro Station located near the European Commission headquarters in the center of Brussels. This statement paper deals with different aspects of hospital policy and disaster response planning that interface with terrorism. Research shows that the availability of necessary equipment and facilities (eg, personal protective clothing, decontamination rooms, antidotes, and anti-viral drugs) in hospitals clearly is insufficient. Emergency teams are insufficiently prepared: adequate and repetitive training remain necessary. Unfortunately, there are many examples of health care workers and physicians or hospitals being targeted in both political or religious conflicts and wars. Many health workers were kidnapped and/or killed by insurgents of various ideology. Attacks on hospitals also could cause long-term effects: hospital units could be unavailable for a long time and replacing staff could take several months, further compounding hospital operations. Both physical and psychological (eg, posttraumatic stress disorder [PTSD]) after-effects of a terrorist attack can be detrimental to health care services. On the other hand, physicians and other hospital employees have shown to be involved in terrorism. As data show that some offenders had a previous history with the location of the terror incident, the possibility of hospitals or other health care services being targeted by insiders is discussed. The purpose of this report was to consider how past terrorist incidents can inform current hospital preparedness and disaster response planning

  15. Targeted Therapy in Systemic Sclerosis

    Directory of Open Access Journals (Sweden)

    Murray Baron

    2016-10-01

    Full Text Available Targeted therapies use an understanding of the pathophysiology of a disease in an individual patient. Although targeted therapy for systemic sclerosis (SSc, scleroderma has not yet reached the level of patient-specific treatments, recent developments in the understanding of the global pathophysiology of the disease have led to new treatments based on the cells and pathways that have been shown to be involved in the disease pathogenesis. The presence of a B cell signature in skin biopsies has led to the trial of rituximab, an anti-CD20 antibody, in SSc. The well-known properties of transforming growth factor (TGF-β in promoting collagen synthesis and secretion has led to a small trial of fresolimumab, a human IgG4 monoclonal antibody capable of neutralizing TGF-β. Evidence supporting important roles for interleukin-6 in the pathogenesis of SSc have led to a large trial of tocilizumab in SSc. Soluble guanylate cyclase (sGC is an enzyme that catalyzes the production of cyclic guanosine monophosphate (cGMP upon binding of nitric oxide (NO to the sGC molecule. Processes such as cell growth and proliferation are regulated by cGMP. Evidence that sGC may play a role in SSc has led to a trial of riociguat, a molecule that sensitizes sGC to endogenous NO. Tyrosine kinases (TKs are involved in a wide variety of physiologic and pathological processes including vascular remodeling and fibrogenesis such as occurs in SSc. This has led to a trial of nintedanib, a next-generation tyrosine-kinase (TK inhibitor which targets multiple TKs, in SSc.

  16. Downstream targets of WRKY33

    DEFF Research Database (Denmark)

    Petersen, Klaus; Fiil, Berthe Katrine; Mundy, John

    2008-01-01

    Innate immunity signaling pathways in both animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. In a recent publication we show that MPK4 and its substrate MKS1 interact with WRKY33 in vivo, and that WRKY33 is released from complexes with MPK4 upon infection. Tran...... immunoprecipitation confirmed that WRKY33 bound the promoter of PAD3 when plants were inoculated with pathogens. Here we further discuss the involvement of two other targets of WRKY33, NUDT6 and ROF2 in defense responses against invading pathogens....

  17. Performance Targets and External Benchmarking

    DEFF Research Database (Denmark)

    Friis, Ivar; Hansen, Allan; Vámosi, Tamás S.

    Research on relative performance measures, transfer pricing, beyond budgeting initiatives, target costing, piece rates systems and value based management has for decades underlined the importance of external benchmarking in performance management. Research conceptualises external benchmarking...... of the ‘inside’ costs of the sub-component, technical specifications of the product, opportunistic behavior from the suppliers and cognitive limitation. These are all aspects that easily can dismantle the market mechanism and make it counter-productive in the organization. Thus, by directing more attention...

  18. The challenge of targeting metastasis.

    Science.gov (United States)

    Fidler, Isaiah J; Kripke, Margaret L

    2015-12-01

    Metastases that are resistant to conventional therapy are the major cause of death from cancer. In most patients, metastasis has already occurred by the time of diagnosis. Thus, the prevention of metastasis is unlikely to be of therapeutic benefit. The biological heterogeneity of metastases presents a major obstacle to treatment. However, the growth and survival of metastases depend on interactions between tumor cells and host homeostatic mechanisms. Targeting these interactions, in addition to the tumor cells, can produce synergistic therapeutic effects against existing metastases.

  19. Introduction to radar target recognition

    CERN Document Server

    Tait, P

    2006-01-01

    This new text provides an overview of the radar target recognition process and covers the key techniques being developed for operational systems. It is based on the fundamental scientific principles of high resolution radar, and explains how the techniques can be used in real systems, taking into account the characteristics of practical radar system designs and component limitations. It also addresses operational aspects, such as how high resolution modes would fit in with other functions such as detection and tracking. Mathematics is kept to a minimum and the complex techniques and issues are

  20. Targeting α-synuclein oligomers

    DEFF Research Database (Denmark)

    van Diggelen, Femke

    2017-01-01

    Parkinson’s Disease (PD) is a complex disease, characterised by degeneration of neocortical, limbic and nigrostriatal neurons. It is unknown what initiates neurodegeneration, but soluble oligomers of the protein α-synuclein (αSn) seem to be particularly toxic, compared to insoluble fibrils....... Although there is currently no cure for PD, αSn oligomers (αSOs) are a potential therapeutic target, but a major drawback it that little is known about the nature of PD-associated αSOs. The scientific literature describes a wide variety of protocols to generate αSOs in vitro, with a subsequent...

  1. LIFE Target Fabrication Research Plan Sept 2008

    Energy Technology Data Exchange (ETDEWEB)

    Miles, R; Biener, J; Kucheyev, S; Montesanti, R; Satcher, J; Spadaccini, C; Rose, K; Wang, M; Hamza, A; Alexander, N; Brown, L; Hund, J; Petzoldt, R; Sweet, W; Goodin, D

    2008-11-10

    The target-system for the baseline LIFE fast-ignition target was analyzed to establish a preliminary estimate for the costs and complexities involved in demonstrating the technologies needed to build a prototype LIFE plant. The baseline fast-ignition target upon which this analysis was developed is shown in Figure 1.0-1 below. The LIFE target-system incorporates requirements for low-cost, high throughput manufacture, high-speed, high accuracy injection of the target into the chamber, production of sufficient energy from implosion and recovery and recycle of the imploded target material residue. None of these functions has been demonstrated to date. Existing target fabrication techniques which lead to current 'hot spot' target costs of {approx}$100,000 per target and at a production rate of 2/day are unacceptable for the LIFE program. Fabrication techniques normally used for low-cost, low accuracy consumer products such as toys must be adapted to the high-accuracy LIFE target. This will be challenge. A research program resulting is the demonstration of the target-cycle technologies needed for a prototype LIFE reactor is expected to cost {approx}$51M over the course of 5 years. The effort will result in targets which will cost an estimated $0.23/target at a rep-rate of 20 Hz or about 1.73M targets/day.

  2. Targeting telomerase with radiolabeled inhibitors.

    Science.gov (United States)

    Waghorn, Philip A; Jackson, Mark R; Gouverneur, Veronique; Vallis, Katherine A

    2017-01-05

    The expression of telomerase in approximately 85% of cancers and its absence in the majority of normal cells makes it an attractive target for cancer therapy. However the lag period between initiation of telomerase inhibition and growth arrest makes direct inhibition alone an insufficient method of treatment. However, telomerase inhibition has been shown to enhance cancer cell radiosensitivity. To investigate the strategy of simultaneously inhibiting telomerase while delivering targeted radionuclide therapy to cancer cells, 123 I-radiolabeled inhibitors of telomerase were synthesized and their effects on cancer cell survival studied. An 123 I-labeled analogue of the telomerase inhibitor MST-312 inhibited telomerase with an IC 50 of 1.58 μM (MST-312 IC 50 : 0.23 μM). Clonogenic assays showed a dose dependant effect of 123 I-MST-312 on cell survival in a telomerase positive cell line, MDA-MB-435. Copyright © 2016 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

  3. Properties of Protein Drug Target Classes

    Science.gov (United States)

    Bull, Simon C.; Doig, Andrew J.

    2015-01-01

    Accurate identification of drug targets is a crucial part of any drug development program. We mined the human proteome to discover properties of proteins that may be important in determining their suitability for pharmaceutical modulation. Data was gathered concerning each protein’s sequence, post-translational modifications, secondary structure, germline variants, expression profile and drug target status. The data was then analysed to determine features for which the target and non-target proteins had significantly different values. This analysis was repeated for subsets of the proteome consisting of all G-protein coupled receptors, ion channels, kinases and proteases, as well as proteins that are implicated in cancer. Machine learning was used to quantify the proteins in each dataset in terms of their potential to serve as a drug target. This was accomplished by first inducing a random forest that could distinguish between its targets and non-targets, and then using the random forest to quantify the drug target likeness of the non-targets. The properties that can best differentiate targets from non-targets were primarily those that are directly related to a protein’s sequence (e.g. secondary structure). Germline variants, expression levels and interactions between proteins had minimal discriminative power. Overall, the best indicators of drug target likeness were found to be the proteins’ hydrophobicities, in vivo half-lives, propensity for being membrane bound and the fraction of non-polar amino acids in their sequences. In terms of predicting potential targets, datasets of proteases, ion channels and cancer proteins were able to induce random forests that were highly capable of distinguishing between targets and non-targets. The non-target proteins predicted to be targets by these random forests comprise the set of the most suitable potential future drug targets, and should therefore be prioritised when building a drug development programme. PMID

  4. Bioengineering Strategies for Designing Targeted Cancer Therapies

    Science.gov (United States)

    Wen, Xuejun

    2014-01-01

    The goals of bioengineering strategies for targeted cancer therapies are (1) to deliver a high dose of an anticancer drug directly to a cancer tumor, (2) to enhance drug uptake by malignant cells, and (3) to minimize drug uptake by nonmalignant cells. Effective cancer-targeting therapies will require both passive- and active targeting strategies and a thorough understanding of physiologic barriers to targeted drug delivery. Designing a targeted therapy includes the selection and optimization of a nanoparticle delivery vehicle for passive accumulation in tumors, a targeting moiety for active receptor-mediated uptake, and stimuli-responsive polymers for control of drug release. The future direction of cancer targeting is a combinatorial approach, in which targeting therapies are designed to use multiple targeting strategies. The combinatorial approach will enable combination therapy for delivery of multiple drugs and dual ligand targeting to improve targeting specificity. Targeted cancer treatments in development and the new combinatorial approaches show promise for improving targeted anticancer drug delivery and improving treatment outcomes. PMID:23768509

  5. TARGET 2 and Settlement Finality

    Directory of Open Access Journals (Sweden)

    Ivan MANGATCHEV

    2011-03-01

    Full Text Available This article examines how TARGET 2 as system implements the idea of settlement finality regulated by Directive 98/26 EC of the European parliament and of the Council of 19 May 1998 on settlement finality in payment and securities settlement systems (Settlement Finality Directive and Directive 2009/44/EC of the European parliament and of the Council of 6 May 2009 amending Directive 98/26/EC on settlement finality in payment and securities settlement systems and Directive 2002/47/EC on financial collateral arrangements as regards linked systems and credit claims (Directive 2009/44/EC. As the title of the arti and finality of the settlement in this system.

  6. Terahertz-based target typing.

    Energy Technology Data Exchange (ETDEWEB)

    Lyo, Sungkwun Kenneth; Wanke, Michael Clement; Reno, John Louis; Shaner, Eric Arthur; Grine, Albert D.; Barrick, Todd A.

    2008-09-01

    The purpose of this work was to create a THz component set and understanding to aid in the rapid analysis of transient events. This includes the development of fast, tunable, THz detectors, along with filter components for use with standard detectors and accompanying models to simulate detonation signatures. The signature effort was crucial in order to know the spectral range to target for detection. Our approach for frequency agile detection was to utilize plasmons in the channel of a specially designed field-effect transistor called the grating-gate detector. Grating-gate detectors exhibit narrow-linewidth, broad spectral tunability through application of a gate bias, and no angular dependence in their photoresponse. As such, if suitable sensitivity can be attained, they are viable candidates for Terahertz multi-spectral focal plane arrays.

  7. Gene Therapy Targeting HIV Entry

    Directory of Open Access Journals (Sweden)

    Chuka Didigu

    2014-03-01

    Full Text Available Despite the unquestionable success of antiretroviral therapy (ART in the treatment of HIV infection, the cost, need for daily adherence, and HIV-associated morbidities that persist despite ART all underscore the need to develop a cure for HIV. The cure achieved following an allogeneic hematopoietic stem cell transplant (HSCT using HIV-resistant cells, and more recently, the report of short-term but sustained, ART-free control of HIV replication following allogeneic HSCT, using HIV susceptible cells, have served to both reignite interest in HIV cure research, and suggest potential mechanisms for a cure. In this review, we highlight some of the obstacles facing HIV cure research today, and explore the roles of gene therapy targeting HIV entry, and allogeneic stem cell transplantation in the development of strategies to cure HIV infection.

  8. Targeting Persistent Human Papillomavirus Infection.

    Science.gov (United States)

    Shanmugasundaram, Srinidhi; You, Jianxin

    2017-08-18

    While the majority of Human papillomavirus (HPV) infections are transient and cleared within a couple of years following exposure, 10-20% of infections persist latently, leading to disease progression and, ultimately, various forms of invasive cancer. Despite the clinical efficiency of recently developed multivalent prophylactic HPV vaccines, these preventive measures are not effective against pre-existing infection. Additionally, considering that the burden associated with HPV is greatest in regions with limited access to preventative vaccination, the development of effective therapies targeting persistent infection remains imperative. This review discusses not only the mechanisms underlying persistent HPV infection, but also the promise of immunomodulatory therapeutic vaccines and small-molecular inhibitors, which aim to augment the host immune response against the viral infection as well as obstruct critical viral-host interactions.

  9. Targeting ECM Disrupts Cancer Progression

    DEFF Research Database (Denmark)

    Venning, Freja A; Wullkopf, Lena; Erler, Janine T

    2015-01-01

    Metastatic complications are responsible for more than 90% of cancer-related deaths. The progression from an isolated tumor to disseminated metastatic disease is a multistep process, with each step involving intricate cross talk between the cancer cells and their non-cellular surroundings, the ex...... is summarized. In addition, we highlight the promising (pre-)clinical data showing benefits of targeting these ECM macromolecules to prevent cancer progression.......Metastatic complications are responsible for more than 90% of cancer-related deaths. The progression from an isolated tumor to disseminated metastatic disease is a multistep process, with each step involving intricate cross talk between the cancer cells and their non-cellular surroundings......, the extracellular matrix (ECM). Many ECM proteins are significantly deregulated during the progression of cancer, causing both biochemical and biomechanical changes that together promote the metastatic cascade. In this review, the influence of several ECM proteins on these multiple steps of cancer spread...

  10. Obesity treatment: novel peripheral targets.

    Science.gov (United States)

    Field, Benjamin C T; Chaudhri, Owais B; Bloom, Stephen R

    2009-12-01

    Our knowledge of the complex mechanisms underlying energy homeostasis has expanded enormously in recent years. Food intake and body weight are tightly regulated by the hypothalamus, brainstem and reward circuits, on the basis both of cognitive inputs and of diverse humoral and neuronal signals of nutritional status. Several gut hormones, including cholecystokinin, glucagon-like peptide-1, peptide YY, oxyntomodulin, amylin, pancreatic polypeptide and ghrelin, have been shown to play an important role in regulating short-term food intake. These hormones therefore represent potential targets in the development of novel anti-obesity drugs. This review focuses on the role of gut hormones in short- and long-term regulation of food intake, and on the current state of development of gut hormone-based obesity therapies.

  11. Moringa oleifera Lam: Targeting Chemoprevention.

    Science.gov (United States)

    Karim, Nurul Ashikin Abd; Ibrahim, Muhammad Din; Kntayya, Saie Brindha; Rukayadi, Yaya; Hamid, Hazrulizawati Abd; Razis, Ahmad Faizal Abdull

    2016-01-01

    Moringa oleifera Lam, family Moringaceae, is a perennial plant which is called various names, but is locally known in Malaysia as "murungai" or "kelor". Glucomoringin, a glucosinolate with from M. oleifera is a major secondary metabolite compound. The seeds and leaves of the plant are reported to have the highest amount of glucosinolates. M. oleifera is well known for its many uses health and benefits. It is claimed to have nutritional, medicinal and chemopreventive potentials. Chemopreventive effects of M. oleifera are expected due to the existence of glucosinolate which it is reported to have the ability to induce apoptosis in anticancer studies. Furthermore, chemopreventive value of M. oleifera has been demonstrated in studies utilizing its leaf extract to inhibit the growth of human cancer cell lines. This review highlights the advantages of M. oleifera targeting chemoprevention where glucosinolates could help to slow the process of carcinogenesis through several molecular targets. It is also includes inhibition of carcinogen activation and induction of carcinogen detoxification, anti-inflammatory, anti-tumor cell proliferation, induction of apoptosis and inhibition of tumor angiogenesis. Finally, for synergistic effects of M. oleifera with other drugs and safety, essential for chemoprevention, it is important that it safe to be consumed by human body and works well. Although there is promising evidence about M. oleifera in chemoprevention, extensive research needs to be done due to the expected rise of cancer in coming years and to gain more information about the mechanisms involved in M. oleifera influence, which could be a good source to inhibit several major mechanisms involved in cancer development.

  12. Target therapies in pancreatic carcinoma.

    Science.gov (United States)

    Silvestris, Nicola; Gnoni, Antonio; Brunetti, Anna Elisabetta; Vincenti, Leonardo; Santini, Daniele; Tonini, Giuseppe; Merchionne, Francesca; Maiello, Evaristo; Lorusso, Vito; Nardulli, Patrizia; Azzariti, Amalia; Reni, Michele

    2014-01-01

    Pancreatic ductal adenocarcinoma (PDAC) occurs in the majority of cases with early locoregional spread and distant metastases at diagnosis, leading to dismal prognosis and limited treatment options. Traditional cytotoxic chemotherapy provides only modest benefit to patients with PDAC. Identification of different molecular pathways, overexpressed in pancreatic cancer cells, has provided the opportunity to develop targeted therapies (monoclonal antibodies and small-molecule inhibitors) and peculiar new class of taxanes with a crucial therapeutic role in this cancer setting. A phase III trial has shown that erlotinib in combination with gemcitabine was clinically irrelevant and skin toxicity can be a positive prognostic factor. Moreover, the combination of cetuximab or erlotinib with radiotherapy in advanced pancreatic cancer has shown to be synergistic and a reversal of radio-resistance has been suggested by inhibition of VEGF/EGFR pathway. To overcome EGFR-inhibition therapy resistance several alternative pathways targets are under investigation (IGF- 1R, MMPs, Hedgehog proteins, m-TOR, MEK, COX-2) and provide the rationale for clinical use in phase II/III studies. Also nab-paclitaxel, a new taxanes class, uses high pancreatic albumin-binding protein SPARC levels to act in cancer cells with a less toxic and more effective dose with respect to classic taxanes. Understanding of molecular pathogenesis of pancreatic adenocarcinoma continues to expand. However, many promising data in preclinic and phase I/II trials did not yield promise in phase III trials, suggesting that identification of predictive biomarkers for these new agents is mandatory. The knowledge of biologic and molecular aspects of pancreatic cancer can be the basis for future therapeutic developments.

  13. Combinatorial microRNA target predictions

    DEFF Research Database (Denmark)

    Krek, Azra; Grün, Dominic; Poy, Matthew N.

    2005-01-01

    MicroRNAs are small noncoding RNAs that recognize and bind to partially complementary sites in the 3' untranslated regions of target genes in animals and, by unknown mechanisms, regulate protein production of the target transcript1, 2, 3. Different combinations of microRNAs are expressed...... in different cell types and may coordinately regulate cell-specific target genes. Here, we present PicTar, a computational method for identifying common targets of microRNAs. Statistical tests using genome-wide alignments of eight vertebrate genomes, PicTar's ability to specifically recover published micro......RNA targets, and experimental validation of seven predicted targets suggest that PicTar has an excellent success rate in predicting targets for single microRNAs and for combinations of microRNAs. We find that vertebrate microRNAs target, on average, roughly 200 transcripts each. Furthermore, our results...

  14. Targets and processes for fabricating same

    Science.gov (United States)

    Cowna, Thomas; Malekos, Steven; Korgan, Grant; Adams, Jesse; Sentoku, Yasuhiko; LeGalloudec, Nathalie

    2014-06-10

    In particular embodiments, the present disclosure provides targets including a metal layer and defining a hollow inner surface. The hollow inner surface has an internal apex. The distance between at least two opposing points of the internal apex is less than about 15 .mu.m. In particular examples, the distance is less than about 1 .mu.m. Particular implementations of the targets are free standing. The targets have a number of disclosed shaped, including cones, pyramids, hemispheres, and capped structures. The present disclosure also provides arrays of such targets. Also provided are methods of forming targets, such as the disclosed targets, using lithographic techniques, such as photolithographic techniques. In particular examples, a target mold is formed from a silicon wafer and then one or more sides of the mold are coated with a target material, such as one or more metals.

  15. Cooperative tumour cell membrane targeted phototherapy

    Science.gov (United States)

    Kim, Heegon; Lee, Junsung; Oh, Chanhee; Park, Ji-Ho

    2017-06-01

    The targeted delivery of therapeutics using antibodies or nanomaterials has improved the precision and safety of cancer therapy. However, the paucity and heterogeneity of identified molecular targets within tumours have resulted in poor and uneven distribution of targeted agents, thus compromising treatment outcomes. Here, we construct a cooperative targeting system in which synthetic and biological nanocomponents participate together in the tumour cell membrane-selective localization of synthetic receptor-lipid conjugates (SR-lipids) to amplify the subsequent targeting of therapeutics. The SR-lipids are first delivered selectively to tumour cell membranes in the perivascular region using fusogenic liposomes. By hitchhiking with extracellular vesicles secreted by the cells, the SR-lipids are transferred to neighbouring cells and further spread throughout the tumour tissues where the molecular targets are limited. We show that this tumour cell membrane-targeted delivery of SR-lipids leads to uniform distribution and enhanced phototherapeutic efficacy of the targeted photosensitizer.

  16. Study Identifies New Lymphoma Treatment Target

    Science.gov (United States)

    NCI researchers have identified new therapeutic targets for diffuse large B-cell lymphoma. Drugs that hit these targets are under clinical development and the researchers hope to begin testing them in clinical trials of patients with DLBCL.

  17. On the large COMPASS polarized deuteron target

    CERN Document Server

    Finger, M; Baum, G; Doshita, N; Finger, M Jr; Gautheron, F; Goertz, St; Hasegawa, T; Heckmann, J; Hess, Ch; Horikawa, N; Ishimoto, S; Iwata, T; Kisselev, Y; Koivuniemi, J; Kondo, K; Le Goff, J-M; Magnon, A; Marchand, C; Matsuda, T; Meyer, W; Reicherz, G; Srnka, A

    2006-01-01

    The spin structure of the nucleons is investigated in deep inelastic scattering of a polarized muon beam and a polarized nucleon target in the COMPASS experiment at CERN since 2001. To achieve high luminosities a large solid polarized target is used. The COMPASS polarized target consists of a high cooling power $^{3}$He/$^{4}$He dilution refrigerator capable to maintain working temperature of the target material at about 50mK, a superconducting solenoid and dipole magnet system for longitudinal and transversal magnetic field on the target material, respectively, target cells containing polarizable material, microwave cavities and high power microwave radiation systems for dynamic nuclear polarization and the nuclear magnetic resonance system for nuclear spin polarization measurements. During 2001–2004 experiments superconducting magnet system with opening angle $\\pm$69 mrad, polarized target holder with two target cells and corresponding microwave and NMR systems have been used. For the data taking from 200...

  18. Targeting Cancer with Antisense Oligomers

    Energy Technology Data Exchange (ETDEWEB)

    Hnatowich, DJ

    2008-10-28

    With financial assistance from the Department of Energy, we have shown definitively that radiolabeled antisense DNAs and other oligomers will accumulate in target cancer cells in vitro and in vivo by an antisense mechanism. We have also shown that the number of mRNA targets for our antisense oligomers in the cancer cell types that we have investigated so far is sufficient to provide and antisense image and/or radiotherapy of cancer in mice. These studies have been reported in about 10 publications. However our observation over the past several years has shown that radiolabeled antisense oligomers administered intravenously in their native and naked form will accumulate and be retained in target xenografts by an antisense mechanism but will also accumulate at high levels in normal organs such as liver, spleen and kidneys. We have investigated unsuccessfully several commercially available vectors. Thus the use of radiolabeled antisense oligomers for the imaging of cancer must await novel approaches to delivery. This laboratory has therefore pursued two new paths, optical imaging of tumor and Auger radiotherapy. We are developing a novel method of optical imaging tumor using antisense oligomers with a fluorophore is administered while hybridized with a shorter complementary oligomer with an inhibitor. In culture and in tumored mice that the duplex remains intact and thus nonfluorescent until it encounters its target mRNA at which time it dissociates and the antisense oligomer binds along with its fluorophore to the target. Simultaneous with the above, we have also observed, as have others, that antisense oligomers migrate rapidly and quantitatively to the nucleus upon crossing cell membranes. The Auger electron radiotherapy path results from this observation since the nuclear migration properties could be used effectively to bring and to retain in the nucleus an Auger emitting radionuclide such as 111In or 125I bound to the antisense oligomer. Since the object becomes

  19. Targeted integration of genes in Xenopus tropicalis

    DEFF Research Database (Denmark)

    Shi, Zhaoying; Tian, Dandan; Xin, Huhu

    2017-01-01

    With the successful establishment of both targeted gene disruption and integration methods in the true diploid frog Xenopus tropicalis, this excellent vertebrate genetic model now is making a unique contribution to modelling human diseases. Here, we summarize our efforts on establishing homologous...... recombination-mediated targeted integration in Xenopus tropicalis, the usefulness, and limitation of targeted integration via the homology-independent strategy, and future directions on how to further improve targeted gene integration in Xenopus tropicalis....

  20. Capacitive Sensors And Targets Would Measure Alignments

    Science.gov (United States)

    Jenstrom, Del T.

    1994-01-01

    Multiple capacitive sensors and active targets used to measure distance between, and relative orientation of, two objects. Sensed target signals processed and used by control systems to align objects to be joined. Shapes, sizes, and layouts of sensors and targets optimized for specific application. Particular layout of targets and sensors enables determination of relative position and orientation of two objects in all six degrees of freedom.

  1. 40 CFR 35.9020 - Planning targets.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Planning targets. 35.9020 Section 35... STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35.9020 Planning targets. The EPA Assistant Administrator for Water develops planning targets each year to help each...

  2. Inflation Targeting and Business Cycle Synchronization

    OpenAIRE

    Flood, Robert P; Rose, Andrew K

    2009-01-01

    Inflation targeting seems to have a small but positive effect on the synchronization of business cycles; countries that target inflation seem to have cycles that move slightly more closely with foreign cycles. Thus the advent of inflation targeting does not explain the decoupling of global business cycles, for two reasons. Indeed business cycles have not in fact become less synchronized across countries.

  3. Starkweather Target Game for Preschool Children.

    Science.gov (United States)

    Starkweather, Elizabeth K.

    The Starkweather Target Game is designed to measure preschool children's willingness to try difficult tasks independent of ability. The game consists of a box-shaped target which responds, when the target is hit by a rolled ball, somewhat like a jack-in-a-box. When the bull's eye is hit, the lid opens and a surprise picture appears. After being…

  4. Vergence facility with stereoscopic and nonstereoscopic targets.

    Science.gov (United States)

    Momeni-Moghaddam, Hamed; Goss, David A; Dehvari, Abubakr

    2014-05-01

    To compare vergence facility with nonstereo and stereo targets in binocular symptomatic and asymptomatic subjects. Sixty-six students were divided into symptomatic and asymptomatic groups according to the Convergence Insufficiency Symptom Survey Questionnaire score. Vergence facility was tested at 40 cm by flipper prism 3Δ BI/12Δ BO (BI, base-in; BO, base-out). The targets used were a nonstereo target (a vertical column of small letter "E" of ~20/30 size), a stereo-local target (fifth set of circles of the Titmus test with stereoacuity of 100 arcsec), and a stereo-global target (page 6 of the TNO test with stereoacuity of 120 arcsec). Repeated-measures analysis of variance showed differences in the mean vergence facility with different targets in all subjects and separately in two symptom groups (p 0.05) but significant for the comparison of stereo-global targets with the other two targets. The receiver operating characteristic curve analysis showed the cutoff points 10.5, 10.5, and 9.75 cycles per minute with nonstereo, stereo-local, and stereo-global targets, respectively. The sensitivity of the three targets used was the same (97%). Specificity was 0.93 or higher with all three targets, with the highest specificity obtained with the stereo-global target (100%). The highest vergence facility was obtained with a nonstereo target and the lowest was obtained with a stereo-global target. High sensitivity with all three targets means that there are few false-negative results with them, and the high specificity is indicative of low false-positive results. Hence, the vergence facility predictive value would be high in diagnosing binocular symptomatic patients using a 3Δ BI/12Δ BO prism flipper at near and a response cutoff of about 10 cycles per minute or less.

  5. Targeted alpha therapy for cancer

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Barry J [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Raja, Chand [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Rizvi, Syed [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Li Yong [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Tsui, Wendy [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Zhang, David [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Song, Emma [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Qu, C F [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Kearsley, John [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Graham, Peter [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Thompson, John [Sydney Melanoma Unit, Royal Prince Alfred Hospital, Camperdown 2050 NSW (Australia)

    2004-08-21

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The {sup 213}Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 {mu

  6. Tantalum/Copper X-Ray Targets

    Science.gov (United States)

    Waters, William J.; Edmonds, Brian

    1993-01-01

    Lewis Research Center developed unique solution to subsidiary problem of fabrication of x-ray target. Plasma spraying enabled fabrication of lightweight, high-performance targets. Power settings, atmosphere-control settings, rate of deposition, and other spraying parameters developed. Thin coats of tantalum successfully deposited on copper targets. Targets performed successfully in tests and satisfied all criteria expressed in terms of critical parameters. Significantly reduces projected costs of fabrication of targets and contributes to development of improved, long-lived, lightweight x-ray system.

  7. Targeting nominal income growth or inflation?

    DEFF Research Database (Denmark)

    Jensen, Henrik

    2002-01-01

    Within a simple New Keynesian model emphasizing forward-looking behavior of private agents, I evaluate optimal nominal income growth targeting versus optimal inflation targeting. When the economy is mainly subject to shocks that do not involve monetary policy trade-offs for society, inflation...... targeting is preferable. Otherwise, nominal income growth targeting may be superior because it induces inertial policy making, which improves the inflation-output-gap trade-off. Somewhat paradoxically, inflation targeting may be relatively less favorable the more society dislikes inflation, and the more...

  8. Improved Targeting of Cancers with Nanotherapeutics

    DEFF Research Database (Denmark)

    Foster, Christian; Watson, Andre; Kaplinsky, Joseph John

    2017-01-01

    Targeted cancer nanotherapeutics offers numerous opportunities for the selective uptake of toxic chemotherapies within tumors and cancer cells. The unique properties of nanoparticles, such as their small size, large surface-to-volume ratios, and the ability to achieve multivalency of targeting...... ligands on their surface, provide superior advantages for nanoparticle-based drug delivery to a variety of cancers. This review highlights various key concepts in the design of targeted nanotherapeutics for cancer therapy, and discusses physicochemical parameters affecting nanoparticle targeting, along...... with recent developments for cancer-targeted nanomedicines....

  9. Graphite target for the spiral project

    Energy Technology Data Exchange (ETDEWEB)

    Putaux, J.C.; Ducourtieux, M.; Ferro, A.; Foury, P.; Kotfila, L.; Mueller, A.C.; Obert, J.; Pauwels, N.; Potier, J.C.; Proust, J. [Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Bertrand, P. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France); Loiselet, M. [Universite Catholique de Louvain, Louvain-La-Neuve (Belgium)] [and others

    1996-12-31

    A study of the thermal and physical properties of graphite targets for the SPIRAL project is presented. The main objective is to develop an optimized set-up both mechanically and thermally resistant, presenting good release properties (hot targets with thin slices). The results of irradiation tests concerning the mechanical and thermal resistance of the first prototype of SPIRAL target with conical geometry are presented. The micro-structural properties of the graphite target is also studied, in order to check that the release properties are not deteriorated by the irradiation. Finally, the results concerning the latest pilot target internally heated by an electrical current are shown. (author). 5 refs.

  10. SU-F-I-03: Correction of Intra-Fractional Set-Up Errors and Target Coverage Based On Cone-Beam Computed Tomography for Cervical Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, JY [Cancer Hospital of Shantou University Medical College, Shantou, Guangdong (China); Hong, DL [The First Affiliated Hospital of Shantou University Medical College, Shantou, Guangdong (China)

    2016-06-15

    Purpose: The purpose of this study is to investigate the patient set-up error and interfraction target coverage in cervical cancer using image-guided adaptive radiotherapy (IGART) with cone-beam computed tomography (CBCT). Methods: Twenty cervical cancer patients undergoing intensity modulated radiotherapy (IMRT) were randomly selected. All patients were matched to the isocenter using laser with the skin markers. Three dimensional CBCT projections were acquired by the Varian Truebeam treatment system. Set-up errors were evaluated by radiation oncologists, after CBCT correction. The clinical target volume (CTV) was delineated on each CBCT, and the planning target volume (PTV) coverage of each CBCT-CTVs was analyzed. Results: A total of 152 CBCT scans were acquired from twenty cervical cancer patients, the mean set-up errors in the longitudinal, vertical, and lateral direction were 3.57, 2.74 and 2.5mm respectively, without CBCT corrections. After corrections, these were decreased to 1.83, 1.44 and 0.97mm. For the target coverage, CBCT-CTV coverage without CBCT correction was 94% (143/152), and 98% (149/152) with correction. Conclusion: Use of CBCT verfication to measure patient setup errors could be applied to improve the treatment accuracy. In addition, the set-up error corrections significantly improve the CTV coverage for cervical cancer patients.

  11. Hip Hop HEALS: Pilot Study of a Culturally Targeted Calorie Label Intervention to Improve Food Purchases of Children.

    Science.gov (United States)

    Williams, Olajide; DeSorbo, Alexandra; Sawyer, Vanessa; Apakama, Donald; Shaffer, Michele; Gerin, William; Noble, James

    2016-02-01

    We explored the effect of a culturally targeted calorie label intervention on food purchasing behavior of elementary school students. We used a quasi-experimental design with two intervention schools and one control school to assess food purchases of third through fifth graders at standardized school food sales before and after the intervention (immediate and delayed) in schools. The intervention comprised three 1-hour assembly-style hip-hop-themed multimedia classes. A mean total of 225 children participated in two baseline preintervention sales with and without calorie labels; 149 children participated in immediate postintervention food sales, while 133 children participated in the delayed sales. No significant change in purchased calories was observed in response to labels alone before the intervention. However, a mean decline in purchased calories of 20% (p < .01) and unhealthy foods (p < .01) was seen in immediately following the intervention compared to baseline purchases, and this persisted without significant decay after 7 days and 12 days. A 3-hour culturally targeted calorie label intervention may improve food-purchasing behavior of children. © 2015 Society for Public Health Education.

  12. Detection of Mismatch Repair Deficiency and Microsatellite Instability in Colorectal Adenocarcinoma by Targeted Next-Generation Sequencing.

    Science.gov (United States)

    Nowak, Jonathan A; Yurgelun, Matthew B; Bruce, Jacqueline L; Rojas-Rudilla, Vanesa; Hall, Dimity L; Shivdasani, Priyanka; Garcia, Elizabeth P; Agoston, Agoston T; Srivastava, Amitabh; Ogino, Shuji; Kuo, Frank C; Lindeman, Neal I; Dong, Fei

    2017-01-01

    Mismatch repair protein deficiency (MMR-D) and high microsatellite instability (MSI-H) are features of Lynch syndrome-associated colorectal carcinomas and have implications in clinical management. We evaluate the ability of a targeted next-generation sequencing panel to detect MMR-D and MSI-H based on mutational phenotype. Using a criterion of >40 total mutations per megabase or >5 single-base insertion or deletion mutations in repeats per megabase, sequencing achieves 92% sensitivity and 100% specificity for MMR-D by immunohistochemistry in a training cohort of 149 colorectal carcinomas and 91% sensitivity and 98% specificity for MMR-D in a validation cohort of 94 additional colorectal carcinomas. False-negative samples are attributable to tumor heterogeneity, and next-generation sequencing results are concordant with analysis of microsatellite loci by PCR. In a subset of 95 carcinomas with microsatellite analysis, sequencing achieves 100% sensitivity and 99% specificity for MSI-H in the combined training and validation set. False-positive results for MMR-D and MSI-H are attributable to ultramutated cancers with POLE mutations, which are confirmed by direct sequencing of the POLE gene and are detected by mutational signature analysis. These findings provide a framework for a targeted tumor sequencing panel to accurately detect MMR-D and MSI-H in colorectal carcinomas. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  13. The trajectory of the target probability effect.

    Science.gov (United States)

    Hon, Nicholas; Yap, Melvin J; Jabar, Syaheed B

    2013-05-01

    The effect of target probability on detection times is well-established: Even when detection accuracy is high, lower probability targets are detected more slowly than higher probability ones. Although this target probability effect on detection times has been well-studied, one aspect of it has remained largely unexamined: How the effect develops over the span of an experiment. Here, we investigated this issue with two detection experiments that assessed different target probability ratios. Conventional block segment analysis and linear mixed-effects modeling converged on two key findings. First, we found that the magnitude of the target probability effect increases as one progresses through a block of trials. Second, we found, by examining the trajectories of the low- and high-probability targets, that this increase in effect magnitude was driven by the low-probability targets. Specifically, we found that low-probability targets were detected more slowly as a block of trials progressed. Performance to high-probability targets, on the other hand, was largely invariant across the block. The latter finding is of particular interest because it cannot be reconciled with accounts that propose that the target probability effect is driven by the high-probability targets.

  14. Secondary anchor targeted cell release.

    Science.gov (United States)

    Ansari, Ali; Lee-Montiel, Felipe T; Amos, Jennifer R; Imoukhuede, P I

    2015-11-01

    Personalized medicine offers the promise of tailoring therapy to patients, based on their cellular biomarkers. To achieve this goal, cellular profiling systems are needed that can quickly and efficiently isolate specific cell types without disrupting cellular biomarkers. Here we describe the development of a unique platform that facilitates gentle cell capture via a secondary, surface-anchoring moiety, and cell release. The cellular capture system consists of a glass surface functionalized with APTES, d-desthiobiotin, and streptavidin. Biotinylated mCD11b and hIgG antibodies are used to capture mouse macrophages (RAW 264.7) and human breast cancer (MCF7-GFP) cell lines, respectively. The surface functionalization is optimized by altering assay components, such as streptavidin, d-desthiobiotin, and APTES, to achieve cell capture on 80% of the functionalized surface and cell release upon biotin treatment. We also demonstrate an ability to capture 50% of target cells within a dual-cell mixture. This engineering advancement is a critical step towards achieving cell isolation platforms for personalized medicine. © 2015 Wiley Periodicals, Inc.

  15. Targeting ceramide metabolism in obesity.

    Science.gov (United States)

    Aburasayn, Hanin; Al Batran, Rami; Ussher, John R

    2016-08-01

    Obesity is a major health concern that increases the risk for insulin resistance, type 2 diabetes (T2D), and cardiovascular disease. Thus, an enormous research effort has been invested into understanding how obesity-associated dyslipidemia and obesity-induced alterations in lipid metabolism increase the risk for these diseases. Accordingly, it has been proposed that the accumulation of lipid metabolites in organs such as the liver, skeletal muscle, and heart is critical to these obesity-induced pathologies. Ceramide is one such lipid metabolite that accumulates in tissues in response to obesity, and both pharmacological and genetic strategies that reduce tissue ceramide levels yield salutary actions on overall metabolic health. We will review herein why ceramide accumulates in tissues during obesity and how an increase in intracellular ceramide impacts cellular signaling and function as well as potential mechanisms by which reducing intracellular ceramide levels improves insulin resistance, T2D, atherosclerosis, and heart failure. Because a reduction in skeletal muscle ceramide levels is frequently associated with improvements in insulin sensitivity in humans, the beneficial findings reported for reducing ceramides in preclinical studies may have clinical application in humans. Therefore, modulating ceramide metabolism may be a novel, exciting target for preventing and/or treating obesity-related diseases. Copyright © 2016 the American Physiological Society.

  16. Resource implications of a national health target

    DEFF Research Database (Denmark)

    Jones, Peter; Sopina, Liza Elizaveta; Ashton, Toni

    2014-01-01

    Background The Shorter Stays in Emergency Departments health target was introduced in New Zealand in 2009. District Health Boards (DHBs) are expected to meet the target with no additional funding or incentives. The costs of implementing such targets have not previously been studied. Method A survey...... of clinical/service managers in ED throughout New Zealand determined the type and cost of resources used for the target. Responses to the target were classified according to their impact in ED, the hospital and the community. Quantifiable resource changes were assigned a financial value and grouped...... into categories: structure (facilities/beds), staff and processes. Simple statistics were used to describe the data, and the correlation between expenditure and target performance was determined. Results There was 100% response to the survey. Most DHBs reported some expenditure specifically on the target...

  17. Targeting dendritic cells--why bother?

    Science.gov (United States)

    Kreutz, Martin; Tacken, Paul J; Figdor, Carl G

    2013-04-11

    Vaccination is among the most efficient forms of immunotherapy. Although sometimes inducing lifelong protective B-cell responses, T-cell-mediated immunity remains challenging. Targeting antigen to dendritic cells (DCs) is an extensively explored concept aimed at improving cellular immunity. The identification of various DC subsets with distinct functional characteristics now allows for the fine-tuning of targeting strategies. Although some of these DC subsets are regarded as superior for (cross-) priming of naive T cells, controversies still remain about which subset represents the best target for immunotherapy. Because targeting the antigen alone may not be sufficient to obtain effective T-cell responses, delivery systems have been developed to target multiple vaccine components to DCs. In this Perspective, we discuss the pros and cons of targeting DCs: if targeting is beneficial at all and which vaccine vehicles and immunization routes represent promising strategies to reach and activate DCs.

  18. Preliminary study of mercury target structure

    Energy Technology Data Exchange (ETDEWEB)

    Kaminaga, Masanori; Haga, Katsuhiro; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kumasaka, Katsuyuki; Uchida, Shoji; Nakagawa, Toshi; Mori, Seiji; Nishikawa, Akira

    1997-11-01

    Development of a proton accelerator based neutron source (1.5 GeV, 5.3 mA (for neutron source 3.3 mA), thermal power 8 MW) is currently conducted by the Special Task Force for Neutron Science Initiative, JAERI. Preliminary design studies and related R and D of a solid metal target for the first stage (1.5 GeV, 1 mA) and a liquid metal target for both the first and second stages (1.5 GeV, 3.3 mA) are conducted by the Target Group to develop both solid and liquid metal target systems. A few kinds of target structures have been investigated in FY 1996 and the preliminary results for the target structures are described in this paper. Investigation results of alternative materials for the target container are also described in this paper. (author)

  19. Governing by targets : Reductio ad unum and evolution of the two-degree climate target

    NARCIS (Netherlands)

    Morseletto, Piero; Biermann, Frank|info:eu-repo/dai/nl/176991662; Pattberg, Philipp

    2017-01-01

    Targets are widely employed in environmental governance. In this paper, we investigate the construction of the 2 °C climate target, one of the best known targets in global environmental governance. Our paper examines this target through a historical reconstruction that identifies four different

  20. Using the Dual-Target Cost to Explore the Nature of Search Target Representations

    Science.gov (United States)

    Stroud, Michael J.; Menneer, Tamaryn; Cave, Kyle R.; Donnelly, Nick

    2012-01-01

    Eye movements were monitored to examine search efficiency and infer how color is mentally represented to guide search for multiple targets. Observers located a single color target very efficiently by fixating colors similar to the target. However, simultaneous search for 2 colors produced a dual-target cost. In addition, as the similarity between…

  1. Target definition for shipwreck hunting

    Directory of Open Access Journals (Sweden)

    Kim Paul Kirsner

    2015-10-01

    Full Text Available The research described in the present article was implemented to define the locations of two World War II shipwrecks, the German raider Kormoran, and the Australian light cruiser HMAS Sydney. The paper describes the long and complex trail that led through inefficient oceanographic prediction to ambiguous historical prediction involving a single report and on to precise cognitive prediction based on nine reports from more than 70 survivors, a process that yielded a single target position or ‘mean’ just 2.7 NM (nautical miles from the wreck of Kormoran. Prediction for the position of the wreck of Sydney opened with wishful thinking that she had somehow reached the coast more than 100 NM away when cognitive analysis of the survivor’s reports actually provided the basis for accurate prediction in a position near to the wreck of Kormoran. In the account provided below, the focus on cognitive procedures emerged from, first, a review of a sample of the shipwreck hunts, and, second, growing awareness of the extraordinarily rich database available for this search, and the extent to which it was open to cognitive analysis. This review touches on both the trans-disciplinary and the cognitive or intra-disciplinary issues that so challenged the political entities responsible for supervising of the search for the wrecks of Kormoran and Sydney. One of the theoretical questions that emerged from these debate concerns the model of expertise advanced by Collins (2013. The decomposability of alleged forms of expertise is revealed as a fundamental problem for research projects that might or might not benefit from trans-disciplinary research. Where expertise can be decomposed for operational purposes, the traditional dividing lines between experts and novices, and fools for that matter, are much harder to discern, and require advanced and scientifically informed review.

  2. Target definition for shipwreck hunting.

    Science.gov (United States)

    Kirsner, Kim

    2015-01-01

    The research described in the present article was implemented to define the locations of two World War II shipwrecks, the German raider Kormoran, and the Australian light cruiser HMAS Sydney. The paper describes the long and complex trail that led through inefficient oceanographic prediction to ambiguous historical prediction involving a single report and on to precise cognitive prediction based on nine reports from more than 70 survivors, a process that yielded a single target position or "mean" just 2.7 NM (nautical miles) from the wreck of Kormoran. Prediction for the position of the wreck of Sydney opened with wishful thinking that she had somehow reached the coast more than 100 NM away when cognitive analysis of the survivor's reports actually provided the basis for accurate prediction in a position near to the wreck of Kormoran. In the account provided below, the focus on cognitive procedures emerged from, first, a review of a sample of the shipwreck hunts, and, second, growing awareness of the extraordinarily rich database available for this search, and the extent to which it was open to cognitive analysis. This review touches on both the trans-disciplinary and the cognitive or intra-disciplinary issues that so challenged the political entities responsible for supervising of the search for the wrecks of Kormoran and Sydney. One of the theoretical questions that emerged from these debate concerns the model of expertise advanced by Collins (2013). The decomposability of alleged forms of expertise is revealed as a fundamental problem for research projects that might or might not benefit from trans-disciplinary research. Where expertise can be decomposed for operational purposes, the traditional dividing lines between experts and novices, and fools for that matter, are much harder to discern, and require advanced and scientifically informed review.

  3. Therapeutic targeting of replicative immortality.

    Science.gov (United States)

    Yaswen, Paul; MacKenzie, Karen L; Keith, W Nicol; Hentosh, Patricia; Rodier, Francis; Zhu, Jiyue; Firestone, Gary L; Matheu, Ander; Carnero, Amancio; Bilsland, Alan; Sundin, Tabetha; Honoki, Kanya; Fujii, Hiromasa; Georgakilas, Alexandros G; Amedei, Amedeo; Amin, Amr; Helferich, Bill; Boosani, Chandra S; Guha, Gunjan; Ciriolo, Maria Rosa; Chen, Sophie; Mohammed, Sulma I; Azmi, Asfar S; Bhakta, Dipita; Halicka, Dorota; Niccolai, Elena; Aquilano, Katia; Ashraf, S Salman; Nowsheen, Somaira; Yang, Xujuan

    2015-12-01

    One of the hallmarks of malignant cell populations is the ability to undergo continuous proliferation. This property allows clonal lineages to acquire sequential aberrations that can fuel increasingly autonomous growth, invasiveness, and therapeutic resistance. Innate cellular mechanisms have evolved to regulate replicative potential as a hedge against malignant progression. When activated in the absence of normal terminal differentiation cues, these mechanisms can result in a state of persistent cytostasis. This state, termed "senescence," can be triggered by intrinsic cellular processes such as telomere dysfunction and oncogene expression, and by exogenous factors such as DNA damaging agents or oxidative environments. Despite differences in upstream signaling, senescence often involves convergent interdependent activation of tumor suppressors p53 and p16/pRB, but can be induced, albeit with reduced sensitivity, when these suppressors are compromised. Doses of conventional genotoxic drugs required to achieve cancer cell senescence are often much lower than doses required to achieve outright cell death. Additional therapies, such as those targeting cyclin dependent kinases or components of the PI3K signaling pathway, may induce senescence specifically in cancer cells by circumventing defects in tumor suppressor pathways or exploiting cancer cells' heightened requirements for telomerase. Such treatments sufficient to induce cancer cell senescence could provide increased patient survival with fewer and less severe side effects than conventional cytotoxic regimens. This positive aspect is countered by important caveats regarding senescence reversibility, genomic instability, and paracrine effects that may increase heterogeneity and adaptive resistance of surviving cancer cells. Nevertheless, agents that effectively disrupt replicative immortality will likely be valuable components of new combinatorial approaches to cancer therapy. Copyright © 2015 The Authors

  4. Target detection and tracking in infrared video

    Science.gov (United States)

    Deng, Zhihui; Zhu, Jihong

    2017-07-01

    In this paper, we propose a method for target detection and tracking in infrared video. The target is defined by its location and extent in a single frame. In the initialization process, we use an adaptive threshold to segment the target and then extract the fern feature and normalize it as a template. The detector uses the random forest and fern to detect the target in the infrared video. The random forest and fern is a random combination of 2bit Binary Pattern, which is robust to infrared targets with blurred and unknown contours. The tracker uses the gray-value weighted mean-Shift algorithm to track the infrared target which is always brighter than the background. And the tracker can track the deformed target efficiently and quickly. When the target disappears, the detector will redetect the target in the coming infrared image. Finally, we verify the algorithm on the real-time infrared target detection and tracking platform. The result shows that our algorithm performs better than TLD in terms of recall and runtime in infrared video.

  5. Fluid mechanics aspects of magnetic drug targeting.

    Science.gov (United States)

    Odenbach, Stefan

    2015-10-01

    Experiments and numerical simulations using a flow phantom for magnetic drug targeting have been undertaken. The flow phantom is a half y-branched tube configuration where the main tube represents an artery from which a tumour-supplying artery, which is simulated by the side branch of the flow phantom, branches off. In the experiments a quantification of the amount of magnetic particles targeted towards the branch by a magnetic field applied via a permanent magnet is achieved by impedance measurement using sensor coils. Measuring the targeting efficiency, i.e. the relative amount of particles targeted to the side branch, for different field configurations one obtains targeting maps which combine the targeting efficiency with the magnetic force densities in characteristic points in the flow phantom. It could be shown that targeting efficiency depends strongly on the magnetic field configuration. A corresponding numerical model has been set up, which allows the simulation of targeting efficiency for variable field configuration. With this simulation good agreement of targeting efficiency with experimental data has been found. Thus, the basis has been laid for future calculations of optimal field configurations in clinical applications of magnetic drug targeting. Moreover, the numerical model allows the variation of additional parameters of the drug targeting process and thus an estimation of the influence, e.g. of the fluid properties on the targeting efficiency. Corresponding calculations have shown that the non-Newtonian behaviour of the fluid will significantly influence the targeting process, an aspect which has to be taken into account, especially recalling the fact that the viscosity of magnetic suspensions depends strongly on the magnetic field strength and the mechanical load.

  6. EFFICACY OF COMBINED ANTIHYPERTENSIVE THERAPY IN ACHIEVEMENT OF TARGET BLOOD PRESSURE IN DIABETIC PATIENTS

    Directory of Open Access Journals (Sweden)

    O. A. Koshel'skaya

    2015-12-01

    Full Text Available Aim. To evaluate the efficacy of long-term combined antihypertensive therapy (AHT based on renin-angiotensin-aldosterone system (RAAS blockers, indapamide and calcium channel blocker (CCB in hypertensive patients with diabetes mellitus (DM in accordance with target blood pressure (BP <130/80 mm Hg achievement rate, dynamics of 24-hour BP profile, metabolic indices, and local stiffness of the main arteries. Besides, to study the effects of the CCB addition to dual therapy on these parameters. Material and methods. Patients (16 men, 31 women, 57.2±6.6 years old with arterial hypertension degrees 1–3 and mild to moderate DM type 2 were included into the study. The patients were treated with perindopril (5–10 mg/day or valsartan (80–160 mg/day in combination with indapamide SR (1.5 mg/day and amlodipine (5–10 mg/day. Examination included office BP measurement and ambulatory BP monitoring (ABPM, common carotid arteries sonarography , evaluation of serum levels of potassium, creatinine, uric acid, glucose metabolism and lipid profile parameters, calculation of insulin resistance index (HOMA at baseline and after 30–32 weeks of treatment. Results. Target BP was achieved in 86.7% of patients. Evenly reduction of day and night BP without reflex tachycardia and hypotension episodes was observed. Office BP decreased from 149.5±12.0/90.0±8.3 to 125.0±7.6/76.8±4.9 mm Hg (p<0.05 and average daily BP (ABPM decreased to 120.1±10.0/71.7±6.9 mmHg. Three drugs were needed to achieve target BP in baseline systolic BP >150 mm Hg (office or >134 mmHg (ABPM. Marked beneficial effect on the morphological and functional characteristics of the vascular wall and its elastic properties, improvement of glycemic control, tissue insulin sensitivity and lipids profile were found. These effects were associated mainly with amlodipine inclusion into the therapy. Conclusion. The combined AHT based on RAAS blockers, indapamide SR and CCB provides achievement of

  7. EFFICACY OF COMBINED ANTIHYPERTENSIVE THERAPY IN ACHIEVEMENT OF TARGET BLOOD PRESSURE IN DIABETIC PATIENTS

    Directory of Open Access Journals (Sweden)

    O. A. Koshel'skaya

    2012-01-01

    Full Text Available Aim. To evaluate the efficacy of long-term combined antihypertensive therapy (AHT based on renin-angiotensin-aldosterone system (RAAS blockers, indapamide and calcium channel blocker (CCB in hypertensive patients with diabetes mellitus (DM in accordance with target blood pressure (BP <130/80 mm Hg achievement rate, dynamics of 24-hour BP profile, metabolic indices, and local stiffness of the main arteries. Besides, to study the effects of the CCB addition to dual therapy on these parameters. Material and methods. Patients (16 men, 31 women, 57.2±6.6 years old with arterial hypertension degrees 1–3 and mild to moderate DM type 2 were included into the study. The patients were treated with perindopril (5–10 mg/day or valsartan (80–160 mg/day in combination with indapamide SR (1.5 mg/day and amlodipine (5–10 mg/day. Examination included office BP measurement and ambulatory BP monitoring (ABPM, common carotid arteries sonarography , evaluation of serum levels of potassium, creatinine, uric acid, glucose metabolism and lipid profile parameters, calculation of insulin resistance index (HOMA at baseline and after 30–32 weeks of treatment. Results. Target BP was achieved in 86.7% of patients. Evenly reduction of day and night BP without reflex tachycardia and hypotension episodes was observed. Office BP decreased from 149.5±12.0/90.0±8.3 to 125.0±7.6/76.8±4.9 mm Hg (p<0.05 and average daily BP (ABPM decreased to 120.1±10.0/71.7±6.9 mmHg. Three drugs were needed to achieve target BP in baseline systolic BP >150 mm Hg (office or >134 mmHg (ABPM. Marked beneficial effect on the morphological and functional characteristics of the vascular wall and its elastic properties, improvement of glycemic control, tissue insulin sensitivity and lipids profile were found. These effects were associated mainly with amlodipine inclusion into the therapy. Conclusion. The combined AHT based on RAAS blockers, indapamide SR and CCB provides achievement of

  8. Resistance to Antibiotics Mediated by Target Alterations

    Science.gov (United States)

    Spratt, Brian G.

    1994-04-01

    The development of resistance to antibiotics by reductions in the affinities of their enzymatic targets occurs most rapidly for antibiotics that inactivate a single target and that are not analogs of substrate. In these cases of resistance (for example, resistance to rifampicin), numerous single amino acid substitutions may provide large decreases in the affinity of the target for the antibiotic, leading to clinically significant levels of resistance. Resistance due to target alterations should occur much more slowly for those antibiotics (penicillin, for example) that inactivate multiple targets irreversibly by acting as close analogs of substrate. Resistance to penicillin because of target changes has emerged, by unexpected mechanisms, only in a limited number of species. However, inactivating enzymes commonly provide resistance to antibiotics that, like penicillin, are derived from natural products, although such enzymes have not been found for synthetic antibiotics. Thus, the ideal antibiotic would be produced by rational design, rather than by the modification of a natural product.

  9. High power target developments at ISAC

    CERN Document Server

    Bricault, P G; Dowling, A; Lane, M

    2003-01-01

    TRIUMF, Canada's national research facility for particle and nuclear physics is currently operating the ISAC facility. A high-energy proton beam from the H sup - TRIUMF cyclotron is used to generate short-lived radioactive species in a thick target. An ion source at the target creates a radioactive beam, which is then injected into the ISAC beam lines and accelerator system. The ISAC facility is designed to accept proton beam intensity up to 100 mu A at 500 MeV. At present our target design can only sustains 40 mu A at maximum. Beyond this point the target has to be cooled. A new target equipped with fins has been developed that may sustain proton beam up to 100 mu A. The fined target has been tested off-line and a thermal simulation using ANSYS[reg] has been conducted and the results are reported here.

  10. Neutronic characterization of the MEGAPIE target

    Energy Technology Data Exchange (ETDEWEB)

    Panebianco, Stefano; David, Jean-Christophe; Leray, Sylvie; Letourneau, Alain; Michel-Sendis, Franco; Stankunas, Gediminas [CEA/IRFU, Gif-sur-Yvette (France); Berg, Klara; Filges, Uwe; Groeschel, Friedrich; Luethy, Markus; Scazzi, Selene; Tobler, Leonhard; Zanini, Luca [PSI, Villigen (Switzerland); Eid, Mohamed [CEA/DEN/DM2S/SERMA, Gif-sur-Yvette (France); Guertin, Arnaud; Thiolliere, Nicolas [SUBATECH, Nantes (France); Konobeyev, Alexander Yu. [FZK/IRS, Karlsruhe (Germany); Latge, Christian [CEA/DEN/DTN/DIR, St. Paul Lez Durance (France); Lemaire, Sebastien [CEA/DAM/DCSA/SCGA, Bruyeres-le-Chatel (France)

    2008-07-01

    The MEGAPIE project aimed to design, build and operate a liquid metal spallation neutron target of 1 MW beam power in the SINQ facility at the Paul Scherrer Institut (Villigen, Switzerland). The project is an important step in the road-map towards the demonstration of the Accelerator Driven System (ADS) concept and high power liquid metal targets in general. Following the design phase, an experimental program was defined to provide a complete characterization of the facility by performing a 'mapping' of the neutron flux at different points, from the center of the target to the beam lines. The neutronic performance of the target was studied using different experimental techniques with the goals of validating the Monte Carlo codes used in the design of the target; additionally, the performance was compared with the solid lead targets used before and after the MEGAPIE experiment. (authors)

  11. Neutronic characterization of the MEGAPIE target

    Energy Technology Data Exchange (ETDEWEB)

    Panebianco, Stefano [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France)], E-mail: Stefano.panebianco@cea.fr; Berg, Klara [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); David, Jean-Christophe [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Eid, Mohamed [CEA/DEN/DM2S/SERMA, Centre de Saclay, F-91194 Gif-sur-Yvette (France); Filges, Uwe; Groeschel, Friedrich [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Guertin, Arnaud [SUBATECH, Ecole des Mines, F-44307 Nantes (France); Konobeyev, Alexander Yu [Forschungszentrum Karlsruhe, IRS, D-76021 Karlsruhe (Germany); Latge, Christian [CEA/DEN/DTN/DIR, Centre de Cadarache, F-13108 Saint-Paul-lez-Durance (France); Lemaire, Sebastien [CEA, DAM Ile de France, F-91297 Bruyeres le Chatel (France); Leray, Sylvie; Letourneau, Alain [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Luethy, Markus [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Michel-Sendis, Franco [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Scazzi, Selene [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Stankunas, Gediminas [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Thiolliere, Nicolas [SUBATECH, Ecole des Mines, F-44307 Nantes (France); Tobler, Leonhard; Zanini, Luca [Paul Scherrer Institut, CH-5232 Villigen (Switzerland)

    2009-04-15

    The MEGAPIE project aimed to design, build and operate a liquid metal spallation neutron target of about 1 MW beam power in the SINQ facility at the Paul Scherrer Institut (Villigen, Switzerland). This project is an important step in the roadmap towards the demonstration of the accelerator driven system (ADS) concept and high power liquid metal targets in general. Following the design phase, an experimental program was defined to provide a complete characterization of the facility by performing a 'mapping' of the neutron flux at different points, from the center of the target to the beam lines. The neutronic performance of the target was studied using different experimental techniques with the goals of validating the Monte Carlo codes used in the design of the target; additionally, the performance was compared with the solid lead targets used before and after the MEGAPIE experiment.

  12. Polarized targets in high energy physics

    Energy Technology Data Exchange (ETDEWEB)

    Cates, G.D. Jr. [Princeton Univ., NJ (United States)

    1994-12-01

    Various approaches are discussed for producing polarized nuclear targets for high energy physics experiments. As a unifying theme, examples are drawn from experiments to measure spin dependent structure functions of nucleons in deep inelastic scattering. This single physics goal has, over roughly two decades, been a driving force in advances in target technology. Actual or planned approaches have included solid targets polarized by dynamic nuclear polarization (DNP), several types of internal targets for use in storage rings, and gaseous {sup 3}He targets polarized by spin-exchange optical pumping. This last approach is the type of target adopted for SLAC E-142, an experiment to measure the spin structure function of the neutron, and is described in detail.

  13. THERMAL OSCILLATIONS IN LIQUID HELIUM TARGETS.

    Energy Technology Data Exchange (ETDEWEB)

    WANG,L.; JIA,L.X.

    2001-07-16

    A liquid helium target for the high-energy physics was built and installed in the proton beam line at the Alternate Gradient Synchrotron of Brookhaven National Laboratory in 2001. The target flask has a liquid volume of 8.25 liters and is made of thin Mylar film. A G-M/J-T cryocooler of five-watts at 4.2K was used to produce liquid helium and refrigerate the target. A thermosyphon circuit for the target was connected to the J-T circuit by a liquid/gas separator. Because of the large heat load to the target and its long transfer lines, thermal oscillations were observed during the system tests. To eliminate the oscillation, a series of tests and analyses were carried out. This paper describes the phenomena and provides the understanding of the thermal oscillations in the target system.

  14. Protection Related to High-power Targets

    CERN Document Server

    Plum, M.A.

    2016-01-01

    Target protection is an important part of machine protection. The beam power in high-intensity accelerators is high enough that a single wayward pulse can cause serious damage. Today's high-power targets operate at the limit of available technology, and are designed for a very narrow range of beam parameters. If the beam pulse is too far off centre, or if the beam size is not correct, or if the beam density is too high, the target can be seriously damaged. We will start with a brief introduction to high-power targets and then move to a discussion of what can go wrong, and what are the risks. Next we will discuss how to control the beam-related risk, followed by examples from a few different accelerator facilities. We will finish with a detailed example of the Oak Ridge Spallation Neutron Source target tune up and target protection.

  15. Visualizing Energy on Target: Molecular Dynamics Simulations

    Science.gov (United States)

    2017-12-01

    ARL-TR-8234 ● DEC 2017 US Army Research Laboratory Visualizing Energy on Target: Molecular Dynamics Simulations by DeCarlos E...return it to the originator. ARL-TR-8234● DEC 2017 US Army Research Laboratory Visualizing Energy on Target: Molecular Dynamics...REPORT TYPE Technical Report 3. DATES COVERED (From - To) 1 October 2015–30 September 2016 4. TITLE AND SUBTITLE Visualizing Energy on Target

  16. ENTERPRISE RESOURCE STRATEGIC PLANNING: TARGET CHOICE TECHNIQUES

    Directory of Open Access Journals (Sweden)

    A. S. Lankin

    2011-01-01

    Full Text Available Choice of the targets is one of most important elements of the resource planning system. Particular feature of the strategic planning is development of future alternatives for the enterprise. Main resource strategic planning cycle elements: examination of principal external and internal environment components; forming the company mission; development of long-term targets; concretization of the long-term targets through short-term aims; examination of strategies and final choice.

  17. Targeting Malignant Brain Tumors with Antibodies

    OpenAIRE

    Rok Razpotnik; Neža Novak; Vladka Čurin Šerbec; Uros Rajcevic

    2017-01-01

    Antibodies have been shown to be a potent therapeutic tool. However, their use for targeting brain diseases, including neurodegenerative diseases and brain cancers, has been limited, particularly because the blood–brain barrier (BBB) makes brain tissue hard to access by conventional antibody-targeting strategies. In this review, we summarize new antibody therapeutic approaches to target brain tumors, especially malignant gliomas, as well as their potential drawbacks. Many different brain deli...

  18. Bioinformatics for cancer immunotherapy target discovery

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Campos, Benito; Barnkob, Mike Stein

    2014-01-01

    therapy target discovery in a bioinformatics analysis pipeline. We describe specialized bioinformatics tools and databases for three main bottlenecks in immunotherapy target discovery: the cataloging of potentially antigenic proteins, the identification of potential HLA binders, and the selection epitopes...... and co-targets for single-epitope and multi-epitope strategies. We provide examples of application to the well-known tumor antigen HER2 and suggest bioinformatics methods to ameliorate therapy resistance and ensure efficient and lasting control of tumors....

  19. Promoting target models by potential measures

    OpenAIRE

    Dubiel, Joerg

    2010-01-01

    Direct marketers use target models in order to minimize the spreading loss of sales efforts. The application of target models has become more widespread with the increasing range of sales efforts. Target models are relevant for offline marketers sending printed mails as well as for online marketers who have to avoid intensity. However business has retained its evaluation since the late 1960s. Marketing decision-makers still prefer managerial performance measures of the economic benefit of a t...

  20. Design of the LBNF Beamline Target Station

    OpenAIRE

    Tariq, S.; Ammigan, K.; Anderson, K.; Buccellato, S. A.; Crowley, C. F.; Hartsell, B. D.; Hurh, P.; Hylen, J.; Kasper, P.; Krafczyk, G. E.; Lee, A.; Lundberg, B.; Marchionni, A; Mokhov, N. V.; Moore, C. D.

    2016-01-01

    The Long Baseline Neutrino Facility (LBNF) project will build a beamline located at Fermilab to create and aim an intense neutrino beam of appropriate energy range toward the DUNE detectors at the SURF facility in Lead, South Dakota. Neutrino production starts in the Target Station, which consists of a solid target, magnetic focusing horns, and the associated sub-systems and shielding infrastructure. Protons hit the target producing mesons which are then focused by the horns into a helium-fil...