WorldWideScience

Sample records for samarium 131

  1. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  2. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  3. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  4. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  5. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  6. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  7. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  8. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  9. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  10. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  11. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  13. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  14. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  15. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  16. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  17. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  18. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  19. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  20. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  1. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  2. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  3. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  5. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  6. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  7. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  9. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  10. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  11. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  12. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  13. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  14. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  15. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  16. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  17. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  18. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  19. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  20. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  1. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  2. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  3. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  4. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  5. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  6. 40 CFR 131.11 - Criteria.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Criteria. 131.11 Section 131.11... Establishment of Water Quality Standards § 131.11 Criteria. (a) Inclusion of pollutants: (1) States must adopt those water quality criteria that protect the designated use. Such criteria must be based on sound...

  7. 46 CFR 131.720 - Use.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use. 131.720 Section 131.720 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Work Vests § 131.720 Use. (a) An approved buoyant work vest is an item of safety apparel and may be carried aboard for wear by a...

  8. 46 CFR 131.840 - Emergency lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting. 131.840 Section 131.840 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.840 Emergency lighting. Emergency lighting must be marked...

  9. 46 CFR 131.970 - Unauthorized lighting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Unauthorized lighting. 131.970 Section 131.970 Shipping... Miscellaneous § 131.970 Unauthorized lighting. No master of a vessel may authorize or permit the vessel's carrying of any lighting not required by law that will interfere in any way with any other vessel's ability...

  10. 46 CFR 502.131 - Requests; issuance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 9 2010-10-01 2010-10-01 false Requests; issuance. 502.131 Section 502.131 Shipping... § 502.131 Requests; issuance. Subpenas for the attendance of witnesses or the production of evidence shall be issued upon request of any party, without notice to any other party. Requests for subpenas for...

  11. 40 CFR 131.40 - Puerto Rico

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Puerto Rico 131.40 Section 131.40... Federally Promulgated Water Quality Standards § 131.40 Puerto Rico (a) Use designations for marine waters. In addition to the Commonwealth's adopted use designations, the following waterbodies in Puerto Rico...

  12. 46 CFR 131.899 - Fire dampers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire dampers. 131.899 Section 131.899 Shipping COAST... Equipment and Emergency Equipment § 131.899 Fire dampers. Each fire damper installed within the boundary of... whether the damper is open or closed and must be marked with red letters at least 13 millimeters (1/2-inch...

  13. 49 CFR 237.131 - Design.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Design. 237.131 Section 237.131 Transportation... TRANSPORTATION BRIDGE SAFETY STANDARDS Repair and Modification of Bridges § 237.131 Design. Each repair or... component of a bridge shall be designed by a railroad bridge engineer. The design shall specify the manner...

  14. 21 CFR 131.155 - Light cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light cream. 131.155 Section 131.155 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.155 Light cream. (a) Description. Light cream is cream which contains not less than 18 percent but less than 30 percent milkfat. It...

  15. 21 CFR 131.149 - Dry cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dry cream. 131.149 Section 131.149 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.149 Dry cream. (a) Description. Dry cream is the product obtained by removal of water only from pasteurized milk or cream or a...

  16. 21 CFR 131.150 - Heavy cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Heavy cream. 131.150 Section 131.150 Food and... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.150 Heavy cream. (a) Description. Heavy cream is cream which contains not less than 36 percent milkfat. It is pasteurized or ultra...

  17. 21 CFR 131.160 - Sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sour cream. 131.160 Section 131.160 Food and Drugs... CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.160 Sour cream. (a) Description. Sour cream results from the souring, by lactic acid producing bacteria, of pasteurized cream...

  18. 9 CFR 3.131 - Sanitation.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Sanitation. 3.131 Section 3.131... Mammals Animal Health and Husbandry Standards § 3.131 Sanitation. (a) Cleaning of enclosures. Excreta... being directly sprayed with the stream of water or wetted involuntarily. (b) Sanitation of enclosures...

  19. 19 CFR 191.131 - Drawback allowance.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Drawback allowance. 191.131 Section 191.131 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Foreign Ownership and Account § 191.131 Drawback allowance. Section 313(g) of the Act, as amended (19 U.S...

  20. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  1. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  2. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  3. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  4. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  5. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  6. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  7. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  8. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  9. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  10. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  11. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  12. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  13. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  14. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  15. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. 40 CFR 131.31 - Arizona.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Arizona. 131.31 Section 131.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS..., 3033 North Central Ave., Phoenix, AZ 85012): COLORADO MAIN STEM RIVER BASIN: Hualapai Wash MIDDLE GILA...

  17. 7 CFR 4279.131 - Credit quality.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Credit quality. 4279.131 Section 4279.131 Agriculture... Credit quality. The lender is primarily responsible for determining credit quality and must address all of the elements of credit quality in a written credit analysis including adequacy of equity, cash...

  18. Quality control of iodine-131-labeled metaiodobenzylguanidine.

    Science.gov (United States)

    Taşdelen, Betül; Kam, Erol; Asliyuksek, Hızır

    2014-01-01

    Iodine-131-m-iodobenzylguanidine ([(131)I]mIBG) is used worldwide for the diagnosis and therapy of neuroendocrine tumors, particularly adrenal medullae tumors. After the synthesis and preparation of a radioiodinated MIBG drug formulation, quality control testing to determine its radiochemical purity (RCP) should be performed. European Pharmacopoeia 8.0 requires that the quality control include a test for RCP for the determination of [(131)I]mIBG. Previously reported procedures using reversed-phase conditions require long retention times. Our system enables the separation of [(131)I]mIBG within a few minutes. The aim of this work was to carry out RCP testing for [(131)I]mIBG without any type of sample pretreatment. RCP testing for ([(131)I]mIBG has been carried out using high-performance liquid chromatography and thin-layer chromatography methods. A simple and rapid reversed-phase isocratic system enables the HPLC investigation of RCP testing for [(131)I]mIBG used for therapy within a few minutes. From the point of view of radiation protection, this method is safer, especially for therapeutic amounts of [(131)I]mIBG.

  19. 40 CFR 417.131 - Specialized definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.131 Section 417.131 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Chlorosulfonic Acid Sulfation...

  20. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  1. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  2. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  3. Tositumomab and Iodine I 131 Tositumomab

    Science.gov (United States)

    This page contains brief information about tositumomab and iodine I 131 tositumomab and a collection of links to more information about the use of this drug combination, research results, and ongoing clinical trials.

  4. 28 CFR 13.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... Administration DEPARTMENT OF JUSTICE ATOMIC WEAPONS AND SPECIAL NUCLEAR MATERIALS REWARDS REGULATIONS § 13.1 Purpose. This part implements the responsibility given to the Attorney General under the Atomic Weapons... weapons and special nuclear material. ...

  5. Dicty_cDB: SLF131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF131 (Link to dictyBase) - G22459 DDB0231642 Contig-U09191-1 SLF1...31P (Link to Original site) SLF131F 321 SLF131Z 552 SLF131P 873 - - Show SLF131 Library SL (Link to library) Clone ID SLF1...ontig-U09191-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-B/SLF1...31Q.Seq.d/ Representative seq. ID SLF131P (Link to Original site) Representative DNA sequence >SLF131 (SLF131Q) /CSM/SL/SLF1...-B/SLF131Q.Seq.d/ GATTTTTGTGATTTGTTAAATAAAGCTGTGATGTTTTACAAAGTCCAACGTGCAGGTCGT TTACCAGA

  6. Dicty_cDB: CHR131 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR131 (Link to dictyBase) - - - Contig-U16471-1 - (Link to Original site) - - CHR...131Z 757 - - - - Show CHR131 Library CH (Link to library) Clone ID CHR131 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHR1-B/CHR131Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ XXXXXXXXXXTGAAAAT...A/SFC806Q.Seq.d/ 944 0.0 CHR131 (CHR131Q) /CSM/CH/CHR1-B/CHR131Q.Seq.d/ 944 0.0 CHQ337 (CHQ337Q) /CSM/CH/CHQ

  7. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  8. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  9. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  10. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  11. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  12. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  13. 14 CFR 151.131 - Forms.

    Science.gov (United States)

    2010-01-01

    ...- ance to be executed by the sponsor and certified by its attorney. (b) Advance planning agreement, FAA... AID TO AIRPORTS Rules and Procedures for Advance Planning and Engineering Proposals § 151.131 Forms. The forms used for the purpose of obtaining an advance planning and engineering grant are as follows...

  14. 21 CFR 131.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION MILK AND CREAM General Provisions § 131.3 Definitions. (a) Cream means the liquid milk product high in fat separated from milk, which may have been adjusted by adding thereto: Milk, concentrated...

  15. Cytogenetic study on {sup 131} Iodine effects

    Energy Technology Data Exchange (ETDEWEB)

    Rodrigues, Claudia Lopes; Mello, Rossana Corbo; Gutfilen, Bianca [Hospital Universitario Clementino Fraga Filho, Rio de Janeiro, RJ (Brazil). Dept. de Radiologia; Aranha, Ivar Pinheiro [Universidade do Estado, Rio de Janeiro, RJ (Brazil). Dept. de Biologia Celular e Genetica

    2001-07-01

    There are no conclusive results, to these days, on the effect of {sup 131} I dosage used in scintigraphy on thyroid patients. The aim of this study was to evaluate the effect of that dosage on human lymphocyte chromosomes. Cells from 21 patients were placed in 1640 RPMI medium with bovine calf serum and incubated for 48 and 72 h at 37 deg C. Blood was collected 24 hours after administration of the radioisotope. Blood collected from the same patients prior to the administration of {sup 131} I was used as control. Chromosomes were stained with Giemsa Gurr 2% pH=6.8 and analyzed under optical microscope. Of the 6,300 metaphases analyzed from the 48 h cultures, 1,146 gaps and 682 breaks were found, in the test group. Of the 6,300 analyzed from the control group, 291 gaps and 119 breaks were observed. In the 72 h cultures, of 6,300 metaphases analyzed, 216 gaps and 52 breaks were found in the test group. Of 6,300 metaphases analyzed from the control group, 10 gaps and no breaks were found. These results were significant in a paired t-test (p < 0,05). Our results show that {sup 131} I is responsible for the observed chromosome alterations. We suggest re-evaluating the use of {sup 131} I, mainly on those patients at fertile age. (author)

  16. 14 CFR 13.131 - Other procedures.

    Science.gov (United States)

    2010-01-01

    ... Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PROCEDURAL RULES INVESTIGATIVE AND ENFORCEMENT PROCEDURES Formal Fact-Finding Investigation Under an Order of Investigation § 13.131 Other procedures. Any question concerning the scope or conduct of a formal investigation not...

  17. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  18. Aplicaciones clínicas del radioyodo 131 (I131 en las enfermedades del tiroides Clinical applications of radioiodine 131 (I131 in the thyroid diseases

    Directory of Open Access Journals (Sweden)

    Levi González Rivero

    2012-12-01

    Full Text Available El radioyodo 131 es un isótopo radioactivo que se emplea exitosamente en el diagnóstico y tratamiento de las enfermedades benignas y malignas del tiroides. Su propiedad de integrarse selectivamente al metabolismo del tiroides y emitir una señal, le permite describir el funcionamiento glandular mediante estudios de captación, y delimitar la morfología y localización de los tejidos que capten yodo, a través de la gammagrafía. Es además una radioterapia sencilla, segura y coste-efectiva, usada como primera línea terapéutica en el control del hipertiroidismo, cuya dosis y momento de aplicación debería individualizarse según la etiología y la clínica de cada paciente. El radioyodo 131 ofrece una alternativa eficaz para reducir el tamaño del bocio no tóxico; además, respalda el tratamiento quirúrgico del carcinoma diferenciado del tiroides, y destruye a dosis ablativa los restos tisulares y las lesiones metastásicas que puede identificar durante el seguimiento gammagráfico. El empleo de radioyodo 131 está sujeto al cumplimiento de regulaciones de protección contra la radioactividad.Radioiodine 131 is a radioactive isotope that is successfully used for the diagnosis and the treatment of benign and malignant thyroid diseases. Its quality of selectively integrating to the thyroid metabolism and emitting a signal allows it to describe the gland functioning through capture studies, and to delimit the morphology and location of the tissues that capture iodine by means of gammagraphy. It is also a simple, safe and cost-effective radiotherapy used as first-line therapeutics in the control of hyperthyroidism. The dose and right time of application should be individualized according to the etiology and the clinic of each patient. Radioiodine 131 offers an efficient alternative to reduce the size of non-toxic goiter in addition to supporting the surgical treatment of the differentiated thyroid carcinoma and destroying with ablative doses

  19. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  20. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  1. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  2. 27 CFR 19.131 - Restrictions as to locations.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Restrictions as to locations. 19.131 Section 19.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTILLED SPIRITS PLANTS Location and Use § 19.131...

  3. 19 CFR 181.131 - Rules of origin.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Rules of origin. 181.131 Section 181.131 Customs... (CONTINUED) NORTH AMERICAN FREE TRADE AGREEMENT Rules of Origin § 181.131 Rules of origin. (a) The regulations effective October 1, 1995, implementing the rules of origin provisions of General Note 12, HTSUS...

  4. 46 CFR 131.525 - Emergency lighting and power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Emergency lighting and power. 131.525 Section 131.525..., Drills, and Inspections § 131.525 Emergency lighting and power. (a) The master of each vessel shall ensure that the emergency lighting and power systems are tested at least once each week that the vessel...

  5. 46 CFR 131.935 - Prevention of oil pollution.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Prevention of oil pollution. 131.935 Section 131.935... Miscellaneous § 131.935 Prevention of oil pollution. Each vessel must be operated in compliance with— (a) Section 311 of the Federal Water Pollution Control Act, as amended (33 U.S.C. 1321); and (b) 33 CFR parts...

  6. 9 CFR 2.131 - Handling of animals.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling of animals. 2.131 Section 2.131 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE REGULATIONS Miscellaneous § 2.131 Handling of animals. (a) All licensees who maintain wild...

  7. 12 CFR 225.131 - Activities closely related to banking.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Activities closely related to banking. 225.131 Section 225.131 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL... Holding Companies Interpretations § 225.131 Activities closely related to banking. (a) Bank management...

  8. Merkel cell carcinoma and iodine-131 metaiodobenzylguanidine scan

    Energy Technology Data Exchange (ETDEWEB)

    Castagnoli, A.; Biti, G.; De Cristofaro, M.T.R.; Papi, M.G. (Florence Univ. (Italy). Dipt. di Fisiopatologia); Ferri, P. (Florence Univ. (Italy). U.O. Medicina Nuclear USL 10D); Magrini, S.M. (Florence Univ. (Italy). U.O. Radioterapia USL 10D); Bianchi, S. (Florence Univ. (Italy). Ist. di Anatomia Patologica)

    1992-10-01

    Two cases of Merkel cell carcinoma, a neuroendocrine neoplasia of the skin, investigated with iodine, 131 metaiodobenzylguanidine ({sup 131}I-mIBG) scintigraphy, are reported. Uptake in the tumor was evident only in 1 case. The possible diagnostic and therapeutic role of {sup 131}I-mIBG in patients with this rare neoplasm is discussed. (orig.).

  9. 46 CFR 131.965 - Sounding of whistle.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Sounding of whistle. 131.965 Section 131.965 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.965 Sounding of whistle. No vessel may sound its whistle within any harbor limits of the...

  10. 46 CFR 131.555 - Spare parts and repair equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Spare parts and repair equipment. 131.555 Section 131... OPERATIONS Tests, Drills, and Inspections § 131.555 Spare parts and repair equipment. Spare parts and repair... wear or consumption or needs to be replaced regularly. These parts and equipment must be kept aboard...

  11. 46 CFR 131.960 - Use of auto-pilot.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Use of auto-pilot. 131.960 Section 131.960 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.960 Use of auto-pilot. When the automatic pilot is used in areas of high traffic density...

  12. 46 CFR 131.805 - General alarm bell, switch.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false General alarm bell, switch. 131.805 Section 131.805 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.805 General alarm bell, switch. The switch in the...

  13. 21 CFR 131.162 - Acidified sour cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Acidified sour cream. 131.162 Section 131.162 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.162 Acidified sour cream. (a) Description. Acidified sour cream results from the souring of pasteurized cream...

  14. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent but...

  15. 46 CFR 131.940 - Marine sanitation device.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Marine sanitation device. 131.940 Section 131.940... Miscellaneous § 131.940 Marine sanitation device. Each vessel with installed toilet facilities must have a marine sanitation device in compliance with 33 CFR part 159. ...

  16. 46 CFR 131.835 - Portable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Portable fire extinguishers. 131.835 Section 131.835... Markings for Fire Equipment and Emergency Equipment § 131.835 Portable fire extinguishers. (a) Except as provided by paragraph (b) of this section, ach portable fire extinguisher must be marked with a number, and...

  17. 27 CFR 70.131 - Conditions to allowance.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Conditions to allowance. 70.131 Section 70.131 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Excise and Special (Occupational) Tax Rule of Special Application § 70.131 Conditions to allowance. (a...

  18. 46 CFR 131.945 - Display of plans.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of plans. 131.945 Section 131.945 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS OPERATIONS Miscellaneous § 131.945 Display of plans. Each vessel must have a permanently exhibited, for the guidance of the...

  19. Methodology to administer therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment of the thyroid cancer with Iodine-131, as well as the use of citric fruits to stimulate the salivation, the post-dose administration of liquids to accelerate the gastric emptying avoiding the secondary effects as the vomit is included. (Author)

  20. Volatility of radiopharmacy-prepared sodium iodide-131 capsules.

    Science.gov (United States)

    Bright, J M; Rees, T T; Baca, L E; Green, R L

    2000-03-01

    The aims of this study were to quantify the extent of volatilization from 131I-NaI therapeutic capsules prepared in a centralized radiopharmacy and to quantify the amount of volatile 131I released from a dispensing vial containing a compounded 131I-NaI therapy capsule. Therapy capsules were prepared by injecting 131I oral solution into capsules containing anhydrous dibasic sodium phosphate. Volatilized activity was obtained by filtering air drawn across samples that were placed open on the bottom of a sample holder cup. Volatile 131I was captured by filtering it through 3 triethylenediamine-impregnated carbon cartridge filters, arranged in series. To quantify the amount of volatile 131I released from a dispensing vial during a simulated patient administration, a vial containing a compounded 131I therapy capsule was opened inside a collapsible plastic bag and all the air was drawn across TEDA-impregnated carbon cartridge filters. The 370-MBq (10-mCi) 131I capsules from the first part of the experiment released an average of 0.035% (SD 0.031%) of the capsule activity on the first day, 0.012% (SD 0.002%) on the second day, and 0.012% (SD < 0.001%) for days 3 through 5. The 37-MBq (1-mCi) 131I capsules released an average of 0.058% (SD 0.025%) on the first day, 0.029% (SD 0.009%) on the second day, and 0.020% (SD 0.004%) on the third day. The activity released from the vial during a simulated patient administration was 0.00093% of the 131I capsule activity. The amount of 131I, which volatilized daily from the exposed therapy capsules, was a small percentage of the capsule activity. The volatile 131I that would be released during a patient administration was much less than the activity that volatilized from the exposed therapy capsules.

  1. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  2. Escherichia coli ST131, an intriguing clonal group.

    Science.gov (United States)

    Nicolas-Chanoine, Marie-Hélène; Bertrand, Xavier; Madec, Jean-Yves

    2014-07-01

    In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Escherichia coli ST131, an Intriguing Clonal Group

    Science.gov (United States)

    Bertrand, Xavier; Madec, Jean-Yves

    2014-01-01

    SUMMARY In 2008, a previously unknown Escherichia coli clonal group, sequence type 131 (ST131), was identified on three continents. Today, ST131 is the predominant E. coli lineage among extraintestinal pathogenic E. coli (ExPEC) isolates worldwide. Retrospective studies have suggested that it may originally have risen to prominence as early as 2003. Unlike other classical group B2 ExPEC isolates, ST131 isolates are commonly reported to produce extended-spectrum β-lactamases, such as CTX-M-15, and almost all are resistant to fluoroquinolones. Moreover, ST131 E. coli isolates are considered to be truly pathogenic, due to the spectrum of infections they cause in both community and hospital settings and the large number of virulence-associated genes they contain. ST131 isolates therefore seem to contradict the widely held view that high levels of antimicrobial resistance are necessarily associated with a fitness cost leading to a decrease in pathogenesis. Six years after the first description of E. coli ST131, this review outlines the principal traits of ST131 clonal group isolates, based on the growing body of published data, and highlights what is currently known and what we need to find out to provide public health authorities with better information to help combat ST131. PMID:24982321

  4. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  5. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  6. Renal 131I-hippuran extraction in man

    DEFF Research Database (Denmark)

    Hutchings, M; Hesse, B; Grønvall, J

    2002-01-01

    This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine.......This study examined the 131I-hippuran extraction fraction during baseline renal blood flow rates and at high flow rates induced by dopamine....

  7. 29 CFR 452.131 - Casting of ballots; delegate elections.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Casting of ballots; delegate elections. 452.131 Section 452... REPORTING AND DISCLOSURE ACT OF 1959 Election Procedures; Rights of Members § 452.131 Casting of ballots; delegate elections. The manner in which the votes of the representatives are cast in the convention is not...

  8. 46 CFR 131.320 - Safety orientation for offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Safety orientation for offshore workers. 131.320 Section... OPERATIONS Preparations for Emergencies § 131.320 Safety orientation for offshore workers. (a) Before a... informing each offshore worker of— (1) In general terms, emergency and evacuation procedures; (2) Locations...

  9. 28 CFR 35.131 - Illegal use of drugs.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Illegal use of drugs. 35.131 Section 35... STATE AND LOCAL GOVERNMENT SERVICES General Requirements § 35.131 Illegal use of drugs. (a) General. (1... an individual based on that individual's current illegal use of drugs. (2) A public entity shall not...

  10. 21 CFR 155.131 - Canned field corn.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned field corn. 155.131 Section 155.131 Food... Canned field corn. (a) Identity. (1) Canned field corn conforms to the definition and standard of... corn by § 155.130(a), except that the corn ingredient consists of succulent field corn or a mixture of...

  11. 41 CFR 105-71.131 - Real property.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Real property. 105-71.131 Section 105-71.131 Public Contracts and Property Management Federal Property Management... any actual and reasonable selling and fixing-up expenses. If the grant is still active, the net...

  12. 10 CFR 71.131 - Nonconforming materials, parts, or components.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Nonconforming materials, parts, or components. 71.131... RADIOACTIVE MATERIAL Quality Assurance § 71.131 Nonconforming materials, parts, or components. The licensee..., segregation, disposition, and notification to affected organizations. Nonconforming items must be reviewed and...

  13. 47 CFR 22.131 - Procedures for mutually exclusive applications.

    Science.gov (United States)

    2010-10-01

    .... 22.131 Section 22.131 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER... public in advance. (c) Procedures. Generally, the Commission may grant one application in a filing group... excluded by that grant, pursuant to § 1.945 of this chapter. (1) Selection methods. In selecting the...

  14. 46 CFR 131.545 - Maintenance in general.

    Science.gov (United States)

    2010-10-01

    ... points with the recommended lubricants. (5) A list of replaceable parts. (6) A list of sources of spare parts. (7) A log for records of inspections, maintenance, and repair. (b) The master shall ensure that... 46 Shipping 4 2010-10-01 2010-10-01 false Maintenance in general. 131.545 Section 131.545 Shipping...

  15. 45 CFR 96.131 - Treatment services for pregnant women.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Treatment services for pregnant women. 96.131... Substance Abuse Prevention and Treatment Block Grant § 96.131 Treatment services for pregnant women. (a) The State is required to, in accordance with this section, ensure that each pregnant woman in the State who...

  16. 46 CFR 131.955 - Display of merchant mariner credential.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Display of merchant mariner credential. 131.955 Section... OPERATIONS Miscellaneous § 131.955 Display of merchant mariner credential. Each officer on a vessel must conspicuously display his or her license or officer endorsements as required by 46 U.S.C. 7110. ...

  17. [sup 131]I-metaiodobenzylguanidine therapy for malignant pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Sakahara, Harumi; Saga, Tsuneo; Hosono, Makoto; Kobayashi, Hisataka; Konishi, Junji (Kyoto Univ. (Japan). Faculty of Medicine); Endo, Keigo

    1994-05-01

    [sup 131]I-metaiodobenzylguanidine (MIBG) therapy was given to five patients with malignant pheochromocytoma. The patients received 1-3 doses of 3.33-4.625 GBq (total dose: 3.7 to 10.73 GBq). Partial tumor regression was observed in two patients, the tumor was unchanged in two patients, and slow progression was noted in one patient. Marked improvement in clinical symptoms was achieved in four patients. The other patients had no symptoms before [sup 131]I-MIBG treatment, but the serum epinephrine and dopamine decreased. There were no severe untoward responses in four patients. However, one patient developed transient but severe orthostatic hypotension, hypertension, and hyperglycemia from 1 week to 1 month after [sup 131]I-MIBG administration. Although complete remission was not obtained, all the patients achieved some benefit from [sup 131]I-MIBG therapy. Thus, [sup 131]I-MIBG appears to be useful for the palliation of malignant pheochromocytoma. (author).

  18. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  19. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  20. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  1. Adrenal scanning with {sup 131}I-cholesterol; Diagnostik von Nebennierenrindenerkrankungen mit {sup 131}I-Cholesterol

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, K. [Klinik und Poliklinik fuer Nuklearmedizin, Klinikum der Ludwig-Maximilians-Univ. Muenchen (Germany)

    2009-03-15

    Adrenal scanning with {sup 131}I-19-cholesterol is used in patients with various forms of adrenal malfunction (adreno-cortical carcinoma or adenoma, hypothalamic-hypophyseal form of Cushing's syndrome, adrenal hirsutism, primary or secondary adrenocortical insufficiency). Adrenal scanning is optimal between the fourth and tenth day after intravenous injection of {sup 131}I-19-cholesterol. This method makes it possible to estimate the size and functional status of the adrenals. Limitation of the method is the relatively high radiation dose of {sup 131}I-19-cholesterol. (orig.)

  2. Get the Facts About Exposure to I-131 Radiation

    Science.gov (United States)

    ... the Fukushima accident in 2011 (primarily Americans in Japan) Releases from atomic weapons production plants (such as ... approximately 2 to 3 times more common in women Reliable information about I-131's impact on human ...

  3. The psychodynamics of work with iodine-131 in nuclear medicine

    National Research Council Canada - National Science Library

    Leila Cunha da Silveira; Maria Cristina Rodrigues Guilam; Sergio Ricardo de Oliveira

    2013-01-01

      This paper seeks to demonstrate to what extent alternative forms adopted in the working process of professionals with iodine-131 in nuclear medicine can assist in managing risks of ionizing radiation...

  4. Resveratrol Sensitizes Selectively Thyroid Cancer Cell to 131-Iodine Toxicity

    Directory of Open Access Journals (Sweden)

    Seyed Jalal Hosseinimehr

    2014-01-01

    Full Text Available Background. In this study, the radiosensitizing effect of resveratrol as a natural product was investigated on cell toxicity induced by 131I in thyroid cancer cell. Methods. Human thyroid cancer cell and human nonmalignant fibroblast cell (HFFF2 were treated with 131I and/or resveratrol at different concentrations for 48 h. The cell proliferation was measured by determination of the percent of the survival cells using 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Results. Findings of this study show that resveratrol enhanced the cell death induced by 131I on thyroid cancer cell. Also, resveratrol exhibited a protective effect on normal cells against 131I toxicity. Conclusion. This result indicates a promising effect of resveratrol on improvement of cellular toxicity during iodine therapy.

  5. Treatment of malignant pheochromocytomas with 131-I metaiodobenzylguanidine and chemotherapy.

    Science.gov (United States)

    Sisson, J C; Shapiro, B; Shulkin, B L; Urba, S; Zempel, S; Spaulding, S

    1999-08-01

    Malignant pheochromocytomas have exhibited partial responses to treatments with 131-I metaiodobenzylguanidine (MIBG) and with chemotherapy. The authors combined these two therapeutic methods to determine if beneficial effects from each would be additive. Patients with documented malignant pheochromocytomas were recruited with the intent of administering 131-I MIBG in three substantial amounts of radioactivity at 3-month intervals followed by a year of chemotherapy in which cyclophosphamide, dacarbazine, and vincristine were to be given in 21-day cycles. Six patients entered the protocol. After the 131-I MIBG treatments, three patients manifested declines in the presence of tumor (smaller tumor volume or abnormalities on bone and 131-I MIBG scans) and the function of tumor (decreased rate of normetanephrine excretion as the major index). Two patients completed at least 9 months of chemotherapy and showed further reductions in the presence and function of tumors and were classified as having partial responses. Progressive disease afflicted three of the other four subjects. Even though toxicity was minimal from 131-I MIBG, it was sufficient to force reduction in the dosages or duration of chemotherapy. A combination of 131-I MIBG treatments and chemotherapy produced additive effects in reducing malignant pheochromocytomas. Toxicity moderately curtailed the proposed chemotherapy protocol.

  6. Additional effective dose by patients undergoing NAI-131 capsules therapy

    Energy Technology Data Exchange (ETDEWEB)

    Orlic, M.; Jovanovic, M.; Spasic Jokic, V.; Cuknic, O.; Ilic, Z.; Vranjes Djuric, S. [VINCA - Institute of Nuclear Sciences, Belgrade, Serbia and Montenegro (Yugoslavia)

    2006-07-01

    Capsules or solutions containing Na{sup 131}I are indicated for the therapy of some thyroid carcinomas such as functioning metastatic papillary or follicular carcinoma of the thyroid; and for the treatment of hyperthyroidism (diffuse toxic goiter and single or multiple toxic nodular goiter). The recommended dosage ranges of Na{sup 131}I capsules or solution for the therapy of the average patient (70 kg) are: (3.7-5.55) GBq for ablation of normal thyroid tissue; (3.7-7.4) GBq for subsequent treatments; a (148-370) MBq for hyperthyroidism. The purpose of this paper is to calculate effective dose as a result of iodine-131 capsules remaining in stomach before absorption starts. This result can determine the disadvantage of capsule versus solution containing sodium iodine-131 (Na{sup 131}I) in radionuclide therapy application from radiation protection point of view. The Monte Carlo code MCNP4b was used to model transport of gamma and beta particles emitted by radionuclide {sup 131}I treated as a point source at the bottom of stomach. Absorbed energy per unit transformation in stomach and surrounding organs has been calculated. (authors)

  7. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  8. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  9. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  10. Prevalence of Escherichia Coli sequence type 131 (ST131 among extraintestinal clinical isolates in different phylogenetic groups

    Directory of Open Access Journals (Sweden)

    Al-hetar Khadega Yahyah Abdullah

    2016-03-01

    Full Text Available Escherichia coli sequence type O25b-ST131 has emerged in recent years around the world in combination with CTX-M-15 among extra-intestinal infections and it has caused considerable morbidity and mortality. Management of infections can be done by controlling the source of infections or contamination. In India there are not many studies on O25b-ST131 clone, This study was done to investigate ST131’s prevalence in different phylogenetic groups among isolates from different extra-intestinal infections. Hundred E. coli isolates were isolated from different clinical samples including urine, blood, sputum and exudates from Krishna Rajendra (K.R Hospital, Mysore. Polymerase chain reaction (PCR method was used to determine the Phylogenetic groups and O25b-ST131 clone. Out of 100 E. coli strains 55%, 30%, 8% and 7% were isolated from urine, exudates, sputum, and blood respectively. Phylogenetically, B2 group was the dominant group (34% followed by D, B1 and A groups (28, 26, and12 respectively, 87% E. coli samples belonged to O25b-ST131 clone which were distributed among groups; B2, D, B1 and (32, 25, 22 and 8 isolates respectively. Diversity of Phylogenetic groups among O25b-ST131 E. coli strains may refer to the source of infections. Further studies are needed to highlight the source of infection which may help to control the dissemination of E. coli clone.

  11. Different outcomes for relapsed vs. refractory neuroblastoma after therapy with 131I-metaiodobenzylguanidine (131I-MIBG)

    Science.gov (United States)

    Zhou, Margaret J.; Doral, Michelle Y.; DuBois, Steven G.; Villablanca, Judith G.; Yanik, Gregory A.; Matthay, Katherine K.

    2015-01-01

    Background 131I-metaiodobenzylguanidine (131I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to 131I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. Methods This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with 131I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. Results The response rate (complete and partial response) to 131I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after 131I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p = 0.02). Among all patients, the 24-month OS was 47.0% (95% CI 39.9%–53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8%–75.9%), compared to 38.7% (95% CI 30.4%–46.8%) for relapsed patients (p refractory neuroblastoma, patients with prior relapse had higher rates of progressive disease and had lower 2-year overall survival after 131I-MIBG compared to patients with refractory disease. PMID:26254811

  12. In vivo biological evaluation of {sup 131}I radiolabeled-paclitaxel glucuronide ({sup 131}I-PAC-G)

    Energy Technology Data Exchange (ETDEWEB)

    Aslan, O.; Biber Muftuler, F.Z.; Yurt Kilcar, A.; Ichedef, C.; Unak, P. [Ege Univ., Izmir (Turkey). Dept. of Nuclear Applications

    2012-07-01

    Paclitaxel (PAC) is a natural occurring diterpene alkoloid originally isolated from the bark of Taxus Brevifolia. It is one of the most important antitumor agents for clinical treatment of ovarian, breast non-small cell lung and prostate cancers. It is known that these types of cancer cells have high {beta}-glucuronidase enzyme which can catalyze the hydrolysis of glucuronides. This is why the synthesis compounds which undergo glucuronidation come into question in the imaging and therapy of these cancer cells. The aim of current study is conjugation of glucuronic acid (G) to the starting substance PAC, labeling with {sup 131}I and to perform its in vivo biological evaluation. Glucuronic acid derived paclitaxel compound [paclitaxel-glucuronide (PAC-G)] was labeled with {sup 131}I using iodogen method. According to thin layer radio chromatography (TLRC) method, the radiochemical yield of {sup 131}I-PAC-G was 84.30 {+-} 7.40% (n=10). The biodistribution of {sup 131}I-PAC-G in healthy female and male Wistar Albino rats has been investigated. Imaging studies on male Balb-C mice were performed by using the Kodak FX PRO in vivo Imaging System. The range of the breast/blood, breast/muscle; ovary/blood, ovary/muscle ratios is approximately between 1.29 and 11.34 in 240 min, and between 0.71 and 8.24 in 240 min for female rats. The prostate/blood and prostate/muscle ratio is between 1.94 and 6.95 in 30 min for male rats. All these experimental studies indicate that {sup 131}I-PAC-G may potentially be used in breast, ovary and prostate tissues as an imaging agent. Also it is thought that {sup 131}I-PAC-G bears a therapy potential because of the {sup 131}I radionuclide and can be improved with further investigations. (orig.)

  13. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  14. 131I-induced changes in rat thyroid gland function

    Directory of Open Access Journals (Sweden)

    V. Torlak

    2007-08-01

    Full Text Available Therapeutic doses of 131I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of 131I (64-277 µCi. Thirty male Fisher rats in the experimental group and 30 in the control group (untreated were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before 131I administration (4-month-old animals and three times following 131I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 ± 8.16 to 55.0 ± 6.1 nM in the control group and from 69.4 ± 6.9 to 25.4 ± 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after 131I administration to rats, which was not 131I dose dependent.

  15. Experimental release of 131I: the Green Run.

    Science.gov (United States)

    Robkin, M A

    1992-06-01

    In December 1949, a large amount of 131I was released to the air at Hanford during the dissolving of irradiated uranium fuel for a classified military experiment called the "Green Run." Reports of the release have varied from about 0.15-0.3 PBq. Using, as a guide, the reported measurements of 133Xe released during the experiment, the amount of 131I released has been reanalyzed. The results indicate that about 0.40 +/- 0.12 PBq (11 +/- 3 kCi) was released, somewhat larger than the largest previous estimates.

  16. Different outcomes for relapsed versus refractory neuroblastoma after therapy with (131)I-metaiodobenzylguanidine ((131)I-MIBG).

    Science.gov (United States)

    Zhou, Margaret J; Doral, Michelle Y; DuBois, Steven G; Villablanca, Judith G; Yanik, Gregory A; Matthay, Katherine K

    2015-11-01

    (131)I-metaiodobenzylguanidine ((131)I-MIBG) is a targeted radiopharmaceutical with significant activity in high-risk relapsed and chemotherapy-refractory neuroblastoma. Our primary aim was to determine if there are differences in response rates to (131)I-MIBG between patients with relapsed and treatment-refractory neuroblastoma. This was a retrospective cohort analysis of 218 patients with refractory or relapsed neuroblastoma treated with (131)I-MIBG at UCSF between 1996 and 2014. Results were obtained by chart review and database abstraction. Baseline characteristics and response rates between relapsed patients and refractory patients were compared using Fisher exact and Wilcoxon rank sum tests, and differences in overall survival (OS) were compared using the log-rank test. The response rate (complete and partial response) to (131)I-MIBG-based therapies for all patients was 27%. There was no difference in response rates between relapsed and refractory patients. However, after (131)I-MIBG, 24% of relapsed patients had progressive disease compared to only 9% of refractory patients, and 39% of relapsed patients had stable disease compared to 59% of refractory patients (p=0.02). Among all patients, the 24-month OS was 47.0% (95% confidence interval (CI) 39.9-53.9%). The 24-month OS for refractory patients was significantly higher at 65.3% (95% CI 51.8-75.9%), compared to 38.7% (95% CI 30.4-46.8%) for relapsed patients (prefractory disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Iodine-131 Tositumomab: (131)I-anti-B1 antibody, (131)I-tositumomab, anti-CD20 murine monoclonal antibody-I-131, B1, Bexxar, (131)I-anti-B1 antibody, iodine-131 tositumomab, iodine-131 anti-B1 antibody, tositumomab.

    Science.gov (United States)

    2003-01-01

    Iodine-131 tositumomab [B1, Bexxar , iodine-131 anti-B1 antibody] is a murine antibody conjugated to iodine 131 that recognises and binds to the B1 (CD20) antigen which is found specifically on B lymphocytes. Iodine-131 tositumomab has a dual mechanism of action. It is capable of initiating a host immune response to those B cells to which it is attached, and it also triggers apoptosis in a significant proportion of the cells to which it binds. The product was first discovered by Coulter Corporation, Miami, in collaboration with the Dana-Farber Cancer Institute and the University of Michigan. The spin-off company Coulter Pharmaceutical, upon its formation, obtained worldwide rights to iodine-131 tositumomab. (Coulter Corporation was acquired subsequently by Beckman Instruments in October 1997. The union of the two companies produced Beckman Coulter.) In December 2000, Coulter Pharmaceutical was acquired by, and merged into, Corixa Corporation.Iodine-131 tositumomab is available for licencing in Japan. Corixa Corporation and GlaxoSmithKline signed an agreement to jointly develop and commercialise iodine-131 tositumomab. The total agreement has a potential value of up to $US132 million, plus shared profits and royalties. The two companies will jointly market the antibody in the US following regulatory approval. Corixa Corporation has announced it expects iodine-131 tositumomab to be approved in the US for non-Hodgkin's lymphoma (NHL). Under the terms of the original agreement, GlaxoSmithKline will receive exclusive marketing rights outside the US, excluding Japan. However, an amended agreement between the two companies will allow Corixa Corporation to also market the product outside the US. In February 2003, the European Commission granted iodine-131 tositumomab orphan-drug designation. Corixa Corporation and GlaxoSmithKline also intend to jointly investigate the use of the product in other indications. GlaxoSmithKline may also receive access to second generation anti

  18. Comparative biodistribution profile of [131I]VIP and [131I]VIP10-28

    Directory of Open Access Journals (Sweden)

    Maria Tereza Colturato

    2005-10-01

    Full Text Available Various tumor cells express significantly higher amounts of VIP receptors (VIPR that provided the basis for the clinical use of radiolabeled VIP for the in vivo localization of tumors. This work studied the labeling of VIP and VIP10-28 with iodine-131 to compare the biological distribution of the labeled compounds in Nuce mice and the affinity for tumor cells. Both VIP and VIP10-28 peptides contain two tyrosine residues, in positions 10 and 22, that are theoretically equally susceptible to radioiodination employing oxidative electrophilic substitution using oxidizing agents like Chloramine T. Radiochemical purity of the reaction mixture was determined by electrophoresis and HPLC. The VIP peptide and the fragment were labeled with radioiodine with good radiochemical yield (above 96%. Suitable, but important differences can be observed in biological distribution studies. Comparatively, blood clearance was faster for labeled VIP and perhaps because of this, the uptake in tumor was lower, especially during the first hour. These differences observed in the biological distribution of the compounds can be related to the lipophilicity of the labeled compounds.Várias células tumorais expressam significantemente uma alta quantidade de receptores VIP (VIPR que determinam a base para o uso clínico de VIP radiomarcado para localização de tumores in vivo. Foi estudado neste trabalho a marcação do VIP e do fragmento VIP10-28 com iodo-131 comparando a distribuição biológica dos compostos marcados em camundongos Nude e sua afinidade pelas células tumorais. Ambos os peptídeos, VIP e VIP10-28. contém dois resíduos de tirosina nas posições 10 e 22, que teoricamente são igualmente susceptíveis pela substituição eletrofílica oxidativa do radioiodo utilizando Cloramina T como agente oxidante. A pureza radioquímica da mistura de reação foi determinada por eletroforese e cromatografia líquida de alta eficiência (CLAE. O VIP e fragmento foram

  19. 40 CFR 92.131 - Smoke, data analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Smoke, data analysis. 92.131 Section... analysis. The following procedure shall be used to analyze the smoke test data: (a) Locate each throttle... following procedure: (1) Locate the highest reading, and integrate the highest 3-second average reading...

  20. Growth and bacteriocin production kinetics of Leuconostoc mesenteroides E131.

    Science.gov (United States)

    Drosinos, E H; Mataragas, M; Nasis, P; Galiotou, M; Metaxopoulos, J

    2005-01-01

    The aim of this study was to investigate the effect of pH, temperature, sodium chloride, type and level of sugar used in fermented sausages, on the occurrence and the concentration of the maximum bacteriocin activity, in order to optimize the bacteriocin synthesis during the growth cycle of Leuconostoc mesenteroides E131. In order to study the effect of the environmental factors on growth and bacteriocin production of Leuc. mesenteroides E131 fermentations were carried out in fermentor as well as in flasks. Mathematical equations were used to describe the kinetic parameters of the strain. When the micro-organism was grown in lower pH value (5.5) than optimum for growth (pH 6.5) the bacteriocin production was enhanced. On the contrary, bacteriocin production was favoured when the micro-organism was grown at temperatures close to the optimum for growth (25 degrees C). Finally, the level and the type of the sugar used as carbon source affected both growth and bacteriocin production with glucose being better source for biomass production and fructose more suitable for bacteriocin production. Leuconostoc mesenteroides E131 has a potential use as protective culture or its bacteriocin as protective agent in combination with another starter culture in fermented meats. Better understanding of the influence of environmental factors, such as pH, temperature and carbon source on the kinetic behaviour of Leuc. mesenteroides E131.

  1. Iodine Symporter Targeting with 124I/131I Theranostics

    NARCIS (Netherlands)

    Nagarajah, J.; Janssen, M.; Hetkamp, P.; Jentzen, W.

    2017-01-01

    Theranostics, a modern approach combining therapeutics and diagnostics, is among the most promising concepts in nuclear medicine for optimizing and individualizing treatments for many cancer entities. Theranostics has been used in clinical routines in nuclear medicine for more than 60 y-as 131I for

  2. Microdeletion in distal 17p13.1

    DEFF Research Database (Denmark)

    Zeesman, Susan; Kjaergaard, Susanne; Hove, Hanne Buciek

    2012-01-01

    Array comparative genomic hybridization has led to the identification of new syndromes by identifying genomic imbalances not detectable by standard karyotyping methods and by allowing correlations with physical findings. Deletions in the 17p13.1 region have been reported in patients with dysmorph...

  3. Data on repeated (131)I-WB scans and the incidence of positive Tg and negative (131)I-WBS in DTC patients from a 24 months study.

    Science.gov (United States)

    Adedapo, Kayode S; Vangu, Mboyo Di Tamba

    2011-01-01

    We present data on repeated iodine-131 whole body scans ((131)I-WBS) in differentiated thyroid cancer patients (DTC) after surgery and (131)I remnant ablation and on increased thyroglobulin (Tg) with negative (131)I-WBS, in a retrospective study at our hospital. A total of 106 patients (91 female and 15 male) treated with (131)I for DTC met the inclusion criteria. The mean age of the patients was 45 years, age range 16-81 years. A total of 101 patients had complete 24 months follow-up following (131)I remnant ablation treatment. The mean (131)I dose administered after the first 6 months of follow- up was 3GBq while mean total dose was 4.9GBq, range 1.1-7.4GBq. Our results showed that at the end of the first 6 months post treatment, 58/101 patients had a negative (131)I-WBS. By the end of the 4th (131)I treatment at 24th months, the remaining 43 patients became negative for (131)I-WBS. We found increased Tg and negative (131)I-WBS in 2 of the 101 patients at the 24th months examination the so called Tg elevated negative (131)I-WBS (TENIS syndrome). The possible explanation of this syndrome is discussed. In conclusion, our study in DTC operated patients does not support the use of repeated diagnostic (131)I-WBS after an undetectable Tg because we found no Tg rebound in patients with negative (131)I-WBS, after 24 months of follow-up with serial measurements of Tg on and of suppression with L thyroxine.

  4. Evaluation of {sup 131}I retention in several adsorbers

    Energy Technology Data Exchange (ETDEWEB)

    Catanoso, Marcela F.; Osso Junior, Joao Alberto, E-mail: marcela.forli@gmail.co, E-mail: jaosso@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Diretoria de Radiofarmacia

    2011-07-01

    Several iodine radioisotopes are used in nuclear medicine for treatment and diagnostic purposes. The radioisotope {sup 131}I is used both in diagnosis and therapy due to its physical characteristics of decay by {beta}{sup -} and its {gamma}-ray emissions suitable for diagnosis. It is routinely produced at IPEN through the irradiation of TeO{sub 2} targets in the IEA-R1m nuclear reactor. After the irradiation, the {sup 131}I is separated by dry distillation, where the targets are put in an oven, heated at 760 deg C for 2 hours and the {sup 131}I, volatile, is carried by an O{sub 2} gas stream. The aim of this work was to evaluate the retention and elution of {sup 131}I samples produced at IPEN in several adsorbers as part of a project aiming the purification of these radioisotopes, allowing the labeling of biomolecules. Samples of {sup 131}I were used for retention and elution studies with the following adsorbers: commercial cartridges, anionic resin columns and cationic resin column. The results showed that Ag cartridges and anionic resins Dowex 1X8, Dowex 3 and IRA 400 had a great iodine retention but no elution after using specific eluents. The QMA light, acid alumina, neutral alumina and cationic resin Dowex 50WX4 showed high retention and elution and QMA plus and cationic resin Dowex 50WX8 and Dowex 50WX12 had a good retention but lower elution. Regarding to the better retention and elution, Ag cartridges and resins showed a higher percentage of iodine retention but lower elution yield and QMA light, acid and neutral alumina cartridges showed better results. (author)

  5. Methodology for management of therapeutic dose of I-131; Metodologia para administrar dosis terapeutica de I-131

    Energy Technology Data Exchange (ETDEWEB)

    Basteris M, J.; Gomez D, R. [Universidad Autonoma de Yucatan, Facultad de Medicina, Merida, Yucatan (Mexico)

    2007-07-01

    The present work suggests the use of measures guided to eliminate the resulting chronic sialoadenitis of the treatment previously described with a therapeutic dose bigger than ablative of Iodine 131, as well as the use of citric fruits to stimulate the salivation, the administration of liquid post-dose is included to accelerate the gastric emptying avoiding the secondary effects as the vomit. (Author)

  6. Treatment of hyperthyroidism by 131-iodine; Traitement des hyperthyroidies par l'iode 131: dose calculee versus dose fixe

    Energy Technology Data Exchange (ETDEWEB)

    Fieffe, S.; Cuif-Joba, A.; Testard, A.; Fortuna, I.; Pocharta, J.M.; Papathanassioua, D.; Schvartz, C. [Service d' endocrinologie et medecine nucleaires, institut Jean-Godinot, 1, rue du General Koeing, 51056 Reims, (France)

    2009-05-15

    In a first time, we chose to modify the dose to be administered, on using always the Marinelli formula but on increasing the absorbed dose. In a second time, we wanted to simplify the determination of the dose to be administered by modulating it only in function of the thyroid volume. Two groups of patients were managed for hyperthyroidism recurrence. In a first group the iodine dose ({sup 131}I) was determined with the help of the simplified Marinelli formula: chosen absorbed dose was 150 Gy, gland volume determined by echography, measurement of the fixation at the sixth hour. In the second group, the thyroid volume was determined by echography. The patients with a thyroid from 5 to 30 g received 185 MBq, from 30 to 50 g 370 MBq and superior to 50 g 555 MBq of iodine 131. The two groups of patients have the same characteristics. the results of treatment by iodine 131, evaluated on the dosages of T4L and TSH at three and six months, show the preservation of euthyroidism or the passage in hypothyroidism among 94% of patients in the group 1 and 80% of patients in the group 2. These results are not significantly different. The easiness of the realisation of the treatment in the group 2 lead us to continue this simplified therapy scheme that allows equally to improve the radiation protection of medical personnel by avoiding the use of iodine 131. (N.C.)

  7. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  8. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  9. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  10. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  11. Sulfates, Clouds and Radiation Brazil (SCAR-B) University of Washington C131A Data

    Data.gov (United States)

    National Aeronautics and Space Administration — SCAR_B_UWC131A data are Smoke/Sulfates, Clouds and Radiation Experiment in Brazil data from instruments on board the University of Washington C131A aircraft in...

  12. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Detailed results of the Hanford Environmental Dose Reconstruction project (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  13. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1992-10-01

    Detailed results of the Hanford Environmental Dose Reconstruction (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  14. Choriocarcinoma: blocking factor and monoclonal antibody iodine 131 imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pattillo, R.A.; Khazaeli, M.B.; Ruckert, A.C.; Hussa, R.O.; Collier, B.D.; Beierwaltes, W.; Mattingly, R.F.

    1984-04-01

    Postoperative iodine 131 monoclonal antibody localization in metastatic choriocarcinoma was accomplished in this study. The monoclonal antibody was prepared to male choriocarcinoma which cross reacted with gestational choriocarcinoma. The antibody was raised against whole choriocarcinoma cells and human chorionic gonadotropin (hCG) cross reactivity was excluded. The purified antibody was iodinated with /sup 131/I and successfully imaged BeWo choriocarcinoma transplanted in nude mice; however, imaging of choriocarcinoma in a patient was verified only after resection. It is our belief that failure to sufficiently concentrate the antibody in the tumor before operation was due to blocking factor in the serum of the patient. Blocking factor and hCG dropped postoperatively. Blocking factor activity in 15 patients with metastatic trophoblastic disease was monitored and, like hCG, was found to be a sensitive indicator of the presence of disease. Its efficacy may be in the small number of patients without hCG but with persistent disease.

  15. Iodine-131 releases from the Hanford Site, 1944--1947

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Releases of fission product iodine-131 are calculated for the 1944 through 1947 period from the Hanford Reservation. Releases to the atmosphere were from the ventilation stacks of T and B separation plants. A reconstruction of daily separation plant operations forms the basis of the releases. The reconstruction traces the iodine-131 content of each fuel discharge from the B, D, and F Reactors to the dissolving step in the separation plants. Statistical computer modeling techniques are used to estimate hourly release histories based on sampling mathematical distribution functions that express the uncertainties in the source data and timing. The reported daily, monthly, and yearly estimates are averages and uncertainty ranges are based on 100 independent Monte Carlo realizations'' of the hourly release histories.

  16. Transcriptional response to 131I exposure of rat thyroid gland.

    Science.gov (United States)

    Rudqvist, Nils; Spetz, Johan; Schüler, Emil; Parris, Toshima Z; Langen, Britta; Helou, Khalil; Forssell-Aronsson, Eva

    2017-01-01

    Humans are exposed to 131I in medical diagnostics and treatment but also from nuclear accidents, and better knowledge of the molecular response in thyroid is needed. The aim of the study was to examine the transcriptional response in thyroid tissue 24 h after 131I administration in rats. The exposure levels were chosen to simulate both the clinical situation and the case of nuclear fallout. Thirty-six male rats were i.v. injected with 0-4700 kBq 131I, and killed at 24 h after injection (Dthyroid = 0.0058-3.0 Gy). Total RNA was extracted from individual thyroid tissue samples and mRNA levels were determined using oligonucleotide microarray technique. Differentially expressed transcripts were determined using Nexus Expression 3.0. Hierarchical clustering was performed in the R statistical computing environment. Pathway analysis was performed using the Ingenuity Pathway Analysis tool and the Gene Ontology database. T4 and TSH plasma concentrations were measured using ELISA. Totally, 429 differentially regulated transcripts were identified. Downregulation of thyroid hormone biosynthesis associated genes (e.g. thyroglobulin, thyroid peroxidase, the sodium-iodine symporter) was identified in some groups, and an impact on thyroid function was supported by the pathway analysis. Recurring downregulation of Dbp and Slc47a2 was found. Dbp exhibited a pattern with monotonous reduction of downregulation with absorbed dose at 0.0058-0.22 Gy. T4 plasma levels were increased and decreased in rats whose thyroids were exposed to 0.057 and 0.22 Gy, respectively. Different amounts of injected 131I gave distinct transcriptional responses in the rat thyroid. Transcriptional response related to thyroid function and changes in T4 plasma levels were found already at very low absorbed doses to thyroid.

  17. 10 CFR 1.31 - Office of the Chief Financial Officer.

    Science.gov (United States)

    2010-01-01

    ... comply with the Federal Manager's Financial Integrity Act of 1982; (e) Develops and manages an agencywide... 10 Energy 1 2010-01-01 2010-01-01 false Office of the Chief Financial Officer. 1.31 Section 1.31... Financial Officer § 1.31 Office of the Chief Financial Officer. The Office of the Chief Financial Officer...

  18. 40 CFR 131.42 - Antidegradation Implementation Methods for the Commonwealth of Puerto Rico.

    Science.gov (United States)

    2010-07-01

    ... for the Commonwealth of Puerto Rico. 131.42 Section 131.42 Protection of Environment ENVIRONMENTAL... Standards § 131.42 Antidegradation Implementation Methods for the Commonwealth of Puerto Rico. (a) General... February 2, 1989 Resolution R-89-2-2 of the Governing Board of the Puerto Rico Environmental Quality Board...

  19. 26 CFR 1.381(c)(13)-1 - Involuntary conversions.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Involuntary conversions. 1.381(c)(13)-1 Section 1.381(c)(13)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.381(c)(13)-1 Involuntary conversions...

  20. Transcription pattern of UL131A-128 mRNA in clinical strains of ...

    Indian Academy of Sciences (India)

    Mean while, clones containing UL131A-128 transcripts in an HCMV cDNA library of a clinical strain were selected and sequenced. It was demonstrated that UL131A-128 mRNA was expressed with immediately early, early and late kinetics. Sequences obtained by RT-PCR showed that the UL131A gene consisted of two ...

  1. 21 CFR 516.131 - Refuse to file a request for determination of eligibility for indexing.

    Science.gov (United States)

    2010-04-01

    ... eligibility for indexing. 516.131 Section 516.131 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... § 516.131 Refuse to file a request for determination of eligibility for indexing. (a) If a request for determination of eligibility for indexing contains all of the information required by § 516.129, FDA shall file...

  2. 42 CFR 137.131 - When should a final offer be submitted?

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false When should a final offer be submitted? 137.131 Section 137.131 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE Final Offer § 137.131 When should...

  3. Interventional therapy for human breast cancer in nude mice with 131I gelatin microspheres (131I-GMSs) following intratumoral injection

    OpenAIRE

    Li, Chuan-Chao; Chi, Jun-Lin; Ma, Yu; Li, Jian-Hong; Xia, Chuan-Qin; LI, Lin; Chen, Zhuo; Chen, Xiao-li

    2014-01-01

    Introduction The aim of this study was to investigate the effects of 131I gelatin microspheres (131I-GMS) on human breast cancer cells (MCF-7) in nude mice and the biodistribution of 131I-GMSs following intratumoral injections. Methods A total of 20 tumor-bearing mice were divided into a treatment group and control group and received intratumoral injections of 2.5 mci 131I-GMSs and nonradioactive GMSs, respectively. Tumor size was measured once per week. Another 16 mice received intratumoral ...

  4. Epidemiology and characteristics of Escherichia coli sequence type 131 (ST131) from long-term care facility residents colonized intestinally with fluoroquinolone-resistant Escherichia coli.

    Science.gov (United States)

    Han, Jennifer H; Garrigan, Charles; Johnston, Brian; Nachamkin, Irving; Clabots, Connie; Bilker, Warren B; Santana, Evelyn; Tolomeo, Pam; Maslow, Joel; Myers, Janice; Carson, Lesley; Lautenbach, Ebbing; Johnson, James R

    2017-03-01

    The objective of this study was to evaluate molecular and epidemiologic factors associated with Escherichia coli sequence type 131 (ST131) among long-term care facility (LTCF) residents who acquired gastrointestinal tract colonization with fluoroquinolone-resistant E. coli (FQREC). Colonizing isolates from 37 residents who newly developed FQREC colonization at three LTCFs from 2006 to 2008 were evaluated. Twenty-nine (78%) of 37 total FQREC colonizing isolates were ST131. Most ST131 isolates had a distinctive combination of gyrA and parC replacement mutations. The ST131 and non-ST131 isolates differed significantly for the prevalence of many individual virulence factors but not for the proportion that qualified molecularly as extraintestinal pathogenic E. coli (ExPEC) or aggregate virulence factor scores. E. coli ST131 was highly prevalent among LTCF residents with FQREC colonization. Future studies should determine the risk factors for infection among ST131-colonized residents, and assess the potential for increased transmissibility of ST131 in the long-term care setting. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  6. Toxicity of upfront {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) therapy in newly diagnosed neuroblastoma patients: a retrospective analysis

    Energy Technology Data Exchange (ETDEWEB)

    Bleeker, Gitta; Schoot, Reineke A.; Caron, Huib N.; Kraker, Jan de; Tytgat, Godelieve A. [Emma Children' s Hospital, Academic Medical Centre (AMC), Department of Paediatric Oncology, PO Box 22700, Amsterdam (Netherlands); Hoefnagel, Cees A. [National Cancer Institute (NKI-AvL), Department of Nuclear Medicine, Amsterdam (Netherlands); Eck, Berthe L. van [Academic Medical Centre (AMC), Department of Nuclear Medicine, Amsterdam (Netherlands)

    2013-10-15

    In the treatment of patients with high-risk neuroblastoma, different doses of {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) are administered at different time points during treatment. Toxicity, mainly haematological (thrombocytopenia), from {sup 131}I-MIBG therapy is known to occur in extensively chemotherapy pretreated neuroblastoma patients. Up to now, acute toxicity from {sup 131}I-MIBG as initial treatment has never been studied in a large cohort. The aim of this retrospective study was to document acute toxicity related to upfront {sup 131}I-MIBG. All neuroblastoma patients (stages 1-4 and 4S) treated upfront with {sup 131}I-MIBG at the Emma Children's Hospital, Academic Medical Centre (1992 - 2008) were included in this retrospective analysis. The acute toxicity (during therapy) and short-term toxicity (1st month following therapy) of the first two {sup 131}I-MIBG therapies were studied. Of 66 patients (34 boys, 32 girls; median age 2.2 years, range 0.1 - 9.4 years), 49 had stage 4 disease, 5 stage 4S, 6 stage 3, 1 stage 2 and 5 stage 1. The median first dose was 441 MBq/kg (range 157 - 804 MBq/kg). The median second dose was 328 MBq/kg (range 113 - 727 MBq/kg). The most frequently observed symptoms were nausea and vomiting (21 %, maximum grade II). The main toxicity was grade IV haematological, occurring only in stage 4 patients, after the first and second {sup 131}I-MIBG therapies: anaemia (5 % and 4 %, respectively), leucocytopenia (3 % and 4 %) and thrombocytopenia (2 % and 4 %). No stem cell rescue was needed. The main acute toxicity observed was haematological followed by nausea and vomiting. One patient developed posterior reversible encephalopathy syndrome during {sup 131}I-MIBG therapy, possibly related to {sup 131}I-MIBG. We consider {sup 131}I-MIBG therapy to be a safe treatment modality. (orig.)

  7. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  8. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  9. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  10. Risk Factors of 131I-Induced Salivary Gland Damage in Thyroid Cancer Patients.

    Science.gov (United States)

    Hollingsworth, Brynn; Senter, Leigha; Zhang, Xiaoli; Brock, Guy N; Jarjour, Wael; Nagy, Rebecca; Brock, Pamela; Coombes, Kevin R; Kloos, Richard T; Ringel, Matthew D; Sipos, Jennifer; Lattimer, Ilene; Carrau, Ricardo; Jhiang, Sissy M

    2016-11-01

    Sialadenitis and xerostomia are major adverse effects of 131I therapy in thyroid cancer patients. The risk factors for these adverse effects, other than administered activity of 131I, have not been investigated. The aim of this study is to identify risk factors for 131I-induced salivary gland damage among follicular cell-derived thyroid cancer patients. We enrolled 216 thyroid cancer patients who visited The Ohio State University Wexner Medical Center between April 2013 and April 2014. Symptoms of xerostomia and sialadenitis were identified via questionnaire and medical record search. To validate the findings in a large cohort, we retrospectively searched for ICD-9/10 codes for sialadenitis, xerostomia, and autoimmune disease associated with Sjögren's syndrome (AID-SS) in our existing database (n = 1507). Demographic and clinical information was extracted from medical records. Multivariate analyses were performed to identify independent predictors for salivary gland damage. 131I treatment associated with higher incidence of xerostomia and sialadenitis. Patients with xerostomia had 46 mCi higher mean cumulative 131I activity and 21 mCi higher mean first-administered 131I activity than patients without xerostomia. Increased age associated with higher incidence of xerostomia, and females had a higher incidence of sialadenitis. Patients who experienced sialadenitis before 131I therapy had higher sialadenitis incidence after 131I therapy. 131I-treated patients diagnosed with AID-SS, whether before or after 131I treatment, had a higher incidence of xerostomia and sialadenitis among 131I-treated patients. Risk factors for 131I-induced salivary gland damage include administered 131I activity, age, gender, history of sialadenitis before 131I treatment, and AID-SS diagnosis.

  11. Iodine 131 ablation of an obstructive lingual thyroid

    Directory of Open Access Journals (Sweden)

    Lester Johnson

    2009-01-01

    Full Text Available A 48-year-old woman undergoing surgery could not be intubated because of an oropharyngeal mass. CT and MRI revealed a 3 cm possible lingual thyroid mass, confirmed by Iodine-123 SPECT/CT. The patient underwent successful Iodine-131 ablation and has done well on thyroid hormone-replacement therapy. This case also demonstrates how modern cross-sectional imaging like SPECT/CT can appropriately be used in the patient diagnosis and management, and is of additional interest for including pre- and post-therapy MRI documenting efficacy morphologically.

  12. /sup 131/I uptake in a benign serous crystadenoma of the ovary

    Energy Technology Data Exchange (ETDEWEB)

    Kim, E.E.; Pjura, G.; Gobuty, A.; Verani, R.

    1984-09-01

    A patient with well-differentiated thyroid carcinoma had a whole body scan using 5 mCi /sup 131/I which demonstrated abnormal uptake of /sup 131/I in a palpable pelvic mass. Approximately 24 years ago the patient had a total thyroidectomy followed by /sup 131/I treatment. The histologic examination of the mass was consistent with serous cystadenoma of the ovary. No thyroid tissue or teratoma was identified. The mechanism for the unusual uptake of /sup 131/I in a benign ovarian tumor is not clear, and the differential diagnosis of metastatic thyroid cancer is briefly reviewed.

  13. I-131-Metaiodobenzylguanidine therapy with allogeneic cord blood stem cell transplantation for recurrent neuroblastoma

    Directory of Open Access Journals (Sweden)

    Sato Yuya

    2012-10-01

    Full Text Available Abstract Iodine-131-metaiodiobenzylguanidine (131I-MIBG therapy combined with allogeneic cord blood stem cell transplantation (SCT was used to treat a 4-year-old girl with recurrent neuroblastoma. The patient experienced relapse 2 years after receiving first-line therapies, which included chemotherapy, surgical resection, irradiation, and autologous peripheral SCT. Although 131I-MIBG treatment did not achieve complete remission, the size of the tumor was reduced after treatment. Based on our findings, we suggest that 131I-MIBG treatment with myeloablative allogeneic SCT should be considered as first-line therapy for high-risk neuroblastoma patients when possible.

  14. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  15. Liquid discharges from patients undergoing {sup 131}I treatments

    Energy Technology Data Exchange (ETDEWEB)

    Barquero, R. [Servicio de Radiofisica y Proteccion Radiologica, Hospital Universitario Rio Hortega, E-47010 Valladolid (Spain)], E-mail: rbarquero@hurh.sacyl.es; Basurto, F. [Departamento de Fisica Teorica, Atomica y Optica, Universidad de Valladolid, E-47010 Valladolid (Spain); Nunez, C. [Servicio de Radiofisica y Proteccion Radiologica, Fundacion Jimenez Diaz, FJD, E-82001 Madrid (Spain); Esteban, R. [Servicio de Radiologia, Hospital Clinico Universitario, E-47005 Valladolid (Spain)

    2008-10-15

    This work discusses the production and management of liquid radioactive wastes as excretas from patients undergoing therapy procedures with {sup 131}I radiopharmaceuticals in Spain. The activity in the sewage has been estimated with and without waste radioactive decay tanks. Two common therapy procedures have been considered, the thyroid cancer (4.14 GBq administered per treatment), and the hyperthyroidism (414 MBq administered per treatment). The calculations were based on measurements of external exposure around the 244 hyperthyroidism patients and 23 thyroid cancer patients. The estimated direct activity discharged to the sewage for two thyroid carcinomas and three hyperthyroidisms was 14.57 GBq and 1.27 GBq, respectively, per week; the annual doses received by the most exposed individual (sewage worker) were 164 {mu}Sv and 13 {mu}Sv, respectively. General equations to calculate the activity as a function of the number of patient treated each week were also obtained.

  16. 19p13.1 Is a triple-negative-specific breast cancer susceptibility locus

    NARCIS (Netherlands)

    K. Stevens (Kristen); Z. Fredericksen (Zachary); C. Vachon (Celine); X. Wang (Xing); S. Margolin (Sara); A. Lindblom (Annika); H. Nevanlinna (Heli); D. Greco (Dario); K. Aittomäki (Kristiina); C. Blomqvist (Carl); J. Chang-Claude (Jenny); A. Vrieling (Alina); D. Flesch-Janys (Dieter); H.-P. Sinn (Hans-Peter); S. Wang-Gohrke (Shan); S. Nickels (Stefan); H. Brauch (Hiltrud); Y-D. Ko (Yon-Dschun); H.-P. Fischer; R.K. Schmutzler (Rita); A. Meindl (Alfons); C.R. Bartram (Claus); S. Schott (Sarah); C. Engel (Christoph); A.K. Godwin (Andrew); J. Weaver (JoEllen); S.S. Pathak; P. Sharma (Pankaj); H. Brenner (Hermann); H. Mul̈ler (Heiko); V. Arndt (Volker); C. Stegmaier (Christa); P. Miron (Penelope); D. Yannoukakos (Drakoulis); A. Stavropoulou (Alexandra); G. Fountzilas (George); H. Gogas (Helen); R. Swann (Ruth); M. Dwek (Miriam); A. Perkins (Annie); R.L. Milne (Roger); J. Benítez (Javier); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); S.E. Bojesen (Stig); S.F. Nielsen (Sune); B.G. Nordestgaard (Børge); H. Flyger (Henrik); P. Guénel (Pascal); T. Truong (Thérèse); F. Menegaux (Florence); E. Cordina-Duverger (Emilie); B. Burwinkel (Barbara); F. Marme (Federick); A. Schneeweiss (Andreas); C. Sohn (Christof); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); J. Peto (Julian); N. Johnson (Nichola); O. Fletcher (Olivia); I. dos Santos Silva (Isabel); P.A. Fasching (Peter); M.W. Beckmann (Matthias); A. Hartmann; A.B. Ekici (Arif); A. Lophatananon (Artitaya); K.R. Muir (Kenneth); P. Puttawibul (Puttisak); S. Wiangnon (Surapon); M.K. Schmidt (Marjanka); A. Broeks (Annegien); L.M. Braaf (Linde); E.H. Rosenberg (Efraim); J.L. Hopper (John); C. Apicella (Carmel); D.J. Park (Daniel); M.C. Southey (Melissa); A.J. Swerdlow (Anthony ); A. Ashworth (Alan); O. Nicholas (Orr); M. Schoemaker (Minouk); H. Anton-Culver (Hoda); A. Ziogas (Argyrios); L. Bernstein (Leslie); C.C. Dur (Christina Clarke); C-Y. Shen (Chen-Yang); J-C. Yu (Jyh-Cherng); H.-M. Hsu (Huan-Ming); C.-N. Hsiung (Chia-Ni); U. Hamann (Ute); T. Dun̈nebier (Thomas); T. Rud̈iger (Thomas); H.U. Ulmer (Hans); P.D.P. Pharoah (Paul); A.M. Dunning (Alison); M.K. Humphreys (Manjeet); Q. Wang (Qing); A. Cox (Angela); S.S. Cross (Simon); M.W.R. Reed (Malcolm); P. Hall (Per); K. Czene (Kamila); C.B. Ambrosone (Christine); F. Ademuyiwa (Foluso); H. Hwang (Helena); D. Eccles (Diana); M. García-Closas (Montserrat); J.D. Figueroa (Jonine); M.E. Sherman (Mark); J. Lissowska (Jolanta); P. Devilee (Peter); C.M. Seynaeve (Caroline); R.A.E.M. Tollenaar (Rob); M.J. Hooning (Maartje); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.M. Mulligan (Anna Marie); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); E.M. John (Esther); A. Miron (Alexander); G.G. Alnæs (Grethe); V. Kristensen (Vessela); A.-L. Brøresen-Dale (Anne-Lise); G.G. Giles (Graham); L. Baglietto (Laura); C.A. McLean (Catriona Ann); G. Severi (Gianluca); M. Kosel (Matthew); V.S. Pankratz (Shane); S. Slager (Susan); J.E. Olson (Janet); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); M. Barile (Monica); D. Lambrechts (Diether); S. Hatse (Sigrid); A.-S. Dieudonné (Anne-Sophie); M.R. Christiaens (Marie Rose); G. Chenevix-Trench (Georgia); J. Beesley (Jonathan); X. Chen (Xiaoqing); A. Mannermaa (Arto); V-M. Kosma (Veli-Matti); J. Hartikainen (Jaana); Y. Soini (Ylermi); D.F. Easton (Douglas); F.J. Couch (Fergus)

    2012-01-01

    textabstractThe 19p13.1 breast cancer susceptibility locus is a modifier of breast cancer risk in BRCA1 mutation carriers and is also associated with the risk of ovarian cancer. Here, we investigated 19p13.1 variation and risk of breast cancer subtypes, defined by estrogen receptor (ER),

  17. 26 CFR 1.501(c)(13)-1 - Cemetery companies and crematoria.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Cemetery companies and crematoria. 1.501(c)(13)-1...) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Exempt Organizations § 1.501(c)(13)-1 Cemetery companies and crematoria. (a) Nonprofit mutual cemetery companies. A nonprofit cemetery company may be entitled...

  18. 46 CFR 131.310 - List of crew members and offshore workers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false List of crew members and offshore workers. 131.310... OPERATIONS Preparations for Emergencies § 131.310 List of crew members and offshore workers. (a) The master... members and offshore workers embarked; (2) In a well-marked place at the vessel's normal berth; or (3...

  19. 29 CFR 794.131 - “Customer * * * engaged in bulk distribution”.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âCustomer * * * engaged in bulk distributionâ. 794.131... Sales Made to Other Bulk Distributors § 794.131 “Customer * * * engaged in bulk distribution”. A sale to a customer of an enterprise engaged in the wholesale or bulk distribution of petroleum products will...

  20. 46 CFR 131.915 - Persons allowed in pilothouse and on navigational bridge.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Persons allowed in pilothouse and on navigational bridge. 131.915 Section 131.915 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE... bridge. No person may be in the pilothouse while the vessel is under way, unless connected with the...

  1. 131I-MIBG as a first-line treatment in high-risk neuroblastoma patients

    NARCIS (Netherlands)

    Hoefnagel, C. A.; de Kraker, J.; Valdés Olmos, R. A.; Voûte, P. A.

    1994-01-01

    The observed response to 131I-metaiodobenzylguanidine (MIBG) therapy in advanced neuroblastoma after conventional therapy, the non-invasiveness of the procedure, and the high metabolic activity which is frequently observed in untreated tumours led to the concept of substituting 131I-MIBG therapy for

  2. Clinical significance of /sup 131/I meta-iodobenzylguanidine scintigraphy in neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Odano, Ikuo; Takeda, Masayuki; Kimura, Motomasa; Sakai, Kunio

    1988-05-01

    /sup 131/I meta-iodobenzylguanidine (/sup 131/I-MIBG) scintigraphy was performed in sixteen children of neuroblastoma with ages ranging 1 - 9 years old. Eleven were male and 5 female. Scintigrams were obtained 24 hours and 48 hours after injection of /sup 131/I-MIBG (0.3 approx. 0.5 mCi/0.5 ml). In 5 patients being free from tumor recurrence with negative urinary VMA, positive accumulation of /sup 131/I-MIBG was not observed. In 8 cases with positive urinary VMA, abnormal accumulation was noted in all cases. It was supposed close relationship to be present between urinary VMA and abnormal accumulation of /sup 131/I-MIBG. In 8 preoperative cases, 7 primary lesions were clearly demonstrated (sensitivity 88 %); 5 were in adrenal gland and one was in mediastinal and hilar lesion. The smallest size of the visualized tumor was about 1.0 cm in diameter. In 8 metastatic bone lesions detected by radiography and X-ray CT, 7 (88 %) were demonstrated on /sup 131/I-MIBG scintigram. In 2 liver metastases, 1 (50 %) was demonstrated. In 4 distant lymphnode metastases, 3 (75 %) were imaged. In 8 cases with bone marrow involvement proved by bone marrow biopsy, 3 (38 %) were clearly demonstrated by /sup 131/I-MIBG scintigraphy. It was supposed that /sup 131/I-MIBG scintigraphy was useful in demonstrating not only primary lesions but also bone and bone marrow involvement of neuroblastoma.

  3. 27 CFR 478.131 - Firearms transactions not subject to a NICS check.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Firearms transactions not subject to a NICS check. 478.131 Section 478.131 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL... prescribed for the retention of Form 5300.35 in § 478.129(c). (b) The requirements of this section shall be...

  4. 46 CFR 131.825 - Controls of fire-extinguishing system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Controls of fire-extinguishing system. 131.825 Section... OPERATIONS Markings for Fire Equipment and Emergency Equipment § 131.825 Controls of fire-extinguishing system. Each control cabinet or space containing a valve or manifold for a fire extinguishing system must...

  5. 27 CFR 28.131 - Application for return of wines withdrawn without payment of tax.

    Science.gov (United States)

    2010-04-01

    ... numbers of the containers to be returned. In the case of bottled wines, the number and size of the bottles... wines withdrawn without payment of tax. 28.131 Section 28.131 Alcohol, Tobacco Products and Firearms... Withdrawal of Wine Without Payment of Tax for Exportation, Use on Vessels and Aircraft, Transfer to a Foreign...

  6. Virulence potential and genomic mapping of the worldwide clone Escherichia coli ST131.

    Directory of Open Access Journals (Sweden)

    Jean-Philippe Lavigne

    Full Text Available Recently, the worldwide propagation of clonal CTX-M-15-producing Escherichia coli isolates, namely ST131 and O25b:H4, has been reported. Like the majority of extra-intestinal pathogenic E. coli isolates, the pandemic clone ST131 belongs to phylogenetic group B2, and has recently been shown to be highly virulent in a mouse model, even though it lacks several genes encoding key virulence factors (Pap, Cnf1 and HlyA. Using two animal models, Caenorhabditis elegans and zebrafish embryos, we assessed the virulence of three E. coli ST131 strains (2 CTX-M-15- producing urine and 1 non-ESBL-producing faecal isolate, comparing them with five non-ST131 B2 and a group A uropathogenic E. coli (UPEC. In C. elegans, the three ST131 strains showed intermediate virulence between the non virulent group A isolate and the virulent non-ST131 B2 strains. In zebrafish, the CTX-M-15-producing ST131 UPEC isolates were also less virulent than the non-ST131 B2 strains, suggesting that the production of CTX-M-15 is not correlated with enhanced virulence. Amongst the non-ST131 B2 group isolates, variation in pathogenic potential in zebrafish embryos was observed ranging from intermediate to highly virulent. Interestingly, the ST131 strains were equally persistent in surviving embryos as the non-ST131-group B2 strains, suggesting similar mechanisms may account for development of persistent infection. Optical maps of the genome of the ST131 strains were compared with those of 24 reference E. coli strains. Although small differences were seen within the ST131 strains, the tree built on the optical maps showed that these strains belonged to a specific cluster (86% similarity with only 45% similarity with the other group B2 strains and 25% with strains of group A and D. Thus, the ST131 clone has a genetic composition that differs from other group B2 strains, and appears to be less virulent than previously suspected.

  7. 131I activity quantification of gamma camera planar images

    Science.gov (United States)

    Barquero, Raquel; Garcia, Hugo P.; Incio, Monica G.; Minguez, Pablo; Cardenas, Alexander; Martínez, Daniel; Lassmann, Michael

    2017-02-01

    A procedure to estimate the activity in target tissues in patients during the therapeutic administration of 131I radiopharmaceutical treatment for thyroid conditions (hyperthyroidism and differentiated thyroid cancer) using a gamma camera (GC) with a high energy (HE) collimator, is proposed. Planar images are acquired for lesions of different sizes r, and at different distances d, in two HE GC systems. Defining a region of interest (ROI) on the image of size r, total counts n g are measured. Sensitivity S (cps MBq-1) in each acquisition is estimated as the product of the geometric G and the intrinsic efficiency η 0. The mean fluence of 364 keV photons arriving at the ROI per disintegration G, is calculated with the MCNPX code, simulating the entire GC and the HE collimator. Intrinsic efficiency η 0 is estimated from a calibration measurement of a plane reference source of 131I in air. Values of G and S for two GC systems—Philips Skylight and Siemens e-cam—are calculated. The total range of possible sensitivity values in thyroidal imaging in the e-cam and skylight GC measure from 7 cps MBq-1 to 35 cps MBq-1, and from 6 cps MBq-1 to 29 cps MBq-1, respectively. These sensitivity values have been verified with the SIMIND code, with good agreement between them. The results have been validated with experimental measurements in air, and in a medium with scatter and attenuation. The counts in the ROI can be produced by direct, scatter and penetration photons. The fluence value for direct photons is constant for any r and d values, but scatter and penetration photons show different values related to specific r and d values, resulting in the large sensitivity differences found. The sensitivity in thyroidal GC planar imaging is strongly dependent on uptake size, and distance from the GC. An individual value for the acquisition sensitivity of each lesion can significantly alleviate the level of uncertainty in the measurement of thyroid uptake activity for each patient.

  8. Iodine-131 uptake in a patient with thyroid cancer and rheumatoid arthritis during acupuncture treatment

    Energy Technology Data Exchange (ETDEWEB)

    Otsuka, N.; Fukunaga, M.; Morita, K.; Ono, S.; Nagai, K.; Katagiri, M.; Harada, T.; Morita, R. (Kawasaki Medical School, Okayama (Japan))

    1990-01-01

    A patient with thyroid carcinoma had abnormal accumulation of I-131 in the areas of both feet and hands on whole body scan. The sites of abnormal accumulation of I-131 were similar to those on bone scintigraphy. The radiographic examination of the lesions showed characteristic findings of rheumatoid arthritis, and the presence of small gold needles for acupuncture treatment was demonstrated. There were no findings of bone metastases. Although the mechanism of accumulation of I-131 in this patient is unknown, interpreters of I-131 whole body scintigraphs should keep this case in mind when acupuncture treatment has been done. The authors can only speculate on a common blood flow mechanism for enhanced HMDP and I-131 uptake in this arthritic patient who had been treated by acupuncture.

  9. Relative Biological Effectiveness (RBE) of (131)I Radiation Relative to (60)Co Gamma Rays.

    Science.gov (United States)

    Neshasteh-Riz, Ali; Mahmoud Pashazadeh, Ali; Mahdavi, Seyed Rabie

    2013-01-01

    To assess relative biological effectiveness (RBE) of (131)I radiation relative to (60)Co gamma rays in glioblastoma spheroid cells. : In this experimental study, glioblastoma spheroid cells were exposed to (131)I radiation and (60)Co gamma rays. Radiation induced DNA damage was evaluated by alkaline comet assay. Samples of spheroid cells were treated by radiation from (131)I for four different periods of time to find the dose-response equation. Spheroid cells were also exposed by 200 cGy of (60)Co gamma rays as reference radiation to induce DNA damage as endpoint. Resulted RBE of (131)I radiation relative to (60)Co gamma rays in 100 µm giloblastoma spheroid cells was equal to 1.16. The finding of this study suggests that (131)I photons and electrons can be more effective than (60)Co gamma rays to produce DNA damage in glioblastoma spheroid cells.

  10. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  11. Beta-endorphin 1-31 biotransformation and cAMP modulation in inflammation.

    Directory of Open Access Journals (Sweden)

    Naghmeh Hajarol Asvadi

    Full Text Available A large body of evidence now exists for the immune cell expression, production, and the release of beta-endorphin (BE 1-31 within inflamed tissue. The inflammatory milieu is characterised by increased acidity, temperature and metabolic activity. Within these harsh conditions BE 1-31 is even more susceptible to increased enzymatic degradation over that of plasma or other non-injured tissue. To elucidate the biotransformation pathways of BE 1-31 and provide an insight to the impact of inflamed tissue environments, BE 1-31 and three of its major N-terminal fragments (BE 1-11, BE 1-13 and BE 1-17 were incubated in inflamed tissue homogenates at pH 5.5 for 2 hrs. In addition, the potency of BE 1-31 and five main N--terminal fragments (BE 1-9, BE 1-11, BE 1-13, BE 1-17, BE 1-20 was assessed at mu-opioid receptors (MOR, delta-opioid receptors (DOR, and kappa-opioid receptors (KOR. Opioid receptor potency was investigated by examining the modulation of forskolin induced cAMP accumulation. The majority of the N-terminal fragment of BE 1-31 had similar efficacy to BE 1-31 at MOR. The shortest of the major N-terminal fragments (BE 1-9, had partial agonist activity at MOR but possessed the highest potency of all tested peptides at DOR. There was limited effect for BE 1-31 and the biotransformed peptides at KOR. Major N-terminal fragments produced within inflamed tissue have increased presence within inflamed tissue over that of the parent molecule BE 1-31 and may therefore contribute to BE 1-31 efficacy within disease states that involve inflammation.

  12. Excretion and toxicity evaluation of (131)I-Sennoside A as a necrosis-avid agent.

    Science.gov (United States)

    Yin, Zhiqi; Sun, Lidan; Jin, Qiaomei; Song, Shaoli; Feng, Yuanbo; Liao, Hong; Ni, Yicheng; Zhang, Jian; Liu, Wei

    2017-11-01

    1. Sennoside A (SA) is a newly identified necrosis-avid agent that shows capability for imaging diagnosis and tumor necrosis targeted radiotherapy. As a water-soluble compound, (131)I-Sennoside A ((131)I-SA) might be excreted predominately through the kidneys with the possibility of nephrotoxicity. 2. To further verify excretion pathway and examine nephrotoxicity of (131)I-SA, excretion and nephrotoxicity were appraised. The pharmacokinetics, hepatotoxicity and hematotoxicity of (131)I-SA were also evaluated to accelerate its possible clinical translation. All these studies were conducted in mice with ethanol-induced muscular necrosis following a single intravenous administration of 131I-SA at 18.5 MBq/kg or 370 MBq/kg. 3. Excretion data revealed that (131)I-SA was predominately (73.5% of the injected dose (% ID)) excreted via the kidneys with 69.5% ID detected in urine within 72 h post injection. Biodistribution study indicated that (131)I-SA exhibited initial high distribution in the kidneys but subsequently a fast renal clearance, which was further confirmed by the results of autoradiography and single-photon emission computed tomography-computed tomography (SPECT-CT) imaging. The maximum necrotic to normal muscle ratio reached to 7.9-fold at 48 h post injection, which further verified the necrosis avidity of (131)I-SA. Pharmacokinetic parameters showed that (131)I-SA had fast blood clearance with an elimination half-life of 6.7 h. Various functional indexes were no significant difference (p > 0.05) between before administration and 1 d, 8 d, 16 d after administration. Histopathology showed no signs of tissue damage. 4. These data suggest (131)I-SA is a safe and promising necrosis-avid agent applicable in imaging diagnosis and tumor necrosis targeted radiotherapy.

  13. Can calcification predict {sup 131}I accumulation on metastatic lymph nodes in papillary thyroid carcinoma patients receiving {sup 131}I therapy? Comparison of CT, {sup 131}I WBS and {sup 18}F-FDG PET/CT

    Energy Technology Data Exchange (ETDEWEB)

    Kaneko, Koichiro; Abe, Koichiro; Baba, Shingo; Tanabe, Yoshitaka; Yabuuchi, Hidetake; Hatakenaka, Masamitsu; Honda, Hiroshi [Kyushu University, Department of Clinical Radiology, Graduate School of Medical Sciences, Fukuoka (Japan); Sasaki, Masayuki [Kyushu University, Department of Health Sciences, School of Medicine, 3-1-1 Maidashi, Higashi-ku, Fukuoka (Japan)

    2010-02-15

    The aim of this study was to clarify the predictive significance of nodal calcification in terms of the therapeutic option of {sup 131}I therapy in papillary thyroid carcinoma (PTC) patients. We reviewed 19 computed tomography (CT) examinations of PTC patients on receiving {sup 131}I therapy for the presence of nodal calcification, and compared the {sup 131}I whole-body scintigraphy and {sup 18}F-2-fluoro-2-deoxy-D-glucose (FDG) positron emission tomography (PET)/CT findings. The metastatic lymph nodes (mLNs) were divided into three groups: A, those with calcification; B, those without calcification but belonging to patients who had calcified mLNs; C, those without calcification and belonging to patients who had no calcified mLNs. The incidences of {sup 131}I accumulation and maximum standardised uptake values (SUV max) in the three groups were compared. A total of 70 mLNs were evaluated. Twelve mLNs belonged to group A, 13 to group B and 45 to group C. The incidences of {sup 131}I accumulation were significantly higher in groups A (100%) and B (100%) than in group C (11.1%) (p < 0.0001 for both). The SUVmax was significantly lower in groups A (4.1 {+-} 1.9) and B (3.9 {+-} 1.4) than in group C (7.1 {+-} 4.4) (p = 0.01, p = 0.002, respectively). Our results indicated that calcification in mLNs related to the ability of {sup 131}I accumulation and less dedifferentiation. (orig.)

  14. Tropospheric Aerosol Radiative Forcing Observational eXperiment - University of Washington instrumented C-131A aircraft Data Set

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A is the Tropospheric Aerosol Radiative Forcing Observational eXperiment (TARFOX) - University of Washington instrumented C-131A aircraft data set. The...

  15. Tropospheric Aerosol Radiative Forcing Observational eXperiment - Ames Sun Photometer - University of Washington C-131A aircraft

    Data.gov (United States)

    National Aeronautics and Space Administration — TARFOX_UWC131A_SUNP Data Set was collected from the 6-channel Sun Photometer flown on the University of Washington C-131A aircraft during the Tropospheric Aerosol...

  16. Cytogenetic in thyroid carcinoma and therapy with 131{sup I}; Citogenetica en cancer de tiroides y terapia con 131''I

    Energy Technology Data Exchange (ETDEWEB)

    Popova, L.; Hadjidekova, V.; Christova, R.; Agova, S.; Grudeva, V.; Hadjieva, T.; Dominguez, I.

    2007-07-01

    In order to assess the genotoxic risk of the therapy with radioiodine-131(''131I), the production of micronuclei (MN) and chromosome aberrations (CA) were analyzed in the peripheral blood lymphocytes of group of 26 patients undergoing therapy with this radionuclide for differentiated thyroid carcinoma (DTC). Blood samples were taken immediately before ''131 I administration and 1 month later. The patients underwent radioiodine ablation (RIA) or radioiodine therapy (RIT) after radical thyroidectomy. The amount of orally administered ''131I activity varied from 3330 to 4030 MBq according to the king of therapy (RIA or RIT). results show that after radioiodine therapy there is a significant increase in the frequency of MN and CA. The mean frequencies of MN {+-} Sd before and after the therapy were 10.72 % {+-} 5.84 % and 25.28 %{+-} 12.6% respectively. For CA, the mean frequencies obtained were 1.16% {+-} 0.36% before and 2.3% {+-} 0.87% after the therapy. These findings indicate a genotoxic activity of ''131I therapy estimated after a period of one month. (Author) 38 refs.

  17. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  18. 131I-Traced PLGA-Lipid Nanoparticles as Drug Delivery Carriers for the Targeted Chemotherapeutic Treatment of Melanoma

    Science.gov (United States)

    Wang, Haiyan; Sheng, Weizhong

    2017-05-01

    Herein, folic acid (FA) conjugated Poly(d,l-lactide-co-glycolide) (PLGA)-lipid composites (FA-PL) were developed as nanocarriers for the targeted delivery of insoluble anti-cancer drug paclitaxel (PTX), resulting FA-PLP nanoparticles. Furthermore, 131I, as a radioactive tracer, was used to label FA-PLP nanoparticles (FA-PLP-131I) to evaluate their cell uptake activity, in vivo blood circulation, and biodistribution. The FA-PLP-131I nanoparticles had a spherical morphology with great stability, a narrow size distribution (165.6 and 181.2 nm), and -22.1 mV in average zeta potential. Confocal laser scanning microscopy indicated that the targeting molecule FA promotes PLP-131I uptake by melanoma B16F10 cells, which was further confirmed by the cell incorporation rate via 131I activity detection as measured by a gamma counter. FA-PLP-131I without PTX (FA-PL-131I) shows minor cytotoxicity, good biocompatibility, while FA-PLP-131I was demonstrated to have efficient cell viability suppression compared to free PTX and PLP-131I. Following intravenous injection, the blood circulation half-life of free PTX ( t 1/2 = 5.4 ± 0.23 h) was prolonged to 18.5 ± 0.5 h by FA-PLP-131I. Through FA targeting, the tumor uptake of FA-PLP-131I was approximately 4.41- and 12.8-fold higher compared to that of PLP-131I and free PTX-131I, respectively. Moreover, following 40 days of treatment, FA-PLP-131I showed an improved tumor inhibition effect compared to free PTX and PLP-131I, with no relapse and no remarkable systemic in vivo toxicity. The results demonstrate that the 131I-labeled PLGA-lipid nanoparticle can be simultaneously applied for targeted drug delivery and reliable tracking of drugs in vivo.

  19. {sup 131}I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Mu [Taipei Medical University - Shuang Ho Hospital, Department of Nuclear Medicine, Taipei (China); Taipei Medical University, Department of Radiology, College of Medicine, Taipei (China); Doyle, Pat [London School of Hygiene and Tropical Medicine, Faculty of Epidemiology and Population Health, London (United Kingdom); Tsan, Yu-Tse [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); Taichung Veterans General Hospital, Department of Emergency Medicine, Taichung (China); Chung Shan Medical University, School of Medicine, Taichung (China); Lee, Chang-Hsing [Ton Yen General Hospital, Department of Occupational Medicine, Hsinchu County (China); Wang, Jung-Der [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Cheng Kung University College of Medicine, Department of Public Health, Tainan (China); Chen, Pau-Chung [National Taiwan University College of Public Health, Institute of Occupational Medicine and Industrial Hygiene, Taipei (China); National Taiwan University College of Public Health, Department of Public Health, Taipei (China); National Taiwan University College of Medicine and Hospital, Department of Environmental and Occupational Medicine, Taipei (China); Collaboration: Health Data Analysis in Taiwan (hDATa) Research Group

    2014-02-15

    To evaluate the association between {sup 131}I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative {sup 131}I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of {sup 131}I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10{sup 5} person-years. {sup 131}I was used in the treatment of 6,153 patients (68.8 %) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative {sup 131}I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing {sup 131}I dose (test for trend p = 0.51). No interaction was found between {sup 131}I dose and age (p = 0.94) or {sup 131}I dose and sex (p = 0.99). {sup 131}I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years. (orig.)

  20. 131I treatment for thyroid cancer and risk of developing primary hyperparathyroidism: a cohort study.

    Science.gov (United States)

    Lin, Chien-Mu; Doyle, Pat; Tsan, Yu-Tse; Lee, Chang-Hsing; Wang, Jung-Der; Chen, Pau-Chung

    2014-02-01

    To evaluate the association between (131)I therapy for thyroid cancer and risk of developing primary hyperparathyroidism. This was a nationwide population-based cohort study of patients with thyroid cancer diagnosed during the period 1997-2008. The data were obtained from the Taiwan National Health Insurance Research dataset. The cumulative (131)I dose in each patient was calculated. Hazard ratios (HRs) were calculated using a proportional hazards model to estimate the effect of (131)I therapy on the risk of developing primary hyperparathyroidism in the cohort. A total of 8,946 patients with thyroid cancer were eligible for the final analysis. Among these patients, 8 developed primary hyperparathyroidism during the follow-up period that represented 38,248 person-years giving an incidence rate of 20.9 per 10(5) person-years. (131)I was used in the treatment of 6,153 patients (68.8%) with a median cumulative dose of 3.7 GBq. The adjusted HRs were 0.21 (95% CI 0.02-1.86) and 0.46 (95% CI 0.10-2.10) for those receiving a cumulative (131)I dose of 0.1-3.6 GBq and ≥3.7 GBq, respectively, compared to no therapy. The risk of developing primary hyperparathyroidism did not increase with increasing (131)I dose (test for trend p = 0.51). No interaction was found between (131)I dose and age (p = 0.94) or (131)I dose and sex (p = 0.99). (131)I treatment for thyroid cancer did not increase risk of primary hyperparathyroidism during a 10-year follow-up in this study population. Further research with a longer follow-up period is needed to assess late adverse effects beyond 10 years.

  1. THERAPY OF GRAVES’ DISEASE WITH SODIUM IODIDE-131

    Directory of Open Access Journals (Sweden)

    I Wayan Hartadi Noor

    2013-11-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Graves’ disease is the most common form of thyrotoxicosis, with a peak incidence in the 20-40 year of age group. Females are involved about five times more commonly than male. The easiest sign to recognize patients with Graves’ disease is the present of Graves’ ophthalmopathy. The diagnosis of Graves’ disease may sometimes base only on a physical examination and a medical history. Diffuse thyroid enlargement and sign of thyrotoxicosis, mainly ophthalmopathy and to lesser extent dermopathy, usually adequate for diagnosis. TSH test combined with FT4 test is usually the first laboratory test performs in these patients. The patients suffered Graves’ disease can be treated with antithyroid drug therapy or undergo subtotal Thyroidectomy. Another therapy is by using sodium iodide-131, where this therapy has advantages including easy administration, effectiveness, low expense, and absence of pain. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  2. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  3. Radiosensitive effect of curcumin on thyroid cancer cell death induced by radioiodine-131

    Directory of Open Access Journals (Sweden)

    Hosseinimehr Seyed Jalal

    2014-06-01

    Full Text Available Curcumin is a natural product widely consumed by humans. It has many biological properties. In this study, we investigated the radiosensitive effect of curcumin on thyroid cancer cells against cellular toxicity induced by 131-I. Human thyroid cancer and human non-malignant fibroblast cells (HFFF2 were treated with 131-I and/or curcumin at different concentrations (5, 10 and 25 μg/ml for 48 h. The cell proliferation was measured by determination of the surviving cells by using MTT assay. Our results showed that curcumin increased the killing effect of 131-I on thyroid cancer cells, while it exerted no toxicity on HFFF2 cells. This result shows a promising effect of curcumin on the enhancement of therapeutic effects of 131-I in patients

  4. Cystic thyroid mass following I-131 treatment of papillary thyroid carcinoma: An unusual complication

    Energy Technology Data Exchange (ETDEWEB)

    Morrish, D.W.; Jackson, F.I.; Lalani, Z.H.; Catz, Z.; Sloboda, R. (Univ. of Alberta, Edmonton (Canada))

    1989-12-01

    Several unusual complications of I-131 therapy for thyroid carcinoma are known. Two patients who developed a further unusual event that consisted of a palpable mass and cystic degeneration are described.

  5. The presynaptic Munc13-1 binds alcohol and modulates alcohol self-administration in Drosophila

    Science.gov (United States)

    Das, Joydip; Xu, Shiyu; Pany, Satyabrata; Guillory, Ashley; Shah, Vrutant; Roman, Gregg W.

    2013-01-01

    Munc13-1 is a presynaptic active-zone protein essential for neurotransmitter release and involved in presynaptic plasticity in brain. Ethanol, butanol and octanol quenched the intrinsic fluorescence of the C1 domain of Munc13-1 with EC50s of 52 mM, 26 mM and 0.7 mM, respectively. Photoactive azialcohols photolabeled Munc13-1 C1 exclusively at Glu-582, which was identified by mass spectrometry. Mutation of Glu-582 to alanine, leucine and histidine reduced the alcohol binding two- to five-fold. Circular dichroism studies suggested that binding of alcohol increased the stability of the wild type Munc13-1 compared with the mutants. If Munc13-1 plays some role in the neural effects of alcohol in vivo, changes in the activity of this protein should produce differences in the behavioral responses to ethanol. We tested this prediction with a loss-of-function mutation in the conserved Dunc-13 in Drosophila melanogaster. The Dunc-13P84200/+ heterozygotes have 50% wild type levels of Dunc-13 mRNA and display a very robust increase in ethanol self-administration. This phenotype is reversed by the expression of the rat Munc13-1 protein within the Drosophila nervous system. The present studies indicate that Munc13-1 C1 has binding site(s) for alcohols and Munc13-1 activity is sufficient to restore normal self-administration to Drosophila mutants deficient in Dunc-13 activity. PMID:23692447

  6. Comparative Analysis of Direct and Indirect 131I Measurement Methods from the Stack to Outdoor

    Directory of Open Access Journals (Sweden)

    G. Suhariyono

    2017-11-01

    Full Text Available The radioisotope production facility at PUSPIPTEK Serpong produces and processes 131I that can disperse to the settlements (community and the environment around the Serpong Nuclear Area (SNA. 131I is produced routinely for medical uses in hospitals and pharmacies, for both domestic uses and export. 131I is a beta and gamma emitting radioactive material and can cause thyroid cancer. The problem was that there was so far no research and in-depth assessment of the aerial dispersion of 131I radioactivity emitted from the radioisotope production stack to the environment at actual conditions. The research was conducted through simultaneous measurement of 131I radioactivity in the stack of the 131I radioisotope production facility, Serpong, and outdoor in house courtyards around SNA in normal condition (no accident based on the variations of the distance and wind direction. Direct measurements were carried out with a portable in-situ NaI(Tl detector at outdoor, and with a LaBr3 detector in the stack. Indirect measurements were carried out by using charcoal filter and vacuum pump in the stack and outdoor. The direct measurement method has many advantages over the indirect measurement. The direct measurement method was found to be more accurate, less expensive, easier to operate, needing just one operator in its implementation, portable, and can be operated continuously and for long durations. The overall activity concentrations of 131I on average obtained by either direct or indirect method were still below the upper limit of 131I activity concentration in the air (530 Bq/m3 stipulated by the Regulation of the Chairman of BAPETEN (Perka BAPETEN No. 7/2013. 

  7. Uso do TSH recombinante humano no tratamento do bócio multinodular com iodo 131

    OpenAIRE

    Mesa Júnior, Cléo Otaviano; Graf, Hans

    2003-01-01

    Orientador : Hans Graf Dissertaçao (mestrado) - Universidade Federal do Paraná, Setor de Ciencias da Saúde Resumo: O uso do iodo 131 (131l) no tratamento de pacientes com bocio multinodular (BMN) ja esta bem estabelecido, porem devido as baixas captacoes de 1311 destes bocios, geralmente sao necessarias altas doses terapeuticas de iodo radioativo. Este estudo tem como objetivos verificar em pacientes com BMN, apos uso de TSH recombinante humano (rhTSH - recombinant human TSH), o aumento...

  8. Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131

    Science.gov (United States)

    2014-05-01

    solution, and a pit is subsequently formed. Dislocation of the particle may have been facilitated by the AFM tip, formation of corrosion products, or...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 by Joseph P. Labukas and Kenneth E. Strawhecker ARL-TR-6925 May...Scanning Probe Investigation of Pitting Corrosion on Aluminum 5083 H131 Joseph P. Labukas and Kenneth E. Strawhecker Weapons and Materials

  9. 32 CFR 935.131 - Right-hand side of the road.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Right-hand side of the road. 935.131 Section 935... INSULAR REGULATIONS WAKE ISLAND CODE Motor Vehicle Code § 935.131 Right-hand side of the road. Each person driving a motor vehicle on Wake Island shall drive on the right-hand side of the road, except where...

  10. Detection and tracing of the medical radioisotope 131I in the Canberra environment

    Science.gov (United States)

    Gilfillan, Nathan R.; Timmers, Heiko

    2012-10-01

    The transport and radioecology of the therapeutical radioisotope 131I has been studied in Canberra, Australia. The isotope has been detected in water samples and its activity quantified via characteristic J-ray photo peaks. A comparison of measurements on samples from upstream and downstream of the Canberra waste water treatment plant shows that 131I is discharged from the plant outflow into the local Molonglo river. This is consistent with observations in other urban environments. A time-correlation between the measured activities in the outflow and the therapeutical treatment cycle at the hospital identifies the medical treatment as the source of the isotope. Enhanced activity levels of 131I have been measured for fish samples. This may permit conclusions on 131I uptake by the biosphere. Due to the well-defined and intermittent input of 131I into the sewage, the Canberra situation is ideally suited for radioecological studies. Furthermore, the 131I activity may be applied in tracer studies of sewage transport to and through the treatment plant and as an indicator of outflow dilution following discharge to the environment.

  11. Iodine-131 Metaiodobenzylguanidine Therapy for Neuroblastoma: Reports So Far and Future Perspective

    Directory of Open Access Journals (Sweden)

    Daiki Kayano

    2015-01-01

    Full Text Available Neuroblastoma, which derives from neural crest, is the most common extracranial solid cancer in childhood. The tumors express the norepinephrine (NE transporters on their cell membrane and take in metaiodobenzylguanidine (MIBG via a NE transporter. Since iodine-131 (I-131 MIBG therapy was firstly reported, many trails of MIBG therapy in patients with neuroblastoma were performed. Though monotherapy with a low dose of I-131 MIBG could achieve high-probability pain reduction, the objective response was poor. In contrast, more than 12 mCi/kg I-131 MIBG administrations with or without hematopoietic cell transplantation (HCT obtain relatively good responses in patients with refractory or relapsed neuroblastoma. The combination therapy with I-131 MIBG and other modalities such as nonmyeloablative chemotherapy and myeloablative chemotherapy with HCT improved the therapeutic response in patients with refractory or relapsed neuroblastoma. In addition, I-131 MIBG therapy incorporated in the induction therapy was proved to be feasible in patients with newly diagnosed neuroblastoma. To expand more the use of MIBG therapy for neuroblastoma, further studies will be needed especially in the use at an earlier stage from diagnosis, in the use with other radionuclide formations of MIBG, and in combined use with other therapeutic agents.

  12. Observation of radioactive iodine ({sup 131}I, {sup 129}I) in cropland soil after the Fukushima nuclear accident

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Hideshi, E-mail: hfuji@affrc.go.jp

    2016-10-01

    During the early stages of the Fukushima nuclear accident, the temporal variations of {sup 131}I deposited on the ground and of {sup 131}I accumulated in cropland soil were monitored at a fixed location in Japan. Moreover, concentrations of long-lived radioactive iodine ({sup 129}I) in atmospheric deposits and soil were measured to examine the feasibility of retrospectively reconstructing {sup 131}I levels from the levels of accident-derived {sup 129}I. The exceptionally high levels of {sup 131}I in deposits and soil were attributed to rainfall-related deposition of radionuclides. In the crop field studied, the losses of deposited {sup 131}I and {sup 129}I due to volatilization were small. The atomic ratio {sup 129}I/{sup 131}I in the topsoil corresponded to the same ratio in deposits. The {sup 131}I concentrations measured in the topsoil were very consistent with the {sup 131}I concentrations reconstructed from the {sup 129}I concentrations in the soil. - Highlights: • A high level of {sup 131}I contamination occurs through rainfall-related deposition. • Only a small loss of deposited radioactive iodine occurs via volatilization. • The {sup 129}I/{sup 131}I ratio in soil corresponds to the ratio in atmospheric deposit. • The feasibility of retrospectively reconstructing {sup 131}I is confirmed.

  13. Production of fusion radionuclides: Molybdenum-99/ Iodine - 131 and Xenon-133; Produccion de los radionucleidos de fision: Molibdeno-99, Yodo-131 y Xenon-133

    Energy Technology Data Exchange (ETDEWEB)

    Barrachina, M.; Carrillo, D.

    1982-07-01

    This report presents a new radiochemical method for industrial production of the radionuclides: molybdenum-99, iodine-131 and xenon-133. The above mentioned method based on the alkaline metathesis reaction of irradiated uranium (IV) fluoride, presents the best characteristics for the proposed objective. The study deals with the analysis of that reaction and the separation and purification processes. (Author) 71 refs.

  14. Radioactive Body Burden Measurements in 131Iodine Therapy for Differentiated Thyroid Cancer: Effect of Recombinant Thyroid Stimulating Hormone in Whole Body 131Iodine Clearance

    OpenAIRE

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive 131I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation...

  15. Radioimmunotherapy in refractory b-cell nonhodgkins lymphoma with I-131-labeled chimeric anti cd-20 c2b8 (I-131 rituximab): preliminary result

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hye Jin; Park, Yeon Hee; Kim, Sung Eun and others [Korea University Medical School, Seoul (Korea, Republic of)

    2005-07-01

    Recently, the native chimeric human-mouse anti CD-20 antibody IDEC-C2B8 (Rituximab) has been widely applied in NHL. This ongoing phase study was to evaluate whether radioimmunotherapy (RIT) with I-131 rituximab is effective in refractory B-cell NHL. Inclusion criteria were as follows: B-cell NHL with relapsed or refractory to primary standard therapy, measurable disease, adequate hematologic, renal, and hepatic function, informed consent. The rituximab (Mabthera, Roach) was radiolabeled with iodine-131(I-131) using a modified chloramine T method with high radiochemical purity (95%) and preservation of immuno-reactivity. All patients received loading doses of unlabeled rituximab (median, 40 mg: range, 20{approx}70 mg) immediately prior to administration of therapeutic dose (51.4{approx}152.2 MBq/kg), and then underwent gamma camera scan. 11 patients were enrolled (4 low-grade B-cell NHL, 7 DLBCL, median age 63 years). Patients had received a median of three prior chemotherapy regimens. The objective response rate was 36.4% (1 CR, 3 PRs). These all responses were observed in low-grade B-cell NHL, except one with DLBCL. Adverse events were primarily hematologic toxicities; the incidence of grade 3/4 neutropenia, thrombocytopenia, and anemia was 27.3%, 45.5%, and 18.2%, respectively. The treatment-related mortality was observed in one patient, who had been previously treated with high-dose chemotherapy plus TBI with autologous stem cell transplantation. RIT with I-131 rituximab seems to be effective tolerable in refractory low-grade B-cell NHL, although modest activity in refractory DLBCL. Further studies to define the efficacy of I-131 rituximab in DLBCL are warranted.

  16. Pulmonary scintiscanning using /sup 131/iodine-labeled Aprindin in experimental pneumonia and pulmonary embolism. Lungenszintigraphie mit /sup 131/Jod-Aprindin bei experimenteller Pneumonie und Lungenembolie

    Energy Technology Data Exchange (ETDEWEB)

    Doll, M.

    1983-10-25

    An antiarrhythmic agent generally known as Aprindin showed to be accumulated in a highly selective way in the lungs (labeled with iodine-125) and its pharmacokinetic properties were observed to remain largely unchanged following iodination. Unlike human albumin particles labeled with iodine-131 or 99mTc, which are used for conventional 'perfusion' scans, this substance is assumed to enable 'parenchymal' scintiscanning. The study described here was performed to find out whether the distribution pattern of iodine-131-labeled Aprindin is altered due to pathological changes in the parenchymal structure of the lungs. For this purpose, pulmonary embolism and pneumonia were chosen, which are often difficult to differentiate from each other, and studied in animal experiments. Moreover, a relatively simple method of iodination is described. Following administration of 131-I-Aprindin and 99mTc-MAA two successive scintigrams were obtained from rabbits previously assigned to three different study groups. The first group included healthy control animals, while pulmonary embolism was provoked in the second group prior to the examinations. The scintigrams recorded after administration of 131-I-Aprindin gave no evidence of changes in the animals showing embolism as compared to healthy rabbits, whereas the 'perfusion' scintiscans showed the anticipated regions of reduced activity. In the third group, where pneumonia had been induced, the scintigrams obtained following injection of 131-I-Aprindin were marked by considerably reduced levels of activity in the diseased areas. It was concluded that the combined use of the methods tested here enables diagnostic differentiation between pulmonary embolism and pneumonia, the two pathological conditions chosen for this study. It still remains to be investigated in further studies, in which way this combination method can be used in clinical practice. (TRV).

  17. 131I-MIBG myocardial scintigraphy in patients with Parkinson's disease

    Directory of Open Access Journals (Sweden)

    Tuan-feng YANG

    2016-06-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG, which can be taken by cardiac sympathetic postganglionic fibers, is an imaging agent to assess the cardiac sympathetic nerve function. The present study is to assess the cardiac sympathetic nerve function of patients with Parkinson's disease (PD by 131I-MIBG myocardial scintigraphy and preliminarily explore its applications in the early diagnosis of PD.  Methods Twenty-one eligible PD patients (16 early PD and 5 late PD and 9 normal controls were enrolled in the study. Unified Parkinson's Disease Rating Scale (UPDRS and Hoehn-Yahr stage were used to evaluate the severity of PD. Planar images of chest were obtained at different time points (15 min, 4 h and 24 h after injection of 3 mCi 131I-MIBG, and then the 131I-MIBG myocardial uptake ratios were calculated.  Results 1 The 131I-MIBG myocardial uptake ratios in PD group at 15 min (1.67 ± 0.38, 4 h (1.53 ± 0.47 and 24 h (1.35 ± 0.42 after injection were lower than those in the normal control group respectively (P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the PD group reduced over time (P = 0.002, 0.000, 0.000. 2 The 131I-MIBG myocardial uptake ratios in the early and late PD groups at 15 min [(1.73 ± 0.40 and (1.50 ± 0.30], 4 h [(1.58 ± 0.51 and (1.37 ± 0.31], 24 h [(1.39 ± 0.46 and (1.24 ± 0.29] after injection were lower than those in the normal control group respectively (early PD: P = 0.000, 0.000, 0.000; late PD: P = 0.000, 0.000, 0.000, and the 131I-MIBG myocardial uptake ratios in the early and late PD groups reduced over time (early PD: P = 0.012, 0.000, 0.000; late PD: P = 0.039, 0.001, 0.024.  Conclusions Cardiac sympathetic nerve damage could occur in PD patients, even at an early stage of PD. 131I-MIBG myocardial scintigraphy may help in the early diagnosis of PD. DOI: 10.3969/j.issn.1672-6731.2016.06.008

  18. Evolutionary History of the Global Emergence of the Escherichia coli Epidemic Clone ST131.

    Science.gov (United States)

    Stoesser, Nicole; Sheppard, Anna E; Pankhurst, Louise; De Maio, Nicola; Moore, Catrin E; Sebra, Robert; Turner, Paul; Anson, Luke W; Kasarskis, Andrew; Batty, Elizabeth M; Kos, Veronica; Wilson, Daniel J; Phetsouvanh, Rattanaphone; Wyllie, David; Sokurenko, Evgeni; Manges, Amee R; Johnson, Timothy J; Price, Lance B; Peto, Timothy E A; Johnson, James R; Didelot, Xavier; Walker, A Sarah; Crook, Derrick W

    2016-03-22

    Escherichia colisequence type 131 (ST131) has emerged globally as the most predominant extraintestinal pathogenic lineage within this clinically important species, and its association with fluoroquinolone and extended-spectrum cephalosporin resistance impacts significantly on treatment. The evolutionary histories of this lineage, and of important antimicrobial resistance elements within it, remain unclearly defined. This study of the largest worldwide collection (n= 215) of sequenced ST131E. coliisolates to date demonstrates that the clonal expansion of two previously recognized antimicrobial-resistant clades, C1/H30R and C2/H30Rx, started around 25 years ago, consistent with the widespread introduction of fluoroquinolones and extended-spectrum cephalosporins in clinical medicine. These two clades appear to have emerged in the United States, with the expansion of the C2/H30Rx clade driven by the acquisition of ablaCTX-M-15-containing IncFII-like plasmid that has subsequently undergone extensive rearrangement. Several other evolutionary processes influencing the trajectory of this drug-resistant lineage are described, including sporadic acquisitions of CTX-M resistance plasmids and chromosomal integration ofblaCTX-Mwithin subclusters followed by vertical evolution. These processes are also occurring for another family of CTX-M gene variants more recently observed among ST131, theblaCTX-M-14/14-likegroup. The complexity of the evolutionary history of ST131 has important implications for antimicrobial resistance surveillance, epidemiological analysis, and control of emerging clinical lineages ofE. coli These data also highlight the global imperative to reduce specific antibiotic selection pressures and demonstrate the important and varied roles played by plasmids and other mobile genetic elements in the perpetuation of antimicrobial resistance within lineages. Escherichia coli, perennially a major bacterial pathogen, is becoming increasingly difficult to manage due to

  19. Radioactive body burden measurements in (131)iodine therapy for differentiated thyroid cancer: effect of recombinant thyroid stimulating hormone in whole body (131)iodine clearance.

    Science.gov (United States)

    Ravichandran, Ramamoorthy; Al Saadi, Amal; Al Balushi, Naima

    2014-01-01

    Protocols in the management of differentiated thyroid cancer, recommend adequate thyroid stimulating hormone (TSH) stimulation for radioactive (131)I administrations, both for imaging and subsequent ablations. Commonly followed method is to achieve this by endogenous TSH stimulation by withdrawal of thyroxine. Numerous studies worldwide have reported comparable results with recombinant human thyroid stimulating hormone (rhTSH) intervention as conventional thyroxine hormone withdrawal. Radiation safety applications call for the need to understand radioactive (131)I (RA(131)I) clearance pattern to estimate whole body doses when this new methodology is used in our institution. A study of radiation body burden estimation was undertaken in two groups of patients treated with RA(131)I; (a) one group of patients having thyroxine medication suspended for 5 weeks prior to therapy and (b) in the other group retaining thyroxine support with two rhTSH injections prior to therapy with RA(131)I. Sequential exposure rates at 1 m in the air were measured in these patients using a digital auto-ranging beta gamma survey instrument calibrated for measurement of exposure rates. The mean measured exposure rates at 1 m in μSv/h immediately after administration and at 24 h intervals until 3 days are used for calculating of effective ½ time of clearance of administered activity in both groups of patients, 81 patients in conventionally treated group (stop thyroxine) and 22 patients with rhTSH administration. The (131)I activities ranged from 2.6 to 7.9 GBq. The mean administered (131)I activities were 4.24 ± 0.95 GBq (n = 81) in "stop hormone" group and 5.11 ± 1.40 GBq (n = 22) in rhTSH group. The fall of radioactive body burden showed two clearance patterns within observed 72 h. Calculated T½eff values were 16.45 h (stop hormone group) 12.35 h (rhTSH group) for elapsed period of 48 h. Beyond 48 h post administration, clearance of RA(131)I takes place with T½eff> 20 h in both groups

  20. Radiochemical purity, at expiry, and radiochemical stability of iodine-131 labelled meta-iodobenzylguanidine concentrates for intravenous infusion.

    Science.gov (United States)

    Wafelman, A R; Hoefnagel, C A; Maes, R A; Beijnen, J H

    1996-08-01

    The determination of the amount of free [131I]iodide in [131I]metaiodobenzylguanidine ([131I]MIBG) concentrates for intravenous infusion under different storage conditions derived from daily practice. The percentage of free [131I]iodide was determined in [131I]MIBG concentrates (1.6-3.9 GBq in 7.5 ml), kept on dry ice (up to expiry, 3 days after production) or, after thawing, at room temperature (up to 24 h). A validated solid phase extraction (SPE) assay was used. Free [131I]iodide increased from 1.9% +/- 0.34% at production to 4.4% +/- 0.67% (mean +/- SD; n = 5) at expiry in 3.7 GBq per 7.5 ml [131I]MIBG infusion concentrates stored on dry ice (-78 degrees C). At room temperature, formation of free [131I]iodide was found to be dependent on the radioactive concentration of the fluid. [131I]iodide levels increased from 3.1%, immediately after thawing, to 6.6% and 16.6% at t = 5 and 24 h, respectively, for a 3.9 GBq per 7.5 ml concentrate. The investigated formulation of [131I]MIBG concentrates, stored in its original packing containing dry ice, can generally be used up to expiry. After thawing, the undiluted concentrates should be administered to a patient within 3.5 h.

  1. Radioiodine (1-131) Dose for the Treatment of Hyperthyroidism in Rajavithi Hospital.

    Science.gov (United States)

    Kuanrakcharoen, Pichit

    2016-02-01

    The main cause of hyperthyroidism is diffuse toxic goiter (Graves' disease), and the treatment of choice after medical therapy failure is radioiodine (I-131). There are two common methods of determining the optimal I-131 dose: calculated dose or fixed dose. The calculated dose method is based on the following formula: 75-200 microcuri/gram of thyroid gland divided by the percentage of radioiodine uptake at 24 hours (24-hour RAIU). As this is quite complex, some centers use fixed doses, such as 5, 10 or 15 mCi because it is simpler. At Rajavithi Hospital, the applied dose of I-131 is determined based on the thyroid gland weight assessed by palpation and other clinical factors. To study the mean I-131 dose for the initial treatment of hyperthyroidism in Rajavithi Hospital, to find the clinical factors that correlate with I-131 treatment dose, and to devise a formula to predict the optimal I-131 treatment dose. This was a retrospective study of 510 patients with a diagnosis of hyperthyroidism who received initial I-131 treatment at the Department of Nuclear Medicine in Rajavithi Hospital between January 2014 and June 2015. Baseline characteristics including age, sex, age at diagnosis, duration of antithyroid drug (ATD) therapy, gland weight (g), 3-hour RAIU and I-131 treatment dose were reviewed from medical records. The mean age ± SD was 41.93 ± 14.11 years (range 14-81 years), and the male to female ratio was 4.1:1. The mean duration of ATD therapy was 3.54 ± 4.02 years (min-max, 0.8-40.6 years). The mean gland weight was 54.35 ± 32.95 grams, and the mean 3-hour RAIU was 55.5 ± 23.69%. The mean I-131 treatment dose was 14.84 ± 5.71 mCi (min-max, 7-30 mCi). There was no significant correlation between dose and age, age at diagnosis, duration of A TD therapy or 3-hour RAIU. The study showed a significant correlation between I-131 dose and gland size, r = 0.938 (p hyperthyroidism after medical therapy failure, and there are various techniques for determining the

  2. Use of /sup 131/I-MIBG scintigraphy in the evaluation of suspected pheochromocytoma

    Energy Technology Data Exchange (ETDEWEB)

    Swensen, S.J.; Brown, M.L.; Sheps, S.G.; Sizemore, G.W.; Gharib, H.; Grant, C.S.; van Heerden, J.A.

    1985-05-01

    Studies at the University of Michigan have shown that /sup 131/I-metaiodobenzylguanidine (/sup 131/I-MIBG) is an effective agent for the diagnosis and localization of pheochromocytomas and paragangliomas. The authors conducted a study that confirmed and expanded that finding. From January 1983 to March 1984, 48 patients at our institution had 51 /sup 131/I-MIBG scans during the workup of suspected sporadic or metastatic pheochromocytoma. Scintigrams were obtained after 500 microCI of /sup 131/I-MIBG had been administered intravenously. The final diagnosis (true-positive, false-negative, or false-positive result) was made at operation and pathologic examination. A true-negative diagnosis was confirmed by normal plasma and fractionated urinary levels of catecholamines and metabolites and, in most patients, computed tomography (CT). The overall sensitivity of /sup 131/I-MIBG scanning was 77%, specificity was 96%, and accuracy was 86%. This test is fairly sensitive in the workup of patients with known or suspected recurrent or metastatic pheochromocytoma. It may also be helpful in the evaluation of suspected sporadic pheochromocytoma when CT findings are normal.

  3. Subchronic toxicity and mutagenicity/genotoxicity studies of Irvingia gabonensis extract (IGOB131).

    Science.gov (United States)

    Kothari, Shil C; Shivarudraiah, Prasad; Venkataramaiah, Suresh Babu; Gavara, Swapna; Soni, Madhu G

    2012-05-01

    African Bush Mango from Irvingia gabonensis is a West African culinary fruit and the mucilage from this fruit seed is used to make traditional soups and sauces. Extract from the kernel (IGOB131) has been claimed for its health benefits. In the present investigations, potential adverse effects, if any, of IGOB131 were investigated in dose-response 90-day study and genotoxicity studies. In the subchronic study, Sprague Dawley rats (20/sex/group) were gavaged with I. gabonensis extract (IGOB131) at dose levels of 0, 100, 1000 and 2500 mg/kg body weight (bw)/day for 90-days. No treatment-related changes in clinical signs, functional observations, mortality, ophthalmologic observations, body weights, body weight gain or feed consumption were noted. Similarly, hematological, clinical chemistry, urine analysis parameters, and organ weights did not reveal any toxicologically significant treatment-related changes. No treatment-related macroscopic and microscopic abnormalities were noted at the end of treatment period. The mutagenicity as evaluated by Ames assay, in vitro and in vivo chromosomal aberration test and in vivo micronucleus assay did not reveal any genotoxicity of IGOB131. The results of subchronic toxicity study suggest the no-observed-adverse-effect level (NOAEL) for I. gabonensis extract (IGOB131) as ≥ 2500 mg/kg bw/day, the highest dose tested. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Detection of multiple endocrine tumours using {sup 131}I-MIBG

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, C.A. [Royal Brisbane Hospital, Herston, QLD (Australia). Department of Nuclear Medicine

    1998-03-01

    Full text: An {sup 131}l-MIBG scan was requested in an effort to locate an endocrine tumour after the patient presented with a history of funny turns, intermittent hypertension and elevated urinary catecholamines. The patient was injected with {sup 131}l-MIBG, and scanned 48 and 72 hours post-injection. Anterior and posterior static images of the torso identified several abnormal accumulations of {sup 131}l-MIBG. To help with the diagnosis a {sup 99}mTc-MPP scan followed. Blood pool images showed areas of intense activity matching some of the abnormalities on the {sup 131}l-MIBG scan. The delayed images were unremarkable. Some of these abnormalities were palpable on physical examination and the patient was aware of these lesions since childhood. Surgical excision of five tumours was performed. Histology of {sup 131}l tumours confirmed the diagnosis of ganglioneuroma. The nuclear medicine scans successfully identified the location and type of tumour responsible for the patient``s hormonal problems.

  5. False-positive I-131 scan by contaminated muffler in a patient with thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Han Kyung; Kim, Min Woo; Jeong, Hwan Jeong; Sohn, Myung Hee [Chonbuk National University Hospital, Chonju (Korea, Republic of)

    2006-02-15

    A 39-year-old female patient who had undergone a total thyroidectomy for a papillary thyroid carcinoma underwent a whole body scan with I-131. The I-131 scan was performed 72 hours after administering 185 MBq (5 mGi) of an I-131 solution. The anterior image of head, neck, and upper chest showed multiple areas of increased uptake in the mediastinal area considering of functional metastasis. However, radioactivity was not evident in the image taken after removing her clothes and muffler. The image obtained after placing the muffler on the pallet showed that the radioactivity was still present. It is well known that artifacts on an I-131 scan can be produced by styling hair sputum, drooling during sleep, chewing gum, and paper or a cloth handkerchief that is contaminated with the radioactive iodine from either perspiration or saliva. This activity might be mistaken for a functional metastasis. Therefore, it is essential that an image be obtained after removing the patient's clothes. In this study, artifacts due to a contaminated muffler on the I-131 scan were found. These mimicked a functional metastasis of the mediastinal area in a patient with a papillary thyroid carcinoma.

  6. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  7. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  8. Optimization of the therapeutic dose of {sup 131}I for thyroid differentiated carcinoma; Otimizacao da dose terapeutica com {sup 131}I para carcinoma diferenciado da tiroide

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Fabiana Farias de

    2002-09-01

    I-131 thyroid cancer therapy is based on the strategy of concentrating radioactive iodine in the thyroid tissue, to completetly eliminate thyroid tissue and functioning thyroid cancer metastases remaining after thyroidectomy. In Brazil, fixed activities of {sup 131} I generally are given, sometimes either delivering insufficient activities to ablate all of the remnants, or unnecessarily high activities, with patients remaining in the hospital for some period of time. This investigation proposes a protocol of individualized planning of ablative doses, based on individual patients metabolisms and measured thyroid remnant masses. Simulated thyroid remnants were fabricated in various forms, volumes and activities, and optimum image acquisition parameters were determined using Single-Photon Emission Computed Tomography 9SPECT). Resultant images were evaluated, to determine the apparent volumes and the {sup 131} I concentrations. I-131 metabolism was studied in 9 patients who had undergone thyroidectomies. Their thyroid remnant masses were determined applying the same parameters used in SPECT simulation studies, and the optimum activity for their therapy was calculated and compared to the established fixed activity of 3.7 GBq (100 mCi), which would have normally been assigned. Background subtraction using the method of percent maximum counts, using a value of 67.5%, combined with scatter correction (triple energy window method), was shown to be optimum for SPECT quantification of volumes between 3-10 ml. Errors in the method were below 9% for sources with regular geometries and around 11% for sources with irregular geometries. In the patient studies, it was observed that 78% of patients could have received reduced activities of {sup 131} (from 0.8-3-2. GBq (20-87 nCi). In addition, 33% of these patients could have received low enough activities to have discharged from the hospital, using an individualized administration scheme. This could also have resulted in a dose

  9. Melanoma vectorized radiotherapy: preclinical evaluation of a new marker labelled by iodine 131; Radiotherapie vectorisee du melanome: evaluation preclinique d un nouveau vecteur marque par l iode 131

    Energy Technology Data Exchange (ETDEWEB)

    Bonnet, M.; Papon, J.; Miot-Noirault, E.; Madelmont, J.C.; Chezal, J.M.; Moins, N. [INSERM/UdA, EA4231, UMR 990, 63 - Clermont Ferrand (France); Mishellany, F.; Penault-Llorca, F.; Cayre, A. [laboratoire d anatomopathologie, CJP, 63 - Clermont-Ferrand (France)

    2010-05-15

    A significant anti tumoral effect of the internal vectorized radiotherapy using the compound {sup 131}I-ICF01012 is demonstrated on different models of melanomas, whatever be their aggressive potential, the quantity and localisation of the melanoma target. this effect is associated to an inhibition of the tumors cells dissemination towards lungs. The optimization of the protocol therapy is underway to get a maximum therapy efficiency associated to a toxicity controlled on non target-organs. (N.C.)

  10. Place of synthesis anti thyroids in the hyperthyroidism treatment by iodine 131; Place des antithyroidiens de synthese dans le traitement par iode 131 des hyperthyroidies

    Energy Technology Data Exchange (ETDEWEB)

    Clerc, J. [Hopital Necker, 75 - Paris (France)

    2000-01-01

    The prescription of synthesis anti thyroids allows to get a fast control of hyperthyroidism when the average time of curing after iodine 131 varies from 6 to 12 weeks, according to the level of radiation doses. It allows to treat the patients in euthyroidism and to avoid aggravation of thyrotoxicosis in the following of the iodine and is particularly useful for the old patients with a cardio vascular risk.

  11. Micronuclei induction by {sup 131}I exposure. Study in hyperthyroidism patients

    Energy Technology Data Exchange (ETDEWEB)

    Gutierrez, S.; Carbonell, E.; Creus, A.; Marcos, R. [Grup de Mutagenesi, Departament de Genetica i de Microbiologia, Edifici Cn, Universitat Autonoma de Barcelona, Bellaterra (Spain); Galofre, P. [Servei de Medicina Nuclear, Ciutat Sanitaria i Universitaria Vall d`Hebron, Barcelona (Spain)

    1997-01-03

    To evaluate the eventual genetic damage induced by therapeutic exposure to {sup 131}I, we have studied the presence of micronuclei (MN) in binucleated peripheral blood lymphocytes from a group of 28 hyperthyroidism patients who received {sup 131}I sodium iodide, via oral administration. The study was conducted over time and blood samples were obtained before the treatment, and 1 week, 1 month and 3 months after it. The results obtained indicate a positive relationship between dose and BNMN frequency as calculated by the linear regression coefficient, showing significant increases in the frequency of MN and BNMN (binucleated cells with MN) in the subgroup of patients that received more than 500 MBq. Taking into account that the patients studied were treated with relatively low doses of {sup 131}I, our positive results support the view that the MN assay is sensitive enough to monitor the chromosome damage resulting from the exposure.

  12. Breast ultrasound in 22,131 asymptomatic women with negative mammography.

    Science.gov (United States)

    Girardi, Veronica; Tonegutti, Mara; Ciatto, Stefano; Bonetti, Franco

    2013-10-01

    To evaluate increment cancer detection rate generated by ultrasound (US). US only detected cancers were assessed for 22,131 self-referring asymptomatic women with negative mammography and subgroups by age, previous cancer, breast density. Invasive assessment and surgical biopsy rate were evaluated. The overall US detection was 1.85 per thousand (41/22,131). In the subgroups it was: 1.95 per thousand (22/11,274) in women breasts (p = 0.17) vs 1.56 per thousand (19/12,171) in fatty breasts. The US generated invasive assessment was 1.9% (422/22,131). The benign to malignant open surgical biopsy ratio was 0.17 (7/41). Adding US to negative mammography allowed for substantial incremental cancer detection rate (1.85 per thousand), particularly at age breast cancer and in dense breasts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Transfer of /sup 131/I and /sup 95m/Tc from pasture to goat milk

    Energy Technology Data Exchange (ETDEWEB)

    Bondietti, E.A.; Garten, C.T. Jr.

    1984-01-01

    Field measurements were made in 1983 on the transfer of /sup 131/I and /sup 95m/Tc from spray-contaminated pasture to goat's milk. The transfer of /sup 131/I to milk was similar to that used for mathematical models in US Nuclear Regulatory Commission Regulatory Guide 1.109, which was derived from stall-feeding experiments using capsulized doses. Compared to /sup 131/I, the /sup 95m/Tc transferred to milk was about 5600 times less. The lower transfer resulted from both immobilization of technetium on pasture prior to ingestion as well as reduced gastrointestinal absorption. The results show that the food chain transfer of technetium to milk is much less than that previously expected based on inferences made from metabolism studies. 6 references, 4 figures, 1 table.

  14. Radionuclide 131I-labeled multifunctional dendrimers for targeted SPECT imaging and radiotherapy of tumors

    Science.gov (United States)

    Zhu, Jingyi; Zhao, Lingzhou; Cheng, Yongjun; Xiong, Zhijuan; Tang, Yueqin; Shen, Mingwu; Zhao, Jinhua; Shi, Xiangyang

    2015-10-01

    We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and labeling of radioactive iodine-131 (131I). The generated multifunctional 131I-G5.NHAc-HPAO-PEG-FA dendrimers were characterized via different methods. We show that prior to 131I labeling, the G5.NHAc-HPAO-PEG-FA dendrimers conjugated with approximately 9.4 HPAO moieties per dendrimer are noncytotoxic at a concentration up to 20 μM and are able to target cancer cells overexpressing FA receptors (FAR), thanks to the modified FA ligands. In the presence of a phenol group, radioactive 131I is able to be efficiently labeled onto the dendrimer platform with good stability and high radiochemical purity, and render the platform with an ability for targeted SPECT imaging and radiotherapy of an FAR-overexpressing xenografted tumor model in vivo. The designed strategy to use the facile dendrimer nanotechnology may be extended to develop various radioactive theranostic nanoplatforms for targeted SPECT imaging and radiotherapy of different types of cancer.We report the synthesis, characterization, and utilization of radioactive 131I-labeled multifunctional dendrimers for targeted single-photon emission computed tomography (SPECT) imaging and radiotherapy of tumors. In this study, amine-terminated poly(amidoamine) dendrimers of generation 5 (G5.NH2) were sequentially modified with 3-(4'-hydroxyphenyl)propionic acid-OSu (HPAO) and folic acid (FA) linked with polyethylene glycol (PEG), followed by acetylation modification of the dendrimer remaining surface amines and

  15. Unexpected Uptake by the Gallbladder in Post-Ablative I-131 Scan

    Directory of Open Access Journals (Sweden)

    Kemal Ünal

    2015-06-01

    Full Text Available A 47-year-old woman was diagnosed as papillary thyroid carcinoma. I-131 ablation therapy was applied following total thyroidectomy, and the whole-body scan revealed a focus of increased uptake in the right upper quadrant. Lateral view images of the uptake site showed that the focus was located near the right liver lobe. The patient was referred to radiology department for correlative abdominal Computed Tomography (CT and Ultrasonography (US to rule out a possible liver metastasis. CT images detected a gallstone in the corresponding area, which was verified by US. These methods did not reveal any metastatic disease in the liver or in other abdominal organs. This is the first published case report documents a rare false-positive finding of I-131 scan that was associated with an asymptomatic gallstone, and emphasizes the importance of correlative imaging in gallbladder related I-131 uptake.

  16. Phenotypic Microarrays Suggest Escherichia coli ST131 Is Not a Metabolically Distinct Lineage of Extra-Intestinal Pathogenic E. coli

    OpenAIRE

    Alqasim, Abdulaziz; Emes, Richard; Clark, Gemma; Newcombe, Jane; La Ragione, Roberto; McNally, Alan

    2014-01-01

    Extraintestinal pathogenic E. coli (ExPEC) are the major aetiological agent of urinary tract infections (UTIs) in humans. The emergence of the CTX-M producing clone E. coli ST131 represents a major challenge to public health worldwide. A recent study on the metabolic potential of E. coli isolates demonstrated an association between the E. coli ST131 clone and enhanced utilisation of a panel of metabolic substrates. The studies presented here investigated the metabolic potential of ST131 and o...

  17. Therapy of hepatocellular carcinoma with iodine-131-lipiodol. Results in a large German cohort

    Energy Technology Data Exchange (ETDEWEB)

    Risse, J.H. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Rabe, C. [Univ. Clinic of Internal Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Pauleit, D. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Inst. of Medicine, Research Center Juelich (Germany); Reichmann, K.; Biersack, H.J.; Palmedo, H. [Univ. Clinic of Nuclear Medicine, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany); Menzel, C.; Gruenwald, F. [Univ. Clinic of Nuclear Medicine, Johann-Wolfgang-Goethe-Univ., Frankfurt am Main (Germany); Strunk, H. [Univ. Clinic of Radiology, Rheinische Friedrich-Wilhelms-Univ., Bonn (Germany)

    2006-07-01

    Aim: to evaluate the efficacy and tolerance of iodine-131-lipiodol ({sup 131}I-lipiodol) for hepatocellular carcinoma (HCC) in German long term patients and comparison with medically treated controls. Patients, Methods: 38 courses of intra-arterial {sup 131}I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC (6 with portal vein thrombosis). Liver and tumour volume and lipiodol deposition were measured by computed tomography and {sup 131}I activity by scintigraphy. Therapeutic efficacy was determined by tumour volume change and matched-pairs analysis in comparison to medically (i.e. tamoxifen or medical support) treated patients. Results: tumour volume decreased in 20/32 index nodules (63%) after the first course. Repeated therapy frequently resulted in further tumour reduction. Overall response to treatment was partial in 11 nodules, minor response in 4 nodules, and disease was stable in 12 and progressive in 5. Significant response was associated with pretherapeutic nodule volume up to 150 ml (diameter of 6.6 cm). Survival rate after 3, 6, 9, 12, 24 and 36 months was 78, 61, 50, 39, 17, and 6%. Matched-pairs analysis of survival revealed {sup 131}I-lipiodol to be superior to medical treatment. The most important side effect was a pancreatitis-like syndrome whereas overall tolerance was good. Conclusions: The long term results confirm that HCC therapy with {sup 131}I-lipiodol is effective and probably superior to medical treatment. Tumour nodules of up to 6 cm diameter are well suited for this therapy even in the presence of portal vein thrombosis. (orig.)

  18. S values for 131I based on the ICRP adult voxel phantoms.

    Science.gov (United States)

    Lamart, Stephanie; Simon, Steven L; Bouville, Andre; Moroz, Brian E; Lee, Choonsik

    2016-01-01

    To improve the estimates of organ doses from nuclear medicine procedures using (131)I, the authors calculated a comprehensive set of (131)I S values, defined as absorbed doses in target tissues per unit of nuclear transition in source regions, for different source and target combinations. The authors used the latest reference adult male and female voxel phantoms published by the International Commission on Radiological Protection (ICRP Publication 110) and the (131)I photon and electron spectra from the ICRP Publication 107 to perform Monte Carlo radiation transport calculations using MCNPX2.7 to compute the S values. For each phantom, the authors simulated 55 source regions with an assumed uniform distribution of (131)I. They computed the S values for 42 target tissues directly, without calculating specific absorbed fractions. From these calculations, the authors derived a comprehensive set of S values for (131)I for 55 source regions and 42 target tissues in the ICRP male and female voxel phantoms. Compared with the stylised phantoms from Oak Ridge National Laboratory (ORNL) that consist of 22 source regions and 24 target regions, the new data set includes 1662 additional S values corresponding to additional combinations of source-target tissues that are not available in the stylised phantoms. In a comparison of S values derived from the ICRP and ORNL phantoms, the authors found that the S values to the radiosensitive tissues in the ICRP phantoms were 1.1 (median, female) and 1.3 (median, male) times greater than the values based on the ORNL phantoms. However, for several source-target pairs, the difference was up to 10-fold. The new set of S values can be applied prospectively or retrospectively to the calculation of radiation doses in adults internally exposed to (131)I, including nuclear medicine patients treated for thyroid cancer or hyperthyroidism. Published by Oxford University Press 2015. This work is written by (a) US Government employee(s) and is in the

  19. Cardiac 131I-MIBG scintigraphy in patients with multiple system atrophy

    Directory of Open Access Journals (Sweden)

    Li WANG

    2014-03-01

    Full Text Available Background 131I-metaiodobenzylguanidine (131I-MIBG can be intaked by cardiac sympathetic postganglionic fibre, thus becomes the imaging agent to evaluate cardiac sympathetic nerve function. The aim of this study is to investigate the autonomic nerve dysfunction of patients with multiple system atrophy (MSA by using cardiac 131I-MIBG scintigraphy.  Methods Clinical data of 12 MSA patients conforming to the "secord consensus statement on the diagnosis of MSA" was analyzed by Unified Multiple System Atrophy Rating Scale (UMSARS. 131I-MIBG scintigraphy was performed in 12 MSA patients and 7 age-matched controls. Planar images of the chest were obtained 15 min, 4 h and 24 h after the intravenous injection of 3 mCi 13131I-MIBG. Cardiac 131I-MIBG uptake was quantified by comparing region of interest (ROI over heart/mediastinum (H/M ratio.  Results Cardiac 131131I-MIBG uptake ratio in MSA group was significantly less than that in control group in 15 min (1.90 ± 0.41 vs 2.38 ± 0.32, P = 0.017 and 4 h (1.96 ± 0.63 vs 2.60 ± 0.55, P = 0.039. There were significant difference (P < 0.05 between MSA group and control group.  Conclusions Cardiac 131I-MIBG uptake ratio in MSA group was less than that in control group. This finding suggests cardiac sympathetic degeneration may occur in MSA patients. doi: 10.3969/j.issn.1672-6731.2014.03.018

  20. {sup 131}I-induced changes in rat thyroid gland function

    Energy Technology Data Exchange (ETDEWEB)

    Torlak, V.; Capkun, V.; Stanicic, A. [Clinical Hospital Split, Split (Croatia). Dept. of Nuclear Medicine; Zemunik, T. [University of Split, Split (Croatia). Dept. of Medical Biology]. E-mail: tzemunik@bsb.mefst.hr; Modun, D. [University of Split, Split (Croatia). Dept. of Pharmacology; Pesutic-Pisac, V. [Clinical Hospital Split, Split (Croatia). Dept. of Pathology; Markotic, A. [University of Split, Split (Croatia). School of Medicine. Dept. of Biochemistry; Pavela-Vrancic, M. [University of Split, Split (Croatia). Faculty of Natural Sciences. Dept. of Chemistry

    2007-08-15

    Therapeutic doses of {sup 131}I administered to thyrotoxic patients may cause thyroid failure. The present study used a rat model to determine thyroid function after the administration of different doses of {sup 131}I (64-277 {mu}Ci). Thirty male Fisher rats in the experimental group and 30 in the control group (untreated) were followed for 6 months. The animals were 4 months old at the beginning of the experiment and were sacrificed at an age of 9 months. Hormone concentration was determined before {sup 131}I administration (4-month-old animals) and three times following {sup 131}I administration, when the animals were 7, 8, and 9 months old. The thyroid glands were removed and weighed, their volume was determined and histopathological examination was performed at the end of the experiment. Significant differences in serum triiodothyronine and thyroid-stimulating hormone concentration, measured at the age of 7, 8, and 9 months, were found in the experimental group. During aging of the animals, the concentration of thyroxin fell from 64.8 {+-} 8.16 to 55.0 {+-} 6.1 nM in the control group and from 69.4 {+-} 6.9 to 25.4 {+-} 3.2 nM in the experimental group. Thyroid gland volume and weight were significantly lower in the experimental than in the control group. Thyroid glands from the experimental group showed hyaline thickness of the blood vessel wall, necrotic follicles, a strong inflammatory reaction, and peeling of necrotic cells in the follicles. In conclusion, significant differences in hormone levels and histopathological findings indicated prolonged hypothyroidism after {sup 131}I administration to rats, which was not {sup 131}I dose dependent. (author)

  1. 131I therapy for 345 patients with refractory severe hyperthyroidism: Without antithyroid drug pretreatment.

    Science.gov (United States)

    Ding, Yong; Xing, Jialiu; Fang, Yi; Wang, Yong; Zhang, Youren; Long, Yahong

    2016-02-01

    The aim of this study is to evaluate the safety and long-term results of (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment. From January 2002 to December 2012, 408 patients with refractory severe hyperthyroidism were treated with (131)I alone. Among them, 345 were followed up for 1 to 10 years for physical examination, thyroid function, and thyroid ultrasound. Complete Blood Count (CBC) liver function, electrocardiogram, echocardiogram, and Emission Computed Tomography (ECT) thyroid imaging were performed as indicated. The 345 patients had concomitant conditions including thyrotoxic heart disease, severe liver dysfunction, enlarged thyroid weighing 80 to 400 g, severe cytopenia, and vasculitis. One to two weeks prior to (131)I therapy, all patients were given low-iodine diet. The dose of (131)I therapy was 2.59 to 6.66 MBq (70 to180 µCi) per gram of thyroid with an average of 3.83 ± 0.6 MBq (103.6 ± 16.4 µCi); and the total (131)I activity administrated for the individuals was 111 to 3507.6 MBq (3.0 to 94.8 mCi, mean 444 ± 336.7 MBq (12.0 ± 9.1 mCi)). Out of the 408 patients, 283 were cured, 15 with complete remission, and 47 with incomplete remission. No treatment failure or significant clinical worsening was noted in these patients. Our data indicated that (131)I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment is safe and effective. © 2015 by the Society for Experimental Biology and Medicine.

  2. 131I therapy for 345 patients with refractory severe hyperthyroidism: Without antithyroid drug pretreatment

    Science.gov (United States)

    Xing, Jialiu; Fang, Yi; Wang, Yong; Zhang, Youren; Long, Yahong

    2015-01-01

    The aim of this study is to evaluate the safety and long-term results of 131I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment. From January 2002 to December 2012, 408 patients with refractory severe hyperthyroidism were treated with 131I alone. Among them, 345 were followed up for 1 to 10 years for physical examination, thyroid function, and thyroid ultrasound. Complete Blood Count (CBC) liver function, electrocardiogram, echocardiogram, and Emission Computed Tomography (ECT) thyroid imaging were performed as indicated. The 345 patients had concomitant conditions including thyrotoxic heart disease, severe liver dysfunction, enlarged thyroid weighing 80 to 400 g, severe cytopenia, and vasculitis. One to two weeks prior to 131I therapy, all patients were given low-iodine diet. The dose of 131I therapy was 2.59 to 6.66 MBq (70 to180 µCi) per gram of thyroid with an average of 3.83 ± 0.6 MBq (103.6 ± 16.4 µCi); and the total 131I activity administrated for the individuals was 111 to 3507.6 MBq (3.0 to 94.8 mCi, mean 444 ± 336.7 MBq (12.0 ± 9.1 mCi)). Out of the 408 patients, 283 were cured, 15 with complete remission, and 47 with incomplete remission. No treatment failure or significant clinical worsening was noted in these patients. Our data indicated that 131I therapy alone for patients with refractory severe hyperthyroidism without antithyroid drug pretreatment is safe and effective. PMID:26341470

  3. Therapy of hepatocellular carcinoma with iodine-131-lipiodol. Results in a large German cohort.

    Science.gov (United States)

    Risse, J H; Rabe, C; Pauleit, D; Reichmann, K; Menzel, C; Grünwald, F; Strunk, H; Biersack, H-J; Palmedo, H

    2006-01-01

    To evaluate the efficacy and tolerance of iodine-131-lipiodol ((131)I-lipiodol) for hepatocellular carcinoma (HCC) in German long term patients and comparison with medically treated controls. 38 courses of intra-arterial (131)I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC (6 with portal vein thrombosis). Liver and tumour volume and lipiodol deposition were measured by computed tomography and (131)I activity by scintigraphy. Therapeutic efficacy was determined by tumour volume change and matched-pairs analysis in comparison to medically (i.e. tamoxifen or medical support) treated patients. Tumour volume decreased in 20/32 index nodules (63%) after the first course. Repeated therapy frequently resulted in further tumour reduction. Overall response to treatment was partial in 11 nodules, minor response in 4 nodules, and disease was stable in 12 and progressive in 5. Significant response was associated with pretherapeutic nodule volume up to 150 ml (diameter of 6.6 cm). Survival rate after 3, 6, 9, 12, 24 and 36 months was 78, 61, 50, 39, 17, and 6%. Matched-pairs analysis of survival revealed (131)I-lipiodol to be superior to medical treatment. The most important side effect was a pancreatitis-like syndrome whereas overall tolerance was good. The long term results confirm that HCC therapy with (131)I-lipiodol is effective and probably superior to medical treatment. Tumour nodules of up to 6 cm diameter are well suited for this therapy even in the presence of portal vein thrombosis.

  4. Preparation and preclinical evaluation of 131 I-trastuzumab for breast cancer.

    Science.gov (United States)

    Kameswaran, Mythili; Gota, Vikram; Ambade, Rajwardhan; Gupta, Sudeep; Dash, Ashutosh

    2017-01-01

    Trastuzumab that targets the human epidermal growth factor receptor type 2 (HER2) is known to benefit patients with HER2+ metastatic breast cancer. The objective was to explore the potential of 131 I-trastuzumab for treatment of breast cancers. Radioiodination of trastuzumab was carried out by chloramine-T method, purified by using PD-10 column, and characterized by size exclusion high-performance liquid chromatography on a gel column. In vitro studies were carried out in HER2+ cells to determine the specificity of the radioimmunoconjugate. Uptake and retention of 131 I-trastuzumab were determined by biodistribution studies in tumor-bearing non-obese diabetic/severe combined immunodeficiency and normal severe combined immunodeficiency mice. The radiochemical purity (RCP) of 131 I-trastuzumab was 98 ± 0.4% with retention time of 17 minutes by high-performance liquid chromatography. In vitro stability studies exhibited RCP of more than 90% in serum at 37°C after 120 hours of radioiodination. In vitro cell binding with 131 I-trastuzumab in HER2+ cells showed binding of 28% to 35% which was inhibited significantly, with unlabeled trastuzumab confirming its specificity. Kd value of 131 I-trastuzumab was 0.5 nM, while its immunoreactivity was more than 80%. Uptake of more than 12% and retention were observed in the tumors up to 120 hours p.i. 131 I-trastuzumab prepared in-house-exhibited RCP of more than 98%, excellent immunoreactivity, affinity to HER2+ cell lines and good tumor uptake thereby indicating its potential for further evaluation in HER2+ breast cancers. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Anatomical location of cervical uptake areas after total thyroidectomy with {sup 131}Iodine - SPECT-CT

    Energy Technology Data Exchange (ETDEWEB)

    Torres, Ivone do Carmo Goncalves; Lima, Eduardo Nobrega Pereira; Carvalho, Andre Lopes; Cavicchioli, Marcelo; Martinez, Iris do Carmo da Costa; Bitencourt, Almir Galvao Vieira [Hospital A.C. Camargo, Sao Paulo, SP (Brazil)

    2012-07-01

    Objective: The purpose of this study was to evaluate the use of SPECT-CT for the determination of the anatomical locations of the cervical {sup 131}Iodine uptake areas during {sup 131}Iodine-whole body ({sup 131}I-WB) scans. Methods: One hundred fifty-four patients who had undergone total thyroidectomy for differentiated thyroid carcinoma (DTC) and had {sup 13I}-WB scan with cervical uptake images were studied with SPECT-CT, from March 2003 to October 2006. Results: From the 154 patients included, 124 were women (80.5%) and the mean age of 46.09 {+-} 14.77 years. {sup 131}I-WB was performed 1-2 months after surgery in 137 patients (89.0%). The percentage of cervical uptake found varied between 0.1 and 15.0% and its mean was 1.42 {+-} 2.05%. Using SPECT-CT, 223 foci of cervical {sup 131}Iodine uptake (CIU) were identified in 154 patients. CIU foci were localized to the thyroid bed in 17 patients, while 29 patients presented with CIU in the thyroid bed and the extra thyroid tissue and in both the thyroid bed and extra thyroid tissues in another 29 patients. In the remaining 108 subjects, the CIU were located outside of the thyroid bed, of which the most common locations were the sternothyroid muscle and the thyroid cartilage. Conclusions: The use of SPECT-CT demonstrated significant diversity in the anatomical locations of CIU foci observed during {sup 131}I-WB scans after thyroidectomy for DTC. (author)

  6. Use of I-131- CRTX for targeting malignant adenocarcinoma in mice: biodistribution and radiation dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Raquel Gouvea dos; Soares, Marcella Araugio; Andrade, Henrique Martins de, E-mail: santosr@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Santos, Marcos Antonio da Cunha [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Estatistica

    2008-07-01

    Snake venoms molecules have been shown to play a role not only in the survival and proliferation of tumour cells but also in the processes of tumour cell adhesion, migration and angiogenesis. We have shown that {sup 125}I-Crtx, a radiolabeled version of a protein derived from Crotalus durissus terrificus snake venom (Cdt), specifically binds to tumor and triggers apoptotic death. This study reports the biokinetic profile of {sup 99m}Tc-Cdt and {sup 125/131}I-Crtx in Swiss mice bearing Ehrlich solid tumor and MIRD formulation was applied to calculate the absorbed radiation doses for various organs and tumor site. Biokinetic evaluations were performed up to 24 h after intravenous (i.v) or intratumor (i.tu.) injection of {sup 99m}Tc-Cdt or {sup 125/131}I-Crtx. Time-activity curves were generated for the main organs by fitting the organ specific mass mean counts. The radiation dose from {sup 131}I-Crtx was calculated based on non penetrating radiation in the mouse model. Biokinetics data from {sup 99m}Tc-Cdt after i.v. injection in mice tumor model showed rapid blood clearance (T{sub 1/2}= 36.1 ± 2.4 min.), slow tumor clearance (T{sub 1/2}: 108.3 ± 19.5 min.) and indicated the kidneys as the main excretion pathway. Interaction studies in vitro demonstrated that {sup 125}I-Crtx recognize specific sites on Erlich tumor cell membrane. Upon intravenous and intratumor administration of {sup 131}I-Crtx in mice bearing Erlich tumor, it was observed high uptake in tumor site in vivo (Ã =72kBq x h/g) resulting in a high absorbed dose radiation to tumor site. Distributions of {sup 125/131}I-Crtx i.v. were only significant in tumor, stomach, liver and kidneys, reflecting non-specific uptake of Crtx in normal excretion tissues in vivo. Intratumoral administration reduced significantly the radiation dose to the kidneys (42-fold lower) and increased the uptake by the tumor site (128- fold higher). {sup 131}I control was run in a parallel experiment and showed no significant tumor

  7. Internal dosimetry of nuclear medicine workers through the analysis of {sup 131}I in aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Gomes C, L.; Lucena, E. A.; Da Silva S, C.; Almeida D, A. L.; Oliveira S, W.; Souza S, M.; Maranhao D, B., E-mail: carneiro@ird.gov.br [Instituto de Radioprotecao e Dosimetria - CNEN, Av. Salvador Allende s/n, 22783-127 Rio de Janeiro (Brazil)

    2014-08-15

    {sup 131}I is widely used in nuclear medicine for diagnostic and therapy of thyroid diseases. Depending of workplace safety conditions, routine handling of this radionuclide may result in a significant risk of exposure of the workers subject to chronic intake by inhalation of aerosols. A previous study including in vivo and in vitro measurements performed recently among nuclear medicine personnel in Brazil showed the occurrence of {sup 131}I incorporation by workers involved in the handling of solutions used for radioiodine therapy. The present work describes the development, optimization and application of a methodology to collect and analyze aerosol samples aiming to assess internal doses based on the activity of {sup 131}I present in a radiopharmacy laboratory. Portable samplers were positioned at one meter distant from the place where non-sealed liquid sources of {sup 131}I are handled. Samples were collected over one hour using high-efficiency filters containing activated carbon and analyzed by gamma spectrometry with a high purity germanium detection system. Results have shown that, although a fume hood is available in the laboratory, {sup 131}I in the form of vapor was detected in the workplace. The average activity concentration was found to be of 7.4 Bq /m{sup 3}. This value is about three orders of magnitude below the Derived Air Concentration (Dac) of 8.4 kBq/m{sup 3}. Assuming that the worker is exposed by inhalation of iodine vapor during one hour, {sup 131}I concentration detected corresponds to an intake of 3.6 Bq which results in a committed effective dose of 7.13 x 10{sup -5} mSv. These results show that the radiopharmacy laboratory evaluated is safe in terms of internal exposure of the workers. However it is recommended that the presence of {sup 131}I should be periodically re-assessed since it may increase individual effective doses. It should also be pointed out that the results obtained so far reflect a survey carried out in a specific

  8. Internal dosimetry of nuclear medicine workers through the analysis of (131)I in aerosols.

    Science.gov (United States)

    Carneiro, Luana Gomes; de Lucena, Eder Augusto; Sampaio, Camilla da Silva; Dantas, Ana Letícia Almeida; Sousa, Wanderson Oliveira; Santos, Maristela Souza; Dantas, Bernardo Maranhão

    2015-06-01

    (131)I is widely used in nuclear medicine for diagnostic and therapy of thyroid diseases. Depending of workplace safety conditions, routine handling of this radionuclide may result in a significant risk of exposure of the workers subject to chronic intake by inhalation of aerosols. A previous study including in vivo and in vitro measurements performed recently among nuclear medicine personnel in Brazil showed the occurrence of (131)I incorporation by workers involved in the handling of solutions used for radioiodine therapy. The present work describes the development, optimization and application of a methodology to collect and analyze aerosol samples aiming to assess internal doses based on the activity of (131)I present in a radiopharmacy laboratory. Portable samplers were positioned at one meter distant from the place where non-sealed liquid sources of (131)I are handled. Samples were collected over 1h using high-efficiency filters containing activated carbon and analyzed by gamma spectrometry with a high-purity germanium detection system. Results have shown that, although a fume hood is available in the laboratory, (131)I in the form of vapor was detected in the workplace. The average activity concentration was found to be of 7.4Bq/m(3). This value is about three orders of magnitude below the Derived Air Concentration (DAC) of 8.4kBq/m(3). Assuming that the worker is exposed by inhalation of iodine vapor during 1h, (131)I concentration detected corresponds to an intake of 3.6Bq which results in a committed effective dose of 7.13×10(-5)mSv. These results show that the radiopharmacy laboratory evaluated is safe in terms of internal exposure of the workers. However it is recommended that the presence of (131)I should be periodically re-assessed since it may increase individual effective doses. It should also be pointed out that the results obtained so far reflect a survey carried out in a specific workplace. Thus, it is suggested to apply the methodology

  9. Die Psalms: soorte, funksie, aard en die omdigting van Psalm 131

    Directory of Open Access Journals (Sweden)

    C.J.A. Vos

    2002-08-01

    Full Text Available Psalms: types, function, character and the versification of Psalm 131 The publishing of Liedboek van die kerk (2001 has emphasised the importance of the Psalms for the liturgy and the hymnology. This article considers the following aspects: the bridge function of the psalms; the significance and function of the psalms as an open hymnbook and as an anthology; and the literary types found in the psalms. The structure and form of Psalm 131 are analysed in greater detail. This analysis leads in conclusion to a literary evaluation of its versification by T.T. Cloete.

  10. Measurement of the thyroid's iodine absorption utilizing minimal /sup 131/I dose

    Energy Technology Data Exchange (ETDEWEB)

    Paz A, B.; Villegas A, J.; Delgado B, C. (Universidad Nacional San Agustin de Arequipa (Peru). Departamento de Bioquimica)

    1981-03-01

    We utilize a minimal dose of /sup 131/I thus limiting the contact of the thyroid tissues with the isotopic materials to determine the absorption of /sup 131/I by the thyroid from 6 to 24 hours in 90 pupils of the locality of Arequipa. The average rate of absorption in 6 and 24 hours in the case considered are of 24.15% and 35.42% respectively, with a standard deviation of 6.93% and 9.61%. No significant differences were reported from the results of those of adults and our own results in all the probes which were undertaken.

  11. Stimulation with 0.3-mg recombinant human thyrotropin prior to iodine 131 therapy to improve the size reduction of benign nontoxic nodular goiter

    DEFF Research Database (Denmark)

    Nielsen, Viveque Egsgaard; Bonnema, Steen Joop; Boel-Jørgensen, Henrik

    2006-01-01

    ) were randomized to receive either 0.3 mg of recombinant human thyrotropin (n = 28) or placebo (n = 29) 24 hours before (131)I therapy. The (131)I dose was calculated based on thyroid size (measured by ultrasound), thyroid (131)I uptake, and (131)I half-life. The follow-up period was 1 year and included......BACKGROUND: Use of recombinant human thyrotropin increases the thyroid radioiodine (iodine 131 [(131)I]) uptake and may have a role in the context of (131)I therapy of benign goiter. METHODS: In a double-blind, placebo-controlled trial, 57 patients with nodular nontoxic goiter (51 women and 6 men......: Stimulation with recombinant human thyrotropin prior to (131)I therapy improves thyroid size reduction by 35%, with a 5-fold higher rate of hypothyroidism. These effects are, at least partially, mediated through mechanisms other than an increase in retained (131)I thyroid dose. Further recombinant human...

  12. Extraction, radiolabeling and in vivo biological evaluation of {sup 131}I labeled egonol glycosides extract

    Energy Technology Data Exchange (ETDEWEB)

    Akguel, Yurdanur; Pazar, Erdinc [Ege Univ., Izmir (Turkey). Chemistry Dept.; Yilmaz, Habibe; Sanlier, Senay Hamarat [Ege Univ., Izmir (Turkey). Biochemistry Dept.; Lambrecht, Fatma Yurt [Ege Univ., Izmir (Turkey). Dept. of Nuclear Applications; Yilmaz, Osman [Dokuz Eyluel Univ., Izmir (Turkey). Dept. of Lab. Animal Science

    2015-09-01

    Crude extract of S. officinalis L. was found to have suspending agent, hemolytic, antitumor, antioxidant and antimicrobial activities. Its major components benzofurans and benzofuran glycosides have antifungal, anticancer, antibacterial and anticomplement activities and display acetylcholinesterase-cyclooxygenase inhibitory and cytotoxic properties. Recently, it has been reported that egonolgentiobioside is a valuable target for structural modification and warrants further investigation for its potential as a novel pharmaceutical tool for the prevention of estrogen deficiency induced diseases. The aim of the current study is to perform in vivo biological evaluation of a glycosides extract, which was isolated from the fruits endocarp of Styrax officinalis L, identified as egonolgentiobioside and homoegonolgentiobioside and labeled with {sup 131}I. The radiolabeled glycosides extract was labeled with {sup 131}I with high yield. The labeled obtained radiolabeled compound was found to be quite stable and lipophilic. In order to determine its tissue distribution, an in vivo study was performed using healthy female Albino Wistar rats injected by {sup 131}I-glycosides. The biodistribution results showed that clearance of the radiolabeled compound is through the hepatobiliary pathway. The experimental study indicated that the radiolabeled glycosides extract accumulated in the large intestine. Therefore, the potential of {sup 131}I-glycosides might be evaluated in colon cancer cell lines and this might be a promising of tumor-imaging agent.

  13. Hyper-reactive PMNs in Fc gamma RIIa 131 H/H genotype periodontitis patients

    NARCIS (Netherlands)

    Nicu, E A; Van der Velden, U; Everts, V; Van Winkelhoff, A J; Roos, D; Loos, B G

    2007-01-01

    Background: Receptors for the Fc part of IgG (Fc gamma RIIa) on polymorphonuclear leukocytes (PMN) mediate phagocytosis and cell activation. Previous results show that one of the genetic variants of the Fc gamma RIIa, the 131 H/H, is associated with more periodontal breakdown than the R/R. This may

  14. Differences in the dry deposition of gaseous elemental I-131 to several leafy vegetable species

    Energy Technology Data Exchange (ETDEWEB)

    Shinonaga, T.; Heuberger, H.; Tschiersch, J. [GSF-National Research Center for Environment and Health, Institute of Radiation Protection, Neuherberg, Germany, IAEA Laboratories, Seibersdorf (Austria)

    2004-07-01

    The height of the dry deposition of gaseous elemental {sup 131}I to leafy vegetable is quite uncertain because of the different habit, surface texture and leaf uptake of the different plant species. There is no comparative data on the deposition to various species, but leafy vegetables are taken as reference plants for the estimation of the height of contamination of vegetable foods after a nuclear accident. Therefore new chamber experiments were performed to determine under homogeneous and controlled conditions the dry deposition of gaseous elemental {sup 131}I on mature leafy vegetable. The simultaneous exposition of endive, head lettuce, red oak leaf lettuce and spinach (spring leafy vegetable) rsp. curly kale, white cabbage and spinach (summer leafy vegetable) was arranged. The sample collective of each species was such large that for the expected variation of the results a statistically firm analysis was possible. Significant differences were observed for the {sup 131}I deposition on spring vegetable: the deposition on spinach was roughly 3 times that on leaf lettuce, 4 times that on endive and 9 times that on head lettuce. All summer vegetables showed differences in deposition. For Iodine, the deposition on spinach was roughly 3 times (6 times) that on curly kale and 35 times (100 times) that on white cabbage in the 2 experiments. Washing by deionised water could reduce the contamination only by about 10% for {sup 131}I. (author)

  15. 40 CFR 131.21 - EPA review and approval of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.21 EPA review and approval of water quality standards. (a) After the State submits its... analysis. (b) The Regional Administrator's approval or disapproval of a State water quality standard shall...

  16. 40 CFR 131.22 - EPA promulgation of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false EPA promulgation of water quality... PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.22 EPA promulgation of water quality standards. (a) If the State does not adopt the changes specified by the Regional...

  17. 40 CFR 131.20 - State review and revision of water quality standards.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS Procedures for Review and Revision of Water Quality Standards § 131.20 State review and revision of water quality standards. (a) State review. The State shall... reviewing applicable water quality standards and, as appropriate, modifying and adopting standards. Any...

  18. [Evaluation of Reproductive Health of Chickens and Their Progeny at a Chronic Effect of 131I].

    Science.gov (United States)

    Boudarkov, V A

    2015-01-01

    A reproductive health of hens exposed to 131I in a 30-day period with daily quantities ranging from 0.11 to 4.6 MBq/kg and 6 progenies of their offspring was evaluated. We determined that 131I did not change significantly the reproductive potential of hens if administered at a dose of 0.11 MBq, while it raised at 1.1 MBq, progressively decreased after a short-time increase at 2.1 MBq and was inhabited up to its irreversible extinction at 4.6 MBq. Irrespective of the isotope quantity administered, a decline occurred in the birth rate of the progeny where hens dominated in the sex composition. The reproductive potential (i.e., laying capacity) of the offspring of three chicken progenies that had been administered 131I at 0.11 MBq/kg, progenies 3 and 5 that had been administered 1.1 MBq/kg and progeny 1 affected with 2.1 MBq/kg increased, while for chicken progenies 1, 2, 4 and 6 that had been given 131I at 1.1. MBq/kg the reproductive capacity was within the normal range or decreased.

  19. Long-term radiobiological effects in rats after exposure of 131I in utero

    Directory of Open Access Journals (Sweden)

    V. V. Talko

    2017-12-01

    Full Text Available Remote radiobiological effects in male rats prenatally exposed by 131I in different periods of gestation were studied. It was established that the negative effects of irradiation of 131I in utero in the distant period are manifested by disorders of the functioning of the pituitary-thyroid link of endocrine regulation, pro-antioxidant equilibrium, changes in the lipid-lipoprotein spectrum of blood serum. As a result of irradiation of 131I in utero throughout the period of gestation, discoordination in the functioning of the pituitary-thyroid link of endocrine regulation, a violation of the pro-antioxidant balance by increasing the intensity of lipoperoxidation processes and the activity reducing of enzymes of antioxidant defense, the atherogenic orientation of changes in the lipid-lipoprotein spectrum was established. As a result of irradiation by 131I in utero during the third trimester of gestation, the development of hypothyroidism, changes in pro-antioxidant balance due to the activation of antioxidant defense, and the reduction of the concentration of the main classes of lipids have been established.

  20. Deciphering the measured ratios of Iodine-131 to Cesium-137 at the Fukushima reactors

    OpenAIRE

    Matsui, T.

    2011-01-01

    We calculate the relative abundance of the radioactive isotopes Iodine-131 and Cesium-137 produced by nuclear fission in reactors and compare it with data taken at the troubled Fukushima Dai-ichi nuclear power plant. The ratio of radioactivities of these two isotopes can be used to obtain information about when the nuclear reactions terminated.

  1. 25 CFR 39.131 - What is a Language Development Program?

    Science.gov (United States)

    2010-04-01

    ....131 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL...) Are not proficient in spoken or written English; (b) Are not proficient in any language; (c) Are learning their Native language for the purpose of maintenance or language restoration and enhancement; (d...

  2. Structure of negative parity yrast bands in odd mass 125− 131Ce ...

    Indian Academy of Sciences (India)

    The negative parity yrast bands of neutron-deficient 125-131Ce nuclei are studied by using the projected shell model approach. Energy levels, transition energies and (1)/(2) ratios are calculated and compared with the available experimental data. The calculations reproduce the band-head spins of negative parity ...

  3. Structure of negative parity yrast bands in odd mass 125−131Ce ...

    Indian Academy of Sciences (India)

    Abstract. The negative parity yrast bands of neutron-deficient 125−131Ce nuclei are studied by using the projected shell model approach. Energy levels, transition energies and B(M1)/B(E2) ratios are calculated and compared with the available experimental data. The calculations reproduce the band-head spins of negative ...

  4. 21 CFR 131.127 - Nonfat dry milk fortified with vitamins A and D.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Nonfat dry milk fortified with vitamins A and D... and Cream § 131.127 Nonfat dry milk fortified with vitamins A and D. (a) Description. Nonfat dry milk fortified with vitamins A and D conforms to the standard of identity for nonfat dry milk, except that...

  5. 17 CFR 1.31 - Books and records; keeping and inspection.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Books and records; keeping and... REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Recordkeeping § 1.31 Books and records; keeping and inspection. (a)(1) All books and records required to be kept by the Act or by these regulations shall be kept for...

  6. Renal I-131-hippurate clearance overestimates true renal blood flow in the instrumented conscious dog

    NARCIS (Netherlands)

    Visscher, CA; DeZeeuw, D; Navis, G; VanZanten, AK; DeJong, PE; Huisman, RM

    We evaluated renal I-131-hippurate clearance (ERPF(hip)) as a measure of renal blood flow (RBF) in chronically instrumented conscious dogs. When adjusted for renal hippurate extraction (E(hip), 0.77 +/- 0.01) and hematocrit (Hct, 39.7 +/- 1%), calculated RBF(hip) (656 +/- 37 ml/min) markedly

  7. Tissue to plasma capillary permeability of 131I-albumin in the perfused rabbit ear

    DEFF Research Database (Denmark)

    Bent-Hansen, Lasse; Svendsen, J H

    1991-01-01

    The tissue to plasma transfer of 131I-albumin was recorded in perfused rabbit ears (n = 6) following equilibration for 24 hr. 125I-fibrinogen served as the plasma marker, and was introduced intravenously 15 min before clamping. The ears were rollerpump perfused with isotonic diluted plasma...

  8. Radiation protection procedures in 131I treatments for thyroid cancer in patients requiring hemodialysis.

    Science.gov (United States)

    Fioroni, Federica; Sghedoni, Roberto; Grassi, Elisa; Piccagli, Vando; Sollini, Martina; Filice, Angelina; Versari, Annibale; Iori, Mauro

    2014-06-01

    Hemodialysis is essential for patients with renal failure, and iodine-131 ((131)I) administration is the standard of care in thyroid carcinoma treatment. Although the need for hemodialysis during (131)I treatment is very rare, it raises some concerns due to the involvement of personnel not exposed to radiation and to the contamination of devices used for other patients. In this paper, a radioprotection protocol to perform hemodialysis safely on patients during (131)I treatment has been presented. The exposure of personnel who assisted 13 patients over the course of 10 years was monitored: external exposure was measured through electronic dosimeters, and internal contamination was checked by thyroid uptake and urine sample gamma spectrometry. Over this period, room layout was optimized to allow an improvement of radioprotection procedures.Two nurses were involved in patient assistance. After hemodialysis, measurements of internal contamination were below the minimum detectable activity and external exposure was in the range of 1-82 μSv in terms of H(p)(10). A reduction in personnel exposure was observed after hospitalization room renovation: H(p)(10) normalized to the activity administered to the patient was about halved. The data show that hemodialysis can be performed safely during I treatments when appropriate radioprotection actions are implemented.

  9. Doubled haploid inbred lines USVL048 and USVL131 of heading broccoli

    Science.gov (United States)

    Two inbred lines of heading broccoli (Brassica oleracea L. var. italica), designated USVL048 and USVL131, were released by the Agricultural Research Service of the U.S. Department of Agriculture in 2012. Both of the released lines are doubled haploids originally derived from another culture. As do...

  10. [Management of iodine-131 ablation therapy for thyroid carcinoma in a patient on chronic hemodialysis].

    Science.gov (United States)

    Zenasni, Nadia; Elkhayat, Salma; Taleb, Sara; Zamd, Mohammed; Medkouri, Ghizlaine; Benghanem Gharbi, Mohammed; Ramdani, Benyounes; Aschawa, Hind; Guensi, Amal

    2015-04-01

    Iodine-131 ablation therapy for thyroid cancer in the patient on chronic hemodialysis represents a real problem since the main route of elimination of radioiodine is urinary. There is no recommendation on the management of this treatment in the patient on hemodialysis. We report our experience of management of this treatment in a patient aged 38 years, undergoing hemodialysis for chronic renal failure, and who have been indicated the treatment with iodine-131 for papillary thyroid carcinoma high risk. After multidisciplinary discussions (nephrologists and specialists in nuclear medicine and radiation safety), it has been decided to treat the patient with continuous ambulatory peritoneal dialysis therapy (CAPD). Because of the low but continuous elimination of iodine in the case of CAPD, the patient received a reduced ablative (131)I dose of 1850 MBq, which is 30% of the usual dose delivered in subjects with normal renal function. The patient was hospitalized for four days in nuclear medicine unit and the (131)I radioactivity emitted from him was 2.5 μSv/h at one meter at his hospital discharge. In conclusion, CAPD in relay of hemodialysis is a technique of renal replacement therapy that can be suggested to minimize exposure to radioactivity to the patient, his family and the medical staff. Copyright © 2015 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

  11. Development of gamma-photon/Cerenkov-light hybrid system for simultaneous imaging of I-131 radionuclide

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Seiichi; Suzuki, Mayumi; Kato, Katsuhiko [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine (Japan); Watabe, Tadashi; Ikeda, Hayato; Kanai, Yasukazu [Department of Molecular Imaging in Medicine, Osaka University Graduate School of Medicine (Japan); Ogata, Yoshimune [Radiological and Medical Laboratory Sciences, Nagoya University Graduate School of Medicine (Japan); Hatazawa, Jun [Department of Molecular Imaging in Medicine, Osaka University Graduate School of Medicine (Japan)

    2016-09-11

    Although iodine 131 (I-131) is used for radionuclide therapy, high resolution images are difficult to obtain with conventional gamma cameras because of the high energy of I-131 gamma photons (364 keV). Cerenkov-light imaging is a possible method for beta emitting radionuclides, and I-131 (606 MeV maximum beta energy) is a candidate to obtain high resolution images. We developed a high energy gamma camera system for I-131 radionuclide and combined it with a Cerenkov-light imaging system to form a gamma-photon/Cerenkov-light hybrid imaging system to compare the simultaneously measured images of these two modalities. The high energy gamma imaging detector used 0.85-mm×0.85-mm×10-mm thick GAGG scintillator pixels arranged in a 44×44 matrix with a 0.1-mm thick reflector and optical coupled to a Hamamatsu 2 in. square position sensitive photomultiplier tube (PSPMT: H12700 MOD). The gamma imaging detector was encased in a 2 cm thick tungsten shield, and a pinhole collimator was mounted on its top to form a gamma camera system. The Cerenkov-light imaging system was made of a high sensitivity cooled CCD camera. The Cerenkov-light imaging system was combined with the gamma camera using optical mirrors to image the same area of the subject. With this configuration, we simultaneously imaged the gamma photons and the Cerenkov-light from I-131 in the subjects. The spatial resolution and sensitivity of the gamma camera system for I-131 were respectively ~3 mm FWHM and ~10 cps/MBq for the high sensitivity collimator at 10 cm from the collimator surface. The spatial resolution of the Cerenkov-light imaging system was 0.64 mm FWHM at 10 cm from the system surface. Thyroid phantom and rat images were successfully obtained with the developed gamma-photon/Cerenkov-light hybrid imaging system, allowing direct comparison of these two modalities. Our developed gamma-photon/Cerenkov-light hybrid imaging system will be useful to evaluate the advantages and disadvantages of these two

  12. 18 CFR 131.80 - FERC Form No. 556, Certification of qualifying facility status for an existing or a proposed...

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false FERC Form No. 556... facility. 131.80 Section 131.80 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... annual hourly energy input in terms of Btu for the following fossil fuel energy inputs, and provide the...

  13. 12 CFR 204.131 - Participation by a depository institution in the secondary market for its own time deposits.

    Science.gov (United States)

    2010-01-01

    ... the secondary market for its own time deposits. 204.131 Section 204.131 Banks and Banking FEDERAL... secondary market for its own time deposits. (a) Background. In 1982, the Board issued an interpretation concerning the effect of a member bank's purchase of its own time deposits in the secondary market in order...

  14. Diagnostic I-131 scintigraphy in patients with differentiated thyroid cancer : no additional value of higher scan dose

    NARCIS (Netherlands)

    Phan, TTH; van Tol, KM; Links, TP; Piers, DA; de Vries, EGE; Dullaart, RPF; Jager, PL

    2004-01-01

    Objective: After initial treatment with total thyroidectomy and radioiodine ablation, most follow-up protocols for patients with differentiated thyroid carcinoma contain cyclic diagnostic I-131 imaging and serum thyroglobulin measurements. The applied diagnostic I-131 doses vary between 37 and 370

  15. Genomic analysis of Bacillus subtilis OH 131.1 and coculturing with Cryptococcus flavescens for control of fusarium head blight

    Science.gov (United States)

    Bacillus subtilis OH131.1 is a bacterial antagonist of Fusarium graminearum, a plant pathogen which causes Fusarium head blight in wheat. The genome of B. subtilis OH131.1 was sequenced, annotated and analyzed to understand its potential to produce bioactive metabolites. The analysis identified 6 sy...

  16. Gamma camera based method for 131I capsule counting: an alternate method to Uptake probe method.

    Science.gov (United States)

    Menon, Biju K; Uday, Awasare S; Singh, Baghel N

    2017-11-10

    The main objective of this study was to check the validity of using gamma camera as an alternate method to thyroid uptake probe, for counting 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules before administration to thyroid patients. Methods: - 10 sets each of 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules received from Board Of Radiation and Isotope Technology, Department Of Atomic Energy, India (BRIT, DAE) have been counted individually using thyroid uptake probe for 10 seconds following institutional protocol and also by keeping individual capsule of a set with 8cm gap between each of them .These capsules were also scanned by Scintillation gamma camera for 100 seconds. Capsules having counts within the range of mean ±2 Standard Deviation (SD) were accepted for patient administration. After analysing both the data, correlation coefficient between these two methods has been evaluated. Results: Scanned images were analysed by drawing Identical ROI around each set of 25uCi (0.925 MBq) and 50uCi (1.85 MBq) 131I capsules. Capsules with counts within 2 Standard Deviation from mean were accepted for patient administration. Good correlation coefficient (r >0.95) was observed between these two counts set. Conclusion: Gamma camera based 131I -capsule counting method is an easy and time saving method compared to probe based capsule counting method as we can scan a set of capsules in a single acquisition. It can provide uniformity information for a batch of 131I -capsules and avoid the time consuming method of individual capsule counting with the thyroid uptake probe. Copyright © 2017 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  17. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: a systematic review and meta-analysis.

    Science.gov (United States)

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-03-17

    Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient populations. Hyperendemicity could result from increased transmissibility, longer duration of infectiousness, and/or higher pathogenic potential as compared with other lineages of the same species. The aim of our research is to quantitatively estimate these critical parameters for E. coli ST131 and K. pneumoniae ST258, in order to investigate whether E. coli ST131 and K. pneumoniae ST258 are truly hyperendemic clones. A systematic literature search was performed to assess the evidence of transmissibility, duration of infectiousness, and pathogenicity for E. coli ST131 and K. pneumoniae ST258. Meta-regression was performed to quantify these characteristics. The systematic literature search yielded 639 articles, of which 19 data sources provided information on transmissibility (E. coli ST131 n=9; K. pneumoniae ST258 n=10)), 2 on duration of infectiousness (E. coli ST131 n=2), and 324 on pathogenicity (E. coli ST131 n=285; K. pneumoniae ST258 n=39). Available data on duration of carriage and on transmissibility were insufficient for quantitative assessment. In multivariable meta-regression E. coli isolates causing infection were associated with ST131, compared to isolates only causing colonisation, suggesting that E. coli ST131 can be considered more pathogenic than non-ST131 isolates. Date of isolation, location and resistance mechanism also influenced the prevalence of ST131. E. coli ST131 was 3.2 (95% CI 2.0 to 5.0) times more pathogenic than non-ST131. For K. pneumoniae ST258 there were not enough data for meta-regression assessing the influence of colonisation versus infection on ST258 prevalence. With the currently available data, it cannot be confirmed nor rejected, that E. coli ST131

  18. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258: a systematic review and meta-analysis

    Science.gov (United States)

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-01-01

    Objectives Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient populations. Hyperendemicity could result from increased transmissibility, longer duration of infectiousness, and/or higher pathogenic potential as compared with other lineages of the same species. The aim of our research is to quantitatively estimate these critical parameters for E. coli ST131 and K. pneumoniae ST258, in order to investigate whether E. coli ST131 and K. pneumoniae ST258 are truly hyperendemic clones. Primary outcome measures A systematic literature search was performed to assess the evidence of transmissibility, duration of infectiousness, and pathogenicity for E. coli ST131 and K. pneumoniae ST258. Meta-regression was performed to quantify these characteristics. Results The systematic literature search yielded 639 articles, of which 19 data sources provided information on transmissibility (E. coli ST131 n=9; K. pneumoniae ST258 n=10)), 2 on duration of infectiousness (E. coli ST131 n=2), and 324 on pathogenicity (E. coli ST131 n=285; K. pneumoniae ST258 n=39). Available data on duration of carriage and on transmissibility were insufficient for quantitative assessment. In multivariable meta-regression E. coli isolates causing infection were associated with ST131, compared to isolates only causing colonisation, suggesting that E. coli ST131 can be considered more pathogenic than non-ST131 isolates. Date of isolation, location and resistance mechanism also influenced the prevalence of ST131. E. coli ST131 was 3.2 (95% CI 2.0 to 5.0) times more pathogenic than non-ST131. For K. pneumoniae ST258 there were not enough data for meta-regression assessing the influence of colonisation versus infection on ST258 prevalence. Conclusions With the currently available data

  19. In Vitro Activities of Moxifloxacin, 127I-Moxifloxacin and 131I-Moxifloxacin Against Staphylococcus Aureus Biofilms

    Directory of Open Access Journals (Sweden)

    Hasan Demiroğlu

    2015-02-01

    Full Text Available Objective: The aim of the study was to investigate the antimicrobial effect of Moxifloxacin (MXF, radio (Na131I and cold (K127I iodinated MXF on methicillin susceptible Staphylococcus aureus ATCC 35556 (MSSA biofilms. Methods: MXF was labeled with Na131I using the iodogen method. The optimum radiodination conditions for 131I-MXF was determined by thin-layer radio chromatography studies. Thin-layer radio chromatography (TLRC chromatograms were obtained by using Cyclone Plus Storage Phosphor System. The MICs of MXF, 127I-MXF and 131I-MXF were determined using the microdilution broth method according to CLSI criteria. Time kill curves were performed over 24 h using an inoculum of 2×105 (CFU/mL. Biofilms were grown in microtitre plates, dyed with crystal violet and the mean optical density (OD630 was used for quantification. Biofilms were incubated MXF, 127I-MXF and 131I-MXF at various concentration (0.03 to 64 µg/mL. Results: MXF was labeled with 131I iodogen method. 131I-MXF was obtained with high a yield 95±3%. The MIC values for MXF, 127I-MXF and 131I-MXF was 0.06 µg/mL. Bactericidal activity was demonstrated at 0.25 µg/mL 4 hour for MXF, 127I-MXF and 131I-MXF. At MIC levels, MXF, 127I-MXF and 131I-MXF was not showed a marked reduction of metabolic activity in the S. aureus biofilm. The ODs of biofilm after incubation with an increasing antibiotic concentration were significantly lower than the ODs of biofilms without antibiotic p≤005. The radiolabeled MXF was most effective than MXF, 127I-MXF in reducing the number of bacteria in biofilm. After 24 h incubation Log10 CFU/mL values for 32 µg/mL antibiotic concentration: Control, MXF, 127I-MXF and 131I-MXF were 9.5, 4.3, 4.8 and 3.1, respectively. Conclusion: 131I and 127I were used alone there was no penetration of the S. aureus biofilm and no damage. In contrast our results demonstrate that the radiolabeled Moxifloxacin (131I-MXF have potent anti-biofilm activity against S. aureus

  20. Control system of liquid effluents generated in treatment with I-131; Sistema de control de efluentes liquidos generados en el tratamiento con I-131

    Energy Technology Data Exchange (ETDEWEB)

    Garcia M, T.; Ruiz C, M. A.; Angeles C, A.; Ramirez S, R., E-mail: teodoro.garcia@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

    2015-09-15

    In recent years, nuclear medicine has developed greatly in our country and around the world. Techniques for both medical diagnosis and therapy have increased the use of radiopharmaceuticals, notably the I-131. In Mexico there are around 150 nuclear medicine establishments authorized by the Comision Nacional de Seguridad Nuclear y Salvaguardias. Most of these establishments do not have an appropriate facility for the treatment of radioactive liquid effluents, to ensure compliance with the concentration limits established in the regulations. The Instituto Nacional de Investigaciones Nucleares (ININ) developed and implemented successfully, a control system of radioactive effluents (named SACEL) from a nuclear medicine facility. This system ensures an effective compliance with regulations and also better management and control of these radioactive effluents. Calculations and design of SACEL were made with respect to I-131, because is one of the most commonly used in radiotherapy and medical diagnostics, besides its half-life is greater in relation to other radionuclides. SACEL is comprised of four storage tanks and decay and a fifth tank for measuring the concentration of I-131 and later discharge to the drain; these tanks are connected to an automated system that controls the effluents passage. The calculation to determine the volume of the tanks was carried out according to the demand that has the hospital, to the maximum activity being poured in effluents and time required to decay. In this paper the design and installation of SACEL system, in addition to functioning as a facility that enables the Hospital meet the required standards is presented. Dose calculations performed with MCNPX and the methodology used in the calibration of the detection system is also presented. (Author)

  1. Proton-hole and core-excited states in the semi-magic nucleus 131In82

    Energy Technology Data Exchange (ETDEWEB)

    Taprogge, J.; Jungclaus, A.; Grawe, H.; Borzov, I. N.; Nishimura, S.; Doornenbal, P.; Lorusso, G.; Simpson, G. S.; Söderström, P. -A.; Sumikama, T.; Xu, Z. Y.; Baba, H.; Browne, F.; Fukuda, N.; Gernhäuser, R.; Gey, G.; Inabe, N.; Isobe, T.; Jung, H. S.; Kameda, D.; Kim, G. D.; Kim, Y. -K.; Kojouharov, I.; Kubo, T.; Kurz, N.; Kwon, Y. K.; Li, Z.; Sakurai, H.; Schaffner, H.; Shimizu, Y.; Steiger, K.; Suzuki, H.; Takeda, H.; Vajta, Zs.; Watanabe, H.; Wu, J.; Yagi, A.; Yoshinaga, K.; Benzoni, G.; Bönig, S.; Chae, K. Y.; Coraggio, L.; Daugas, J. -M.; Drouet, F.; Gadea, A.; Gargano, A.; Ilieva, S.; Itaco, N.; Kondev, F. G.; Kröll, T.; Lane, G. J.; Montaner-Pizá, A.; Moschner, K.; Mücher, D.; Naqvi, F.; Niikura, M.; Nishibata, H.; Odahara, A.; Orlandi, R.; Patel, Z.; Podolyák, Zs.; Wendt, A.

    2016-11-01

    The decay of the N = 83 nucleus Cd-131 has been studied at the RIBF facility at the RIKEN Nishina Center. The main purpose of the study was to identify the position of the and proton-hole states and the energies of core-excited configurations in the semi-magic nucleus In-131. From the radiation emitted following the decay, a level scheme of In-131 was established and the feeding to each excited state determined. Similarities between the single-particle transitions observed in the decays of the N = 83 isotones In-132 and Cd-131 are discussed. Finally the excitation energies of several core-excited configurations in In-131 are compared to QRPA and shell-model calculations.

  2. Proton-hole and core-excited states in the semi-magic nucleus {sup 131}In{sub 82}

    Energy Technology Data Exchange (ETDEWEB)

    Taprogge, J. [Instituto de Estructura de la Materia, CSIC, Madrid (Spain); Universidad Autonoma de Madrid, Departamento de Fisica Teorica, Madrid (Spain); RIKEN Nishina Center, RIKEN, Saitama (Japan); Jungclaus, A. [Instituto de Estructura de la Materia, CSIC, Madrid (Spain); Grawe, H. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Borzov, I.N. [Kurchatov Institute, Moscow (Russian Federation); Joint Institute for Nuclear Research, Dubna (Russian Federation); Nishimura, S.; Doornenbal, P.; Soederstroem, P.A.; Baba, H.; Fukuda, N.; Inabe, N.; Isobe, T.; Kameda, D.; Kubo, T.; Shimizu, Y.; Suzuki, H.; Takeda, H.; Watanabe, H. [RIKEN Nishina Center, RIKEN, Saitama (Japan); Lorusso, G. [RIKEN Nishina Center, RIKEN, Saitama (Japan); National Physical Laboratory, NPL, Teddington, Middlesex (United Kingdom); University of Surrey, Department of Physics, Guildford (United Kingdom); Simpson, G.S.; Drouet, F. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble Cedex (France); Sumikama, T. [Tohoku University, Department of Physics, Sendai, Miyagi (Japan); Xu, Z.Y.; Niikura, M. [University of Tokyo, Department of Physics, Tokyo (Japan); Browne, F. [RIKEN Nishina Center, RIKEN, Saitama (Japan); University of Brighton, School of Computing, Engineering and Mathematics, Brighton (United Kingdom); Gernhaeuser, R.; Steiger, K.; Muecher, D. [Technische Universitaet Muenchen, Physik Department E12, Garching (Germany); Gey, G. [RIKEN Nishina Center, RIKEN, Saitama (Japan); LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble Cedex (France); Institut Laue-Langevin, B.P. 156, Grenoble Cedex 9 (France); Jung, H.S. [Chung-Ang University, Department of Physics, Seoul (Korea, Republic of); Kim, G.D.; Kwon, Y.K. [Institute for Basic Science, Rare Isotope Science Project, Daejeon (Korea, Republic of); Kim, Y.K. [Institute for Basic Science, Rare Isotope Science Project, Daejeon (Korea, Republic of); Hanyang University, Department of Nuclear Engineering, Seoul (Korea, Republic of); Kojouharov, I.; Kurz, N.; Schaffner, H. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Li, Z. [Peking University, School of Physics and State key Laboratory of Nuclear Physics and Technology, Beijing (China); Sakurai, H. [RIKEN Nishina Center, RIKEN, Saitama (Japan); University of Tokyo, Department of Physics, Tokyo (Japan); Vajta, Zs. [RIKEN Nishina Center, RIKEN, Saitama (Japan); MTA Atomki, P.O. Box 51, Debrecen (Hungary); Wu, J. [RIKEN Nishina Center, RIKEN, Saitama (Japan); Peking University, School of Physics and State key Laboratory of Nuclear Physics and Technology, Beijing (China); Yagi, A.; Nishibata, H.; Odahara, A. [Osaka University, Department of Physics, Toyonaka (Japan); Yoshinaga, K. [Tokyo University of Science, Department of Physics, Faculty of Science and Technology, Noda, Chiba (Japan); Benzoni, G. [INFN, Sezione di Milano, Milano (Italy); Boenig, S.; Ilieva, S.; Kroell, T. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); Chae, K.Y. [Sungkyunkwan University, Department of Physics, Suwon (Korea, Republic of); Coraggio, L.; Gargano, A. [Complesso Universitario di Monte S. Angelo, Istituto Nazionale di Fisica Nucleare, Napoli (Italy); Daugas, J.M. [CEA, DAM, DIF, Arpajon cedex (France); Gadea, A.; Montaner-Piza, A. [CSIC-Univ. of Valencia, Instituto de Fisica Corpuscular, Paterna (Spain); Itaco, N. [Seconda Universita di Napoli, Dipartimento di Matematica e Fisica, Caserta (Italy); Kondev, F.G. [Argonne National Laboratory, Nuclear Engineering Division, Argonne, IL (United States); Lane, G.J. [Australian National University, Department of Nuclear Physics, Research School of Physical Sciences and Engineering, Canberra (Australia); Moschner, K.; Wendt, A. [University of Cologne, IKP, Cologne (Germany); Naqvi, F. [Yale University, Wright Nuclear Structure Laboratory, New Haven, CT (United States); Orlandi, R. [K.U. Leuven, Instituut voor Kern- en StralingsFysica, Heverlee (Belgium); Japan Atomic Energy Agency, Advanced Science Research Center, Tokai, Ibaraki (Japan); Patel, Z.; Podolyak, Zs. [University of Surrey, Department of Physics, Guildford (United Kingdom)

    2016-11-15

    The β decay of the N = 83 nucleus {sup 131}Cd has been studied at the RIBF facility at the RIKEN Nishina Center. The main purpose of the study was to identify the position of the 1p{sub 3/2} and 0f{sub 5/2} proton-hole states and the energies of core-excited configurations in the semi-magic nucleus {sup 131}In. From the radiation emitted following the β decay, a level scheme of {sup 131}In was established and the β feeding to each excited state determined. Similarities between the single-particle transitions observed in the β decays of the N = 83 isotones {sup 132}In and {sup 131}Cd are discussed. Finally the excitation energies of several core-excited configurations in {sup 131}In are compared to QRPA and shell-model calculations. (orig.)

  3. Thyroid dose of I-131 absorbed by the internal organs of a pregnant woman; Dosis tiroidea de I-131 absorbida por los organos internos de una embarazada

    Energy Technology Data Exchange (ETDEWEB)

    Arcos P, A.; Manzanares A, E.; Vega C, H.R.; Leon, C.L. de [Cuerpo Academico de Radiobiologia de la Universidad Autonoma de Zacatecas (Mexico)]. e-mail: emanz_44@yahoo.com

    2007-07-01

    The use of nuclear techniques, for diagnosis or treatment, generates stress in the patient and its relatives. During the pregnancy some sufferings related with the thyroid gland can be presented. If the patient is pregnant, OEP or NOEP, the stress comes from the fear to that the product can it turns affected. The dose is calculated that the Iodine 131, captured by the thyroid of a woman with three months of pregnancy, it deposits in the brain, stomach, heart, kidneys, liver, lungs, ovaries, pancreas, thymus, spleen and in the uterus. The thymus is the organ that receives the biggest dose. (Author)

  4. Test of irradiation of tellurium oxide for obtaining iodine-131 by dry distillation; Prueba de irradiacion de dioxido de telurio para obtener yodo-131 por destilacion seca

    Energy Technology Data Exchange (ETDEWEB)

    Alanis M, J. [ININ, Departamento de Materiales Radiactivos, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2003-07-15

    With the purpose of optimizing to the maximum independently the work of the reactor of those mathematical calculations of irradiation that are already optimized, now it corresponds to carry out irradiation tests in the different positions with their respective neutron fluxes that it counts the reactor for samples irradiation. Then, it is necessary to carry out the irradiation of the tellurium dioxide through cycles, with the purpose of observing the activity that it goes accumulating in each cycle and this way to obtain an activity of the Iodine-131 obtained when finishing the last cycle. (Author)

  5. The utility of I-123 pretherapy scan in I-131 radioiodine therapy for thyroid cancer.

    Science.gov (United States)

    Chen, Ming-Kai; Yasrebi, Mona; Samii, Jason; Staib, Lawrence H; Doddamane, Indukala; Cheng, David W

    2012-03-01

    There is a growing belief that a pretherapy scan yields little or no additional information that would impact on radioiodine ablation dosing. In addition, there is some concern regarding on the stunning effect of a pretherapy scan, especially when I-131 radioisotope is used for imaging. We hypothesized that a pretherapy scan provides invaluable information on the amount of thyroid remnant, sometimes indicating the need for two-step I-131 ablation. It may also detect unsuspected local lymph node involvement or distant metastases, indicating the requirement for a higher I-131 dose after thyroidectomy. The aim of this study was to evaluate how effective pretherapy scans are for guiding I-131 therapy planning and augmenting information provided in the pathology reports for thyroidectomy specimens. We reviewed 122 patients who underwent I-123 pretherapy scan and I-131 radioablation at Yale New Haven Hospital between January 2006 and August 2007. The percentage of neck uptake and whole-body images were acquired 24 hours following the administration of 51.8 MBq (1.4 mCi) of I-123 NaI. A 24-hour uptake of >3% was used as the cutoff to determine whether there was a greater than desired quantity of thyroid remnant, which would require a two-step treatment protocol. Furthermore, attention was paid to identifying cervical lymph nodes, which may not have presented themselves in the euthyroid state at the time of thyroidectomy. Additional clinical information provided by pretherapy scans was computed as percentages with 95% confidence intervals by using adjusted Wald intervals. Overall, the pretherapy scans provided additional critical information in 25% of the cases (31/122; 95% CI: 18%-34%). For cases demonstrating >3% uptake with midline lymph nodes, the pretherapy scan provided additional information in 50% of the cases (8/16; 95% CI: 28%-72%). Our study demonstrated that I-123 pretherapy scans provide valuable information with regard to unsuspected lymph nodes or

  6. Use of gamma probe in {sup 131}I thyroid uptake studies; Utilizacao da sonda a cintilacao na captacao de {sup 131}I pela tireoide

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, Andrea Gondim Leitao

    2002-11-01

    Evaluation of thyroid uptake by administration of radioactive iodine is a well-defined procedure to assess patient thyroid function. In general, nuclear medicine institutions use gamma cameras coupled to pinhole collimators to perform uptake studies. With the growing use of intraoperative gamma probes in the radioguided surgical techniques, several institutions are purchasing this new and portable equipment, which can technically be also employed to assess patient's thyroid function, permitting further other applications of gamma cameras. The aim of the study was to compare thyroid uptake trails carried out with both gamma camera and intraoperative gamma probe, in order to evaluate the possible use of gamma probe for this purpose. At first a preliminary study of feasibility was carried out using a neck phantom to verify equipment efficiency with known activities of {sup 131} I. Henceforth, work data from 12 patients undergone studies of thyroid uptakes were evaluated, 24 hours after oral administration of 370 kBq of {sup 131} I. The maximum difference observed between the values obtained with both equipment was 60%, which demonstrated the feasibility of the proposed protocol and made clear that gamma probe can be useful for thyroid uptake studies. (author)

  7. Evaluation of the Basedow disease treatment by a iodine 131 fixed dose; Evaluation du traitement de la maladie de Basedow par une dose fixe d'iode 131

    Energy Technology Data Exchange (ETDEWEB)

    El Ajmi, W.; Slim, I; Rmadi, S.; Yeddes, I.; Krimi, S.; Ltaief, B.; Mhiri, A.; Ben Slimene, M.F. [Service de medecine nucleaire, institut Salah Azeiz, Tunis, (Tunisia)

    2009-05-15

    The treatment of the basedow disease by iodine 131 is more and more used. however, the doses used stay variable. In order to reduce the treatment failure, we chose a protocol with strong fix doses of iodine 131. We give our preliminary results for 63 patients. The treatment by strong fix dose of iodine 131 is simple, safe and efficient for the control of hyperthyroidism in the Basedow disease. This protocol has for advantage to be simpler comparatively to these ones using adjusted doses according the weight of the thyroid and its fixation rate. (N.C.)

  8. Dose {sup 131}I radioactivity interfere with thyroglobulin measurement in patients undergoing radioactive iodine therapy with recombinant human TSH?

    Energy Technology Data Exchange (ETDEWEB)

    Park, So Hyun; Bang, Ji In; Lee, Ho Young; Kim, Sang Eun [Dept. of Nuclear Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2015-06-15

    Recombinant human thyroid-stimulating hormone (rhTSH) is widely used in radioactive iodine therapy (RIT) to avoid side effects caused by hypothyroidism during the therapy. Owing to RIT with rhTSH, serum thyroglobulin (Tg) is measured with high 131I concentrations. It is of concern that the relatively high energy of 131I could interfere with Tg measurement using the immunoradiometric assay (IRMA). We investigated the effect of 131I administration on Tg measurement with IRMA after RIT. A total of 67 patients with thyroid cancer were analysed retrospectively. All patients had undergone rhTSH stimulation for RIT. The patients’ sera were sampled 2 days after 131I administration and divided into two portions: for Tg measurements on days 2 and 32 after 131I administration. The count per minute (CPM) of whole serum (200 μl) was also measured at each time point. Student’s paired t-test and Pearson’s correlation analyses were performed for statistical analysis. Serum Tg levels were significantly concordant between days 2 and 32, irrespective of the serum CPM. Subgroup analysis was performed by classification based on the 131I dose. No difference was noted between the results of the two groups. IRMA using 125I did not show interference from 131I in the serum of patients stimulated by rhTSH.

  9. {sup 131}I-CRTX internal dosimetry: animal model and human extrapolation

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Henrique Martins de; Ferreira, Andrea Vidal; Soares, Marcella Araugio; Silveira, Marina Bicalho; Santos, Raquel Gouvea dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: hma@cdtn.br

    2009-07-01

    Snake venoms molecules have been shown to play a role not only in the survival and proliferation of tumor cells but also in the processes of tumor cell adhesion, migration and angiogenesis. {sup 125}I-Crtx, a radiolabeled version of a peptide derived from Crotalus durissus terrificus snake venom, specifically binds to tumor and triggers apoptotic signalling. At the present work, {sup 125}I-Crtx biokinetic data (evaluated in mice bearing Erlich tumor) were treated by MIRD formalism to perform Internal Dosimetry studies. Doses in several organs of mice were determinate, as well as in implanted tumor, for {sup 131}I-Crtx. Doses results obtained for animal model were extrapolated to humans assuming a similar concentration ratio among various tissues between mouse and human. In the extrapolation, it was used human organ masses from Cristy/Eckerman phantom. Both penetrating and non-penetrating radiation from {sup 131}I in the tissue were considered in dose calculations. (author)

  10. {sup 131}I-SPGP internal dosimetry: animal model and human extrapolation

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Henrique Martins de; Ferreira, Andrea Vidal; Soprani, Juliana; Santos, Raquel Gouvea dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: hma@cdtn.br; Figueiredo, Suely Gomes de [Universidade Federal do Espirito Santo, (UFES), Vitoria, ES (Brazil). Dept. de Ciencias Fisiologicas. Lab. de Quimica de Proteinas

    2009-07-01

    Scorpaena plumieri is commonly called moreia-ati or manganga and is the most venomous and one of the most abundant fish species of the Brazilian coast. Soprani 2006, demonstrated that SPGP - an isolated protein from S. plumieri fish- possess high antitumoral activity against malignant tumours and can be a source of template molecules for the development (design) of antitumoral drugs. In the present work, Soprani's {sup 125}ISPGP biokinetic data were treated by MIRD formalism to perform Internal Dosimetry studies. Absorbed doses due to the {sup 131}I-SPGP uptake were determinate in several organs of mice, as well as in the implanted tumor. Doses obtained for animal model were extrapolated to humans assuming a similar ratio for various mouse and human tissues. For the extrapolation, it was used human organ masses from Cristy/Eckerman phantom. Both penetrating and non-penetrating radiation from {sup 131}I were considered. (author)

  11. Retrospective reconstruction of Iodine-131 distribution through the analysis of Iodine-129

    Science.gov (United States)

    Matsuzaki, Hiroyuki; Muramatsu, Yasuyuki; Ohno, Takeshi; Mao, Wei

    2017-09-01

    Iodine-131 distribution released from the Fukushima Dai-ichi Nuclear Power Plant accident was reconstructed through the iodine-129 measurements. From nearly 1,000 surface soil samples iodine was extracted by the pyro hydrolysis method. Extracted iodine was then mixed with carrier, purified and finally collected as silver iodide. Silver iodide sample was pressed into the cathode holder and set at the ion source of the MALT facility, The University of Tokyo. The isotopic ratio 129I/127I was measured by means of Accelerator Mass Spectrometry. From 129I data obtained, 131I deposition map was constructed. There observed various fine structures in the map which could not estimated neither by the simulation nor 137Cs distribution.

  12. Retrospective reconstruction of Iodine-131 distribution through the analysis of Iodine-129

    Directory of Open Access Journals (Sweden)

    Matsuzaki Hiroyuki

    2017-01-01

    Full Text Available Iodine-131 distribution released from the Fukushima Dai-ichi Nuclear Power Plant accident was reconstructed through the iodine-129 measurements. From nearly 1,000 surface soil samples iodine was extracted by the pyro hydrolysis method. Extracted iodine was then mixed with carrier, purified and finally collected as silver iodide. Silver iodide sample was pressed into the cathode holder and set at the ion source of the MALT facility, The University of Tokyo. The isotopic ratio 129I/127I was measured by means of Accelerator Mass Spectrometry. From 129I data obtained, 131I deposition map was constructed. There observed various fine structures in the map which could not estimated neither by the simulation nor 137Cs distribution.

  13. Factors affecting uptake of {sup 131}I in Chinese white cabbage (Brassica Chinensis Linn)

    Energy Technology Data Exchange (ETDEWEB)

    Yu, K.N. E-mail: peter.yu@cityu.edu.hk; Cheung, T.; Luo, D.L.; Li, M.F

    2000-06-01

    The factors affecting the uptake of {sup 131}I in Chinese white cabbage (Brassica Chinensis Linn) were studied. The time required for the ratio between the activity in the vegetable (Bq kg{sup -1} dry mass) and the activity in the soil (Bq kg{sup -1} dry mass) to reach equilibrium was around 72 h derived from an investigation period of 145 h. The ratio was also dependent on the mass of the vegetable (increased by more than twice when the vegetable mass was decreased to around 60%), the growth period of the vegetable (almost linearly decreased from 3.0x10{sup -2} to 1.1x10{sup -2} when the growth period changed from 66 to 81 d) and the season of culture, while it was independent of the concentration of {sup 131}I applied to the soil. The mean concentration ratio obtained for 51 samples was (6.3{+-}4.4)x10{sup -2}.

  14. Purification and characterization of a bacteriocin produced by Leuconostoc mesenteroides E131.

    Science.gov (United States)

    Xiraphi, N; Georgalaki, M; Rantsiou, K; Cocolin, L; Tsakalidou, E; Drosinos, E H

    2008-10-01

    Leuconostoc mesenteroides E131, isolated from Greek traditional fermented sausage, prepared without the addition of starters, produces a bacteriocin which is active against the pathogen Listeria monocytogenes. The bacteriocin was purified by 50% ammonium sulphate precipitation, cation exchange, and reverse-phase chromatography. Bacteriocin is active at pH values between 4.0 and 9.0 and retains activity after incubation for 1h at 100°C. Proteolytic enzymes inactivated the bacteriocin after 1h of incubation, while renin resulted in full inactivation only after 24h. Lipase resulted in full inactivation after 4h. Applying molecular methods, it was determined that the bacteriocin produced, named as mesenterocin E131, was identical to mesenterocin Y105 and was expressed during the exponential growth phase.

  15. Fluoroquinolone-Resistant Sequence Type 131 Subgroups O25b and O16 Among Extraintestinal Escherichia coli Isolates from Community-Acquired Urinary Tract Infections.

    Science.gov (United States)

    Hefzy, Enas Mamdouh; Hassuna, Noha Anwar

    2017-03-01

    The multidrug-resistant sequence type 131 (ST131) Escherichia coli is a spreading epidemiological burden particularly among isolates resistant to fluoroquinolones. We aimed to evaluate the commonality of ST131-O25b and ST131-O16 among fluoroquinolone-resistant E. coli isolates causing community-acquired urinary tract infections (UTIs) at Fayoum University Hospital, in Egypt. Ninety-two fluoroquinolone-resistant E. coli isolates were subjected to multiplex PCR for detection of ST131 of either O25b or O16 subgroups. Positive isolates were then assessed for antimicrobial susceptibility and virulence genotyping. Out of 92 fluoroquinolone-resistant E. coli isolates, 56 (60.9%) isolates were O25b/O16 subgroups of ST131, including 44 (78.6%) ST131-O25b and 12 (21.4%) ST131-O16 subgroups. All the O25b/O16 ST131 isolates were sensitive to meropenem, where ST131-O25b isolates were significantly more resistant to extended spectrum cephalosporins compared to S131-O16 strains. All the O25b/O16 ST131 isolates harbored three or more of the virulence factors associated with extraintestinal pathogenic E. coli status. ST131-O16 showed a significantly higher virulence score than ST131-O25b isolates. Our results bring to highlight the emergence of O25b/O16 ST131 isolates between community acquired UTIs among Egyptian patients. This is the first report for the presence of O16 isolates in Egypt, showing a lower predominance than the O25b subgroup. The high prevalence of O25b/O16 ST131 isolates requires strict stewardship on antimicrobial use, notably fluoroquinolones, to control the endemicity of such emerging multidrug-resistant clone in the community.

  16. Therapeutic effectiveness of {sup 131}I-MIBG on malignant pheochromocytoma. Results of long follow-up

    Energy Technology Data Exchange (ETDEWEB)

    Kusakabe, Kiyoko; Kanaya, Kazuko; Kanaya, Shinichi [Tokyo Women`s Medical Coll. (Japan)] [and others

    1994-12-01

    The therapeutic response of {sup 131}I-MIBG was evaluated in 4 patients with malignant pheochromocytoma who had been treated with {sup 131}I-MIBG and followed-up over 5 years. The patients were 2 men and 2 women with ages ranging from 41 to 69 years old (mean 53 years). The primary tumors in 3 of 4 patients had been resected four to eight years before {sup 131}I-MIBG treatment. One patient was diagnosed as adrenal pheochromocytoma, and two were retroperitoneal paraganglioma. And in one patient, the resection of primary mediastinal tumor was not performed due to the adhesion to pericardium but the diagnosis of paraganglioma was obtained by biopsy of bone lesion. All patients showed the clear accumulation of {sup 131}I-MIBG in tumor on scintigraphy. The number of doses of {sup 131}I-MIBG ranged from one to three times with 3.7 GBq per administration and a cumulative activity from 3.7 to 11.1 GBq. Treatment effect was obvious in one patient with lung, bone, and lymphnode metastases whose cumulated absorbed dose with 11.1 GBq of {sup 131}I-MIBG exceeded over 150 Gy. At the present time, the duration of survival since the beginning of initial {sup 131}I-MIBG therapy is over 5 yrs. The other three patients, however, showed little effects, and died with the disease in 2.6 to 4.1 years after the initial {sup 131}I-MIBG therapy. {sup 131}I-MIBG will become a promising agent for therapy in patients with malignant pheochromocytoma with high degree of accumulation. (author).

  17. Demonstration of traumatic hepato-pleural-cutaneous defect by 131I-rose bengal.

    Science.gov (United States)

    Henderson, R W; Lee, Y C; Telfer, N

    1978-11-01

    A 19-year-old man was shot in the right chest about 2 cm below the nipple; bloody fluid was drained through a chest tube. Two days later sero-sanguineous fluid tinged with bile was seen to drain from the wound site. 131I-rose bengal, injected intravenously, collected in the dome of the liver and drained into a collection bag placed over the wound site, thus identifying a hepato-pleural-cutaneous fistula, which was confirmed at surgery.

  18. Optimization algorithm for absorbed dose calculation during single intake of 131І to rats

    Directory of Open Access Journals (Sweden)

    I. P. Drozd

    2016-02-01

    Full Text Available Original calculation algorithms are proposed for absorbed doses in the thyroid gland and thymus of rats at single income of 131I that enable to simplify the calculations and at the same time ensure high reliability of results in the range of input activities of 1 - 115000 Bq. According to the algorithms, the program is developed in the MATLAB environment, adapted for use on Windows running PC. Relative error of calculations is ±2 %.

  19. Numerical simulations of atmospheric dispersion of iodine-131 by different models

    OpenAIRE

    Ádám Leelőssy; Róbert Mészáros; Attila Kovács; István Lagzi; Tibor Kovács

    2017-01-01

    Nowadays, several dispersion models are available to simulate the transport processes of air pollutants and toxic substances including radionuclides in the atmosphere. Reliability of atmospheric transport models has been demonstrated in several recent cases from local to global scale; however, very few actual emission data are available to evaluate model results in real-life cases. In this study, the atmospheric dispersion of 131I emitted to the atmosphere during an industrial process was sim...

  20. Numerical simulations of atmospheric dispersion of iodine-131 by different models

    OpenAIRE

    Leelőssy, Ádám; Mészáros, Róbert; Kovács, Attila; Lagzi, István; Kovács, Tibor

    2016-01-01

    Several dispersion models are available to simulate the transport processes of air pollutants and toxic substances including radionuclides in the atmosphere. Reliability of atmospheric transport models has been demonstrated in several recent cases from local to global scale, however, very few actual emission data are available to evaluate model results in real-life cases. In this study, the atmospheric dispersion of 131I emitted to the atmosphere during an industrial process was simulated wit...

  1. Lung-conserving treatment of a pulmonary oligometastasis with a wedge resection and 131Cs brachytherapy.

    Science.gov (United States)

    Wernicke, A Gabriella; Parikh, Apurva; Yondorf, Menachem; Trichter, Samuel; Gupta, Divya; Port, Jeffrey; Parashar, Bhupesh

    2013-01-01

    Soft-tissue sarcomas most frequently metastasize to the lung. Surgical resection of pulmonary metastases is the primary treatment modality. Although lobectomy is widely acknowledged as the standard procedure to treat primary pulmonary tumors, the standard for pulmonary metastases is not well defined; furthermore, compromised lung function may tip the scales in favor of a less invasive approach. Here, we report the results of a patient treated with wedge resection and intraoperative cesium-131 ((131)Cs). A 58-year-old African American female was diagnosed with the American Joint Committee on Cancer Stage IIA mixed uterine leiomyosarcoma and underwent total abdominal hysterectomy and bilateral salpingo-oophorectomy followed by adjuvant external beam radiotherapy to a total dose of 45 Gy and vaginal brachytherapy to a total dose of 20 Gy. At 2 years, a routine CT scan of the chest revealed metastasis to right upper lobe of the lung. The patient's poor pulmonary function, related to a 45 pack-year smoking history and chronic emphysema, precluded a lobectomy. After the patient underwent a lung-sparing wedge resection of the pulmonary right upper lobe metastasis and intraoperative brachytherapy with (131)Cs seeds to a total dose of 80 Gy, she remained disease free in the implanted area. At a 2-year followup, imaging continued to reveal 100% local control of the area treated with wedge resection and intraoperative (131)Cs brachytherapy. The patient had no complications from this treatment. Such treatment approach may become an attractive option in patients with oligometastatic disease and compromised pulmonary function. Copyright © 2013 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

  2. SCOR WG-131: The Legacy of in situ Iron Enrichment Experiments - Data Compilation and Modeling

    Science.gov (United States)

    Boyd, Philip W.; Bakker, Dorothee C. E.; Wg-131, Scor

    2010-05-01

    Working Group 131 (WG-131) of the Scientific Committee on Oceanic Research (SCOR) has these aims: 1) Data compilation. Assembling in a common open-access database the metadata and data of the in situ iron fertilization experiments, ranging from surface water and water column data on physical, chemical and biological parameters, to biogeochemical rate processes and incubation experiments 2) Modeling and data synthesis of specific aspects of two or more such experiments for various topics, such as physical mixing, phytoplankton productivity, overall ecosystem functioning, iron chemistry, carbon budgeting, nutrient uptake ratios, and combinations of these variables and processes. Over the last 24 months SCOR WG-131 participants, in particular Doug Mackie, have liased with Cyndy Chandler and Steve Gegg at the Biological and Chemical Oceanography Data Management Office (BCO-DMO; http://www.bco-dmo.org/home) to pull together a relational database that spans data from IronEx I in 1993 to SEEDS II in 2004. The BCO-DMO database currently contains data sets for IronEx I, IronEx II, SOIREE, SEEDS I, SEEDS II, SERIES, SOFeX-North and SOFeX-South. The BCO-DMO data base also has a link to the publicly available EisenEx data, which are stored at the World Data Center for Marine Environmental Sciences (WDC-MARE, http://www.wdc-mare.org/). We hope to launch the BCO-DMO database at a side meeting on the afternoon of Sunday 21 February 2010 before the Ocean Sciences Meeting in Portland. The relational BCO-DMO database permits intercomparisons of data, thus allowing for exciting and novel opportunities for data synthesis and modeling, from 1-dimensional simple biological models through to complex 3-dimensional models. Scientists interested in such work are invited to contact the chairs of WG-131.

  3. Hypertension complicating {sup 131}I-meta-iodobenzylguanidine therapy for neuroblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Kosmin, Michael A.; Cork, Nicholas J.; Gaze, Mark N. [University College London Hospitals NHS Foundation Trust, Department of Oncology, London (United Kingdom); Bomanji, Jamshed B. [University College London Hospitals NHS Foundation Trust, Department of Nuclear Medicine, London (United Kingdom); Shankar, Ananth [University College London Hospitals NHS Foundation Trust, Department of Paediatric Oncology, London (United Kingdom)

    2012-04-15

    Radiolabelled meta-iodobenzylguanidine (mIBG), used as targeted therapy for neuroblastoma, is known to have effects on blood pressure (BP). In this study we audited BP changes in patients receiving {sup 131}I-mIBG therapy for neuroblastoma to identify BP-related adverse events (AE) and possible predictive factors. Between 2003 and 2010, 50 patients with neuroblastoma received 110 {sup 131}I-mIBG administrations. BP measurements before and after administration were compared with age- and sex-matched centile values. AE were analysed, and possible predisposing factors identified. This population had a baseline BP distribution higher than that of their age- and sex-matched peers, with 16% of preadministration systolic BP values above the 95th centile. Changes in BP after administration showed an approximately normal distribution with similar numbers of reduced and increased values. Four AE, all related to hypertension, occurred with one patient having generalized seizures. One AE was immediate, others occurred between 20 and 25 h after administration. No significant association between AE and patient age or sex was demonstrated. However, a significant association between AE and high preadministration BP was shown, both above the 90th centile (p = 0.0022) and above the 95th centile (p = 0.0135). Clinically relevant hypertension following {sup 131}I-mIBG therapy affected less than 5% of administrations, but was more common in those patients with preexisting hypertension. As hypertensive episodes may occur many hours after treatment, close monitoring of BP needs to be continued for at least 48 h after administration of {sup 131}I-mIBG. (orig.)

  4. Managing Terrorism or Accidental Nuclear Errors, Preparing for Iodine-131 Emergencies: A Comprehensive Review

    Directory of Open Access Journals (Sweden)

    Eric R. Braverman

    2014-04-01

    Full Text Available Chernobyl demonstrated that iodine-131 (131I released in a nuclear accident can cause malignant thyroid nodules to develop in children within a 300 mile radius of the incident. Timely potassium iodide (KI administration can prevent the development of thyroid cancer and the American Thyroid Association (ATA and a number of United States governmental agencies recommend KI prophylaxis. Current pre-distribution of KI by the United States government and other governments with nuclear reactors is probably ineffective. Thus we undertook a thorough scientific review, regarding emergency response to 131I exposures. We propose: (1 pre-distribution of KI to at risk populations; (2 prompt administration, within 2 hours of the incident; (3 utilization of a lowest effective KI dose; (4 distribution extension to at least 300 miles from the epicenter of a potential nuclear incident; (5 education of the public about dietary iodide sources; (6 continued post-hoc analysis of the long-term impact of nuclear accidents; and (7 support for global iodine sufficiency programs. Approximately two billion people are at risk for iodine deficiency disorder (IDD, the world’s leading cause of preventable brain damage. Iodide deficient individuals are at greater risk of developing thyroid cancer after 131I exposure. There are virtually no studies of KI prophylaxis in infants, children and adolescents, our target population. Because of their sensitivity to these side effects, we have suggested that we should extrapolate from the lowest effective adult dose, 15–30 mg or 1–2 mg per 10 pounds for children. We encourage global health agencies (private and governmental to consider these critical recommendations.

  5. Cep70 and Cep131 contribute to ciliogenesis in zebrafish embryos

    Directory of Open Access Journals (Sweden)

    Carl Matthias

    2009-03-01

    Full Text Available Abstract Background The centrosome is the cell's microtubule organising centre, an organelle with important roles in cell division, migration and polarity. However, cells can divide and flies can, for a large part of development, develop without them. Many centrosome proteins have been identified but the roles of most are still poorly understood. The centrioles of the centrosome are similar to the basal bodies of cilia, hair-like extensions of many cells that have important roles in cell signalling and development. In a number of human diseases, such Bardet-Biedl syndrome, centrosome/cilium proteins are mutated, leading to polycystic kidney disease, situs inversus, and neurological problems, amongst other symptoms. Results We describe zebrafish (Danio rerio embryos depleted for two uncharacterised, centrosome proteins, Cep70 and Cep131. The phenotype of these embryos resembles that of zebrafish mutants for intraflagellar transport proteins (IFTs, with kidney and ear development affected and left-right asymmetry randomised. These organs and processes are those affected in Bardet-Biedl syndrome and other similar diseases. Like these diseases, the root cause of the phenotype lies, in fact, in dysfunctional cilia, which are shortened but not eliminated in several tissues in the morphants. Centrosomes and basal bodies, on the other hand, are present. Both Cep70 and Cep131 possess a putative HDAC (histone deacetylase interacting domain. However, we could not detect in yeast two-hybrid assays any interaction with the deacetylase that controls cilium length, HDAC6, or any of the IFTs that we tested. Conclusion Cep70 and Cep131 contribute to ciliogenesis in many tissues in the zebrafish embryo: cilia are made in cep70 and cep131 morphant zebrafish embryos but are shortened. We propose that the role of these centrosomal/basal body proteins is in making the cilium and that they are involved in determination of the length of the axoneme.

  6. Slide 131

    Indian Academy of Sciences (India)

    This is not to say, though, that the best way to design a life preserver is in the form of a piano top. I think that we are clinging to a great many piano tops in accepting yesterday's fortuitous contrivings as constituting the only means for solving a given problem. R. Buckminster Fuller (Operating Manual for Spaceship Earth)

  7. [Metabolic therapy with iodine 131 in patients with chronic renal failure. Clinical case].

    Science.gov (United States)

    Vázquez-Rodríguez Barbero, Inmaculada; Espadas-Maeso, María José; Muñoz-Morales, Ana; Flores-Gómez, Pilar; Serrano-Carretero, María Belén; Castedo-Sal, Juan José; Sánchez Rey-Castro, Elena; Zamorano-Córdoba, Antonio

    2015-01-01

    62 year-old male with CKD stage 5 in dialysis program since 2012 who underwent surgery for papillary thyroid carcinoma with lymph node metastasis. Subsequently, the patient was admitted to the Unit of Metabolic Therapy at his reference hospital, where he is administered 80 millicuries of iodine-131 as a treatment associated with the surgery, unable to have his conventional dialysis, nursing interventions required in various stages of implementation of the continuous extrarenal clearance techniques (TCDE) were performed. The following care values were addressed targeted to patients undergoing treatment with I(131): specific equipment, personal protective measures and major diagnoses and nursing interventions. TCDE, despite being attributed to very critical patients, they can be extrapolated to other patients in a given time. TCDE allowed these patients to undergo dialysis in a safe environment for staff, ensuring proper disposal of contaminated liquids. TCDE were an effective treatment for the removal of I131, a single ssesion being necessary to normalize the levels of radioactivity. Coordination between services allewed ensure proper and effective treatment for the patient. Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  8. Requirements Doc for Refurb of JASPER Facility in B131HB

    Energy Technology Data Exchange (ETDEWEB)

    Knittel, Kenn M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-01-25

    The Joint Actinide Shock Physics Experimental Research (JASPER) Program target fabrication facility is currently located in building 131 (B131) of the Lawrence Livermore National Laboratory (LLNL). A portion of this current facility has been committed to another program as part of a larger effort to consolidate LLNL capabilities into newer facilities. This facility assembles precision targets for scientific studies at the Nevada National Security Site (NNSS). B131 is also going through a modernization project to upgrade the infrastructure and abate asbestos. These activities will interrupt the continuous target fabrication efforts for the JASPER Program. Several options are explored to meet the above conflicting requirements, with the final recommendation to prepare a new facility for JASPER target fabrication operations before modernization efforts begin in the current facility assigned to JASPER. This recommendation fits within all schedule constraints and minimizes the disruption to the JASPER Program. This option is not without risk, as it requires moving an aged, precision coordinate measuring machine, which is essential to the JASPER Program’s success. The selected option balances the risk to the machine with continuity of operations.

  9. Case of hyperthyroidism complicated with diabetic ketoacidosis following /sup 131/I therapy

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, Mitsuyasu; Funauchi, Masanori; Fukuma, Naobumi; Abe, Yohsuke; Hirooka, Yoshibumi; Nihei, Noriyuki (Hamamatsu Univ. Shizuoka (Japan). School of Medicine)

    1982-10-01

    The coexistence of diabetes mellitus and hyperthyroidism has long been known and, in a few cases, diabetic acidosis complicated with thyroid storm has been reported. We describe a case who developed thyroid storm and diabetic ketoacidosis following /sup 131/I therapy for severe hyperthyroidism. A 50-yr-old man was diagnosed as having hyperthyroidism complicated with diabetes mellitus at the age of 47. After he had been unsuccessfully treated with methimazole and oral hypoglycemic agents, radioactive iodine was administered twice. However, no remarkable effect was observed. After a third treatment with /sup 131/I, the patient showed symptoms like thyroid storm and diabetic ketoacidosis. He was hospitalized on October 3, 1980. Adm of insulin and supportive therapy including correction of dehydration alleviated his symptoms after admission. Administration of methimazole normalized his thyroid function. A 75 g GTT and tolbutamide i.v. test revealed impaired secretion of endogenous insulin. The patient had a high level of serum T/sub 3/ and T/sub 4/ following /sup 131/I therapy, indicating that the released hormone caused a transient condition like thyroid storm, which led to deterioration of glucose metabolism as indicated in high levels of hemoglobin A1c. Diabetic acidosis is the precipitating factor for thyroid storm. Prompt treatment for diabetic ketoacidosis, therefore, might prevent the complications of life-threatening thyroid storm.

  10. NOTE: Monte Carlo microdosimetry of 188Re- and 131I-labelled anti-CD20

    Science.gov (United States)

    Torres-García, E.; Garnica-Garza, H. M.; Ferro-Flores, G.

    2006-10-01

    The radiolabelled monoclonal antibody anti-CD20 has the property of binding to the CD20 antigen expressed on the cell surface of B-lymphocytes, thus making it a useful tool in the treatment of non-Hodgkin's lymphoma. In this work, the event-by-event Monte Carlo code NOREC is used to calculate the single-event distribution function f1(z) in the cell nucleus using the beta spectra of the 188Re and 131I radionuclides. The simulated geometry consists of two concentric spheres representing the nucleus and the cell surface embedded in a semi-infinite water medium. An isotropic point source was placed on the cell surface to simulate the binding of the anti-CD20 labelled with either 188Re or 131I. The simulations were carried out for two combinations of cell surface and nucleus radii. A method was devised that allows one to calculate the contribution of betas of energy greater than 1 MeV, which cannot be simulated by the NOREC code, to the single-event distribution function. It is shown that disregarding this contribution leads to an overestimation of the frequency-mean specific energy of the order of 9 12%. In general, the antibody radiolabelled with 131I produces single-event distribution functions that yield higher frequency-mean specific energies.

  11. Identification of transplanted pancreatic islet cells by radioactive dithizone-[131I]-histamine conjugate. Preliminary report.

    Science.gov (United States)

    Garnuszek, P; Licińska, I; Mrozek, A; Wardawa, A; Fiedor, P S; Mazurek, A P

    2000-01-01

    The unique mechanism of dithizone action in the interior of the viable pancreatic islet suggests the possible development of a specific radiopharmaceutical that may have a potential clinical application in the diagnosis of the pancreatic organ allografts or islets rejection. The radiodiagnostic properties of the newly developed radioactive analogue of dithizone, i.e. Dithizone-[(131)I]-Histamine conjugate have been evaluated in the present study. The four islet cells transplantation models were chosen for this purpose. The most important feature of the Dithizone-[(131)I]-Histamine conjugate is its possessed ability of zinc chelation. As was presented in the recent study, the conjugate stains pink-reddish the isolated pancreatic islets in vitro. Among the studied transplantation models, only the islets grafting under testis capsule enabled determination of the pancreatic islets in rats by radioactive Dithizone-[(131)I]-Histamine conjugate. The level of the radioactivity in the recipient testis (right) was almost two times higher compared to the controls (0.24 vs. 0.13% ID/g, respectively). These preliminary data demonstrate the ability of the developed radioactive analogue of dithizone for in vivo identification of transplanted pancreatic islets, and suggests a potential clinical application of the radiodithizone in the diagnosis of the pancreatic islet rejection.

  12. Radiolabeling and biodistribution of monoclonal antibody (MAb) anti-CD20 with iodine-131

    Energy Technology Data Exchange (ETDEWEB)

    Akanji, Akinkunmi Ganiyu; Muramoto, Emiko; Caldeira Filho, Jose de Souza; Couto, Renata Martinussi; Araujo, Elaine Bortoletti de [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP), SP (Brazil)

    2005-10-15

    Radioactive isotopes of iodine, mainly iodine-131 have been broadly used in many monoclonal antibody radioiodination settings, employing different methods. In this study, using a Chloramine-T procedure, the influence of incubation time, CT mass, and Ab/activity ratio on the radiochemical yield of the anti-CD20 antibody labeled with iodine-131 was observed. Radiochemical yield was > 97 %, employing different Chloramine-T masses, independently of incubation time. Radiochemical purity was above 99 % after purification of the labeled compound. The relationship between Ab mass and radioactivity was tested and no difference was observed when 90.6 MBq (2.45mCi) of activity was incorporated in the Ab-mass range studied. Biodistribution study in normal Swiss mice showed higher uptake by the liver and intestines. Low thyroid uptake indicated a suitable in vivo stability. Slight blood uptake was considered a result of circulating radioactivity in normal organs and tissues. A favorable biological distribution of {sup 131} I-anti-CD20 suggests this radiopharmaceutical may be effectively used in the therapy of Non Hodgkin Lymphoma.(author)

  13. Subclinical Hypothyroidism after 131I-Treatment of Graves' Disease: A Risk Factor for Depression?

    Science.gov (United States)

    Yu, Jing; Tian, Ai-Juan; Yuan, Xin; Cheng, Xiao-Xin

    2016-01-01

    Although it is well accepted that there is a close relationship between hypothyroidism and depression, previous studies provided inconsistent or even opposite results in whether subclinical hypothyroidism (SCH) increased the risk of depression. One possible reason is that the etiology of SCH in these studies was not clearly distinguished. We therefore investigated the relationship between SCH resulting from 131I treatment of Graves' disease and depression. The incidence of depression among 95 patients with SCH and 121 euthyroid patients following 131I treatment of Graves' disease was studied. The risk factors of depression were determined with multivariate logistic regression analysis. Thyroid hormone replacement therapy was performed in patients with thyroid-stimulating hormone (TSH) levels exceeding 10 mIU/L. Patients with SCH had significantly higher Hamilton Depression Scale scores, serum TSH and thyroid peroxidase antibody (TPOAb) levels compared with euthyroid patients. Multivariate logistic regression analysis revealed SCH, Graves' eye syndrome and high serum TPO antibody level as risk factors for depression. L-thyroxine treatment is beneficial for SCH patients with serum TSH levels exceeding 10 mIU/L. The results of the present study demonstrated that SCH is prevalent among 131I treated Graves' patients. SCH might increase the risk of developing depression. L-thyroxine replacement therapy helps to resolve depressive disorders in SCH patients with TSH > 10mIU/L. These data provide insight into the relationship between SCH and depression.

  14. Emergence and Dissemination of ST131 Escherichia coli Isolates Among Patients with Hospital-Acquired Pneumonia in Asian Countries.

    Science.gov (United States)

    Cha, Min Kyeong; Kang, Cheol-In; Kim, So Hyun; Thamlikitkul, Visanu; So, Thomas Man-Kit; Ha, Young Eun; Chung, Doo Ryeon; Peck, Kyong Ran; Song, Jae-Hoon

    2017-01-01

    We investigated the molecular epidemiology and microbiological characteristics of 51 Escherichia coli isolates causing hospital-acquired pneumonia (HAP) in eight Asian areas. Sequence type 131 (ST131) was the most prevalent among E. coli isolates causing HAP, especially in South Korea, Thailand, and the Philippines. The current study showed that CTX-M-15-producing E. coli ST131 has emerged in and disseminated among patients with HAP in Asia. Our data suggest that this pandemic clone poses an important public health threat even in nosocomial infections.

  15. Medically-derived I-131: a potential tool for understanding the fate of wastewater nitrogen in aquatic systems

    Science.gov (United States)

    Rose, P. S.; Smith, J. P.; Aller, R. C.; Cochran, J. K.; Swanson, R. L.; Murthy, S. N.; Coffin, R. B.

    2010-12-01

    Iodine-131(t1/2 = 8 days) has been measured in Potomac River water and sediments in the vicinity of the Blue Plains Water Pollution Control Plant (WPCP), Washington, DC. The source of I-131 is medical, where it is commonly used to treat thyroid cancer and hyperthyroidism. Iodine is metabolized by patients and eliminated primarily in urine. While other medical radioisotopes may enter the environment via sewage effluent, the nature and quantity of treatments using I-131 cause it to account for much of the radioactivity in sewage effluent. Natural iodine in aquatic systems is biologically cycled similar to other nutrients, such as nitrogen. Iodine-131 concentrations measured in sewage effluent from Blue Plains WPCP and in the Potomac River suggest a relatively continuous discharge of this isotope. Dissolved I-131 shows a strong, positive correlation with δ15N values of nitrate in the river. The range of I-131 concentrations detected in surface waters is 0.18 ± 0.01 to 0.68 ± 0.02 Bq/L. Surface water δ15NO3 values ranged from 8.7 ± 0.3 to 33.4 ± 7.3 ‰ with NO3+NO2 concentrations between 0.38 ± 0.02 and 2.79 ± 0.13 mgN/L. Sediment profiles of particulate I-131 and δ15N indicate rapid mixing or sedimentation and in many cases remineralization of a heavy nitrogen source consistent with wastewater nitrogen. Iodine-131 concentrations in sediments ranged from 1.31 ± 0.8 to 117 ± 2 Bq/kg dry weight. Values of δ15N in sediments ranged from 4.7 ± 0.1 ‰ to 9.3 ± 0.1 ‰. We propose that I-131 coupled with δ15N can be an excellent tracer for the short-term fate of wastewater nitrogen in this system. However, the utility of I-131 as a tracer is not limited to use in the Potomac River. Other studies have documented the presence of I-131 in several aquatic systems and continuous discharges of this radioisotope in sewage effluent are likely to be widespread in urban environments.

  16. Retrospective reconstruction of Ioidne-131 distribution at the Fukushima Daiichi Nuclear Power Plant accident by analysis of Ioidne-129

    Science.gov (United States)

    Matsuzaki, Hiroyuki; Muramatsu, Yasuyuki; Toyama, Chiaki; Ohno, Takeshi; Kusuno, Haruka; Miyake, Yasuto; Honda, Maki

    2014-05-01

    Among various radioactive nuclides emitted from the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident, Iodine-131 displayed high radioactivity just after the accident. Moreover if taken into human body, Iodine-131 concentrates in the thyroid and may cause the thyroid cancer. The recognition about the risk of Iodine-131 dose originated from the experience of the Chernobyl accident based on the epidemiological study [1]. It is thus important to investigate the detailed deposition distribution of I-131 to evaluate the radiation dose due to I-131 and watch the influence on the human health. However I-131 decays so rapidly (half life = 8.02 d) that it cannot be detected several months after the accident. At the recognition of the risk of I-131 on the Chernobyl occasion, it had gone several years after the accident. The reconstruction of I-131 distribution from Cs-137 distribution was not successful because the behavior of iodine and cesium was different because they have different chemical properties. Long lived radioactive isotope I-129 (half life = 1.57E+7 yr,), which is also a fission product as well as I-131, is ideal proxy for I-131 because they are chemically identical. Several studies had tried to quantify I-129 in 1990's but the analytical technique, especially AMS (Accelerator Mass Spectrometry), had not been developed well and available AMS facility was limited. Moreover because of the lack of enough data on I-131 just after the accident, the isotopic ratio I-129/I-131 of the Chernobyl derived iodine could not been estimated precisely [2]. Calculated estimation of the isotopic ratio showed scattered results. On the other hand, at the FDNPP accident detailed I-131 distribution is going to be successfully reconstructed by the systematical I-129 measurements by our group. We measured soil samples selected from a series of soil collection taken from every 2 km (or 5km, in the distant area) meshed region around FDNPP conducted by the Japanese Ministry of

  17. Analysis of uncertainties in a individualized method of estimation activity of {sup 1}31I for hyperthyroid patient; Analisis de incertidumbres en un metodo individualizado de estimacion de actividad de {sup 1}31I para el paciente hipertiroideo

    Energy Technology Data Exchange (ETDEWEB)

    Orellana Salas, A.; Melgar Perez, J.; Arrocha Acevedo, J. F.

    2013-07-01

    The determination of the activity to prescribe the hyperthyroid patients presented difficult consideration uncertainties. The uncertainties associated with the experimental design can exceed 20%, so it should be valued to customize activity therapy of {sup 1}31 I. (Author)

  18. Relapse of pulmonary tuberculosis: a rare cause of false-positive of the scintigraphy with iodine 131; Sequelles de tuberculose pulmonaire: une rare cause de faux-positif de la scintigraphie a l'iode 131

    Energy Technology Data Exchange (ETDEWEB)

    Ungureanu, C.M.; Angoue, O.; Blagosklonov, O.; Boulahdour, H. [Service de medecine nucleaire, CHU Jean-Minjoz, Besancon, (France); Manzoni, P. [service de radiologie, CHU Jean-Minjoz, Besancon, (France)

    2009-05-15

    The whole body scintigraphy with {sup 131}I is used in the follow up of the differentiated thyroid cancer. It is important to know the causes of false positive before decision of treatment by iodine 131. We present the case of a patient with a pulmonary fixation that was a false positive of {sup 131}I, of rare etiology. The after-effects of tuberculosis are able to fix iodine 131 and then to give false positive. scintigraphy. This etiology of false positive is rare and is worthy to be known because the lung is frequently an area of metastases in the thyroid cancer and the incidence of tuberculosis is increasing. (N.C.)

  19. Putting to point the production process of iodine-131 by dry distillation (Preoperational tests); Puesta a punto el proceso de produccion de yodo-131 por destilacion seca (Pruebas preoperacionales)

    Energy Technology Data Exchange (ETDEWEB)

    Alanis M, J. [ININ, Departamento de Materiales Radiactivos, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2002-12-15

    With the purpose of putting to point the process of production of {sup 131}I, one of the objectives of carrying out the realization of operational tests of the production process of iodine-131, it was of verifying the operation of each one of the following components: heating systems, vacuum system, mechanical system and peripheral equipment that are part of the production process of iodine-131, another of the objectives, was settling down the optimal parameters that were applied in each process during the obtaining of iodine-131, it is necessary to point out that this objective is very important, since the components of the equipment are new and its behavior during the process is different to the equipment where its were carried out the experimental studies. (Author)

  20. SU-E-T-260: Radiation Exposure Estimation for 131Cs Prostate Implant Patient Release Determination.

    Science.gov (United States)

    Yang, M; Du, W; Frank, S; Pugh, T; Bruno, T; Kudchadker, R

    2012-06-01

    Due to the short half-life and high energy of Cesium-131 (131Cs), the exposure rate outside the patient could potentially increase radiation exposure to hospital staff and exceed the maximum patient release exposure rate limit. A calculation technique has been developed to estimate the exposure rate at 1 meter from the patient, for prostate patients receiving 131Cs implants. In our calculation for each patient, all 131Cs sources were treated as one single source, and the point on the prostate with the shortest distance to skin surface was selected as the effective source position. Attenuation inside the patient was calculated based on the attenuation coefficient of 30 keV photons in water, assuming homogeneous patient density. This calculation technique was evaluated on our first 25 131Cs implant patients. For comparison, the exposure rate at approximately 1 meter inferior to patient perineum was measured prior to patient release using the Inovision 451P-RYR survey meter. The distance from the edge of the prostate to skin surface along the inferior direction was the shortest in all 25 patients. The mean of the calculated exposure rates at 1 meter from skin surface was 0.53 mR/hr, 0.53 mR/hr, 0.04 mR/hr, 0.04 mR/hr and 1.5 mR/hr along the anterior, posterior, left, right and inferior directions, respectively. The mean of the measured exposure rate at 1 meter inferior to patient perineum was 1.1 mR/hr. The mean ratio of the measured versus calculated exposure rate was 0.74 (standard deviation = 0.23). Our calculation technique is useful in determining in advance whether a patient may require hospitalization after his implant. The exposure rate at 1 meter inferior to patient perineum is a good indicator for determining whether the exposure rate along any direction might exceed the maximum allowed patient release exposure rate of 6 mR/hr. © 2012 American Association of Physicists in Medicine.

  1. Biological dosimetry of patients with differenced carcinoma of thyroid treated with Iodine-131; Dosimetria biologica de pacientes con carcinoma diferenciado de tiroides tratados con Iodo-131

    Energy Technology Data Exchange (ETDEWEB)

    Vallerga, M. B.; Rojo, A.M.; Taja, M.R.; Deluca, G.; Di Giorgio, M. [Autoridad Regulatoria Nuclear Av. Del Libertador 8250 (C1429BNP). Buenos Aires (Argentina); Fadel, A. [Hospital General de Agudos Dr. Carlos Durand Av. Diaz Velez 5044. Buenos Aires (Argentina); Cabrejas, M.; Valdivieso, C. [Hospital de Clfnicas Jose de San Martin Av. Cordoba 2351 (CP1120). Buenos Aires (Argentina)]. e-mail: mvallerg@cae.arn.gov.ar

    2006-07-01

    The administration of I-131 to patient with Differentiated Thyroid Carcinoma (CaDiT) it is used inside the therapeutic outline as later step to the thyroidectomy. However, the good activity to give is of difficult determination due to factors such as, the variability in the capacity of tumoral reception of the I-131, distribution of the pharmaceutical, physiologic status, other associate pathologies, grade of advance of the illness, and previous treatments. Additionally, the activity to administer is dependent of the dose of tolerance in the healthy tissues; superior dose to 2 Gy in bone marrow, its could drive to myelotoxicity. At the moment, the form more extended of administration it is the empiric prescription that considers clinical parameters and of laboratory for their determination. Presently work, the protocol of applied treatment incorporates the evaluation for internal dosimetry and biological dosimetry to estimate absorbed dose in bone marrow. The biological estimate of the dose of these patients is based on the quantification of chromosomal aberrations whose frequency is referred to a curve-dose response in which the lymphocytes is irradiated in vitro with I-131, allowing to determine the in vivo dose to the patient's circulating lymphocytes. The objective of the present work is to determine the applicability of different cytogenetic essays in the estimate of the absorbed dose to the whole body or specific organs. Three patients were evaluated with CaDiT. Their treatment protocol consisted on a tracer administration of radioactive iodine of 74 - 111 MBq (2 - 3 mCi) and a therapy 7,4 - 11,1 GBq (200 - 300 mCi). Previous to the tracer administration and 8 days post-therapeutic administration took samples of veined blood that were evaluated by biological dosimetry by means of the application of the techniques: conventional cytogenetic Micronucleus and FISH (Hybridization in situ by Fluorescence). Starting from the frequencies of observed chromosomal

  2. Evaluation of internal vectorized radiotherapy by Mibg-{sup 131}I in the treatment of malignant pheochromocytomas/paraganglioma; Evaluation de la radiotherapie interne vectorisee par MIBG-131I dans le traitement des pheochromocytomes/paragangliomes malins

    Energy Technology Data Exchange (ETDEWEB)

    Moret, M.; Borson-Chazot, F. [Federation d' endocrinologie, GHE, hospices civils de Lyon, (France); Girre, M.; Bournaud, C. [service de medecine nucleaire, GHE, hospices civils de Lyon, (France); Chabre, O. [service d' endocrinologie, CHU Michallon, Grenoble, (France); Caravel, J.P. [service de medecine nucleaire, CHU Michallon, Grenoble, (France); Baguet, J.P. [service de cardiologie, CHU Michallon, Grenoble, (France)

    2009-05-15

    With the results, the internal vectorized radiotherapy by Mibg-{sup 131}I seems more efficient in case of low tumoral mass and exclusive extra osseous metastases. It would be interesting to study this therapy modality in prospective way in adjuvant treatment of the pheochromocytomas/paraganglioma (P.H./P.G.L.) surgery following the example {sup 131}I in the papillary cancer of thyroid. (N.C.)

  3. Software for dosimetry hypothyroid patients treated with I131 pick up and using probe gamma camera; Software para la dosimetria de pacientes hipertiroideos tratados con 131I utilizando sonda de captacion y gammacamara

    Energy Technology Data Exchange (ETDEWEB)

    Jimenez Felstrom, D.; Luis simon, J.; Reyes Garcia, R.; Derecho Torres, P.; Herrador Cordoba, M.

    2015-07-01

    In this communication the process recently implemented in our hospital for pre and post treatment of patients treated with I-131 in benign diseases of the thyroid gland internal dosimetry is described. We have developed a proprietary software that facilitates the process of dosimetry. Through scans Planar or pictures Spect be determines the mass of the gland thyroid. In function of the mass, is calculated by Monte Carlo the media power absorbed by disintegration of the I-131 in said gland endocrine. (Author)

  4. Reconstruction of {sup 131}I radioactive contamination in Ukraine caused by the Chernobyl accident using atmospheric transport modelling

    Energy Technology Data Exchange (ETDEWEB)

    Talerko, Nikolai [Scientific Center for Radiation Medicine, 53 Melnikov Street, Kyiv 04050 (Ukraine)]. E-mail: ntalerko@mail.ru

    2005-07-01

    The evaluation of {sup 131}I air and ground contamination field formation in the territory of Ukraine was made using the model of atmospheric transport LEDI (Lagrangian-Eulerian DIffusion model). The {sup 131}I atmospheric transport over the territory of Ukraine was simulated during the first 12 days after the accident (from 26 April to 7 May 1986) using real aerological information and rain measurement network data. The airborne {sup 131}I concentration and ground deposition fields were calculated as the database for subsequent thyroid dose reconstruction for inhabitants of radioactive contaminated regions. The small-scale deposition field variability is assessed using data of {sup 137}Cs detailed measurements in the territory of Ukraine. The obtained results are compared with available data of radioiodine daily deposition measurements made at the network of meteorological stations in Ukraine and data of the assessments of {sup 131}I soil contamination obtained from the {sup 129}I measurements.

  5. Reconstruction of (131)I radioactive contamination in Ukraine caused by the Chernobyl accident using atmospheric transport modelling.

    Science.gov (United States)

    Talerko, Nikolai

    2005-01-01

    The evaluation of (131)I air and ground contamination field formation in the territory of Ukraine was made using the model of atmospheric transport LEDI (Lagrangian-Eulerian DIffusion model). The (131)I atmospheric transport over the territory of Ukraine was simulated during the first 12 days after the accident (from 26 April to 7 May 1986) using real aerological information and rain measurement network data. The airborne (131)I concentration and ground deposition fields were calculated as the database for subsequent thyroid dose reconstruction for inhabitants of radioactive contaminated regions. The small-scale deposition field variability is assessed using data of (137)Cs detailed measurements in the territory of Ukraine. The obtained results are compared with available data of radioiodine daily deposition measurements made at the network of meteorological stations in Ukraine and data of the assessments of (131)I soil contamination obtained from the (129)I measurements.

  6. Incremental Value of Diagnostic 131I SPECT/CT Fusion Imaging in the Evaluation of Differentiated Thyroid Carcinoma

    National Research Council Canada - National Science Library

    Wong, Ka Kit; Zarzhevsky, Natalia; Cahill, John M; Frey, Kirk A; Avram, Anca M

    2008-01-01

    ...., Ann Arbor, MI 48109-0028. OBJECTIVE. The purpose of this study was to determine the incremental value of 131 I SPECT/CT over traditional planar imaging of patients with differentiated thyroid carcinoma...

  7. Combined therapy with {sup 131}I and retinoic acid in Korean patients with radioiodine-refractory papillary thyroid cancer

    Energy Technology Data Exchange (ETDEWEB)

    Oh, So Won [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Seoul National University Boramae Medical Center, Department of Nuclear Medicine, Seoul (Korea, Republic of); Moon, Seung-hwan; Chung, June-Key [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Park, Do Joon; Cho, Bo Youn [Seoul National University College of Medicine, Department of Internal Medicine, Seoul (Korea, Republic of); Jung, Kyeong Cheon [Seoul National University College of Medicine, Department of Pathology, Seoul (Korea, Republic of); Lee, Dong Soo [Seoul National University College of Medicine, Department of Nuclear Medicine, Seoul (Korea, Republic of); Seoul National University WCU Graduate School of Convergence Science and Technology, Department of Molecular Medicine and Biopharmaceutical Sciences, Seoul (Korea, Republic of)

    2011-10-15

    The aim of this study was to assess the clinical outcome of redifferentiation therapy using retinoic acid (RA) in combination with {sup 131}I therapy, and to identify biological parameters that predict therapeutic response in Korean patients with radioiodine-refractory papillary thyroid carcinoma (PTC). A total of 47 patients (13 men, 34 women; age 54.2 {+-} 13.6 years) with radioiodine-refractory PTC underwent therapy consisting of consecutive treatment with {sup 131}I and RA. Each {sup 131}I/RA treatment cycle involved the administration of oral isotretinoin for 6 weeks at 1-1.5 mg/kg daily followed by a single oral dose of {sup 131}I (range 5.5-16.7 GBq). Therapeutic responses were determined using serum thyroglobulin (Tg) levels and the change in tumour size 6 months after completing the {sup 131}I/RA therapy. Biological parameters and pathological parameters before and after combined therapy were compared. After completing {sup 131}I/RA therapy, 1 patient showed a complete response, 9 partial response, 9 stable disease, and 28 progressive disease, representing an overall response rate of 21.3%. Univariate analysis revealed that an age of <45 years and a persistently high serum Tg level were related to a good response. No clinical response was achieved when metastases showing no iodine uptake were present. Multivariate regression analysis showed that an age of <45 years was significantly associated with a good response. Of the 24 patients with well-differentiated carcinoma, 5 (20.8%) responded to {sup 131}I/RA therapy, whereas all 6 patients with poorly differentiated carcinoma failed to respond. {sup 131}I/RA therapy was found to elicit a response rate of 21.3% among patients with radioiodine-refractory PTC, and an age of <45 years was found to be significantly associated with a good response. (orig.)

  8. Effect of selenium supplementation for protection of salivary glands from iodine-131 radiation damage in patients with differentiated thyroid cancer.

    Science.gov (United States)

    Son, Haiyoung; Lee, Sang Mi; Yoon, Ra Gyoung; Lee, Hakmin; Lee, Ilkyun; Kim, Soon; Chung, Woong Youn; Lee, Jeong Won

    2017-01-01

    In the current study, we examined whether selenium supplementation during iodine-131 ((131)I) treatment had a radio-protective effect on salivary glands. Sixteen patients with differentiated thyroid cancer were prospectively enrolled in the study. Patients after total thyroidectomy, before (131)I treatment, were divided into two groups; 8 patients in the selenium group and 8 patients in the control group. Patients in the selenium group received 300νg of selenium orally for 10 days, from 3 days before to 6 days after (131)I treatment. The control group received a placebo over the same period. To assess salivary gland function, salivary gland scintigraphy was performed before and 6 months after (131)I treatment. Serum amylase and whole blood selenium levels were measured before and 2 days and 6 months after (131)I treatment. Using salivary gland scintigraphy, maximum uptake ratio (MUR), maximum secretion percentage (MSP), and ejection fraction (EF) of each salivary gland were calculated. Baseline clinical characteristics, baseline amylase and selenium levels, and parameters of baseline salivary gland scintigraphy were not significantly different between selenium and control groups (P>0.05). On a blood test performed 2 days after (131)I treatment, the selenium group showed a significantly higher whole blood selenium level (P=0.008) and significantly lower serum amylase level (P=0.009) than the control group. On follow-up salivary gland scintigraphy, the control group showed significantly decreased, MUR of the bilateral parotid and left submandibular glands, MSP of the bilateral parotid and submandibular glands, and EF of the left submandibular glands (Pgland and EF of the left submandibular gland (Psalivary glands damage by (131)I radiation in patients with differentiated thyroid cancer.

  9. Rapid identification of ST131 Escherichia coli by a novel multiplex real-time allelic discrimination assay.

    Science.gov (United States)

    François, Patrice; Bonetti, Eve-Julie; Fankhauser, Carolina; Baud, Damien; Cherkaoui, Abdessalam; Schrenzel, Jacques; Harbarth, Stephan

    2017-09-01

    Escherichia coli sequence type 131 is increasingly described in severe hospital infections. We developed a rapid real-time allelic discrimination assay for the rapid identification of E. coli ST131 isolates. This rapid assay represents an affordable alternative to sequence-based strategies before completing characterization of potentially highly virulent isolates of E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Empiric Therapy with Low-Dose I-131 in Differentiated Cancer Thyroid: What is the Magic Number?

    Science.gov (United States)

    Shinto, Ajit S; Kamaleshwaran, K K; Shibu, Deepu K; Vyshak, K; Antony, Joppy

    2013-05-01

    Low dose radioactive iodine-131 (RAI) has been widely reported in the treatment of patients with differentiated thyroid cancer (DTC) since 1970's. However, the clinical outcomes, dosage of I-131 and criteria for successful ablation are different in various studies. The aim of this study was to assess clinical outcome 18-month after RAI therapy in selected DTC patients and identify factors associated with a good response. In this experimental study, among patients with DTC referred to the Nuclear Medicine Department and had an indication for RAI therapy in the period between December 2008 and January 2011, 108 subjects were selected randomly. The patients were randomly divided into three groups and empiric low dose therapy with 30, 50 or 75 mCi of I-131 was administered. Patients were monitored closely clinically and with serum thyroglobulin assays and I-131 whole-body scans at 6 monthly intervals for 18-month after treatment. Among 105 patients who completed follow-up, 86% were successfully ablated with a single low dose of I-131. There was no statistically significant difference in ablation rates in the subgroups receiving 30.50 or 75 mCi of I-131. Cumulative ablation rate was 99% in patients after the second dose of low dose therapy. If appropriate selection criteria are used in DTC, successful remnant ablation can be achieved with low doses of I-131 in the range of 30-75 mCi. No significant differences were found in results achieved with 30.50 or 75 mCi of I-131. As the majority of the DTC patients fall within the inclusion criteria of this study, they can be treated on an ambulatory basis with associated low cost, convenience, and low whole-body radiation-absorbed dose to the patients.

  11. High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

    Directory of Open Access Journals (Sweden)

    Du Peige

    2008-10-01

    Full Text Available Abstract Background Estrogen receptor α (ERα is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131 as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE. In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells.

  12. Adjuvant Radioactive iodine 131 ablation in papillary microcarcinoma of thyroid: Saudi Arabian experience [corrected].

    Science.gov (United States)

    Al-Qahtani, Khalid Hussain; Al Asiri, Mushabbab; Tunio, Mutahir A; Aljohani, Naji J; Bayoumi, Yasser; Fatani, Hanadi; AlHadab, Abdulrehman

    2015-12-01

    Papillary Microcarcinoma (PMC) of thyroid is a rare type of differentiated thyroid cancer (DTC), which according to the World Health Organization measures 1.0 cm or less. The gold standard of treatment of PMC is still controversy. Our aim was to contribute in resolving the debate on the therapeutic choices of the surgical and adjuvant I-131 (RAI) treatment in PMC. From 2000 to 2012, 326 patients were found to have PMC and were retrospectively reviewed for clinicopathological characteristics, treatment outcomes and prognostic factors. Mean age of cohort was 42.6 years (range: 18-76) and the mean tumor size was 0.61 cm ± 0.24; lymph node involvement was seen in 12.9 % of cases. Median follow up period was 8.05 years (1.62-11.4). Total 23 all site recurrences (7.13 %) were observed; more observed in patients without I-131 ablation (p Cox regression Model analysis revealed size, histopathologic variants, multifocality, extrathyroidal extension, lymphovascular space invasion, nodal status, and adjuvant RAI ablation the important prognostic factors affecting DFS. Despite excellent DFS rates, a small proportion of patients with PMC develop recurrences after treatment. Adjuvant RAI therapy improves DFS in PMC patients with aggressive histopathologic variants, multifocality, ETE, LVSI, tumor size (> 0.5 cm) and lymph node involvement. Failure of RAI ablation to decrease risk in N1a/b supports prophylactic central neck dissection during thyroidectomy, however more trials are warranted. Adjuvant I-131 ablation following thyroidectomy in PMC patients, particularly with poor prognostic factors improves DFS rates.

  13. Coupling Reaction of Oligo p-Phenylene Ethynylene and Peptide Antagonist RM26 Labeling with 131

    Directory of Open Access Journals (Sweden)

    JIAN Yuan1,2;ZHOU Zhi-jun2;ZHUO Lian-gang2;ZHAO Peng2;LIAO Wei2;WANG Guan-quan2;LIU Ning1

    2016-08-01

    Full Text Available Investigations reveale that oligo p-phenylene ethynylene (OPE molecule can insert into cell membrane, which leads to its cellular internization capacility. Antagonists have high cancer cell affinity, high uptake in cancer cells and fast clearance in normal tissue, these capabilities have attracted much research interest in radiopharmaceutical development. Combining the strong cell-penetrating ability and high affinity of Gastrin-releasing peptide which is overexpressed in the PC-3 cells, the thesis designed and synthesized unsymmetric OPE(NH2 molecule. Then the OPE(NH2 molecule was followed by the coupling reaction with RM26 peptide to obtain the OPE-RM26, and (Tyr3-RM26 was also got for controling study. After that, the (Tyr3-RM26 and OPE-RM26 were radiolabeled with I-131 to give high radiolabeling yields that could up to 95%. The radiolabeling compound was stable after 24 h storage at room temperature. These labeled compounds are ready for animal in-vivo experiment. It is expected that OPE-RM26-131I has multi-properties with targeting membrane crossing fire of radioactive elements. The molecule may fast travel to the target tissue and bind to GRP receptor and internalized into cancer cells. The casade process will give rise to its cancer cell toxicity due to longer retention and more killing effect of ray’s irradiation to cancer cells. In this way, OPE-RM26-131I can achieve better anti-cancer ability.

  14. Therapy of hepatocellular carcinoma with 131I-lipiodol: patient dosimetry.

    Science.gov (United States)

    Risse, J H; Pauleit, D; Palmedo, H; Bender, H; Bucerius, J; Ezziddin, S; Klein, V; Grünwald, F; Biersack, H-J; Reichmann, K

    2007-01-01

    Dosimetry in (131)I-lipiodol therapy for hepatocellular carcinoma (HCC) in the hitherto largest existing patient cohort. 38 courses of intra-arterial (131)I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC. Liver and tumour volume were measured by computed tomography (CT) and (131)I-activity by scintigraphy on day 3, 6, 14, 28 and 42 after injection. Lipiodol deposition in tumour nodules as shown by CT rendered definite attachment to scintigraphic data possible. The radiation dose in tumour nodules, liver and lungs was calculated according to the MIRD concept and the tumour dose related to pre-therapeutic tumour volume, response and survival. Mean tumour dose was 23.6 +/- 3.6 Gy (14.2 +/- 2.1 mGy/MBq) with maximal 162 Gy (90.1 mGy/MBq) after one and 274 Gy after three courses. The dose to nontumourous liver was 1.9 +/- 0.2 Gy (1.2 +/- 0.1 mGy/MBq) and the mean dose ratio of tumour / nontumourous liver 11.1 +/- 1.7 (max. 82). The pulmonary dose was 25.9 +/- 1.8 mGy (16.3 +/- 1.2 microGy/MBq) and therefore much lower. There was a reciprocal relation between tumour dose and pretherapeutic tumour volume. Tumour dose had no effect on response or survival. High radiation doses are particularly in small tumour nodes achievable but not necessarily related to tumour response. The dose of non-tumourous liver and lungs is much lower.

  15. Therapy of hepatocellular carcinoma with {sup 131}I-lipiodol: patient dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Risse, J.H. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Bonn Univ. (Germany). Univ. Clinic of Nuclear Medicine; Pauleit, D. [Radiology and Nuclear Medicine Inst., Bad Honnef (Germany); Research Center Juelich (Germany). Inst. of Medicine; Palmedo, H.; Bender, H.; Bucerius, J.; Ezziddin, S.; Klein, V.; Biersack, H.J.; Reichmann, K. [Bonn Univ. (Germany). Univ. Clinic of Nuclear Medicine; Gruenwald, F. [Frankfurt Univ. (Germany). Univ. Clinic of Nuclear Medicine

    2007-07-01

    Aim: Dosimetry in {sup 131}I-lipiodol therapy for hepatocellular carcinoma (HCC) in the hitherto largest existing patient cohort. Patients, methods: 38 courses of intra-arterial {sup 131}I-lipiodol therapy with a total activity up to 6.7 GBq were performed in 18 patients with HCC. Liver and tumour volume were measured by computed tomography (CT) and {sup 131}I activity by scintigraphy on day 3, 6, 14, 28 and 42 after injection. Lipiodol deposition in tumour nodules as shown by CT rendered definite attachment to scintigraphic data possible. The radiation dose in tumour nodules, liver and lungs was calculated according to the MIRD concept and the tumour dose related to pre-therapeutic tumour volume, response and survival. Results: Mean tumour dose was 23.6 {+-} 3.6 Gy (14.2 {+-} 2.1 mGy/MBq) with maximal 162 Gy(90.1 mGy/MBq) after one and 274 Gy after three courses.The dose to nontumourous liver was 1.9 {+-} 0.2 Gy (1.2 {+-}0.1 mGy/MBq) and the mean dose ratio of tumour / nontumourous liver 11.1 {+-} 1.7 (max. 82). The pulmonary dose was 25.9 {+-} 1.8 mGy (16.3 {+-} 1.2 {mu}Gy/MBq) and therefore much lower. There was a reciprocal relation between tumour dose and pretherapeutic tumour volume. Tumour dose had no effect on response or survival. Conclusion: High radiation doses are particularly in small tumour nodes achievable but not necessarily related to tumour response. The dose of nontumourous liver and lungs is much lower. (orig.)

  16. SU-E-T-619: Planning 131I Thyroid Treatments for Patients Requiring Hemodialysis

    Energy Technology Data Exchange (ETDEWEB)

    Stroud, D [Kaiser Permanente, Los Angeles Ca, CA (United States)

    2015-06-15

    Purpose: Treatment of 131I thyroid cancer patients who also require regular hemodialysis (HD) treatments requires consideration of the administered activity and the HD schedule. In this work the red bone marrow is considered the dose limiting organ and the treatment plan optimized the HD schedule with the amount of radioactivity administered. Methods: The ‘Safe’ dose was considered to be 2 Gy (200 rad) to the red bone marrow.1 131Iodine doses of 50 mCi to 100 mCi were modeled and found to require a range of HD schedules. In order to achieve the safe dose to the red marrow, more aggressive HD schedules are required. 100 mCi required an aggressive HD treatment of every 24 hours for at least one week to achieve the ‘safe’ dose and an exposure appropriate for release from the hospital. A more normal schedule of HD beginning at 18 hours then every 48 hours allowed for up to 60 mCi administered dose allowed for a safe dose and expected release after less than one week.2In addition room was equipped with video cameras cameras for monitoring the patient and their vital signs from an adjacent room during HD. In this way the dialysis nurses were able to monitor the patient closely from an adjoining room. Results: Two HD patients were administered adjusted doses of about 50 mCi. The medical and nursing staff were exposed to no more than 4 mR for the entire treatment. The residual Iodine in the patient appeared to be normal after 4 to 6 days when the patient was released. Conclusion: With careful treatment planning 131Iodine treatments can be performed safely for patients needing HD and treatments appear to be as effective as those for patients with normal renal function.

  17. SU-F-T-222: Dose of Fetus and Infant Following Accidental Intakes of I-131 by the Mother

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Y [The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan (China); Hu, P [Fudan University Shanghai Cancer Center, Shanghai, Shanghai (China)

    2016-06-15

    Purpose: To estimate the calculation of absorbed dose to the fetus and infants from intakes of I-131 by the mother. Thus provide some advice to the radioprotection of radioactive accident. Methods: In this clinical case, a staff of nuclear medicine accidently intake I-131 during (10–12 weeks) and after pregnancy. The infant was born at full term, but both lobes of the thyroid gland were found to be absent (bilobar thyroid agenesis). It was suspected that the fetal thyroid agenesis may be related with mother’s contamination of I-131 during pregnancy. Urine samples for 24h were collected at different times after administered and radioactivity were measured to calculate the dose of intake I-131. Calculate the intake I-131 by the results of personal TLD dosimeter. We adopted the mean of two calculated results as the I-131 intake. According to the dose of intake I-131 by the mother, effective dose and absorbed dose of thyroid for mother, fetus and infant were calculated. Results: The intake of I-131 was estimated for 8.18 mCi. I-131 intake was calculated for 7.9 mCi based on data of TLD dosimeter. We adopted the mean of two results as the I-131 intake. The final result was 8.0 mCi. Effective dose and absorbed dose of thyroid for mother were 7.3Sv and 164 Gy, effective dose and absorbed dose of thyroid for fetus were 2.035 Sv and 40.7 Gy, effective dose and absorbed dose of thyroid for infant were 16.25 Sv and 355Gy. Conclusion: The intake during pregnancy was about 1mCi. The absorbed dose of thyroid of the mother was 19.5Gy, whereas the effective of infant was estimated for 40.7Gy. The function of the mother’s thyroid was normal after diagnosis. But the infant was diagnosed as bilobar thyroid agenesis.

  18. Facteurs predictifs de l'efficacite ablative de l'iode 131 dans les ...

    African Journals Online (AJOL)

    La prise en charge des cancers différenciés de la thyroïde (CDT) comporte souvent une radiothérapie métabolique à l'iode131 (IRA-thérapie). Le but de ce travail est d'évaluer le caractère prédictif des différents éléments anatomopathologiques, de la classification pTNM et de la stadification pronostique sur l'activité ...

  19. Comparison of surface contamination monitors for in vivo measurement of {sup 131}I in thyroid

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, S.M.; Dantas, A.L.A.; Dantas, B.M., E-mail: salomao.marques@ymail.com [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)

    2015-07-01

    The routine handling of radiopharmaceuticals in nuclear medicine represents a significant risk of internal exposure to the staff. The IAEA recommends the implementation of monitoring plans for all workers subject to a risk of exposures above 1 mSv per year. However, in Brazil, such recommendation is practically unfeasible due to the lack of a sufficient number of qualified internal dosimetry services over the country. This work presents an alternative based on a simple and inexpensive methodology aimed to perform in-vivo monitoring of {sup 131}I in thyroid using portable surface contamination probes. All models evaluated showed suitable sensitivity for such application. (author)

  20. Intraoperative localization following preoperative marking with iodine-131 for improved treatment of differentiated thyroid carcinomas

    Energy Technology Data Exchange (ETDEWEB)

    Littmann, K.; Magdsick, G.; Stroetges, W.; Eigler, F.W.

    1980-06-01

    Patients with differentiated carcinomas of the thyroid gland (n = 25) and patients with receptive lymphnode metastases (n = 10) who had all undergone total thyroidectomy were marked with /sup 131/iodine 48 h before undergoing lymphonodectomy. The thoroughness of the resection was checked by the intraoperative use of a detector. There was a significant decrease in the postoperative areas visible on the scintigrams of a group of patients who had been operated upon without the intraoperative use of a detector. There were also fewer complications in this control group owing to a more subtle operative procedure.

  1. Novel genes associated with enhanced motility of Escherichia coli ST131.

    Science.gov (United States)

    Kakkanat, Asha; Phan, Minh-Duy; Lo, Alvin W; Beatson, Scott A; Schembri, Mark A

    2017-01-01

    Uropathogenic Escherichia coli (UPEC) is the cause of ~75% of all urinary tract infections (UTIs) and is increasingly associated with multidrug resistance. This includes UPEC strains from the recently emerged and globally disseminated sequence type 131 (ST131), which is now the dominant fluoroquinolone-resistant UPEC clone worldwide. Most ST131 strains are motile and produce H4-type flagella. Here, we applied a combination of saturated Tn5 mutagenesis and transposon directed insertion site sequencing (TraDIS) as a high throughput genetic screen and identified 30 genes associated with enhanced motility of the reference ST131 strain EC958. This included 12 genes that repress motility of E. coli K-12, four of which (lrhA, ihfA, ydiV, lrp) were confirmed in EC958. Other genes represented novel factors that impact motility, and we focused our investigation on characterisation of the mprA, hemK and yjeA genes. Mutation of each of these genes in EC958 led to increased transcription of flagellar genes (flhD and fliC), increased expression of the FliC flagellin, enhanced flagella synthesis and a hyper-motile phenotype. Complementation restored all of these properties to wild-type level. We also identified Tn5 insertions in several intergenic regions (IGRs) on the EC958 chromosome that were associated with enhanced motility; this included flhDC and EC958_1546. In both of these cases, the Tn5 insertions were associated with increased transcription of the downstream gene(s), which resulted in enhanced motility. The EC958_1546 gene encodes a phage protein with similarity to esterase/deacetylase enzymes involved in the hydrolysis of sialic acid derivatives found in human mucus. We showed that over-expression of EC958_1546 led to enhanced motility of EC958 as well as the UPEC strains CFT073 and UTI89, demonstrating its activity affects the motility of different UPEC strains. Overall, this study has identified and characterised a number of novel factors associated with enhanced

  2. Determination of X- and gamma-ray emission intensities in the decay of (131)I.

    Science.gov (United States)

    Lépy, Marie-Christine; Brondeau, Laurine; Bobin, Christophe; Lourenço, Valérie; Thiam, Cheick; Bé, Marie-Martine

    2016-03-01

    The activity per unit mass of an iodine-131 solution was absolutely standardized by both the 4πβ-γ coincidence method and the 4πγ counting technique. The calibrated solution was used to prepare point sources after a preliminary deposit of AgNO3 to prevent the loss of volatile iodine. Relative and absolute photon emission intensities of 15 sgamma-rays and those of the two K X-rays of xenon were determined by gamma-ray spectrometry, with relative uncertainties of 0.8% for the three main emissions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. National comparison of {sup 131}I measurement among nuclear medicine clinics of eight countries

    Energy Technology Data Exchange (ETDEWEB)

    Olsovcova, Veronika, E-mail: volsovcova@cmi.c [Czech Metrology Institute, Radiova 1, Praha 10, 102 00 (Czech Republic); Iwahara, Akira [Laboratorio Nacional de Metrologia das Radiacoes Ionizantes, Instituto de Radioprotecao e Dosimetria, Av. Salvador Allende, s/no. Recreio, Rio de Janeiro, CEP 22780-160 Brazil (Brazil); Oropesa, Pilar [Centro de Isotopos, Ave. Monumental y Carretera La Rada, Km 31/2, Guanabacoa, Ciudad Habana (Cuba); Joseph, Leena; Ravindra, Anuradha [Bhabha Atomic Research Centre, Radiation Safety Systems Division, Trombay, Mumbai-400 085 (India); Ghafoori, Mostafa [SSDL, Agricultural, Medical and Industrial Research School (AMIRS). Nuclear Science and Technology Research Institute, AEOI, Karaj (Iran, Islamic Republic of); Son, Hye-Kyung [Radiation Safety Division, National Institute of Food and Drug Safety Evaluation, Korea Food and Drug Administration, 194 Tongilro, Eunpyung-Gu, Seoul, 122-704 (Korea, Republic of); Sahagia, Maria [Horia Hulubei National Institute of R and D for Physics and Engineering, POB MG-6, 077125 Bucharest (Romania); Tastan, Selma [Ankara University Medical Faculty, Department of Nuclear Medicine, Cebeci 06100, Ankara (Turkey); Zimmerman, Brian [Dosimetry and Medical Radiation Physics Section, International Atomic Energy Agency, P.O. Box 100, A-1400 Vienna (Austria); Ionizing Radiation Division, National Institute of Standards and Technology, Gaithersburg, MD 20899-8462 (United States)

    2010-07-15

    A generally applicable protocol for organizing comparisons among nuclear medicine clinics created within the IAEA project CRP E2.10.05 was tested in Brazil, Cuba, Czech Republic, India, Iran, Republic of Korea, Romania and Turkey in 2007. Comparisons of measurement of {sup 131}I were organized by local pilot laboratories with different backgrounds and levels of experience in this field. The results and experiences gained were compared and analyzed. A majority of results in each national comparison were within 10% of the reference value.

  4. A phase II study of radioimmunotherapy with intraventricular 131 I-3F8 for medulloblastoma.

    Science.gov (United States)

    Kramer, Kim; Pandit-Taskar, Neeta; Humm, John L; Zanzonico, Pat B; Haque, Sofia; Dunkel, Ira J; Wolden, Suzanne L; Donzelli, Maria; Goldman, Debra A; Lewis, Jason S; Lyashchenko, Serge K; Khakoo, Yasmin; Carrasquillo, Jorge A; Souweidane, Mark M; Greenfield, Jeffrey P; Lyden, David; De Braganca, Kevin D; Gilheeney, Stephen W; Larson, Steven M; Cheung, Nai-Kong V

    2018-01-01

    High-risk and recurrent medulloblastoma (MB) is associated with significant mortality. The murine monoclonal antibody 3F8 targets the cell-surface disialoganglioside GD2 on MB. We tested the efficacy, toxicity, and dosimetry of compartmental radioimmunotherapy (cRIT) with intraventricular 131 I-labeled 3F8 in patients with MB on a phase II clinical trial. Patients with histopathologically confirmed high-risk or recurrent MB were eligible for cRIT. After determining adequate cerebrospinal fluid (CSF) flow, patients received 2 mCi (where Ci is Curie) 124 I-3F8 or 131 I-3F8 with nuclear imaging for dosimetry, followed by up to four therapeutic (10 mCi/dose) 131 I-3F8 injections. Dosimetry estimates were based on serial CSF and blood samplings over 48 hr plus region-of-interest analyses on serial imaging scans. Disease evaluation included pre- and posttherapy brain/spine magnetic resonance imaging approximately every 3 months for the first year after treatment, and every 6-12 months thereafter. Forty-three patients received a total of 167 injections; 42 patients were evaluable for outcome. No treatment-related deaths occurred. Toxicities related to drug administration included acute bradycardia with somnolence, headache, fatigue, and CSF pleocytosis consistent with chemical meningitis and dystonic reaction. Total CSF absorbed dose was 1,453 cGy (where Gy is Gray; 350.0-2,784). Median overall survival from first dose of cRIT was 24.9 months (95% confidence interval [CI]:16.3-55.8). Patients treated in radiographic and cytologic remission were at a lower risk of death compared to patients with radiographically measurable disease (hazard ratio: 0.40, 95% CI: 0.18-0.88, P = 0.024). cRIT with 131 I-3F8 is safe, has favorable dosimetry to CSF, and when added to salvage therapy using conventional modalities, may have clinical utility in maintaining remission in high-risk or recurrent MB. © 2017 Wiley Periodicals, Inc.

  5. Treatment of hyperthyroidism: use of 131I and 125I

    Energy Technology Data Exchange (ETDEWEB)

    Atkins, Harold L.

    1977-01-01

    Factors related to late hypothyroidism following the use of /sup 131/I for treatment of hyperthyroidism are discussed with regard to age of patient, size of dose, previous surgery, immune status, and others. Possible reasons for the post-therapeutic hypothyroidism are discussed with regard to effects of radiation on the reproductive capacity of thyroid cells, effects of radiation on blood vessels, and dose distribution of radioiodine. The following therapeutic strategies are discussed: reduction of initial dose; multiple small doses; high dose radioiodine followed by replacement therapy; the use of external beam irradiation; and the use of /sup 125/I. (HLW)

  6. Immunological Characterizations of a Cloned 13.1-Kilodalton Protein from Pathogenic Naegleria fowleri

    OpenAIRE

    Cho, Myoung-Soo; Jung, Suk-Yul; Park, Sun; Kim, Kyongmin Hwang; Kim, Hyung-Il; Sohn, Seonghyang; Kim, Han-Jip; Im, Kyung-il; Shin, Ho-Joon

    2003-01-01

    We previously cloned an antigenic gene (named nfa1) from a cDNA library of Naegleria fowleri by immunoscreening. The nfa1 gene had a coding nucleotide sequence consisting of 357 bases and produced a recombinant 13.1-kDa protein (Nfa1). In this study, to get more information regarding the recombinant Nfa1 protein (rNfa1), we produced an anti-Nfa1 polyclonal antibody from mice immunized with rNfa1 and used a peroxidase staining method to carry out immunocytochemistry experiments. In addition, w...

  7. Distribution of 131I-labeled Bothrops erythromelas venom in mice

    Directory of Open Access Journals (Sweden)

    C.M.L. Vasconcelos

    1998-03-01

    Full Text Available Bothrops erythromelas is responsible for many snake bites in northeastern Brazil. In the present study we determined the in vivo distribution of the venom following its subcutaneous injection into mice. B. erythromelas venom and albumin were labeled individually with 131I by the chloramine T method, and separated in a Sephacryl® S-200 column. The efficiency of labeling was 68%. Male Swiss mice (40-45 g, which had been provided with drinking water containing 0.05% KI over a period of 10 days prior to the experiment, were inoculated dorsally (sc with 0.3 ml (2.35 x 105 cpm/mouse of 131I-venom (N = 42, 131I-albumin or 131I (controls, N = 28 each. Thirty minutes and 1, 3, 6, 12, 18 and 24 h after inoculation, the animals were perfused with 0.85% NaCl and skin and various organs were collected in order to determine radioactivity content. There was a high rate of venom absorption in the skin (51% within the first 30 min compared to albumin (20.1% and free iodine (8.2%. Up to the third hour after injection there was a tendency for venom and albumin to concentrate in the stomach (3rd h, small intestine (3rd h and large intestine (6th h. Both control groups had more radioactivity in the digestive tract, especially in the stomach, but these levels decreased essentially to baseline by 12-18 h postinjection. In the kidneys, the distribution profiles of venom, albumin and iodine were similar. Counts at 30 min postinjection were low in all three groups (1.37, 1.86 and 0.77, respectively, and diminished to essentially 0% by 12-18 h. Albumin tended to concentrate in muscle until the 3rd h postinjection (1.98%. There was a low binding of labeled venom in the liver (<0.54%, thyroid (<0.11% and lungs (<0.08%, and no iodinated venom was detected in brain, heart, diaphragm, spleen or bladder. The low venom binding observed in most internal organs, comparable to that of albumin, suggests that B. erythromelas venom does not specifically target most internal organs

  8. Distribution of {sup 131} I- labeled Bothrops erythromelas venom in mice

    Energy Technology Data Exchange (ETDEWEB)

    Vasconcelos, C.M.L.; Valenca, R.C.; Araujo, E.A. [Pernambuco Univ., Recife, PE (Brazil). Dept. de Biofisica e Radiobiologia; Modesto, J.C.A.; Pontes, M.M.; Guarnieri, M.C. [Pernambuco Univ., Recife, PE (Brazil). Dept. de Zoologia; Brazil, T.K. [Bahia Univ., Salvador, BA (Brazil). Inst. de Biologia

    1998-03-01

    Bothrops erythromelas is responsible for many snake bites in northeastern Brazil. In the present study we determined the in vivo distribution of the venom following its subcutaneous injection into mice. B. erythromelas venom and albumin were labeled individually with {sup 131} I by the chloramine T method, and separated in a Sephacryl S-200 column. The efficiency of labeling was 68%.Male Swiss mice (40-45 g), which had been provided with drinking water containing 0.05% KI over a period of 10 days prior to the experiment, were inoculated dorsally (sc) with 0.3 ml (2.35 x 10{sup 5} cpm/mouse) of {sup 131} I-venom (N = 42), {sup 131} -albumin or {sup 131} I (controls, N = 28 each). Thirty minutes and 1,3, 6, 12, 18 and 24 h after inoculation, the animals were perfused with 0.85% Na Cl and skin and various organs were collected in order to determine radioactivity content. There was a high rate of venom absorption int he skin (51%) within the first 30 min compared to albumin (20.1%) and free iodine (8.2%). Up to the third hour after injection there was a tendency for venom and albumin to concentrate in the stomach ( 3 rd h),small intestine (3 rd h) and large intestine (6th h). Both control groups had more radioactivity in the digestive tract, especially in the stomach, but these levels decreased essentially to baseline by 12-18 h postinjection. In the kidneys, the distribution profiles of venom, albumin and iodine were similar. Counts at 30 min postinjection were low in all three groups (1.37, 1.86 and 0.77, respectively), and diminished to essentially 0% by 12-18 h. Albumin tended to concentrate in muscle until the 3 rd h postinjection (1.98%).There was a low binding of labeled venom in the liver (B. erythromelas venom does not specifically target most internal organs). That is, the systemic effects of envenomation ar mainly due to an indirect action. (author) 14 refs., 2 figs.

  9. Treatment of metastatic para-aortic paraganglioma by surgery, radiotherapy and I-131 mIBG

    Energy Technology Data Exchange (ETDEWEB)

    Ball, A.B.S.; Tait, D.M.; Fisher, C.; Sinnett, H.D.; Harmer, C.L. (Royal Marsden Hospital, London (United Kingdom))

    1991-10-01

    A patient with a malignant, functioning, aortico-sympathetic paraganglioma and a solitary bone metastasis causing paraplegia was treated by spinal decompression, irradiation of the metastasis, surgical excision of the primary tumour and systemic I-131 meta-iodobenzyl-guanidine (mIBG). Sixteen months after treatment there was no clinical, radiological or biochemical evidence of residual disease and neurological function was restored. The case supports the use of combined treatment incorporating mIBG in patients with metastatic neuroendocrine tumours which demonstrate mIBG uptake. (author).

  10. Design of patient rooms and automatic radioiodine-131 waste water management system for a thyroid cancer treatment ward: 'Suandok Model'.

    Science.gov (United States)

    Vilasdechanon, N; Ua-Apisitwong, S; Chatnampet, K; Ekmahachai, M; Vilasdechanon, J

    2014-09-01

    The great benefit of (131)I radionuclide treatment for differentiated thyroid cancer (DTC) was acknowledged by the long survival rate. The main requirements for (131)I therapy in hospital were treatment facilities and a radiation safety plan that assured radiation protection and safety to patient, hospital worker, public, and environment. To introduce the concepts and methods of radiation safety design for a patient's room in a (131)I treatment ward and a system of radioactive waste water management in hospital. The design was based on principles of external and internal radiation protection for unsealed source and radioactive waste management. Planning for treatment facilities was concluded from clinical evidence, physical and physiological information for (131)I, radiation safety criteria, hospital resources and budget. The three phases of the working process were: construction, software development, and radiation safety assessment. The (131)I treatment facility and automatic radioactive waste water management system was completely implemented in 2009. The radiation waste water management system known as the 'Suandok Model' was highly recommended by the national regulator to hospitals who desire to provide (131)I treatment for thyroid cancer. In 2011, the Nuclear Medicine Division, Chiang Mai University was rewarded by the national authority for a very good radiation practice in development of safe working conditions and environment. The Suandok Model was a facility design that fulfilled requirements for the safe use of high radiation (131)I doses for thyroid cancer treatment in hospital. The facility presented in this study may not be suitable for all hospitals but the design concepts could be applied according to an individual hospital context and resources. People who use or gain benefit from radiation applications have to emphasise the responsibility to control and monitor radiation effects on individuals, communities and the environment.

  11. Extraintestinal pathogenic Escherichia coli sequence type 131 H30-R and H30-Rx subclones in retail chicken meat, Italy.

    Science.gov (United States)

    Ghodousi, Arash; Bonura, Celestino; Di Carlo, Paola; van Leeuwen, Willem B; Mammina, Caterina

    2016-07-02

    Extraintestinal pathogenic Escherichia coli sequence type 131 (ST131), typically fluoroquinolone-resistant (FQ-R) and/or extended-spectrum β-lactamase (ESBL)-producing, has emerged globally. Among clinical isolates, ST131, primarily its H30-R and H30-Rx subclones, accounts for most antimicrobial-resistant E. coli and is the dominant E. coli strain worldwide. We assessed its prevalence and characteristics among raw chicken meat samples on sale in Palermo, Italy. A collection of 237 fluoroquinolone resistant and ESBL/AmpC producing E. coli isolates, which had been isolated from processed retail chicken meat in the period May 2013-April 2015, was analyzed. Established polymerase chain reaction methods were used to define ST131 and its H30 subclones, ESBL, AmpC, and plasmid-mediated quinolone resistance (PMQR) determinants. Amplified Fragment Length Polymorphism (AFLP) was performed to assess the relatedness among ST131 isolates. Out of the 237 E. coli isolates, 12 isolates belonged to the phylogenetic group B2. Based on the molecular definition of ExPEC, all isolates were attributed with the status of ExPEC. SNP-PCR results confirmed that nine isolates were ST131. SNP-PCR for H30-R and H30-Rx subclones showed that six and three ExPEC ST131 were positive for H30-R and H30-Rx, respectively. The results of AFLP showed that, except for four isolates grouped into two clusters which proved to be indistinguishable, the isolates under study were genetically heterogeneous. To the best of our knowledge, this is the first report of H30-R and H30-Rx subclones in animal food samples. Our findings appear to support the role of food chain in their transmission to humans. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Tackling Drug Resistant Infection Outbreaks of Global Pandemic Escherichia coli ST131 Using Evolutionary and Epidemiological Genomics

    Science.gov (United States)

    Downing, Tim

    2015-01-01

    High-throughput molecular screening is required to investigate the origin and diffusion of antimicrobial resistance in pathogen outbreaks. The most frequent cause of human infection is Escherichia coli, which is dominated by sequence type 131 (ST131)—a set of rapidly radiating pandemic clones. The highly infectious clades of ST131 originated firstly by a mutation enhancing conjugation and adhesion. Secondly, single-nucleotide polymorphisms occurred enabling fluoroquinolone-resistance, which is near-fixed in all ST131. Thirdly, broader resistance through beta-lactamases has been gained and lost frequently, symptomatic of conflicting environmental selective effects. This flexible approach to gene exchange is worrying and supports the proposition that ST131 will develop an even wider range of plasmid and chromosomal elements promoting antimicrobial resistance. To stop ST131, deep genome sequencing is required to understand the origin, evolution and spread of antimicrobial resistance genes. Phylogenetic methods that decipher past events can predict future patterns of virulence and transmission based on genetic signatures of adaptation and gene exchange. Both the effect of partial antimicrobial exposure and cell dormancy caused by variation in gene expression may accelerate the development of resistance. High-throughput sequencing can decode measurable evolution of cell populations within patients associated with systems-wide changes in gene expression during treatments. A multi-faceted approach can enhance assessment of antimicrobial resistance in E. coli ST131 by examining transmission dynamics between hosts to achieve a goal of pre-empting resistance before it emerges by optimising antimicrobial treatment protocols. PMID:27682088

  13. Risk factors of hepatic dysfunction in patients with Graves’ hyperthyroidism and the efficacy of 131iodine treatment

    Science.gov (United States)

    Wang, Renfei; Tan, Jian; Zhang, Guizhi; Zheng, Wei; Li, Chengxia

    2017-01-01

    Abstract Hepatic dysfunction is often observed in patients with Graves’ hyperthyroidism. The aims of this study were to investigate the risk factors for hepatic dysfunction and to analyze the efficacy of 131I (radioactive iodine-131) treatment. In total, 2385 patients with Graves’ hyperthyroidism (478 males, 1907 females; age 42.8 ± 13.5 years) were involved in our study. Of these, 1552 cases with hepatic dysfunction received 131I treatment. All clinical data were retrospectively reviewed to explore the risk factors associated with hepatic dysfunction using logistic regression analysis. Furthermore, we observed thyroid and liver function indices for the 1552 subjects at 3, 6 and 12 months after 131I treatment, in order to evaluate efficacy. Overall, 65% patients were affected by hepatic dysfunction. The most common abnormality was elevated alkaline phosphatase (ALP), of which the prevalence was 52.3%. The percentages of hepatocellular injury type, bile stasis, and mixed type were 45.8%, 32.4%, and 21.8%, respectively. Both univariate and multivariate analyses demonstrated that age, duration of Graves hyperthyroidism, free triiodothyronine (FT3)level, and thyrotrophin receptor antibody (TRAb) concentration were the most significant risk factors predicting hepatic dysfunction. Additionally, the patients with mild hepatic dysfunction, or hepatocellular injury type were more likely to attain normal liver function after 131I treatment. Furthermore, after 131I treatment, liver function was more likely to return to normal in the cured group of patients compared with the uncured group. Older patients and cases with a longer history of Graves’ hyperthyroidism, higher FT3 or TRAb concentration were more likely to be associated with hepatic dysfunction, and the prognosis of hepatic dysfunction was closely associated with the outcomes of Graves’ hyperthyroidism after 131I treatment. PMID:28151911

  14. Tackling Drug Resistant Infection Outbreaks of Global Pandemic Escherichia coli ST131 Using Evolutionary and Epidemiological Genomics

    Directory of Open Access Journals (Sweden)

    Tim Downing

    2015-05-01

    Full Text Available High-throughput molecular screening is required to investigate the origin and diffusion of antimicrobial resistance in pathogen outbreaks. The most frequent cause of human infection is Escherichia coli, which is dominated by sequence type 131 (ST131—a set of rapidly radiating pandemic clones. The highly infectious clades of ST131 originated firstly by a mutation enhancing conjugation and adhesion. Secondly, single-nucleotide polymorphisms occurred enabling fluoroquinolone-resistance, which is near-fixed in all ST131. Thirdly, broader resistance through beta-lactamases has been gained and lost frequently, symptomatic of conflicting environmental selective effects. This flexible approach to gene exchange is worrying and supports the proposition that ST131 will develop an even wider range of plasmid and chromosomal elements promoting antimicrobial resistance. To stop ST131, deep genome sequencing is required to understand the origin, evolution and spread of antimicrobial resistance genes. Phylogenetic methods that decipher past events can predict future patterns of virulence and transmission based on genetic signatures of adaptation and gene exchange. Both the effect of partial antimicrobial exposure and cell dormancy caused by variation in gene expression may accelerate the development of resistance. High-throughput sequencing can decode measurable evolution of cell populations within patients associated with systems-wide changes in gene expression during treatments. A multi-faceted approach can enhance assessment of antimicrobial resistance in E. coli ST131 by examining transmission dynamics between hosts to achieve a goal of pre-empting resistance before it emerges by optimising antimicrobial treatment protocols.

  15. Thymic uptake of iodine 131 in the follow up of thyroid carcinoma: frequency and characteristics; Fixation thymique de l'iode 131 dans le suivi du cancer thyroidien: frequence et caracteristiques

    Energy Technology Data Exchange (ETDEWEB)

    Dedienne, B.; Brenot-Rossi, I.; Sauvan, R.; Pasquier, J. [Institut Paoli-Calmettes, 13 - Marseille (France)

    1999-11-01

    Following radioiodine therapy for thyroid carcinoma, we can see a thymic uptake. The aim of this study was to assess its frequency and characteristics. Patients and methods: 262 patients underwent one or more therapeutic activity of iodine-131. A whole body scintigraphy after administration of 74 MBq of iodine-131 was always done before. Results: six patients (2.3%) had a thymic uptake (4 women and 2 men); they were less than 51 years old. Thymic uptake was never seen after the first therapeutic activity, appeared for 3 patients after 2 therapeutics activities, for one after 3, and for 2 after 4. It was visualized in all cases only after the fourth day control, but never after 74 MBq of iodine-131. Thyroglobulin plasma level was normal in 5 cases. The sixth was 44 {mu}g/l but the patient had lymph metastases. Five patients had a CT-scan: the mediastinal uptake was related to a normal thymus in 4 patients and to an hyperplastic gland in one. Conclusion: thymus uptake of iodine-131 is not frequent, it happens after at least 2 therapeutics activities in rather young patients. It is seen only at post-therapeutic control. Thyroglobulin is normal if thymic uptake is the only abnormality, and the CT-scan shows a normal or hyperplastic gland. Additional therapeutics activities are without effect on thymic uptake of iodine-131. It is important to diagnose it in order to avoid surgery and useless therapeutics activities administrations. (author)

  16. [Clinical value of 99mTc-MIBI imaging, 131I whole body scan and HTG determination for the follow-up of patients with differentiated thyroid carcinoma after 131I therapy].

    Science.gov (United States)

    Yu, N; Guan, C; Liu, Y; Yang, X

    1999-12-01

    The purpose of this study was to make a comparative evaluation of 99mTc-MIBI imaging, 131I whole body scan and HTG determination in use for the follow-up of patients with differentiated thyroid carcinoma (DTC) after 131I therapy. Fifty-three patients with DTC had undergone surgical treatment and 131I ablation. Clinical examinations showed that 22 of them had metastases or recurrences. In the follow-up of all the patients, the HTG determination, the 99mTc-MIBI imaging and the 131I-WBS were performed in sequence after the discontinuance of the administration of thyroxin for 4-6 weeks. The results showed that the sensitivity, specificity and accuracy of 99mTc-MIBI imaging were 86.36%, 87.10% and 86.79% respectively; those for HTG were 68.18%, 100% and 86.79% and those for 131I-WBS were 63.64%, 100% and 84.91% respectively. The total sensitivity of the three examinations was 100%; the total specificity and total accuracy were 87.10% and 92.45% respectively. The data of this study suggest that 99mTc-MIBI imaging is a highly sensitive method and the combined use of the three examinations can improve the sensitivity and accuracy of diagnosis for patients with DTC.

  17. The efficacy of montelukast as a protective agent against 131I-induced salivary gland damage in rats: scintigraphic and histopathological findings.

    Science.gov (United States)

    Koca, Gökhan; Gültekin, Salih S; Han, Unsal; Kuru, Serdar; Demirel, Koray; Korkmaz, Meliha

    2013-05-01

    This study was designed to evaluate the efficiency of montelukast as a novel radioprotective agent against sodium [131I]iodide or potassium [131I]iodide (131I)-induced salivary gland damage in a rat model. The function and structure of salivary glands in 50 albino Wistar rats were evaluated with technetium-99m pertechnetate scintigraphies and histopathological examination. The animals were classified into five groups as follows: the control group (sham operated); group 1 (n=10; only 131I administration), group 2 (n=10; administration with 131I and montelukast); group 3 (n=10; 131I administration after total thyroidectomy); and group 4 (n=10; administration with 131I and montelukast after total thyroidectomy). All rats were killed at the end of the third month and three pairs of salivary glands were removed surgically. The scintigraphic evaluation revealed better results for groups administered montelukast than it did for other groups. Statistically significant differences (P0.05) between groups 1 and 2 (n=20) and groups 3 and 4 (n=20). Histopathological examinations showed that pathological changes were significantly high in the groups treated with 131I without montelukast when compared with the other groups. This is the first study on rats to assess the protective effect of montelukast on salivary glands after 131I therapy. According to our results, montelukast was found to be a potential protective agent against 131I-induced damage on salivary glands.

  18. Renal graft evaluation with pertechnetate and I-131 Hippuran. A comparative clinical study. [Tc-99m

    Energy Technology Data Exchange (ETDEWEB)

    Clorius, J.H.; Dreikorn, K.; Zelt, J.; Raptou, E.; Weber, D.; Rubinstein, K.; Dahm, D.; Georgi, P.

    1979-10-01

    This retrospective study compared standard clinical and biochemical data from 50 graft recipients against 533 I-131 Hippuran sequential scintigrams and 515 (/sup 99m/Tc)pertechnetate serial scintigrams. All grafts included in this study are cadaver kidneys. The majority of the studies were made during the early posttransplantation period. Anuria or oliguria of at least 4 days duration was seen in 18 patients. The study spans 574 days of oliguria during which 136 dual-tracer studies were made. I-131 Hippuran renography of functioning grafts was carried out 397 times, and the Tc-99m sequential scintigraphy 379 times. In all, 47 episodes of acute rejection were registered clinically in functioning grafts, 36 of which were recognized during Hippuran renography and 38 with the pertechnetate study. False-positive errors were seen 12 times during renography. The study also demonstrated that furosemide will significantly and predictably influence renography and the pertechnetate study. This seems noteworthy since furosemide is extensively used in posttransplant management.

  19. Numerical simulations of atmospheric dispersion of iodine-131 by different models.

    Directory of Open Access Journals (Sweden)

    Ádám Leelőssy

    Full Text Available Nowadays, several dispersion models are available to simulate the transport processes of air pollutants and toxic substances including radionuclides in the atmosphere. Reliability of atmospheric transport models has been demonstrated in several recent cases from local to global scale; however, very few actual emission data are available to evaluate model results in real-life cases. In this study, the atmospheric dispersion of 131I emitted to the atmosphere during an industrial process was simulated with different models, namely the WRF-Chem Eulerian online coupled model and the HYSPLIT and the RAPTOR Lagrangian models. Although only limited data of 131I detections has been available, the accuracy of modeled plume direction could be evaluated in complex late autumn weather situations. For the studied cases, the general reliability of models has been demonstrated. However, serious uncertainties arise related to low level inversions, above all in case of an emission event on 4 November 2011, when an important wind shear caused a significant difference between simulated and real transport directions. Results underline the importance of prudent interpretation of dispersion model results and the identification of weather conditions with a potential to cause large model errors.

  20. {sup 131}I age-dependent inhalation dose in Southern Poland from Fukushima accident

    Energy Technology Data Exchange (ETDEWEB)

    Brudecki, K.; Szufa, K.; Mietelski, J.W. [Polish Academy of Sciences, Institute of Nuclear Physics, Krakow (Poland)

    2017-03-15

    A general method for calculating doses absorbed from isotopes released in nuclear accidents is presented. As an example, this method was used to calculate doses for inhabitants of Southern Poland due to inhalation of {sup 131}I released due to the Fukushima nuclear plant accident. {sup 131}I activity measurements in the air of that region provided the basis for the study. The proposed model is based on a complex biokinetic model for iodine merging the Leggett model developed in 2010 with the human respiratory tract and gastrointestinal tract models recommended by the International Commission on Radiological Protection (ICRP). This model is described here, and it is demonstrated that resulting dose estimates are consistent with those obtained using the ICRP methodology. Using the developed model, total doses were calculated for six age groups of both genders, for gaseous and aerosol fractions alike. The committed effective dose, H{sub 50}, for an adult man reached 16 nSv, which is lower than 0.001% of the background dose. The dose for the thyroid of an adult reached 0.33 μSv, which corresponds to circa 0.0007% of the dose to the population of Southern Poland after the Chernobyl nuclear plant accident. (orig.)

  1. Measuring the actual I-131 thyroid uptake curve with a collar detector system: a feasibility study

    Energy Technology Data Exchange (ETDEWEB)

    Brinks, Peter; Van Gils, Koen; Dickerscheid, Dennis B.M.; Habraken, Jan B.A. [Department of Medical Physics, St. Antonius Hospital, Nieuwegein (Netherlands); Kranenborg, Ellen; Lavalaye, Jules [Department of Nuclear Medicine, St. Antonius Hospital, Nieuwegein (Netherlands)

    2017-06-15

    Radionuclide therapy using I-131 is commonly used for the treatment of benign thyroid diseases. The therapeutic dose to be administered is calculated based on the type of disease, the volume of the thyroid, and the measured uptake percentage. This methodology assumes a similar biological half-life of iodine, whereas in reality a large variation in biological half-life is observed. More knowledge about the actual biological half-life of iodine for individual patients will improve the quantification of the delivered radiation dose during radioiodine therapy and could aid the evaluation of the success of the therapy. In this feasibility study we used a novel measurement device [Collar Therapy Indicator (CoTI)] to measure the uptake curve of patients undergoing I-131 radioiodine therapy. The CoTI device is a light-weight wearable device that contains two independent gamma radiation detectors that are placed in a collar. By comparing results of thyroid uptake measurements with results obtained with a gamma camera, the precision of the system is demonstrated. Additionally, for three patients the uptake curve is measured during 48 h of admission in the hospital. The presented results demonstrate the feasibility of the new measurement device to measure the uptake curve during radioiodine therapy. (orig.)

  2. 131I age-dependent inhalation dose in Southern Poland from Fukushima accident.

    Science.gov (United States)

    Brudecki, K; Szufa, K; Mietelski, J W

    2017-03-01

    A general method for calculating doses absorbed from isotopes released in nuclear accidents is presented. As an example, this method was used to calculate doses for inhabitants of Southern Poland due to inhalation of 131I released due to the Fukushima nuclear plant accident. 131I activity measurements in the air of that region provided the basis for the study. The proposed model is based on a complex biokinetic model for iodine merging the Leggett model developed in 2010 with the human respiratory tract and gastrointestinal tract models recommended by the International Commission on Radiological Protection (ICRP). This model is described here, and it is demonstrated that resulting dose estimates are consistent with those obtained using the ICRP methodology. Using the developed model, total doses were calculated for six age groups of both genders, for gaseous and aerosol fractions alike. The committed effective dose, H 50, for an adult man reached 16 nSv, which is lower than 0.001% of the background dose. The dose for the thyroid of an adult reached 0.33 μSv, which corresponds to circa 0.0007% of the dose to the population of Southern Poland after the Chernobyl nuclear plant accident.

  3. [Blocking of the thyroid against I-131 following a nuclear disaster].

    Science.gov (United States)

    Kroizman-Sheiner, Einat; Brickner, Dov; Canfi, Ayala; Schwarzfuchs, Dan

    2005-07-01

    The Chernobyl accident, the recent terrorists' attacks and constant threats, have all once again evoked the fear of a nuclear disaster, in Israel and worldwide. Iodine-131 is a major fission product of nuclear reactors and is highly likely to be released into the atmosphere in severe nuclear disasters. The radioiodine is released as a gas, easily spreads over large areas and is easily absorbed via the respiratory system. Iodine-131 emits gamma and beta radiation in high energies, and is readily absorbed by the thyroid which is a target organ for iodine. The resulting exposure to the thyroid might be very high. A sharp increase in thyroid cancer incidence in children was observed following the Chernobyl accident. This article reviews the medical knowledge about strategies and medications aimed at minimizing the absorption of radioiodine into the thyroid. In addition to regular safety means such as sheltering, restriction of locally produced food products and relocation of the population, the best prophylaxis against thyroid exposure is overloading the gland with stable iodine (as potassium iodide), as soon as possible. Recently, the Israeli government decided to distribute Potassium Iodide tablets to the population in the vicinity of the two nuclear research centers in the country. When this treatment is contraindicated, iodine free thionamides or potassium perchlorate are suggested.

  4. Numerical simulations of atmospheric dispersion of iodine-131 by different models.

    Science.gov (United States)

    Leelőssy, Ádám; Mészáros, Róbert; Kovács, Attila; Lagzi, István; Kovács, Tibor

    2017-01-01

    Nowadays, several dispersion models are available to simulate the transport processes of air pollutants and toxic substances including radionuclides in the atmosphere. Reliability of atmospheric transport models has been demonstrated in several recent cases from local to global scale; however, very few actual emission data are available to evaluate model results in real-life cases. In this study, the atmospheric dispersion of 131I emitted to the atmosphere during an industrial process was simulated with different models, namely the WRF-Chem Eulerian online coupled model and the HYSPLIT and the RAPTOR Lagrangian models. Although only limited data of 131I detections has been available, the accuracy of modeled plume direction could be evaluated in complex late autumn weather situations. For the studied cases, the general reliability of models has been demonstrated. However, serious uncertainties arise related to low level inversions, above all in case of an emission event on 4 November 2011, when an important wind shear caused a significant difference between simulated and real transport directions. Results underline the importance of prudent interpretation of dispersion model results and the identification of weather conditions with a potential to cause large model errors.

  5. Calibration of the Accuscan II In Vivo System for I-131 Thyroid Counting

    Energy Technology Data Exchange (ETDEWEB)

    Orval R. Perry; David L. Georgeson

    2011-07-01

    This report describes the March 2011 calibration of the Accuscan II HpGe In Vivo system for I-131 thyroid counting. The source used for the calibration was an Analytics mixed gamma source 82834-121 distributed in an epoxy matrix in a Wheaton Liquid Scintillation Vial with energies from 88.0 keV to 1836.1 keV. The center of the detectors was position 64-feet from the vault floor. This position places the approximate center line of the detectors at the center line of the source in the thyroid tube. The calibration was performed using an RMC II phantom (Appendix J). Validation testing was performed using a Ba-133 source and an ANSI N44.3 Phantom (Appendix I). This report includes an overview introduction and records for the energy/FWHM and efficiency calibrations including verification counting. The Accuscan II system was successfully calibrated for counting the thyroid for I-131 and verified in accordance with ANSI/HPS N13.30-1996 criteria.

  6. Low radiation dose to relatives after discharge of thyroid cancer patients treated with I-131

    Energy Technology Data Exchange (ETDEWEB)

    Remy, H.; Camps, E. [Pharmacy, Institut de Cancerologie Gustave Roussy, Villejuif (France); Ricard, M.; Lavielle, F.; Coulot, J. [Medical Physics, Institut de Cancerologie Gustave Roussy, Villejuif (France); Borget, I. [Health Economics, Institut de Cancerologie Gustave Roussy, Villejuif (France); Schhumberger, M. [Nuclear Medicine, Institut de Cancerologie Gustave Roussy, Villejuif (France); University Paris-sud, Bicetre (France)

    2012-07-01

    Patients treated with I-131 for thyroid carcinoma are potential source of radiation exposure for other individuals. In order to provide more reliable information to patients and relatives, this study evaluated the radiation dose received by family members after discharge from the hospital. Three main observations can be drawn. First, rhTSH (recombinant human Thyrotropin) stimulation leads to lower irradiation when mean rate is considered (cumulated irradiation divided by time contact) 1.4 {mu}Sv per hour compared to 1.6 {mu}Sv with withdrawal. However, this had no impact on the radiation dose received by relatives, because of a longer time spent close to the patient when rhTSH is used. Secondly, the mean cumulated radiation dose delivered to the relatives during the 7 days following discharge was similar with either rhTSH (58 {mu}Sv) or withdrawal patients (49.6 {mu}Sv). Thirdly, in euthyroid patients after rhTSH, the whole body retention of I-131 after three days of hospitalization is significantly lower than in hypothyroid patients after withdrawal. The hospital stay can be shortened when rhTSH is used

  7. Iodine-131 treatment of hyperthyroidism in the elderly. Results in 180 patients. Radioprotection and waste management in 131-iodine therapy; Traitement de l'hyperthyroidie du sujet age par l'iode 131. A propos de 180 patients. Problemes de radioprotection et de gestion des dechets lies au traitement par l'iode 131

    Energy Technology Data Exchange (ETDEWEB)

    Dejax, C.; Freitas, D. de; Leroux, M.A.; Aubert, B. [Centre Jean-Perrin, Medecine Nucleaire, 63 - Clermont-Ferrand (France); Vennat, J.C. [Centre Jean-Perrin, Radiopharmacie, 63 - Clermont-Ferrand (France); Kwiatkowski, F. [Centre Jean-Perrin, Biostatistiques, 63 - Clermont-Ferrand (France)

    2005-09-15

    A retrospective study has been performed in patients treated by iodine-131 for hyperthyroidism between April 1999 and February 2004..Among the 270 patients, 180 were more than 65 years old. After 65 years, hyperthyroidism is most often the consequence of a toxic adenoma or multi-nodular goiter while Graves' disease is most frequent in young patients. Iodine-131 is usually proposed as first line treatment in the elderly, at the opposite of young patients. With a mean follow-up of 12 months, return to euthyroidism is observed in 56.5% of the older patients and in 73.6% of the young patients. We explain this results by the lower incidence of Graves' disease in the elderly. Nuclear medicine physicians are legally obliged to provide patients with a proper information about radioprotection. Recommendations should nevertheless not induce overdue nor illegitimate fear. They should not only be written and standardized, but also given orally and adapted to each patient. Urinary incontinence is not specific to the old patients, but it is more frequent after 65. Collection and storage of contaminated waste is sometimes difficult and has often to be solved on a case by case basis. (author)

  8. Radiolabeling and biodistribution of monoclonal antibody (MAb anti-CD20 with iodine-131

    Directory of Open Access Journals (Sweden)

    Akinkunmi Ganiyu Akanji

    2005-10-01

    Full Text Available Radioactive isotopes of iodine, mainly iodine-131 have been broadly used in many monoclonal antibody radioiodination settings, employing different methods. In this study, using a Chloramine-T procedure, the influence of incubation time, CT mass, and Ab/activity ratio on the radiochemical yield of the anti-CD20 antibody labeled with iodine-131 was observed. Radiochemical yield was > 97 %, employing different Chloramine-T masses, independently of incubation time. Radiochemical purity was above 99 % after purification of the labeled compound. The relationship between Ab mass and radioactivity was tested and no difference was observed when 90.6 MBq (2.45mCi of activity was incorporated in the Ab-mass range studied. Biodistribution study in normal Swiss mice showed higher uptake by the liver and intestines. Low thyroid uptake indicated a suitable in vivo stability. Slight blood uptake was considered a result of circulating radioactivity in normal organs and tissues. A favorable biological distribution of 131I-anti-CD20 suggests this radiopharmaceutical may be effectively used in the therapy of Non Hodgkin Lymphoma.Radioisótopos de iodo, principalmente iodo-131 foram muito utilizados em vários procedimentos de marcação de anticorpos monoclonais usando diferentes métodos tais como o de Cloramina-T(CT. Neste estudo, observamos a influência de tempo de incubação, massa de CT, relação anticorpo/actividade na pureza radioquímica no anticorpo anti-CD20 marcado com iodo-131. A pureza radioquímica foi superior a 97% quando massas diferentes de CT foram utilizadas independentes do tempo de incubação. A pureza radioquímica superior a 99% após a purificação do composto radiomarcado. Todavia, a relação entre anticorpo/atividade foi determinada e nenhuma diferencia foi observada quando 90,6 MBq (2.45 mCi foram incorporados a 10, 25, 50 ou 100 µg de Ac exceto uma pequena redução em 10 µg. O estudo de distribuição biológica em camundongo

  9. An experimental study on (131)I-CHIBA-1001: a radioligand for α7 nicotinic acetylcholine receptors.

    Science.gov (United States)

    Yin, Lei; Zhao, Qian; Li, Ling; Zhang, Su Lei; Chen, Xue Qi; Ma, Chao; Kang, Lei; Liu, Meng; Zhang, Chun Li; Yan, Ping; Wang, Rong Fu

    2013-01-01

    The α7 nicotinic acetylcholine receptors (nAChRs) play a vital role in the pathophysiology of neuropsychiatric diseases such as Alzheimer's disease and depression. However, there is currently no suitable positron emission tomography (PET) or Single-Photon Emission Computed Tomography (SPECT) radioligands for imaging α7 nAChRs in brain. Here our aim is to radiosynthesize a novel SPECT radioligand (131)I-CHIBA-1001 for whole body biodistribution study and in vivo imaging of α7 nAChRs in brain. (131)I-CHIBA-1001 was radiosynthesized by chloramine-T method. Different conditions of reaction time and temperature were tested to get a better radiolabeling yield. Radiolabeling yield and radiochemical purities of (131)I-CHIBA-1001 were analyzed by thin layer chromatography (TLC) and high-performance liquid chromatography (HPLC) system. Whole body biodistribution study was performed at different time points post injection of (131)I-CHIBA-1001 in KM mice. Monkey subject was used for in vivo SPECT imaging in brain. The radiolabeling yield of (131)I-CHIBA-1001 reached 96% within 1.5∼2.0 h at 90∼95°C. The radiochemical purity reached more than 99% after HPLC purification. (131)I-CHIBA-1001 was highly stable in saline and fresh human serum in room temperature and 37°C separately. The biodistribution data of brain at 15, 30, and 60 min were 11.05±1.04%ID/g, 8.8±0.04%ID/g and 6.28±1.13%ID/g, respectively. In experimental SPECT imaging, the distribution of radioactivity in the brain regions was paralleled with the distribution of α7 nAChRs in the monkey brain. Moreover, in the blocking SPECT imaging study, the selective α7 nAChR agonist SSR180711 blocked the radioactive uptake in the brain successfully. The CHIBA-1001 can be successfully radiolabeled with (131)I using the chloramine-T method. (131)I-CHIBA-1001 can successfully accumulate in the monkey brain and image the α7 acetylcholine receptors. (131)I-CHIBA-1001 can be a candidate for imagingα7 acetylcholine

  10. An experimental study on (131I-CHIBA-1001: a radioligand for α7 nicotinic acetylcholine receptors.

    Directory of Open Access Journals (Sweden)

    Lei Yin

    Full Text Available OBJECTIVE: The α7 nicotinic acetylcholine receptors (nAChRs play a vital role in the pathophysiology of neuropsychiatric diseases such as Alzheimer's disease and depression. However, there is currently no suitable positron emission tomography (PET or Single-Photon Emission Computed Tomography (SPECT radioligands for imaging α7 nAChRs in brain. Here our aim is to radiosynthesize a novel SPECT radioligand (131I-CHIBA-1001 for whole body biodistribution study and in vivo imaging of α7 nAChRs in brain. METHOD: (131I-CHIBA-1001 was radiosynthesized by chloramine-T method. Different conditions of reaction time and temperature were tested to get a better radiolabeling yield. Radiolabeling yield and radiochemical purities of (131I-CHIBA-1001 were analyzed by thin layer chromatography (TLC and high-performance liquid chromatography (HPLC system. Whole body biodistribution study was performed at different time points post injection of (131I-CHIBA-1001 in KM mice. Monkey subject was used for in vivo SPECT imaging in brain. RESULT: The radiolabeling yield of (131I-CHIBA-1001 reached 96% within 1.5∼2.0 h at 90∼95°C. The radiochemical purity reached more than 99% after HPLC purification. (131I-CHIBA-1001 was highly stable in saline and fresh human serum in room temperature and 37°C separately. The biodistribution data of brain at 15, 30, and 60 min were 11.05±1.04%ID/g, 8.8±0.04%ID/g and 6.28±1.13%ID/g, respectively. In experimental SPECT imaging, the distribution of radioactivity in the brain regions was paralleled with the distribution of α7 nAChRs in the monkey brain. Moreover, in the blocking SPECT imaging study, the selective α7 nAChR agonist SSR180711 blocked the radioactive uptake in the brain successfully. CONCLUSION: The CHIBA-1001 can be successfully radiolabeled with (131I using the chloramine-T method. (131I-CHIBA-1001 can successfully accumulate in the monkey brain and image the α7 acetylcholine receptors. (131I-CHIBA-1001 can be a

  11. Analysis of influence of dosimetric factors on the outcome of I-131 therapy in patients with hyperthyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Knapska-Kucharska, M.; Oszukowska, L.; Makarewicz, J. [Department of Nuclear Medecine and Oncological Endocrinology, Province Hospital, Zgierz (Poland); Lewinski, A. [Chair and Department of Endocrinology and Metabolic Diseases, Medical University, Lodz (Poland)

    2012-07-01

    The influence of dosimetric factors on the outcome of {sup 131}I therapy has been examined in hyperthyroid patients submitted to {sup 131}I treatment. The following factors - which could have influence on the effects of therapy with radioiodine - were analysed: the goitre volume, the thyroid radioiodine uptake after 24 h, and the effective half-life time of {sup 131}I (EHL). Five hundred (500) randomly selected patients with hyperthyroidism, treated with {sup 131}I, were studied. They were divided into three groups (based on clinical examination, hormonal and immunological tests, thyroid scintigraphy and ultrasound imaging). The study shows that the effectiveness of {sup 131}I therapy depends on the thyroid volume and absorbed dose in all the groups of patients and on the thyroid radioiodine uptake and EHL in patients with a single autonomously functioning thyroid nodule. We have failed to determine the borderline D, distinguishing between effective and ineffective therapy. The treatment outcome can be predicted with approximately 70% accuracy, based on minimal absorbed dose

  12. The radioprotective effects of Origanum vulgare extract against genotoxicity induced by (131)I in human blood lymphocyte.

    Science.gov (United States)

    Arami, Sanam; Ahmadi, Amirhossein; Haeri, S Abolghasem

    2013-04-01

    Radioiodine ((131)I) has been widely used for the treatment of patients with thyroid diseases. However, there is a persisting concern about the induction of second tumor and genetic damage after (131)I therapy. The purpose of this study was to investigate the radioprotective effects of Origanum vulgare extract against genotoxicity induced by (131)I in human lymphocytes. Whole blood samples from human volunteers were incubated with origanum extract at doses of 12.5, 25, 50 and 100 μg/mL. After 1 hour of incubation, the lymphocytes were incubated with (131)I (20 μCi/mL) for 1 hour. The lymphocytes were then cultured with a mitogenic stimulant to evaluate micronucleus formation in cytokinesis-blocked binucleated cells. Incubation of lymphocytes with (131)I induced additional genotoxicity and shown by increases in micronuclei (MN) frequency in human lymphocytes. Origanum at three last doses significantly reduced the MN frequency in cultured lymphocytes. The maximum protective effect and the maximum decrease in the frequency of MN were observed at 100 μg/mL of origanum, which caused a reduction of 70% (pOriganum extract also exhibited an excellent and dose-dependent radical-scavenging activity against 1,1-diphenyl-2-picrylhydrazyl-free radicals. This study has important implications for patients undergoing nuclear medicine procedures. The results indicate a protective role for origanum extract against the genetic damage induced by radiopharmaceutical administration.

  13. Experimental results concerning the metabolism of ingested iodine-131 in adult sheep under lactation; Resultats experimentaux relatifs au metabolisme de l'iode 131 ingere chez la brebis adulte en lactation

    Energy Technology Data Exchange (ETDEWEB)

    Daburon, F.; Capelle, A.; Tricaud, Y.; Nizza, P. [Commissariat a l' Energie Atomique, 92 - Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires. Departement de la Protection Sanitaire, Laboratoire-etable de Radiobiologie Appliquee

    1967-07-01

    The authors give the results of a series of experiments on metabolism of ingested iodine-131 in adult sheep under lactation; the measurement were carried out over a number of years from 1961 to 1966. The work was concerned initially with the fixation of iodine 131 in the thyroid gland, with the calculation of radiation doses absorbed and with ways of showing up any possible radiation damage in the gland. The modes of absorption of iodine 131 and its elimination through milk, urine and the faeces were then considered. Finally, a last chapter is devoted to changes in the radioactivity of the blood and of the milk, to variations of the PBI level of the blood serum as to different methods for measuring this level. (authors) [French] Les auteurs rapportent les resultats d'une serie d'experimentations relatives au metabolisme de l'iode 131 ingere chez la brebis adulte en lactation, et qui se sont etalees sur plusieurs annees, de 1961 a 1966. Les etudes ont porte d'abord sur les aspects de la fixation de l'iode 131 dans la thyroide, avec le calcul des doses de rayonnements absorbees et les moyens de mettre en evidence les radiolesions eventuelles de la glande. Ensuite ont ete traitees les modalites de l'absorption de l'iode 131 et de son elimination par le lait, les urines et les feces. Enfin un dernier chapitre a ete consacre a l'evolution de la radioactivite du sang et du lait, aux variations ainsi qu'aux divers moyens d'evaluation du taux de PBI du serum sanguin. (auteurs)

  14. Distrofia muscular de Duchenne: análise eletrocardiográfica de 131 pacientes Distrofia muscular de duchenne: análisis electrocardiográfica de 131 pacientes Duchenne muscular dystrophy: electrocardiographic analysis of 131 patients

    Directory of Open Access Journals (Sweden)

    Maria Auxiliadora Bonfim Santos

    2010-05-01

    Full Text Available FUNDAMENTO: É conhecido o envolvimento cardíaco em pacientes com distrofia muscular de Duchenne (DMD. O eletrocardiograma (ECG apresenta algumas alterações típicas na DMD, fato que o torna um exame útil no diagnóstico da lesão cardíaca nessa patologia. OBJETIVO: Avaliar as alterações eletrocardiográficas em pacientes portadores de DMD, correlacionando-as com a idade da população estudada. MÉTODOS: Foram analisados os ECG de 131 pacientes com diagnóstico de DMD. Avaliaram-se diversas variáveis eletrocardiográficas, sendo os pacientes separados em dois grupos: aqueles com e sem alterações, por variável estudada. Fez-se a correlação desses dois grupos com a idade dos pacientes. Foram utilizados os critérios de Garson para estabelecer os parâmetros eletrocardiográficos de normalidade. RESULTADOS: O ECG estava anormal em 78,6% dos pacientes. Todos apresentavam ritmo sinusal. Foram os seguintes os percentuais encontrados para as principais variáveis estudadas: PR curto = 18,3%, ondas R anormais em V1 = 29,7%, ondas Q anormais em V6 = 21,3%, alterações da repolarização ventricular = 54,9%, ondas QS anormais em paredes inferior e/ou lateral alta = 37,4%, distúrbios de condução pelo ramo direito = 55,7%, intervalo QT C prolongado = 35,8% e alargamento do QRS = 23,6%. O teste t não pareado foi utilizado para se estabelecer a correlação da idade com as variáveis eletrocardiográficas estudadas nos dois grupos e, apenas a variável alteração da repolarização mostrou diferença estatisticamente significante. CONCLUSÃO: As alterações eletrocardiográficas na DMD são frequentes, revelando comprometimento cardíaco precoce. Apenas a variável alteração da repolarização ventricular foi mais frequente, porém em faixa etária menor (p FUNDAMENTO: Se sabe de la afectación cardíaca en pacientes con distrofia muscular de Duchenne (DMD. El electrocardiograma (ECG presenta algunas alteraciones típicas en la DMD

  15. Improved detection of lung or bone metastases with an I-131 whole body scan on the 7th day after high-dose I-131 therapy in patients with thyroid cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chong, Ar I; Song, Ho Chun; Min, Jung Joon; Kim, Ja Hae; Yoo, Su Ung; Oh, Jong Ryool; Bom, Hee Seung [Chonnam National University Medical School, Gwangju (Korea, Republic of); Jeong, Shin Young [Kyungpook National University Hospital, Daegu (Korea, Republic of); Ha, Jung Min [Chosun University Hospital, Gwangju (Korea, Republic of)

    2010-12-15

    The purpose of this study is to compare post-therapy third day and seventh day I-131 whole body scans (3DWBS and 7DWBS) in detecting lung or bone metastasis from well-differentiated thyroid cancer. We enrolled 52 patients with lung or bone metastasis out of 1,152 patients who were treated with high-dose I-131 therapy from January 2008 to June 2009. All patients underwent 3DWBS and 7DWBS. I-131 avidity was classified into three grades: no uptake, suspicious for uptake, and definite uptake. We compared the presence and grades of metastatic lesions on each scan. We categorized all cases into three groups based on I-131 uptake on each scan and compared several clinical parameters including FDG uptake and thyroglobulin (Tg) level among the groups. Sixty metastatic cases from 52 patients (45 lung and 15 bone metastases) were included. In 35 cases, I-131-avid metastatic lesions were detected by both 3DWBS and 7DWBS (group A). In 15 cases, metastatic lesions were missed on 3DWBS but detected on 7DWBS (group B). In 10 cases, I-131 uptake was not detected on either 3DWBS or 7DWBS (group C). The of 45 cases (22.2%) of lung metastasis that were negative on 3DWBS were detected on 7DWBS (p=0.002). Five of 15 cases (33.3%) of bone metastasis that were negative on 3DWBS were detected on 7DWBS (p=0.0625). The serum Tg level (TSH stimulated) was significantly different among groups A, B, and C (p=0.0030). However, after exclusion of cases without a history of I-131 therapy, there was no significant difference in serum Tg level among the groups (p=0.2330). The number of cases with a prior history of metastasis was higher in group A than in group B (p=0.0069). However, there was no significant difference in prior history of metastasis between groups A and C (p=0.8107). 7DWBS showed more lung or bone metastatic lesions than 3DWBS. After high-dose I-131 therapy, 7DWBS should be considered regardless of the results of the 3DWBS for the diagnosis of lung or bone metastasis from well

  16. Individual monitoring of internal exposure of {sup 131}I of workers from the nuclear medicine service FUESMEN, Argentina; Monitoraje individual debido a exposicion interna por {sup 131I} de los trabajadores del servicio de medicina nuclear de FUESMEN

    Energy Technology Data Exchange (ETDEWEB)

    Arenas, G.; Acosta, N.; Venier, V.; Bedoya Toboo, C. [Comision Nacional de Energia Atomica (FUESMEN/CNEA), Buenos Aires (Argentina). Fundacion Escuela de Medicina Nuclear

    2013-07-01

    It is presented the FUESMEN experience in routine monitoring of thyroid internal doses due to inhalation of {sup 131}I in workers of the Nuclear Medicine Service in normal operation or accidental exposure. It is used a surface contamination monitor, type Geiger Mueller, calibrated with a acrylic phantom based on specifications of the simulator of thyroid of ICRU 48 with {sup 131}I reference activity. Through the obtained measurements is achieved to validate the use of Portable Monitor to carry out preliminary exploration on the monitoring scenarios of incidental situations.

  17. Treatment of solitary, autonomously-functioning, non-toxic thyroid nodules with I131 Adenema tiroideo autónomo no tóxico tratamiento con I131

    OpenAIRE

    Federico Uribe Londoño; María C. Echeverri; Benjamín Orozco; Arturo Orrego

    1991-01-01

    Fifteen euthyroid patients (14 women and 1man) with solitary autonomously functioning non-toxic thyroid nodules (AFTN) were treated with high doses of I131 (mean 19.2 mCi). Diagnosis was made by I131 thyroid scan and triiodothyronine suppression test. The size of the nodule was determined by thyroid ecography both before and after treatment. Evaluation of thyroid fun...

  18. Emergence of Klebsiella pneumoniae carbapenemase-producing Escherichia coli sequence type 131 in Hangzhou, China.

    Science.gov (United States)

    Lou, Zhengqing; Qi, Yan; Qian, Xiang; Yang, Wei; Wei, Zeqing

    2014-01-01

    Klebsiella pneumoniae carbapenemase (KPC)-producing Escherichia (E.) coli has been reported in China since 2008. However, there is no information about the molecular epidemiology of KPC-producing E. coli in China. In this study, we aimed to investigate the sequence type (ST) and characteristics of KPC-producing E. coli isolates in China. Three carbapenem-resistant isolates of E. coli (E1, E2, and E3) from one teaching hospital in Hangzhou covering a one year period were analyzed. Antibiotic susceptibility was determined by Etest. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for epidemiological analysis. The genetic structure around blaKPC, the major plasmid incompatibility typing, and the identification of β-lactamase gene types were performed by PCR and the positive products were subsequently sequenced. Plasmids were analyzed by transformation, restriction, and Southern blotting. PFGE demonstrated that patterns of isolates E1 and E2 were clonally-related and designated as patterns A1 and A2; pattern of isolate E3 was different and designated as pattern B. MLST analysis showed that the three isolates displayed one common sequence type ST131. The identification of bla gene types by PCR and sequencing showed that blaKPC-2, blaCTX-M-14, and blaTEM-1 were detected in all three isolates. All three isolates carried a KPC-2-encoding plasmid of the IncN replicon. Plasmid analysis and hybridization experiments showed that the isolates were found simultaneously to carry two or four plasmids. The blaKPC-2 gene in E1 and E2 was located in a plasmid with size of ca. 50 kb. However, the blaKPC-2 gene in E3 was located in a plasmid with size of ca. 130 kb. E. coli ST131 with KPC-2 β-lactamase has emerged in China, which enlarges the geographical area where the ST131 KPC-producing E. coli strains have diffused.

  19. Double-phase (131)I whole body scan and (131)I SPECT-CT images in patients with differentiated thyroid cancer: their effectiveness for accurate identification.

    Science.gov (United States)

    Wakabayashi, Hiroshi; Nakajima, Kenichi; Fukuoka, Makoto; Inaki, Anri; Nakamura, Ayane; Kayano, Daiki; Kinuya, Seigo

    2011-11-01

    This study aims to determine whether a (131)I double-phase whole body scan (WBS) and SPECT-CT images have added value over a single-phase WBS image in identifying benign and malignant lesions in patients with well-differentiated thyroid cancer (DTC) at their first radioactive iodine (RAI) treatment. This study included 42 DTC patients who underwent their first radioablation. Post-therapeutic WBS images were acquired after 3 days (early phase) and 7 days (delayed phase). Following early-phase WBS, SPECT-CT images were obtained. The images were reviewed independently of the clinical data by 2 board-certified observers with a 6-point scoring system (benign to malignant -3 to +3). The double-phase WBS and SPECT-CT images showed 115 radioiodine-avid localizations (81 benign and 34 malignant accumulations). Confidence levels of benign accumulations were significantly higher with SPECT-CT (average score -2.40 ± 1.06) compared to those of the early-phase WBS (average score -1.39 ± 1.88) (p images (average score -1.49 ± 1.19) (p confidence score in the early-phase WBS image, the confidence level of the delayed-phase WBS was higher compared to that of the early-phase WBS images (p = 0.0012). The confidence levels of malignant accumulations were significantly higher with SPECT-CT images (average score 2.37 ± 0.96) compared to the early-phase WBS (average score 1.44 ± 1.21) (p images (average score 1.50 ± 1.13) (p image was superior to the early-phase WBS image in enhancing the confidence level and accurately localizing the lesions. The delayed-phase WBS image contributed to the accurate diagnosis of benign lesions with a low confidence level in the early-phase WBS image.

  20. Estimated dose rates to members of the public from external exposure to patients with 131I thyroid treatment.

    Science.gov (United States)

    Dewji, S; Bellamy, M; Hertel, N; Leggett, R; Sherbini, S; Saba, M; Eckerman, K

    2015-04-01

    Estimated dose rates that may result from exposure to patients who had been administered iodine-131 ((131)I) as part of medical therapy were calculated. These effective dose rate estimates were compared with simplified assumptions under United States Nuclear Regulatory Commission Regulatory Guide 8.39, which does not consider body tissue attenuation nor time-dependent redistribution and excretion of the administered (131)I. Dose rates were estimated for members of the public potentially exposed to external irradiation from patients recently treated with (131)I. Tissue attenuation and iodine biokinetics were considered in the patient in a larger comprehensive effort to improve external dose rate estimates. The external dose rate estimates are based on Monte Carlo simulations using the Phantom with Movable Arms and Legs (PIMAL), previously developed by Oak Ridge National Laboratory and the United States Nuclear Regulatory Commission. PIMAL was employed to model the relative positions of the (131)I patient and members of the public in three exposure scenarios: (1) traveling on a bus in a total of six seated or standing permutations, (2) two nursing home cases where a caregiver is seated at 30 cm from the patient's bedside and a nursing home resident seated 250 cm away from the patient in an adjacent bed, and (3) two hotel cases where the patient and a guest are in adjacent rooms with beds on opposite sides of the common wall, with the patient and guest both in bed and either seated back-to-back or lying head to head. The biokinetic model predictions of the retention and distribution of (131)I in the patient assumed a single voiding of urinary bladder contents that occurred during the trip at 2, 4, or 8 h after (131)I administration for the public transportation cases, continuous first-order voiding for the nursing home cases, and regular periodic voiding at 4, 8, or 12 h after administration for the hotel room cases. Organ specific activities of (131)I in the thyroid

  1. Estimated dose rates to members of the public from external exposure to patients with {sup 131}I thyroid treatment

    Energy Technology Data Exchange (ETDEWEB)

    Dewji, S., E-mail: dewjisa@ornl.gov; Bellamy, M.; Leggett, R.; Eckerman, K. [Oak Ridge National Laboratory, 1 Bethel Valley Road, MS-6335, Oak Ridge, Tennessee 37831 (United States); Hertel, N. [Oak Ridge National Laboratory, 1 Bethel Valley Road, MS-6335, Oak Ridge, Tennessee 37831 and Georgia Institute of Technology, 770 State Street, Atlanta, Georgia 30332-0745 (United States); Sherbini, S.; Saba, M. [United States Nuclear Regulatory Commission, Washington, DC 20555-0001 (United States)

    2015-04-15

    Purpose: Estimated dose rates that may result from exposure to patients who had been administered iodine-131 ({sup 131}I) as part of medical therapy were calculated. These effective dose rate estimates were compared with simplified assumptions under United States Nuclear Regulatory Commission Regulatory Guide 8.39, which does not consider body tissue attenuation nor time-dependent redistribution and excretion of the administered {sup 131}I. Methods: Dose rates were estimated for members of the public potentially exposed to external irradiation from patients recently treated with {sup 131}I. Tissue attenuation and iodine biokinetics were considered in the patient in a larger comprehensive effort to improve external dose rate estimates. The external dose rate estimates are based on Monte Carlo simulations using the Phantom with Movable Arms and Legs (PIMAL), previously developed by Oak Ridge National Laboratory and the United States Nuclear Regulatory Commission. PIMAL was employed to model the relative positions of the {sup 131}I patient and members of the public in three exposure scenarios: (1) traveling on a bus in a total of six seated or standing permutations, (2) two nursing home cases where a caregiver is seated at 30 cm from the patient’s bedside and a nursing home resident seated 250 cm away from the patient in an adjacent bed, and (3) two hotel cases where the patient and a guest are in adjacent rooms with beds on opposite sides of the common wall, with the patient and guest both in bed and either seated back-to-back or lying head to head. The biokinetic model predictions of the retention and distribution of {sup 131}I in the patient assumed a single voiding of urinary bladder contents that occurred during the trip at 2, 4, or 8 h after {sup 131}I administration for the public transportation cases, continuous first-order voiding for the nursing home cases, and regular periodic voiding at 4, 8, or 12 h after administration for the hotel room cases. Organ

  2. Development of co-located 129Xe and 131Xe nuclear spin masers with external feedback scheme

    Science.gov (United States)

    Sato, T.; Ichikawa, Y.; Kojima, S.; Funayama, C.; Tanaka, S.; Inoue, T.; Uchiyama, A.; Gladkov, A.; Takamine, A.; Sakamoto, Y.; Ohtomo, Y.; Hirao, C.; Chikamori, M.; Hikota, E.; Suzuki, T.; Tsuchiya, M.; Furukawa, T.; Yoshimi, A.; Bidinosti, C. P.; Ino, T.; Ueno, H.; Matsuo, Y.; Fukuyama, T.; Yoshinaga, N.; Sakemi, Y.; Asahi, K.

    2018-02-01

    We report on the operation of co-located 129Xe and 131Xe nuclear spin masers with an external feedback scheme, and discuss the use of 131Xe as a comagnetometer in measurements of the 129Xe spin precession frequency. By applying a correction based on the observed change in the 131Xe frequency, the frequency instability due to magnetic field and cell temperature drifts are eliminated by two orders of magnitude. The frequency precision of 6.2 μHz is obtained for a 104 s averaging time, suggesting the possibility of future improvement to ≈ 1 nHz by improving the signal-to-noise ratio of the observation.

  3. A simple low-cost of liquid I-131 dispenser for routine radiopharmaceutical dispensing at nuclear medicine department, Institut Kanser Negara

    Energy Technology Data Exchange (ETDEWEB)

    Said, M. A.; Suhaimi, N. E. F. [Fakulti Sains dan Teknologi, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi Selangor (Malaysia); Ashhar, Z. N., E-mail: aminhpj@gmail.com [Institut Kanser Negara, No 4, Jalan P7, Presint 7, 62250 Putrajaya (Malaysia); Zainon, R. [Advanced Medical & Dental Institute, Universiti Sains Malaysia, Bertam, 13200, Kepala Batas, Pulau Pinang (Malaysia)

    2016-01-22

    In routine radiopharmaceutical Iodine-131 ({sup 131}I) dispensing, the amount of radiation dose received by the personnel depends on the distance between the personnel and the source, the time spent manipulating the source and the amount of shielding used to reduce the dose rate from the source. The novel iRAD-I131 dispenser using recycle {sup 131}I liquid lead pot will lead into low cost production, less maintenance and low dose received by the personnel that prepared the {sup 131}I. The new fabricated of low cost {sup 131}I dispenser was tested and the dose received by personnel were evaluated. The body of lead material is made from 2.5 cm lead shielded coated with epoxy paint to absorb the radiation dose up to 7.4 GBq of {sup 131} I. The lead pot was supported with two stainless steel rod. The Optically Stimulated Luminescence (OSL) nanodot was used in this study to measure the dose rate at both extremities for every personnel who prepared the {sup 131}I. Each OSL nanodot was attached at the fingertip. Three different personnel (experienced between one to ten years above in preparing the radiopharmaceuticals) were participated in this study. The average equivalent dose at right and left hand were 122.694 ± 121.637 µSv/GBq and 77.281 ± 62.146 µSv/GBq respectively. This study found that the dose exposure received using iRAD-I131 was less up to seven times compared to the conventional method. The comparison of experimental data using iRAD-I131 and established radiopharmaceutical dispenser was also discussed. The innovation of {sup 131}I dispenser is highly recommended in a small radiopharmaceutical facility with limited budget. The novel iRAD-I131 enables implementation of higher output liquid dispensing with low radiation dose to the personnel.

  4. Is radioactive iodine-{sup 131} treatment related to the occurrence of non-synchronous second primary malignancy in patients with differentiated thyroid cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Marcelo Cruzick de; Momesso, Denise P.; Vieira Neto, Leonardo; Vaisman, Mario, E-mail: dmomesso@terra.com.br [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro, RJ, (Brazil). Servico de Endocrinologia; Vaisman, Fernanda; Corbo, Rossana [Instituto Nacional do Cancer (INCA), Rio de Janeiro, RJ (Brazil). Servico de Endocrinologia; Martins, Rosangela Aparecida Gomes [Hospital Universitario Clementino Fraga Filho (HUCFF), Rio de Janeiro, RJ (Brazil). Divisao de Pesquisa

    2016-02-15

    Objective: Much controversy relates to the risk of non-synchronous second primary malignancies (NSSPM) after radioactive iodine treatment (RAI-131) in differentiated thyroid cancer (DTC) patients. This study evaluated the relationship between RAI-131 and NSSPM in DTC survivors with long-term follow-up. Materials and methods: Retrospective analysis of 413 DTC cases was performed; 252 received RAI-131 and 161 were treated with thyroidectomy alone. Exclusion criteria were: prior or synchronous non-thyroidal malignancies (within the first year), familial syndromes associated to multiple neoplasms, ionizing radiation exposure or second tumors with unknown histopathology. Results: During a mean follow-up of 11.0 ± 7.5 years, 17 (4.1%) patients developed solid NSSPM. Patients with NSSPM were older than those without (p = 0.02). RAI-131 and I-131 cumulative activity were similar in patients with and without NSSPM (p = 0.18 and p = 0.78, respectively). Incidence of NSSPM was 5.2% in patients with RAI-131 treatment and 2.5% in those without RAI-131 (p = 0.18). Using multivariate analysis, RAI-131 was not significantly associated with NSSPM occurrence (p = 0.35); age was the only independent predictor (p = 0.04). Under log rank statistical analysis, after 10 years of follow-up, it was observed a tendency of lower NSSPM-free survival among patients that received RAI-131 treatment (0.96 vs. 0.87; p = 0.06), what was not affected by age at DTC diagnosis. Conclusion: In our cohort of DTC survivors, with a long-term follow-up period, RAI-131 treatment and I-131 cumulative dose were not significantly associated with NSSPM occurrence. A tendency of premature NSSPM occurrence among patients treated with RAI-131 was observed, suggesting an anticipating oncogenic effect by interaction with other risk factors. (author)

  5. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  6. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  7. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  8. Modelling the epidemiology of Escherichia coli ST131 and the impact of interventions on the community and healthcare centres.

    Science.gov (United States)

    Talaminos, A; López-Cerero, L; Calvillo, J; Pascual, A; Roa, L M; Rodríguez-Baño, J

    2016-07-01

    ST131 Escherichia coli is an emergent clonal group that has achieved successful worldwide spread through a combination of virulence and antimicrobial resistance. Our aim was to develop a mathematical model, based on current knowledge of the epidemiology of ESBL-producing and non-ESBL-producing ST131 E. coli, to provide a framework enabling a better understanding of its spread within the community, in hospitals and long-term care facilities, and the potential impact of specific interventions on the rates of infection. A model belonging to the SEIS (Susceptible-Exposed-Infected-Susceptible) class of compartmental models, with specific modifications, was developed. Quantification of the model is based on the law of mass preservation, which helps determine the relationships between flows of individuals and different compartments. Quantification is deterministic or probabilistic depending on subpopulation size. The assumptions for the model are based on several developed epidemiological studies. Based on the assumptions of the model, an intervention capable of sustaining a 25% reduction in person-to-person transmission shows a significant reduction in the rate of infections caused by ST131; the impact is higher for non-ESBL-producing ST131 isolates than for ESBL producers. On the other hand, an isolated intervention reducing exposure to antimicrobial agents has much more limited impact on the rate of ST131 infection. Our results suggest that interventions achieving a continuous reduction in the transmission of ST131 in households, nursing homes and hospitals offer the best chance of reducing the burden of the infections caused by these isolates.

  9. Meta[{sup 131}I]iodobenzylguanidine therapy for patients with metastatic and unresectable pheochromocytoma and paraganglioma

    Energy Technology Data Exchange (ETDEWEB)

    Goldsby, Robert E. [Division of Pediatric Oncology, Department of Pediatrics, University of California, San Francisco, CA 94143-0106 (United States); Fitzgerald, Paul A. [Division of Endocrinology, Department of Medicine, University of California, San Francisco, CA 94143-1222 (United States)], E-mail: paul.fitzgerald@ucsf.edu

    2008-08-15

    Introduction: Pheochromocytomas (PHEOs) and paragangliomas (PGLs) are tumors that can exhibit a malignant behavior. Targeted radiotherapy with {sup 131}I-metaiodobenzylguanidine ({sup 131}I-MIBG) has proven useful in patients with unresectable, metastatic and/or relapsed disease. Methods: We review the literature and our experience at UCSF to highlight important characteristics of PHEO/PGL and the use of {sup 131}I-MIBG in the treatment of this disease. Results: These tumors are rare, with a diagnosed incidence of only two to four cases per million annually; 40% are discovered at autopsy. Clinical manifestations are caused by excess secretion of catecholamines, although some PGLs are nonsecretory. Approximately 25% of patients with PHEO/PGLs have an underlying genetic predisposition. The risk of a germline mutation is higher in children. Diagnostic evaluation should include serial determinations of fractionated metanephrines and serum chromogranin A. Staging requires both {sup 123}I-MIBG and full-body magnetic resonance imaging or {sup 18}FDG-PET scanning. The primary treatment for PHEO/PGL is resection. Patients may be candidates for treatment with {sup 131}I-MIBG if they have unresectable or metastatic tumors that are avid for MIBG. Such patients usually respond to this targeted radioisotope therapy and many achieve a durable remission. Myelosuppression is a dose-related side effect that can be treated with transfusions or autologous hematopoietic stem cells. Late side effects can include infertility, myelodysplasia and second cancers. Conclusions: Treatment with {sup 131}I-MIBG can be considered for patients if surgery is not feasible. There are significant risks associated with this treatment, but the majority of patients will respond. Treatment with {sup 131}I-MIBG should be done at institutions with experience in delivering targeted radiotherapeutics.

  10. False-positive 131I whole-body scan in well-differentiated thyroid cancer patient with respiratory bronchiolitis.

    Science.gov (United States)

    Thientunyakit, Tanyaluck

    2013-09-01

    (131)I whole-body scan is performed during treatment and follow-up after radioiodine treatment to detect functioning thyroid remnant and metastatic lesions in differentiated thyroid carcinoma (DTC). False-positive scans are rare, but may cause a potential pitfall by misleading to unnecessary radiation exposure from inappropriate radioiodine treatment. We report a case of papillary thyroid cancer patient with false-positive (131)I scan in the lung due to pulmonary bronchiolitis. Clinical correlation and imaging characteristics obtained from additional SPECT/CT images are very helpful to indicate this lesion as a benign condition.

  11. Scientific Opinion on the re-evaluation of Patent Blue V (E 131) as a food additive

    OpenAIRE

    EFSA Panel on Food Additives and Nutrient Sources added to Food (ANS)

    2013-01-01

    The Panel on Food Additives and Nutrient Sources added to Food provides a scientific opinion re-evaluating the safety of Patent Blue V (E 131). Patent Blue V (E 131) is a triarylmethane dye permitted for use as a food additive in the EU, that has been previously evaluated by JECFA in 1970 and 1975 and the EU SCF in 1983; JECFA established a Temporary Acceptable Daily Intake (ADI) of 0-1 mg/kg bw/day in 1970, but withdrew it in 1975. Until now JECFA has not allocated an ADI to Patent Blue V (E...

  12. The Assessment of I-131 Internal Doses of Nuclear Medicine Workers in Korea Using Thyroid uptake system

    Energy Technology Data Exchange (ETDEWEB)

    Bahn, Young Kag; Oh, Gi Back; Lee, Chang Ho; Lee, Jong Doo [Yonsei University Health System, Seoul (Korea, Republic of); Yeom, Yu Sun; Hwang, Young Muk [Korea Radioisotope Association, Seoul (Korea, Republic of)

    2012-05-15

    There are possibilities the radiation workers could intake the radiation when workers deal with radiation-materials. Therefore, internal radiation doses of radiation workers need to be assessed. Although an application of the nuclear medicine is continuously increased in Korea, there is not a proper tool and form to monitor the internal doses of nuclear medicine workers. However, it is possible to attain the internal doses of I-131 to evaluate using thyroid uptake and well count system. In this study, we measured and evaluated the I-131 internal doses of nuclear medicine workers in Korea using thyroid uptake and well count system and performed an air sampling

  13. Increasing incidence of hypothyroidism within one year after radioiodine therapy for toxic diffuse goiter. [/sup 131/I

    Energy Technology Data Exchange (ETDEWEB)

    Von Hofe, S.E.; Dorfman, S.G.; Carrette, R.F.; Young, R.L.

    1978-02-01

    Patients treated with 10 mCi of I-131 for toxic diffuse goiter in the period January 1974--June 1976 were evaluated for development of hypothyroidism. Fifty percent were hypothyroid within 3 months and 69 percent within 1 year of treatment. Our data suggest that there is a higher incidence of hypothyroidism after standard doses of I-131 in the 1970s as contrasted with treatment groups in the 1950s and 1960s. The pathophysiology of this increased incidence is not known with certainty; however, infrequent use of thionamide medication, together with recent increases in dietary iodine, may render the gland more radiosensitive.

  14. Nuclear factor-kappa B inhibition can enhance apoptosis of differentiated thyroid cancer cells induced by 131I.

    Directory of Open Access Journals (Sweden)

    Zhaowei Meng

    Full Text Available OBJECTIVE: To evaluate changes of nuclear factor-kappa B (NF-κB during radioiodine 131 ((131I therapy and whether NF-κB inhibition could enhance (131I-induced apoptosis in differentiated thyroid cancer (DTC cells in a synergistic manner. METHODS: Three human DTC cell lines were used. NF-κB inhibition was achieved by using a NF-κB inhibitor (Bay 11-7082 or by p65 siRNA transfection. Methyl-thiazolyl-tetrazolium assay was performed for cell viability assessment. DNA-binding assay, luciferase reporter assay, and Western blot were adopted to determine function and expression changes of NF-κB. Then NF-κB regulated anti-apoptotic factors XIAP, cIAP1, and Bcl-xL were measured. Apoptosis was analyzed by Western blot for caspase 3 and PARP, and by flow cytometry as well. An iodide uptake assay was performed to determine whether NF-κB inhibition could influence radioactive iodide uptake. RESULTS: The methyl-thiazolyl-tetrazolium assay showed significant decrease of viable cells by combination therapy than by mono-therapies. The DNA-binding assay and luciferase reporter assay showed enhanced NF-κB function and reporter gene activities due to (131I, yet significant suppression was achieved by NF-κB inhibition. Western blot proved (131I could increase nuclear NF-κB concentration, while NF-κB inhibition reduced NF-κB concentration. Western blot also demonstrated significant up-regulation of XIAP, cIAP1, and Bcl-xL after (131I therapy. And inhibition of NF-κB could significantly down-regulate these factors. Finally, synergism induced by combined therapy was displayed by significant enhancements of cleaved caspase 3 and PARP from Western blot, and of Annexin V positively staining from flow cytometry. The iodine uptake assay did not show significant changes when NF-κB was inhibited. CONCLUSION: We demonstrated that (131I could induce NF-κB activation, which would attenuate (131I efficacy in DTC cells. NF-κB inhibition by Bay 11-7082 or by p65 si

  15. Preparation of {sup 123}l and {sup 131}l mlBG by ascorbate reduction: A faster, safer method.

    Energy Technology Data Exchange (ETDEWEB)

    Baker, R.J. [Prince of Wales Hospital, Randwick, NSW, (Australia). Department of Nuclear Medicine

    1997-09-01

    Full text: Meta-iodobenzylguanidine labelled with {sup 123}l or {sup 131}l has been prepared in a number of hospital radiopharmacies by the method of van Dormalen and Janssen (Method 1), which uses a copper catalysed exchange reaction accomplished by heating at 140 degree C in a heavy walled glass vial. The product is purified by passage through a small anion exchange column to remove unreacted iodine. More recently, the method of Rossouw (Method 2) has become available which utilizes ascorbic acid and copper (II) ions to effect the iodination at 100 deg C. Since the latter method has a number of potential advantages, the object of this work was to compare the results obtained from each method under conditions of routine preparation. Analysis of preparations using Method 1 gave the following results: {sup 131}l, yield 89.3 {+-} 10.4% (n = 54); {sup 123}l, yield 85.5 {+-} 10.6% (n = 5). The radiochemical purity was determined by both chromatography on Whatman No.1 / butanol, acetic acid, water (60:15:25) and cellulose acetate electrophoresis with the following results (mean values from both techniques): {sup 131}l-mlBG 99.8 {+-} 0.1%;{sup 131}l- iodine 0.2 {+-} -0.1%. For {sup 123}l, {sup 123}l-mlBG 99.2 {+-} 0.2%; {sup 123}l-iodine 0.6 {+-} 0.2%. When prepared by Method 2, the results were: {sup 131}I, yield 86.0 {+-} 9.8% (n = 5); {sup 123}l, yield 97.0 {+-} 5.0% (n = 6). Radiochemical analyses were as follows: {sup 131}l-mlBG 98.9 {+-} 0.1%;{sup 131}l-iodine 1.0 {+-} 0.2%. For {sup 123}l, {sup 123}l-mlBG 97.8 {+-} 0.7%; {sup 123}l-iodine 2.1 {+-} 0.6%. It is concluded that although Method 2 resulted in products of slightly lower purity, the small increase in free iodide for both radionuclides can be tolerated in view of the routine use of thyroid blockade with Lugol`s solution. This method is much preferred as it removes the risk of explosion during the heating step. It is also considerably faster and reduces the chance of spillage as there is no need for passage

  16. Fetal radiation dose estimates for I-131 sodium iodide in cases where conception occurs after administration

    Energy Technology Data Exchange (ETDEWEB)

    Sparks, R.B.; Stabin, M.G. [Oak Ridge Inst. for Science and Education, TN (United States)

    1999-01-01

    After administration of I-131 to the female patient, the possibility of radiation exposure of the embryo/fetus exists if the patient becomes pregnant while radioiodine remains in the body. Fetal radiation dose estimates for such cases were calculated. Doses were calculated for various maternal thyroid uptakes and time intervals between administration and conception, including euthyroid and hyperthyroid cases. The maximum fetal dose calculating was about 9.8E-03 mGy/MBq, which occurred with 100% maternal thyroid uptake and a 1 week interval between administration and conception. Placental crossover of the small amount of radioiodine remaining 90 days after conception was also considered. Such crossover could result in an additional fetal dose of 9.8E-05 mGy/MBq and a maximum fetal thyroid self dose of 3.5E-04 mGy/MBq.

  17. Labeling of the Recombinant Streptokinase Using Iodine-131 as a New Thrombolytic Agent

    Directory of Open Access Journals (Sweden)

    I. Daruwati

    2012-12-01

    Full Text Available Stroke and acute myocardial infarction is a disease with the highest mortality in the world. WHO has estimated in 2008, 30% of deaths from heart disease and more than 80% of this cases have been occurred in developing countries. Streptokinase (SK as an effective thrombolytic agent has been used as a drug of choice for about forty years ago. SK is plasminogen (PG activator that converts plasminogen to active protease, called plasmin (PN which degrades fibrin to soluble products. Recombinant streptokinase (SKA from genetic engineering has been developed at School of Pharmacy ITB to reduce or eliminate immunogenicity of SK. However, scientific disclosures relating to dynamic and its kinetic studies in the body have still to be proven. One method that can explain this phenomenon is the pharmacological studies using radionuclide labeled compounds. Radioiodine labeled compound is used extensively and most suitable for biological studies. This paper describes the preparation of 131I-SKA and its characterization. The labeling conditions of SKA, such as chloramine-T as an oxidizing agent, amount of SKA, incubation time, and size of resin to purify the labeling yield have been observed. The result showed that the optimum condition of labeling (35.11% was obtained using 10 µg of chloramine-T and 60 seconds of incubation time. The highest radiochemical purity (97.46 ± 1.14% has also been obtained by passing through the resin chromatography column using 100 mg Dowex 1x8, size 50-100 mesh. The characterization of 131I-SKA with SDS PAGE method and autoradiography showed the similar performance with unlabeled-SKA

  18. Laboratory evaluation of interception and translocation of {sup 131}I in fenugreek and Okra plants

    Energy Technology Data Exchange (ETDEWEB)

    Singhal, R.K.; Narayanan, U.; Bhat, I.S. [Bhabha Atomic Research Centre, Trombay (India)

    1994-11-01

    The work reported here deals with the study of interception and translocation of airborne {sup 131}I in fenugreek (Trigonella foenum-graecum) and okra (Hibiscus esculentus), two very common vegetables in India. Activity was injected into the experimental chamber in the form of iodide aerosols having a size distribution of 0.3 to 5.0 {mu}m (AMAD). Samples of plants were collected over a period of a few days at different time intervals after injection of the aerosols. Evaluation of interception with deposition and translocation of {sup 131}I was done from the activity measured in air and in plant parts. For the deposition factor, the values are 1.22 m{sup 3} kg{sup -1} for fenugreek leaves, and 1.49 m{sup 3} kg{sup -1} for the plant as a whole. For okra plants these values are 0.02 and 0.16 m{sup 3} kg{sup -1} in edible okra and leaves, respectively. For the okra plant as a whole, the value is 0.19 m{sup 3} kg{sup -1}. The translocation factors vary from 0.62 to 0.86 and 0.47 to 0.87 for leaves and stem, respectively, in the case of fenugreek plants. For okra plants, the translocation factor varies from 0.21 to 0.82, 0.53 to 0.93, and 0.42 to 0.81 in edible okra, leaves, and stems, respectively. 13 refs., 6 figs., 2 tabs.

  19. Whole body dosimetry for treatment individualized neuroblastoma with {sup 1}31I-MIBG; Dosimetria de cuerpo entero para el tratamiento individualizado del neuroblastoma con {sup 1}31I-MIBG

    Energy Technology Data Exchange (ETDEWEB)

    Ferrer Gracia, C.; Luquero Llopis, N.; Sanchez Munoz, F.; Plaza Aparicio, R.; Huerga Cabrerizo, C.; Corredoira Silva, E.; Serrada Hierro, A.

    2013-07-01

    It according to in this study, that in therapy with {sup 1}31I-MIBG for the treatment of neuroblastoma, it can prescribe and manage dose whole body accurately, allowing individualized treatments and major activities that in the treatments based on a fixed activity according to weight management. (Author)

  20. The {sup 131}I cytogenetic effect preceded by the REC-HTSH administration in Wistar rats; Efeito citogenetico do {sup 131}I precedido por administracao de Rec-hTSH em ratos Wistar

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Marcia Augusta da [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)]|[Centro Universitario Sao Camilo, Sao Paulo, SP (Brazil); Ribela, Maria Teresa Carvalho Pinto; Suzuki, Miriam Fussae; Bartolini, Paolo; Okazaki, Kayo [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)]. E-mail: kokazaki@ipen.br; Guimaraes, Maria Ines Calil Cury; Buchpiguel, Carlos Alberto [Sao Paulo Univ., SP (Brazil). Centro de Medicina Nuclear]. E-mail: maria.ins@hcnet.usp.br

    2005-07-01

    In nuclear medicine, the {sup 131}I is one of the most used radionuclides in thyroid disorders, for both diagnostic and therapeutic purposes. The target of the present study was to analyze the cytogenetic effects of the {sup 131}I, precede by stimulus with rec-hTSH, produced at IPEN/CNEN-SP, in an animal model by means of the chromosome aberration technique. The rec-hTSH is a glycoprotein administered in patients submitted to thyroidectomy as an alternative to the suspension of the hormone therapy for increasing the TSH level and, consequently, the {sup 131}I collection by the metastatic tissue, thus maintaining the euthyroid state. For this aim, Wistar rats were used (SPF, females, 200 g heavy), divided in 2 groups: animals treated only with {sup 131}I (G1) (11.1 MBq gastric gavage) and animals submitted to rec-hTSH-IPEN (1.2 {mu}g by intramuscular injection), 24 hours before the {sup 131}I (G2) administration. The blood samples were collected before (basal), 24 hours, 1 week and 1 month after the treatment, for cytogenetic evaluation. The cytogenetic data obtained showed an increase un the frequency of cells with chromosome aberration as well as the number of chromosome/cell aberrations, 24 hours after the {sup 131}I administration, when compared with the basal values, both for animals in group G1 and for in group G2. After 7 and 30 days of the radioiodine administration, a slight fall in the frequency of the chromosome aberrations was verified. The animals pre-treated with rec-hTSH-IPEN showed higher percentage of cells with chromosome aberration and chromosome/cell aberrations than the animals of group G1, in both de 24 hour-after administration of {sup 131}I samples and 7 day-sample, although the difference is not statistically significant (p>0,05). The results obtained allow the extrapolation for humans, in the more accurate evaluation of the biological risks involved by people exposed to the radioiodine, and also for the optimizations of a therapeutic

  1. Extraintestinal Pathogenic and Antimicrobial-Resistant Escherichia coli, Including Sequence Type 131 (ST131), from Retail Chicken Breasts in the United States in 2013.

    Science.gov (United States)

    Johnson, James R; Porter, Stephen B; Johnston, Brian; Thuras, Paul; Clock, Sarah; Crupain, Michael; Rangan, Urvashi

    2017-03-15

    Chicken meat products are hypothesized to be vehicles for transmitting antimicrobial-resistant and extraintestinal pathogenic Escherichia coli (ExPEC) to consumers. To reassess this hypothesis in the current era of heightened concerns about antimicrobial use in food animals, we analyzed 175 chicken-source E. coli isolates from a 2013 Consumer Reports national survey. Isolates were screened by PCR for ExPEC-defining virulence genes. The 25 ExPEC isolates (12% of 175) and a 2:1 randomly selected set of 50 non-ExPEC isolates were assessed for their phylogenetic/clonal backgrounds and virulence genotypes for comparison with their resistance profiles and the claims on the retail packaging label ("organic," "no antibiotics," and "natural"). Compared with the findings for non-ExPEC isolates, the group of ExPEC isolates had a higher prevalence of phylogroup B2 isolates (44% versus 4%; P Organic labeling predicted lower resistance scores (median, 2 [range, 0 to 3] versus 4 [range, 0 to 10]; P = 0.008) but no difference in ExPEC status or virulence scores. These findings document a persisting reservoir of extensively antimicrobial-resistant ExPEC isolates, including isolates from ST131, in retail chicken products in the United States, suggesting a potential public health threat. IMPORTANCE We found that among Escherichia coli isolates from retail chicken meat products purchased across the United States in 2013 (many of these isolates being extensively antibiotic resistant), a minority had genetic profiles suggesting an ability to cause extraintestinal infections in humans, such as urinary tract infection, implying a risk of foodborne disease. Although isolates from products labeled "organic" were less extensively antibiotic resistant than other isolates, they did not appear to be less virulent. These findings suggest that retail chicken products in the United States, even if they are labeled "organic," pose a potential health threat to consumers because they are contaminated

  2. Procedure guideline for radioiodine therapy and {sup 131}iodine whole-body scintigraphy in paediatric patients with differentiated thyroid cancer; Verfahrensanweisung zur Radioiodtherapie und {sup 131}I-Ganzkoerperszintigraphie bei differenzierten Schilddruesenkarzinomen im Kindes- und Jugendalter

    Energy Technology Data Exchange (ETDEWEB)

    Franzius, C.; Schober, O. [Muenster Univ. (Germany). Klinik und Poliklinik fuer Nuklearmedizin; Dietlein, M. [Koeln Univ. (Germany). Klinik und Poliklinik fuer Nuklearmedizin; Biermann, M. [Haukeland University Hospital, Bergen (Norway). Nuclear Medicine and PET-Center; Bergen Univ. (Norway). Dept. of Surgical Sciences; Fruehwald, M.; Linden, T. [Universitaetsklinikum Muenster (Germany). Klinik und Poliklinik fuer Kinderheilkunde; Bucsky, P. [Luebeck Univ. (Germany). Haematologie, Onkologie und Immunologie der Klinik fuer Kinder- und Jugendmedizin; Reiners, C. [Wuerzburg Univ. (Germany). Klinik und Poliklinik fuer Nuklearmedizin

    2007-07-01

    The procedure guideline for radioiodine ({sup 131}I) therapy and {sup 131}I whole-body scintigraphy of differentiated thyroid cancer in paediatric patients is the counterpart to the procedure guidelines (version 3) for adult patients and specify the interdisciplinary guideline for thyroid cancer of the Deutsche Krebsgesellschaft concerning the nuclear medicine part. Characteristics of thyroid cancer in children are the higher aggressiveness of papillary thyroid cancer, the higher frequency of extrathyroidal extension and of disseminated pulmonary metastases as well as the high risk of local recurrences. Radioiodine therapy is generally recommended in children, the {sup 131}I activity depends on the children's body weight. Radioiodine ablation in children with small papillary cancer ({<=}1 cm) should be considered. TSH stimulation is reached two weeks (children) or three weeks (adolescents) after withdrawal of thyroid hormones. Anti-emetic drugs are highly recommended. CT of the chest and examination of pulmonary function are clearly indicated if there is any suspicion on metastases. 3-6 months after {sup 131}I ablation, the {sup 131}I whole-body scintigraphy is highly recommended as lymph node metastases are frequently detected in paediatric patients. Follow-up care should be arranged in shorter intervals than in adults to test the compliance and to adapt dosage of thyroid hormones to the children's body weight. Reference values of fT3 are higher in children than in adults. Evidence is insufficient to describe in which constellation the TSH may be kept within the low normal level. Therefore, TSH suppression is generally recommended. (orig.)

  3. Evaluation of internal occupational exposure of workers from nuclear medicine services by aerosol analysis containing {sup 131}I; Avaliacao da exposicao interna de trabalhadores em servicos de medicina nuclear atraves da analise de aerossois contendo {sup 131}I

    Energy Technology Data Exchange (ETDEWEB)

    Carneiro, Luana Gomes; Sampaio, Camilla da Silva; Dantas, Ana Leticia Almeida; Lucena, Eder Augusto; Santos, Maristela Souza; Dantas, Bernardo Maranhao, E-mail: carneiro@ird.gov.br [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ),Rio de Janeiro, RJ (Brazil); Paula, Gustavo Affonso de [Escola SESC de Ensino Medio, Rio de Janeiro, RJ (Brazil)

    2014-07-01

    This study evaluated the risk of internal occupational exposure associated with the incorporation of {sup 131}I via inhalation, in Nuclear Medicine Services, using aerosol analysis techniques. Occupationally Exposed Individuals (IOE) involved in handling this radionuclide are subject to chronic exposure, which can lead to an increase in the committed effective dose. Results obtained in preliminary studies indicate the occurrence of incorporation of {sup 131}I by workers involved in handling solutions for radioiodine therapy procedures. The evaluation was carried out in radiopharmacy lab (nuclear medicine service) of a public hospital located in the city of Rio de Janeiro. After confirmed the presence of the radioisotope, by a qualitative assessment, it was determined an experimental arrangement for sample collection and were detected and quantitated the presence of steam {sup 131}I during routine work. The average concentration of activity obtained in this study was 3 Bq / m{sup 3}. This value is below of Derived Concentration in Air (DCA) of 8.4 x 10{sup 3} Bq of {sup 131}I / m{sup 3} corresponding to a committed effective dose of 1.76 x 10{sup -4} mSv. These results demonstrate that the studied area is safe in terms of internal exposure of workers. However, the presence of {sup 131}I should be periodically reevaluated, since this type of exposure contributes to the increase of the individual effective doses. Based on the data obtained improvements were suggested in the exhaust system and the use of good work practices in order to optimize the exposures.

  4. Equipment and obtention process of {sup 131}I by dry distillation starting from TeO{sub 2}; Equipo y proceso de obtencion de {sup 131}I por destilacion seca a partir de TeO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Alanis M, J. [ININ, Departamento de Materiales Radiactivos, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2000-08-15

    The present invention refers to an equipment and process for the obtaining of {sup 131}I by dry distillation starting from TeO{sub 2} that has three interconnected systems, the manipulation system, the electric system and the distillation system, the combination of these systems, allows to improve the yield and the separation of the {sup 131}I during the distillation process, since inside the electric system it is an oven that has a special design based on a temperature gradient. The more relevant aspects of the equipment its are the design of each one of its components that give as result the effectiveness of the production of {sup 131}I in routinary form (industrial) whose final product can end up reaching a radiochemical purity up to 99% and a radionuclide purity of approximately 100%. The object of this invention is to provide a distillation equipment different to those that at the moment exist, thanks to its novel internal construction whose main characteristics already gather advantages on those existent. The reaction of obtaining of the TeO{sub 2}, the development of the technique and studies of TeO{sub 2} sintering and the irradiation experiments, its contributed to characterize with more precision the 'new process of obtaining of {sup 131}I by dry via starting from the Te' developed in the ININ, and in this way it was achieved a more pure product, more economic, with less risks, from a point of view of Radiological Safety and mainly that it avoids the import to the country and it makes to self-sufficient Mexico in the production of {sup 131}I. (Author)

  5. Water to atmosphere fluxes of {sup 131}I in relation with alkyl-iodide compounds from the Seine Estuary (France)

    Energy Technology Data Exchange (ETDEWEB)

    Connan, Olivier [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)], E-mail: olivier.connan@irsn.fr; Tessier, Emmanuel [Laboratoire de Chimie Analytique et Bio-Inorganique et Environnement, UMR CNRS universite de Pau et des Pays de l' Adour, Helioparc Pau Pyrenees, 2 Avenue Pierre Angot, 64053 Pau Cedex 9 (France); Maro, Denis [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France); Amouroux, David [Laboratoire de Chimie Analytique et Bio-Inorganique et Environnement, UMR CNRS universite de Pau et des Pays de l' Adour, Helioparc Pau Pyrenees, 2 Avenue Pierre Angot, 64053 Pau Cedex 9 (France); Hebert, Didier; Rozet, Marianne; Voiseux, Claire; Solier, Luc [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)

    2008-07-15

    This study presents an original work on measurements of stable and radioactive iodinated species in the Seine estuary (France), with estimates fluxes of volatile gaseous species from water to the atmosphere. Various iodinated compounds were identified in water and air in particular {sup 131}I in water, what is unusual. Concentrations and behaviour of iodinated elements in the Seine estuary seem similar to what has been observed in other European estuaries. MeI (Methyl Iodide) and Total Volatile Iodine (TVI) fluxes from water to air vary between 392 and 13949 pmol m{sup -2} d{sup -1} and between 1279 and 16484 pmol m{sup -2} d{sup -1}, respectively. Water to air flux of TVI for the Seine river was estimated in the range 4-46 kg y{sup -1}. Measurements of {sup 131}I in water varying between 0.4 and 11.9 Bq m{sup -3}. Fluxes of {sup 131}I from water to atmosphere are in the range 2.4 x 10{sup 5}-1.3 x 10{sup 7} Bq y{sup -1}, close to an annual discharge of {sup 131}I by a nuclear reactor.

  6. Accounting of 131l decomposition under retrospective assessment of its deposition on the basis of determination of 129l deposition

    Directory of Open Access Journals (Sweden)

    Gavrilin Yu.l.

    2013-12-01

    given article aimed a justification of approaches to account of radioactive decay of 131l in the course of determination of its ground deposition density on the basis of determination of the ground deposition density of 129l at the late stage after the accident.

  7. Uncertainty and sensitivity analysis of historical vegetation iodine-131 for measurements in 1945--1947; Hanford Environmental Dose Reconstruction Project

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, R.O.; Mart, E.I.; Strenge, D.L.; Miley, T.B.

    1994-03-01

    The Hanford Environmental Dose Reconstruction (HEDR) Project is developing environmental transport and dose models to estimate the doses to individuals and populations from exposure to radionuclides released from Hanford nuclear facilities since 1944. The validity of these models will be assessed in part by comparing model predictions with environmental measurements of radionuclides. One potentially important set of environmental radionuclide measurements is those made on vegetation samples that, beginning in 1945, were collected on and around the Hanford Site. However, from October 1945 through mid-1948, the available technology permitted the vegetation samples to be measured only for total radioactivity rather than for specific radionuclides. At that time, the factors needed to convert total radioactivities to concentrations ({mu}Ci/kg) of iodine-131, the predominant radionuclide that was released into the air from Hanford stacks in the mid-1940s, were not well known or accurately quantified. A search of historical Hanford records by HEDR Project staff uncovered the original background-corrected radiation measurements, made using a Geiger-Mueller (GM) detector system, for vegetation samples that were collected from October 1945 through early August 1946. HEDR Project staff have developed a model that can be used to convert these radiation measurements to iodine-131 concentrations ({mu}Ci/kg). It is anticipated that this equation will be used to obtain more accurate concentrations of iodine-131 for vegetation for the purpose of validating vegetation iodine-131 concentrations that will be estimated by HEDR Project air-pathway transport models.

  8. A double-voiced reading of Romans 13:1–7 in light of the imperial cult

    African Journals Online (AJOL)

    Drawing on Mikhail Bakhtin's theory of double-voicedness and James Scott's theory of public and hidden transcripts, this essay investigates the colonial context of Romans 13:1–7 with particular attention to the Roman imperial cult. It is my contention that Paul attempts to persuade the audience to resist the imperial cult, ...

  9. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258 : a systematic review and meta-analysis

    NARCIS (Netherlands)

    Dautzenberg, M J D; Haverkate, M R; Bonten, M J M; Bootsma, M C J

    2016-01-01

    OBJECTIVES: Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient

  10. Evaluation of Radioactivity in the Bladder after Injection of 131I Hippurate into Lateral Ventricles of Hydrocephalic Patients

    NARCIS (Netherlands)

    DIJKSTRA, J.; H.W.M. Baars (Hennie)

    1972-01-01

    textabstractThis correlative study sought an explanation for the appearance in the bladder of 131I hippurate injected into the lateral ventricle. Part of the excretion seemed to depend upon a ventricular process. High disappearance constants and early onset times were related to small ventricles,

  11. Fermi-LAT detection of renewed gamma-ray activity from the radio source PKS 2247-131

    Science.gov (United States)

    Angioni, R.; Buson, S.

    2018-01-01

    The Large Area Telescope (LAT), one of two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray emission from a source positionally consistent with the radio source PKS 2247-131, with coordinates RA=342.4983854 deg, Dec=-12.8546736 deg (J2000; Beasley et al. 2002, ApJS, 141, 13), and no measured redshift.

  12. Epidemic potential of Escherichia coli ST131 and Klebsiella pneumoniae ST258 : A systematic review and meta-analysis

    NARCIS (Netherlands)

    Dautzenberg, M. J D|info:eu-repo/dai/nl/357298969; Haverkate, M. R.; Bonten, M. J M|info:eu-repo/dai/nl/123144337; Bootsma, M. C J|info:eu-repo/dai/nl/304830305

    2016-01-01

    Objectives: Observational studies have suggested that Escherichia coli sequence type (ST) 131 and Klebsiella pneumoniae ST258 have hyperendemic properties. This would be obvious from continuously high incidence and/or prevalence of carriage or infection with these bacteria in specific patient

  13. 10 CFR 35.392 - Training for the oral administration of sodium iodide I-131 requiring a written directive in...

    Science.gov (United States)

    2010-01-01

    ... classroom and laboratory training, applicable to the medical use of sodium iodide I-131 for procedures...) Chemistry of byproduct material for medical use; and (v) Radiation biology; and (2) Has work experience... millicuries). 35.392 Section 35.392 Energy NUCLEAR REGULATORY COMMISSION MEDICAL USE OF BYPRODUCT MATERIAL...

  14. Association of FcγRIIa R131H polymorphism with idiopathic pulmonary fibrosis severity and progression

    Directory of Open Access Journals (Sweden)

    Hirani Nikhil

    2010-10-01

    Full Text Available Abstract Background A significant genetic component has been described for idiopathic pulmonary fibrosis (IPF. The R131H (rs1801274 polymorphism of the IgG receptor FcγRIIa determines receptor affinity for IgG subclasses and is associated with several chronic inflammatory diseases. We investigated whether this polymorphism is associated with IPF susceptibility or progression. Methods In a case-control study, we compared the distribution of FcγRIIa R131H genotypes in 142 patients with IPF and in 218 controls using allele-specific PCR amplification. Results No differences in the frequency of FcγRIIa genotypes were evident between IPF patients and control subjects. However, significantly impaired pulmonary function at diagnosis was observed in HH compared to RR homozygotes, with evidence of more severe restriction (reduced forced vital capacity (FVC and lower diffusing capacity for carbon monoxide (DLCO. Similarly, increased frequency of the H131 allele was observed in patients with severe disease (DLCO 10% drop in FVC and/or > 15% fall in DLCO at 12 months after baseline (0.48 vs. 0.33; p = 0.023. Conclusions These findings support an association between the FcγRIIa R131H polymorphism and IPF severity and progression, supporting the involvement of immunological mechanisms in IPF pathogenesis.

  15. 25 CFR 900.131 - What role does the Secretary play during the performance of a self-determination construction...

    Science.gov (United States)

    2010-04-01

    ... CONTRACTS UNDER THE INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT Construction § 900.131 What role... produced to determine compliance with the following documents: (i) The POR, during the conduct of design... period may be extended if the Indian tribe or tribal organization agrees to the extension in writing...

  16. The Interactive Whiteboard: Uses, Benefits, and Challenges. A Survey of 11,683 Students and 1,131 Teachers

    Science.gov (United States)

    Karsenti, Thierry

    2016-01-01

    Over the past five years, the interactive whiteboard (IWB) has been massively introduced into schools across the province of Quebec, Canada. This study explores how the IWB is being used, and the associated benefits and challenges. Data on 11,683 students (from 4th year elementary to grade 12) and 1,131 teachers were collected with five…

  17. Implementation of iodine biokinetic model for interpreting I-131 contamination in breast milk after the Fukushima nuclear disaster

    Science.gov (United States)

    Tani, Kotaro; Kurihara, Osamu; Kim, Eunjoo; Yoshida, Satoshi; Sakai, Kazuo; Akashi, Makoto

    2015-07-01

    After the accident at the Fukushima Daiichi Nuclear Power Plant run by Tokyo Electric Power Company in 2011, breast milk samples obtained from volunteers living in Fukushima and neighboring prefectures were examined and small amounts of I-131 (2.2-36.3 Bq/kg) were detected in some samples. In this work, the I-131 concentrations in breast milk from nursing mothers in Ibaraki prefecture were calculated based on the iodine biokinetic model during lactation together with time-variable intake scenarios by inhalation of ambient air and ingestion of tap water, using the authors’ code. The calculated I-131 concentrations in breast milk generally agreed with those measured for the volunteers. Based on the results, thyroid equivalent doses to breast-fed infants were estimated for each place of residence of the volunteers on the assumption that these infants consumed 800 ml of breast milk every day, resulting in 10-11 mSv for Mito and Kasama cities and 1.1-1.8 mSv for Tsukuba and Moriya cities. It was suggested that breast milk consumption could be a major contributor to internal dose of breast-fed infants in areas with mild I-131 pollution; however, further studies considering personal behavior surveys would be necessary to estimate individual doses.

  18. Acute hepatitis C in Spain: a retrospective study of 131 cases Hepatitis aguda C en España: estudio retrospectivo de 131 casos

    Directory of Open Access Journals (Sweden)

    Ramón Pérez-Álvarez

    2012-01-01

    Full Text Available Background and aims: the management of acute hepatitis C (AHC is controversial. We have conducted a retrospective study to determine the epidemiological and biochemical aspects, the genotypes, the spontaneous clearance of HCV (SVC, and the treatment responses in patients with AHC. Methods: we have retrospectively collected data from 131 patients with AHC from 18 Spanish hospitals. Results: the mean age was 43 ± 16 years (17-83, 69% were symptomatic. The causes of infection were nosocomial in 40% and intravenous drug users in 20%. Eighty two percent had genotype 1. The delay from symptoms-onset to HCV-RNA confirmation was 50 ± 68 days (range, 11-350 days and to treatment (in 59% 14 ±13 weeks (range, 2-58 days. In the treated group, 80% achieved sustained virological response (SVR versus 57% SVC in untreated patients (p = 0.004. Up to 96% of those treated within the first 12 weeks had SVR versus 86% of those treated later (p = 0.04. Patients with HCV-RNA(- at week 4 resolved with or without treatment more frequently than those HCV-RNA(+ (98 versus 69%, p = 0.005. The treatment was not beneficial if HCV-RNA was undetectable at week 12. No differences in SVR were found in genotype 1 patients treated for 24 or 48 weeks. Patients with low baseline viral load achieved higher SVC and SVR. The SVC in patients with bilirubin > 5 mg/dl was 78 versus 40% in those with lower values (p = 0.004. Conclusions: the most common transmission route was nosocomial. SVR was higher in patients treated than SVC in non-treated. Early treatment (before week 12 achieved the highest response rate. SVC and SVR were more common in patients with a low baseline viral load. Undetectable HCV-RNA at week 4 was associated with high SVR and SVC rates. Jaundice was related with SVC.Introducción y objetivos: el manejo de la hepatitis aguda C (HAC es objeto de controversia. Hemos realizado un estudio prospectivo para conocer los aspectos epidemiológicos, bioquímicos, los

  19. Bayesian inverse modeling and source location of an unintended 131I release in Europe in the fall of 2011

    Directory of Open Access Journals (Sweden)

    O. Tichý

    2017-10-01

    Full Text Available In the fall of 2011, iodine-131 (131I was detected at several radionuclide monitoring stations in central Europe. After investigation, the International Atomic Energy Agency (IAEA was informed by Hungarian authorities that 131I was released from the Institute of Isotopes Ltd. in Budapest, Hungary. It was reported that a total activity of 342 GBq of 131I was emitted between 8 September and 16 November 2011. In this study, we use the ambient concentration measurements of 131I to determine the location of the release as well as its magnitude and temporal variation. As the location of the release and an estimate of the source strength became eventually known, this accident represents a realistic test case for inversion models. For our source reconstruction, we use no prior knowledge. Instead, we estimate the source location and emission variation using only the available 131I measurements. Subsequently, we use the partial information about the source term available from the Hungarian authorities for validation of our results. For the source determination, we first perform backward runs of atmospheric transport models and obtain source-receptor sensitivity (SRS matrices for each grid cell of our study domain. We use two dispersion models, FLEXPART and Hysplit, driven with meteorological analysis data from the global forecast system (GFS and from European Centre for Medium-range Weather Forecasts (ECMWF weather forecast models. Second, we use a recently developed inverse method, least-squares with adaptive prior covariance (LS-APC, to determine the 131I emissions and their temporal variation from the measurements and computed SRS matrices. For each grid cell of our simulation domain, we evaluate the probability that the release was generated in that cell using Bayesian model selection. The model selection procedure also provides information about the most suitable dispersion model for the source term reconstruction. Third, we select the most

  20. Bayesian inverse modeling and source location of an unintended 131I release in Europe in the fall of 2011

    Science.gov (United States)

    Tichý, Ondřej; Šmídl, Václav; Hofman, Radek; Šindelářová, Kateřina; Hýža, Miroslav; Stohl, Andreas

    2017-10-01

    In the fall of 2011, iodine-131 (131I) was detected at several radionuclide monitoring stations in central Europe. After investigation, the International Atomic Energy Agency (IAEA) was informed by Hungarian authorities that 131I was released from the Institute of Isotopes Ltd. in Budapest, Hungary. It was reported that a total activity of 342 GBq of 131I was emitted between 8 September and 16 November 2011. In this study, we use the ambient concentration measurements of 131I to determine the location of the release as well as its magnitude and temporal variation. As the location of the release and an estimate of the source strength became eventually known, this accident represents a realistic test case for inversion models. For our source reconstruction, we use no prior knowledge. Instead, we estimate the source location and emission variation using only the available 131I measurements. Subsequently, we use the partial information about the source term available from the Hungarian authorities for validation of our results. For the source determination, we first perform backward runs of atmospheric transport models and obtain source-receptor sensitivity (SRS) matrices for each grid cell of our study domain. We use two dispersion models, FLEXPART and Hysplit, driven with meteorological analysis data from the global forecast system (GFS) and from European Centre for Medium-range Weather Forecasts (ECMWF) weather forecast models. Second, we use a recently developed inverse method, least-squares with adaptive prior covariance (LS-APC), to determine the 131I emissions and their temporal variation from the measurements and computed SRS matrices. For each grid cell of our simulation domain, we evaluate the probability that the release was generated in that cell using Bayesian model selection. The model selection procedure also provides information about the most suitable dispersion model for the source term reconstruction. Third, we select the most probable location of

  1. Long-term efficacy of current thyroid prophylaxis and future perspectives on thyroid protection during I-131-metaiodobenzylguanidine treatment in children with neuroblastoma

    NARCIS (Netherlands)

    Clement, S. C.; van Rijn, R. R.; van Eck-Smit, B. L. F.; van Trotsenburg, A. S. P.; Caron, H. N.; Tytgat, G. A. M.; van Santen, H. M.

    2015-01-01

    Purpose Treatment with I-131-MIBG is associated with significant thyroid damage. This study was undertaken to investigate the long-term efficacy of current thyroid prophylaxis, to explore the relationship between thyroid dysfunction and thyroid volume after exposure to I-131-MIBG and to evaluate the

  2. Long-term efficacy of current thyroid prophylaxis and future perspectives on thyroid protection during I-131-metaiodobenzylguanidine treatment in children with neuroblastoma

    NARCIS (Netherlands)

    Clement, S. C.; van Rijn, R. R.; van Eck-Smit, B. L. E.; van Trotsenburg, A. S. P.; Caron, H. N.; Tytgat, G. A. M.; van Santen, H. M.|info:eu-repo/dai/nl/238668959

    Purpose Treatment with I-131-MIBG is associated with significant thyroid damage. This study was undertaken to investigate the long-term efficacy of current thyroid prophylaxis, to explore the relationship between thyroid dysfunction and thyroid volume after exposure to I-131-MIBG and to evaluate the

  3. Characterization of the extra-intestinal pathogenic Escherichia coli ST131 clone among isolates recovered from urinary and bloodstream infections in the United Kingdom.

    Science.gov (United States)

    Ciesielczuk, H; Doumith, M; Hope, R; Woodford, N; Wareham, D W

    2015-12-01

    The multidrug-resistant ST131-O25b clone of Escherichia coli is well established as a significant cause of extra-intestinal infections worldwide. However, there have been only two small regional studies comparing ST131 isolates from the UK. Therefore, we characterized 143 ST131 E. coli (38 urinary, 105 bloodstream) collected between January 2011 and March 2012 from 38 centres located across the UK and Republic of Ireland. Phenotypic and genotypic characterization of clonal isolates revealed high rates of resistance to amoxicillin-clavulanate (56 %), cefotaxime (32 %), ciprofloxacin (79 %), temocillin (69 %, bloodstream isolates only), gentamicin (67 %) and trimethoprim-sulfamethoxazole (59 %). The most frequently detected extended-spectrum beta-lactamase was CTX-M-15 (87 %), predominantly encoded on IncF plasmids, although it was also associated with IncU plasmids in two isolates. The majority of UK ST131 clonal isolates possessed the O25b antigen (97 %) and the H30 fimH allele (92 %), but three serogroups (O19a, O136 and O153) novel to ST131 were identified among our strains. Contrary to previous reports, UK ST131-O16 isolates were typically susceptible to ciprofloxacin and lacked beta-lactamase genes (n = 12/12). In summary, ST131 strains of E. coli circulating in the UK possess characteristic clonal features, but are becoming more diverse than other international ST131 populations.

  4. A pilot study: 131I-antitenascin monoclonal antibody 81c6 to deliver a 44-Gy resection cavity boost.

    Science.gov (United States)

    Reardon, David A; Zalutsky, Michael R; Akabani, Gamal; Coleman, R Edward; Friedman, Allan H; Herndon, James E; McLendon, Roger E; Pegram, Charles N; Quinn, Jennifer A; Rich, Jeremy N; Vredenburgh, James J; Desjardins, Annick; Guruangan, Sridharan; Boulton, Susan; Raynor, Renee H; Dowell, Jeanette M; Wong, Terence Z; Zhao, Xiao-Guang; Friedman, Henry S; Bigner, Darell D

    2008-04-01

    The purpose of this study was to determine the feasibility and assess the efficacy and toxicity, among newly diagnosed malignant glioma patients, of administering (131)I-labeled murine antitenascin monoclonal antibody 81C6 ((131)I-81C6) into a surgically created resection cavity (SCRC) to achieve a patient-specific, 44-Gy boost to the 2-cm SCRC margin. A radioactivity dose of (131)I-81C6 calculated to achieve a 44-Gy boost to the SCRC was administered, followed by conventional external beam radiotherapy (XRT) and chemotherapy. Twenty-one patients were enrolled in the study: 16 with glioblastoma multiforme (GBM) and 5 with anaplastic astrocytoma. Twenty patients received the targeted 44-Gy boost (+/-10%) to the SCRC. Attributable toxicity was mild and limited to reversible grade 3 neutropenia or thrombocytopenia (n = 3; 14%), CNS wound infections (n = 3; 14%), and headache (n = 2; 10%). With a median follow-up of 151 weeks, median overall survival times for all patients and those with GBM are 96.6 and 90.6 weeks, respectively; 87% of GBM patients are alive at 1 year. It is feasible to consistently achieve a 44-Gy boost dose to the SCRC margin with patient-specific dosing of (131)I-81C6. Our study regimen ((131)I-81C6 + XRT + temozolomide) was well tolerated and had encouraging survival. To determine if selection of good-prognosis patients affects outcome associated with this approach, the U.S. Food and Drug Administration has approved a trial randomizing newly diagnosed GBM patients to either our study regimen or standard XRT plus temozolomide.

  5. Furosemide- sup 131 I-hippuran renography after angiotensin-converting enzyme inhibition for the diagnosis of renovascular hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Erbsloeh-Moeller, B.Du.; Dumas, A.; Roth, D.; Sfakianakis, G.N.; Bourgoignie, J.J. (Univ. of Miami/Jackson Memorial Medical Center, FL (USA))

    1991-01-01

    We have previously demonstrated the greater sensitivity of 131I-hippuran renography than 99mTC-DTPA scintigraphy to diagnose renovascular hypertension (RVH). This study assesses the predictive diagnostic value of furosemide-131I-hippuran renography after angiotensin-converting enzyme (ACE) inhibition in patients with and without RVH. All patients were investigated at the University of Miami/Jackson Memorial Medical Center. Twenty-eight patients had RVH and 22 did not. Twenty-eight patients had normal or minimally decreased renal function and 22 had renal insufficiency. Renography was performed 60 minutes after oral administration of 50 mg captopril or 10 minutes after intravenous injection of 40 micrograms/kg enalaprilat. Forty milligrams of furosemide were administered intravenously 2 minutes after injection of 131I-hippuran. The residual cortical activity (RCA) of 131I-hippuran was measured at 20 minutes. RVH was unlikely when RCA after ACE inhibition was less than 30% of peak cortical activity. Conversely, RVH was present when 131I-hippuran cortical activity steadily increased throughout the test to reach 100% at 20 minutes. In azotemic patients with RCA between 31% and 100%, RVH was differentiated from intrinsic renal disease by obtaining a baseline renogram without ACE inhibition and comparing RCA in that study and RCA after ACE inhibition. If RCA increased (indicating worsening renal function) after ACE inhibition, RVH was likely; whereas, intrinsic renal disease was more likely if RCA remained unchanged or decreased (indicating improved renal function) with ACE inhibition. The test had a specificity of 95% and a sensitivity of 96% in this population. There was a direct correlation between the results of angioplasty or surgery on high blood pressure and the changes in RCA before and after intervention (n = 20).

  6. SU-F-T-653: Radiation Exposure from Cs-131 Permanent Seed Implants

    Energy Technology Data Exchange (ETDEWEB)

    Giaddui, T; Hardin, M; To, D; Kremmel, E; Peng, C; Hann, P; Richardson, S; Yu, Y; Harrison, A; Doyle, L [Sidney Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA (United States)

    2016-06-15

    Purpose: Permanent seed implants have traditionally been used to treat prostate, lung and head or neck cancers using I-125 and Pd-103. Cs-131, which has higher dose rate is being used to treat brain, head and/or neck cancers in our clinic, therefore, we chose to monitor the dose received by surgeons during the extensive procedure. The aims of this work are to assess the level of radiation exposure to surgeons and the instantaneous exposure at bedside and 1 m from patients. Methods: Ten patients received Cs-131 implants for recurrent brain,head and/or neck cancer; the median implanted activity, number of implanted seeds and prescription dose at 0.5 cm from the perpendicular plane of the implant were: 54.3 mCi (14.52 – 77); 19 (4 – 24) and 60 Gy (range 42 – 60) respectively. Radiation exposure was recorded at bedside and 1 m from the patient using Victoreen ion chamber (Fluke Biomedical, Cleveland, OH). Exposure to surgeons was measured using TLD (Mirion Technologies (GDS), Inc., USA). Results: The median equivalent dose rate at 1 m and bedside immediately following implantation were 1.49×10-2 mSv/h (8.77×10-3–2.63×10-2) and 7.76×10-2 mSv/h (3.1×10-2– 1.53×10-1) respectively. Median equivalent dose to surgeons’ hands was 0.60 mSv (0.33 – 1.48) and no doses were detected for whole-body. Surgical reconstruction for one patient was performed 71 days post-implant and resulted in zero exposure to surgeons. Conclusion: The recorded exposure rates were low when compared with the literature. Post procedure surveys at bed site and 1 m indicated that all patients were within safe limits for discharge (< 0.05 mSv/h at 1 m). However, as a precautionary measure, patients were advised to avoid direct contact with children and pregnant women within four weeks of the implant and stay at least at 3 ft from other people. Surgeons doses were well within occupational dose limits.

  7. Determination of the binding mode for the cyclopentapeptide CXCR4 antagonist FC131 using a dual approach of ligand modifications and receptor mutagenesis

    DEFF Research Database (Denmark)

    Thiele, Stefanie; Mungalpara, J; Steen, A

    2014-01-01

    BACKGROUND AND PURPOSE: The cyclopentapeptide FC131 (cyclo(-L-Arg(1) -L-Arg(2) -L-2-Nal(3) -Gly(4) -D-Tyr(5) -)) is an antagonist at the CXC chemokine receptor CXCR4, which plays a role in human immunodeficiency virus infection, cancer and stem cell recruitment. Binding modes for FC131 in CXCR4...... activation) of FC131 and three analogues were performed on wild-type CXCR4 and 25 receptor mutants. Computational modelling was used to rationalize the experimental data. KEY RESULTS: The Arg(2) and 2-Nal(3) side chains of FC131 interact with residues in TM-3 (His(113) , Asp(171) ) and TM-5 (hydrophobic......-bond in CXCR4 crystal structures and mutation of either residue to Ala abolishes CXCR4 activity. CONCLUSIONS AND IMPLICATIONS: Ligand modification, receptor mutagenesis and computational modelling approaches were used to identify the binding mode of FC131 in CXCR4, which was in agreement with binding modes...

  8. Extensive Household Outbreak of Urinary Tract Infection and Intestinal Colonization due to Extended-Spectrum β-Lactamase–Producing Escherichia coli Sequence Type 131

    Science.gov (United States)

    Madigan, Theresa; Johnson, James R.; Clabots, Connie; Johnston, Brian D.; Porter, Stephen B.; Slater, Billie S.; Banerjee, Ritu

    2015-01-01

    Background. Reasons for the successful global dissemination of multidrug-resistant Escherichia coli sequence type 131 (ST131) are undefined, but may include enhanced transmissibility or ability to colonize the intestine compared with other strains. Methods. We identified a household in which 2 young children had urinary tract infection (UTI) caused by an extended-spectrum β-lactamase (ESBL)–producing, multidrug-resistant ST131 E. coli strain. We assessed the prevalence of ST131 intestinal colonization among the 7 household members (6 humans, 1 dog). Fecal samples, collected 3 times over a 19-week period, were cultured selectively for E. coli. Isolates were characterized using clone-specific polymerase chain reaction to detect ST131 and its ESBL-associated H30Rx subclone, pulsed-field gel electrophoresis, extended virulence genotyping, and antimicrobial susceptibility testing. Results. In total, 8 different E. coli pulsotypes (strains) were identified. The index patient's urine isolate represented ST131-H30Rx strain 903. This was the most widely shared and persistent strain in the household, colonizing 5 individuals at each sampling. In contrast, the 7 non-ST131 strains were each found in only 1 or 2 household members at a time, with variable persistence. The ST131 strain was the only strain with both extensive virulence and antimicrobial resistance profiles. Conclusions. An ESBL-producing ST131-H30Rx strain caused UTI in 2 siblings, plus asymptomatic intestinal colonization in multiple other household members, and was the household's most extensively detected and persistent fecal E. coli strain. Efficient transmission and intestinal colonization may contribute to the epidemiologic success of the H30Rx subclone of E. coli ST131. PMID:25828998

  9. Extensive Household Outbreak of Urinary Tract Infection and Intestinal Colonization due to Extended-Spectrum β-Lactamase-Producing Escherichia coli Sequence Type 131.

    Science.gov (United States)

    Madigan, Theresa; Johnson, James R; Clabots, Connie; Johnston, Brian D; Porter, Stephen B; Slater, Billie S; Banerjee, Ritu

    2015-07-01

    Reasons for the successful global dissemination of multidrug-resistant Escherichia coli sequence type 131 (ST131) are undefined, but may include enhanced transmissibility or ability to colonize the intestine compared with other strains. We identified a household in which 2 young children had urinary tract infection (UTI) caused by an extended-spectrum β-lactamase (ESBL)-producing, multidrug-resistant ST131 E. coli strain. We assessed the prevalence of ST131 intestinal colonization among the 7 household members (6 humans, 1 dog). Fecal samples, collected 3 times over a 19-week period, were cultured selectively for E. coli. Isolates were characterized using clone-specific polymerase chain reaction to detect ST131 and its ESBL-associated H30Rx subclone, pulsed-field gel electrophoresis, extended virulence genotyping, and antimicrobial susceptibility testing. In total, 8 different E. coli pulsotypes (strains) were identified. The index patient's urine isolate represented ST131-H30Rx strain 903. This was the most widely shared and persistent strain in the household, colonizing 5 individuals at each sampling. In contrast, the 7 non-ST131 strains were each found in only 1 or 2 household members at a time, with variable persistence. The ST131 strain was the only strain with both extensive virulence and antimicrobial resistance profiles. An ESBL-producing ST131-H30Rx strain caused UTI in 2 siblings, plus asymptomatic intestinal colonization in multiple other household members, and was the household's most extensively detected and persistent fecal E. coli strain. Efficient transmission and intestinal colonization may contribute to the epidemiologic success of the H30Rx subclone of E. coli ST131. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. (131)I-trazodone: preparation, quality control and in vivo biodistribution study by intranasal and intravenous routes as a hopeful brain imaging radiopharmaceutical.

    Science.gov (United States)

    Motaleb, M A; Ibrahim, I T; Sayyed, M E; Awad, G A S

    The preparation of (131)I-trazodone hydrochloride and its biological evaluation as a promising brain imaging radiopharmaceutical using two routes of administration. Trazodone (TZ) was radiolabelled with (131)I using direct electrophilic substitution, and different factors affecting labelling yield were studied. Quality control of (131)I-TZ was carried out using ascending paper chromatography, paper electrophoresis, and high pressure liquid chromatography (HPLC). In vivo biodistribution of (131)I-TZ was evaluated in Swiss albino mice using 3 methods: intravenous (131)I-TZ solution (IVS), intranasal (131)I-TZ solution (INS), and intranasal (131)I-TZ microemulsion (INME). Optimum labelling yield of 91.23±2.12% was obtained with in vitro stability of (131)I-TZ up to 6h at room temperature. The biodistribution results showed a notably higher and sustained brain uptake for INME compared to IVS and INS at all time intervals. In addition, heart and blood uptake levels for INME were lower than those for IV solution which, in turn, could decrease the systemic side effects of trazodone. Also, the (131)I-trazodone INME brain uptake of 6.7±0.5%ID/g was higher than that of (99m)Tc-ECD and (99m)Tc-HMPAO (radiopharmaceuticals currently used for brain imaging). (131/123)I-trazodone formulated as INME could be used as a promising radiopharmaceutical for brain imaging. Copyright © 2017 Elsevier España, S.L.U. y SEMNIM. All rights reserved.

  11. A completely automatic method of processing 131I-labelled Rose Bengal dynamic liver studies.

    Science.gov (United States)

    Nijran, K S; Barber, D C

    1986-05-01

    A completely automatic method of measuring Rose Bengal uptake by the liver, expressed in terms of the half-time T1/2, is described. There is no requirement to construct time-activity curves with blood background activity correction as in the conventional regions-of-interest method. All the dixels in the image of a study are used in the actual data analysis. The method is therefore independent of operator influence. The intersection method is offered as an alternative to the manual method. The intersection method uses principal components analysis as a first step in the computation of the intersection of a theory space and a study space. A simple exponential function is used to generate the liver theory space. Sixty 131I Rose Bengal liver function studies were processed by the intersection method. The first forty minutes of patient data were used in the analysis. To validate the new method, computed T1/2 values were compared with those obtained by the manual method. A standard statistical test showed no significant difference between the two methods. Regression analysis gave a value for the coefficient of correlation of 0.89. The intersection method is currently in routine use for the automatic analysis of Rose Bengal liver studies and is faster than the manual method.

  12. Modeling of growth and bacteriocin production by Leuconostoc mesenteroides E131.

    Science.gov (United States)

    Drosinos, E H; Mataragas, M; Metaxopoulos, J

    2006-12-01

    Leuconostoc mesenteroides E131, isolated from dry fermented sausages, produces an antimicrobial agent, characterized as bacteriocin. The effect of pH and temperature on growth and bacteriocin production, using MRS broth as growth medium, was studied in a fermentor. The pH value at which the best cell growth was observed (6.5) did not coincided with the value at which the maximum bacteriocin activity was attained (5.5). In contrast, the maximum bacteriocin activity was attained at temperature (25°C) close to the optimum temperature for cell growth (25-30°C). Notably, the range of pH and temperature for good bacteriocin production was within the range used for sausage fermentation. An empirical model was developed to describe the growth and bacteriocin production in different pH and temperature conditions. The model was able to describe growth and bacteriocin production and it could be used to predict the kinetic parameters of growth and bacteriocin production within the pH and temperature range examined.

  13. A study on the shielding of lodine 131 using Monte Carlo Simulation

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Dong Gun; Yang, Seoung Oh; Kim, Jung Ki; Lee, Sang Ho; Choi, Hyung Seok; Bae, Cheol Woo [Dongnam Institute of Radiological and Medical Sciences Cancer Center, Busan (Korea, Republic of)

    2014-06-15

    This study was designated to investigate the Bremsstrahlung and radiation dose by beta rays. Radiation attenuation from I-131 treatment ward was analyzed using radio protective apron. Shielding materials which is included lead or water were simulated in Monte Carlo Simulation then the spectrum on interaction was analyzed. The shielding materials were categorized according to the thickness. 0.25 mm and 0.5 mm thick lead and 0.1 mm and 0.2 mm thick water shielding materials were configured in Monte Carlo Simulation for this study. Only lead shielding method and water plus lead shielding method were carried. As a results, when 0.5 mm thick lead shielding method was performed, the radiation dose was similar to the results with water plus lead shielding method. In case of using 0.25 mm thick lead shielding, the shielding effect was somewhat less. However, that shielding method cause dose reduction of about 60% compare with non-shielding material.

  14. GraphCom: A multidimensional measure of graphic complexity applied to 131 written languages.

    Science.gov (United States)

    Chang, Li-Yun; Chen, Yen-Chi; Perfetti, Charles A

    2018-02-01

    We report a new multidimensional measure of visual complexity (GraphCom) that captures variability in the complexity of graphs within and across writing systems. We applied the measure to 131 written languages, allowing comparisons of complexity and providing a basis for empirical testing of GraphCom. The measure includes four dimensions whose value in capturing the different visual properties of graphs had been demonstrated in prior reading research-(1) perimetric complexity, sensitive to the ratio of a written form to its surrounding white space (Pelli, Burns, Farell, & Moore-Page, 2006); (2) number of disconnected components, sensitive to discontinuity (Gibson, 1969); (3) number of connected points, sensitive to continuity (Lanthier, Risko, Stolz, & Besner, 2009); and (4) number of simple features, sensitive to the strokes that compose graphs (Wu, Zhou, & Shu, 1999). In our analysis of the complexity of 21,550 graphs, we (a) determined the complexity variation across writing systems along each dimension, (b) examined the relationships among complexity patterns within and across writing systems, and (c) compared the dimensions in their abilities to differentiate the graphs from different writing systems, in order to predict human perceptual judgments (n = 180) of graphs with varying complexity. The results from the computational and experimental comparisons showed that GraphCom provides a measure of graphic complexity that exceeds previous measures in its empirical validation. The measure can be universally applied across writing systems, providing a research tool for studies of reading and writing.

  15. Bacteraemia due to non-ESBL-producing Escherichia coli O25b:H4 sequence type 131: insights into risk factors, clinical features and outcomes.

    Science.gov (United States)

    Morales-Barroso, Isabel; López-Cerero, Lorena; Molina, José; Bellido, Mar; Navarro, María Dolores; Serrano, Lara; González-Galán, Verónica; Praena, Julia; Pascual, Alvaro; Rodríguez-Baño, Jesús

    2017-04-01

    The epidemiology and outcomes of bloodstream infections (BSIs) caused by Escherichia coli ST131 isolates not producing extended-spectrum β-lactamases (ESBLs) are not well defined despite being more prevalent than ESBL-producers. In this study, risk factors and the impact on outcome of BSIs caused by non-ESBL-producing ST131 E. coli versus non-ST131 E. coli were investigated. A case-control study was performed in two tertiary centres to identify risk factors for ST131. Molecular methods were used to investigate all E. coli isolates from blood cultures for those belonging to O25b:H4-ST131 clonal group. fimH alleles were characterised in ST131 isolates. Multivariate analysis was performed by logistic regression or Cox regression as appropriate. A total of 33 ST131 E. coli cases and 56 controls were studied. ST131 isolates showed higher rates of resistance to ampicillin and ciprofloxacin; fimH alleles were H30 in 14 isolates (42.4%) and H22 in 12 isolates (36.4%). Only recent surgery (OR = 7.03, 95% CI 1.71-28.84; P = 0.007) and unknown source of bacteraemia (OR = 5.37, 95% CI 0.93-30.81; P = 0.05) were associated with ST131. ST131 isolates showed no association with 30-day mortality, therapeutic failure, presentation with severe sepsis/shock or length of stay. Bacteraemia due to non-ESBL-producing O25b:H4-ST131 E. coli showed few differences in terms of risk factors as well as similar outcome to non-ST131 E. coli. These data support the notion that ST131 strains are not less clinically virulent despite showing increased antimicrobial resistance, but also that they are not more virulent than other clonal groups causing BSI. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  16. Development of methodology for evaluation of {sup 99m}Tc and {sup 131}I incorporated activities during lactation; Desenvolvimento de metodologia para avaliacao da atividade de {sup 99m}Tc e {sup 131}I em lactantes

    Energy Technology Data Exchange (ETDEWEB)

    Santos, L. [Universidade Federal do Rio de Janeiro (IF/UFRJ), RJ (Brazil). Inst. de Fisica; Dantas, A.L.A.; Mesquita, S.A. [Universidade Federal do Rio de Janeiro (IF/UFRJ), RJ (Brazil). Inst. de Fisica; Oliveira, S.M.V., E-mail: adantas@ird.gov.br, E-mail: silvia@ird.gov.br [Universidade Federal do Rio de Janeiro (IF/UFRJ), RJ (Brazil). Inst. de Fisica; Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Div. de Dosimetria

    2012-07-01

    Internal contamination of babies may occur for milk ingestion or inhalation of mothers occupationally exposed to ionizing radiation with possible incorporation or mothers submitted to medical exposures during lactation. Radionuclide concentrations in the mother's milk may cause organ absorbed doses in the babies proportionally to the breast volumes. Milk analysis allow to determine activities ingested by the babies by determining the peak of mother's milk considering the decrease of the activity rate and the milk activities drunk at different time intervals. The work had the aim to develop simulators and methodology to evaluate {sup 99m}Tc and {sup 131}I in lactation, in the following steps: to prepare standard solution of contaminated milk separately with {sup 99m}Tc and {sup 131}I; to build four breast simulators (600 g and 800 g) and respective calibration for two geometries (breast and whole-body) in the Whole-Body Counter Unit in Instituto de Radioprotecao e Dosimetria. The results demonstrated the system efficiency to determine {sup 99m}Tc and {sup 131}I activities in breasts during the lactation period. The methodology for positioning in the 'breast geometry' seemed to be more efficient than the 'whole-body geometry' for different breast volumes. The experiment allows achieving better evaluation of internal dosimetry of mothers and their young children. (author)

  17. 99mTc-HYNIC-TOC scintigraphy is superior to 131I-MIBG imaging in the evaluation of extraadrenal pheochromocytoma.

    Science.gov (United States)

    Chen, Libo; Li, Fang; Zhuang, Hongming; Jing, Hongli; Du, Yanrong; Zeng, Zhengpei

    2009-03-01

    In this investigation, the efficacy of scintigraphy using (99m)Tc-labeled hydrazinonicotinyl-Tyr3-octreotide (HYNIC-TOC) in the evaluation of extraadrenal pheochromocytoma was assessed and compared with (131)I-labeled metaiodobenzylguanidine (MIBG) imaging. Ninety-seven patients who were suspected of having pheochromocytoma but showed no definite adrenal abnormalities on CT were evaluated by both (99m)Tc-HYNIC-TOC scintigraphy and (131)I-MIBG imaging. The results were compared with pathology findings or clinical follow-up. Of 58 patients proven to be without pheochromocytoma, (99m)Tc-HYNIC-TOC and (131)I-MIBG imaging excluded 56 and 58 patients, respectively, rendering a specificity of 96.6% for (99m)Tc-HYNIC-TOC imaging and 100% for (131)I-MIBG imaging. In the evaluation of adrenal pheochromocytoma (14 patients), the sensitivity of (99m)Tc-HYNIC-TOC scintigraphy and (131)I-MIBG imaging was 50% and 85.7%, respectively. However, in the evaluation of extraadrenal pheochromocytomas (25 patients), the sensitivity of (99m)Tc-HYNIC-TOC scintigraphy and (131)I-MIBG imaging was 96.0% and 72.0%, respectively. (99m)Tc-HYNIC-TOC scintigraphy is more sensitive than (131)I-MIBG imaging in the detection of extraadrenal pheochromocytomas.

  18. Radiolabeling of bleomycin-glucuronide with (131)I and biodistribution studies using xenograft model of human colon tumor in Balb/C mice.

    Science.gov (United States)

    Demiroğlu, Hasan; Avcibaşi, Ugur; Ünak, Perihan; Müftüler, Fazilet Zümrüt Biber; İçhedef, Ç A; Gümüşer, Fikriye Gül; Sakarya, Serhan

    2012-08-01

    Bleomycin-glucuronide (BLMG) is the glucuronide conjugate of BLM. In the present study, BLMG was primarily enzymatically synthesized by using a microsome preparate separated from rat liver, labeled with (131)I by iodogen method with the aim of generating a radionuclide-labeled prodrug, and investigated its bioaffinities with tumor-bearing Balb/C mice. Quality control procedures were carried out using thin-layer radiochromatography and high-performance liquid chromatography. Tumor growing was carried out by following Caco-2 cell inoculation into mice. Radiolabeling yield was found to be about 65%. Results indicated that (131)I-labeled BLMG ((131)I-BLMG) was highly stable for 24 hours in human serum. Biodistribution studies were carried out with male Albino Wistar rats and colorectal adenocarcinoma tumor-bearing female Balb/C mice. The biodistribution results in rats showed high uptake in the prostate, the large intestine, and the spinal cord. In addition to this, scintigraphic results agreed with those of biodistributional studies. Xenography studies with tumor-bearing mice demonstrated that tumor uptakes of (131)I-BLM and (131)I-BLMG were high in the first 30 minutes postinjection. Tumor-bearing animal studies demonstrated that (131)I-BLMG was specially retained in colorectal adenocarcinoma with high tumor uptake. Therefore, (131)I-BLMG can be proven to be a promising imaging and therapeutic agent, especially for colon cancer in nuclear medical applications.

  19. Iodine-131 releases from the Hanford Site, 1944--1947. Volume 2, Data: Hanford Environmental Dose Reconstruction Project

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1993-03-01

    Detailed results of the Hanford Environmental Dose Reconstruction project (HEDR) iodine-131 release reconstruction are presented in this volume. Included are daily data on B, D, and F Plant, reactor operations from the P-Department Daily Reports (General Electric Company 1947). Tables of B and T Plant material processed from the three principal sources on separations plant operations: The Jaech report (Jaech undated), the 200 Area Report (Acken and Bird 1945; Bird and Donihee 1945), and the Metal History Reports (General Electric Company 1946). A transcription of the Jaech report is also provided because it is computer-generated and is not readily readable in its original format. The iodine-131 release data are from the STRM model. Cut-by-cut release estimates are provided, along with daily, monthly, and yearly summations. These summations are based on the hourly release estimates. The hourly data are contained in a 28 megabyte electronic file. Interested individuals may request a copy.

  20. Iodine-131 releases from the Hanford Site, 1944--1947. Volume 1, Text: Hanford Environmental Dose Reconstruction Project

    Energy Technology Data Exchange (ETDEWEB)

    Heeb, C.M.

    1992-10-01

    Releases of fission product iodine-131 from separation plants at the Hanford reservation are calculated for the 1944 through 1947 period. Releases to the atmosphere were from the ventilation stacks of T and B separation plants. A reconstruction of daily separation plant operations forms the basis of the releases. The reconstruction traces the iodine-131 content of each fuel discharge from the B, D, and F Reactors to the dissolving step in the separation plants. Statistical computer modeling techniques are used to estimate hourly release histories based on sampling mathematical distribution functions that express the uncertainties in the source data and timing. The reported daily, monthly, and yearly estimates are averages and uncertainty ranges are based on 100 independent Monte Carlo ``realizations`` of the hourly release histories.

  1. Antibiotic selection of Escherichia coli sequence type 131 in a mouse intestinal colonization model

    DEFF Research Database (Denmark)

    Hertz, Frederik Boetius; Løbner-Olesen, Anders; Frimodt-Møller, Niels

    2014-01-01

    day, antibiotic treatment was initiated and given subcutaneously once a day for three consecutive days. CFU of E. coli ST131, Bacteroides, and Gram-positive aerobic bacteria in fecal samples were studied, with intervals, until day 8. Bacteroides was used as an indicator organism for impact on the Gram-negative.......05). Of these, only clindamycin suppressed Bacteroides, while the remaining two antibiotics had no negative impact on Bacteroides or Gram-positive organisms. Only clindamycin treatment resulted in prolonged colonization. The remaining six antibiotics, including ciprofloxacin, did not promote overgrowth of E....... coli ST131 (P > 0.95), nor did they suppress Bacteroides or Gram-positive organisms. The results showed that antimicrobials both with and without an impact on Gram-negative anaerobes can select for ESBL-producing E. coli, indicating that not only Gram-negative anaerobes have a role in upholding...

  2. Measures of thyroid function among Belarusian children and adolescents exposed to iodine-131 from the accident at the Chernobyl nuclear plant.

    Science.gov (United States)

    Ostroumova, Evgenia; Rozhko, Alexander; Hatch, Maureen; Furukawa, Kyoji; Polyanskaya, Olga; McConnell, Robert J; Nadyrov, Eldar; Petrenko, Sergey; Romanov, George; Yauseyenka, Vasilina; Drozdovitch, Vladimir; Minenko, Viktor; Prokopovich, Alexander; Savasteeva, Irina; Zablotska, Lydia B; Mabuchi, Kiyohiko; Brenner, Alina V

    2013-07-01

    Thyroid dysfunction after exposure to low or moderate doses of radioactive iodine-131 (131I) at a young age is a public health concern. However, quantitative data are sparse concerning 131I-related risk of these common diseases. Our goal was to assess the prevalence of thyroid dysfunction in association with 131I exposure during childhood (≤ 18 years) due to fallout from the Chernobyl accident. We conducted a cross-sectional analysis of hypothyroidism, hyperthyroidism, autoimmune thyroiditis (AIT), serum concentrations of thyroid-stimulating hormone (TSH), and autoantibodies to thyroperoxidase (ATPO) in relation to measurement-based 131I dose estimates in a Belarusian cohort of 10,827 individuals screened for various thyroid diseases. Mean age at exposure (± SD) was 8.2 ± 5.0 years. Mean (median) estimated 131I thyroid dose was 0.54 (0.23) Gy (range, 0.001-26.6 Gy). We found significant positive associations of 131I dose with hypothyroidism (mainly subclinical and antibody-negative) and serum TSH concentration. The excess odds ratio per 1 Gy for hypothyroidism was 0.34 (95% CI: 0.15, 0.62) and varied significantly by age at exposure and at examination, presence of goiter, and urban/rural residency. We found no evidence of positive associations with antibody-positive hypothyroidism, hyperthyroidism, AIT, or elevated ATPO. The association between 131I dose and hypothyroidism in the Belarusian cohort is consistent with that previously reported for a Ukrainian cohort and strengthens evidence of the effect of environmental 131I exposure during childhood on hypothyroidism, but not other thyroid outcomes.

  3. Interventional therapy for human breast cancer in nude mice with 131I gelatin microspheres (¹³¹I-GMSs) following intratumoral injection.

    Science.gov (United States)

    Li, Chuan-Chao; Chi, Jun-Lin; Ma, Yu; Li, Jian-Hong; Xia, Chuan-Qin; Li, Lin; Chen, Zhuo; Chen, Xiao-Li

    2014-06-23

    The aim of this study was to investigate the effects of 131I gelatin microspheres (131I-GMS) on human breast cancer cells (MCF-7) in nude mice and the biodistribution of 131I-GMSs following intratumoral injections. A total of 20 tumor-bearing mice were divided into a treatment group and control group and received intratumoral injections of 2.5 mci 131I-GMSs and nonradioactive GMSs, respectively. Tumor size was measured once per week. Another 16 mice received intratumoral injections of 0.4 mci 131I-GMSs and were subjected to single photon emission computed tomography (SPECT) scans and tissue radioactivity concentration measurements on day 1, 4, 8 and 16 postinjection. The 20 tumor-bearing mice received intratumoral injections of 0.4 mci [131I] sodium iodide solution and were subjected to SPECT scans and intratumoral radioactivity measurements at 1, 6, 24, 48 and 72 h postinjection. The tumors were collected for histological examination. The average tumor volume in the 131I-GMSs group on post-treatment day 21 decreased to 86.82 ± 63.6%, while it increased to 893.37 ± 158.12% in the control group (P radioactivity, resulting in 19.93 ± 5.24% of the injected radioactivity after 16 days, whereas the control group retained only 1.83 ± 0.46% of the injected radioactivity within the tumors at 1 h postinjection. 131I-GMSs suppressed the growth of MCF-7 in nude mice and provided sustained intratumoral radioactivity retention. The results suggest the potential of 131I-GMSs for clinical applications in radiotherapy for breast cancer.

  4. Virulence of Escherichia coli clinical isolates in a murine sepsis model in relation to sequence type ST131 status, fluoroquinolone resistance, and virulence genotype.

    Science.gov (United States)

    Johnson, James R; Porter, Stephen B; Zhanel, George; Kuskowski, Michael A; Denamur, Erick

    2012-04-01

    Escherichia coli sequence type ST131 (O25b:H4) has emerged over the past decade as a globally disseminated, multidrug-resistant pathogen. Unlike traditional antimicrobial-resistant E. coli, ST131 derives from virulence-associated phylogenetic group B2 and exhibits extraintestinal virulence factors. This, plus preliminary evidence of virulence in experimental animals, has suggested that ST131's epidemic emergence may be due to high virulence potential, compared with other E. coli types. To test this hypothesis, we compared a large number of matched ST131 and non-ST131 E. coli clinical isolates, both fluoroquinolone resistant and susceptible, plus isolates from classic extraintestinal pathogenic E. coli (ExPEC) sequence types (STs) and case report ST131 household transmission isolates, for virulence in a mouse subcutaneous sepsis model. Overall, in mice, the study isolates produced a wide range of lethality and clinical illness. However, neither ST131 status nor fluoroquinolone phenotype correlated with this diversity of illness severity, which occurred within each of the 6 study groups. In contrast, multiple known or suspected ExPEC virulence genes, including pap (P fimbriae), vat (vacuolating toxin), kpsM II (group 2 capsule), ibeA (invasion of brain endothelium), and clbB/N (colibactin synthesis), plus molecularly defined ExPEC status, were significantly associated with virulence. These findings point away from ST131 isolates as having higher virulence potential compared with other E. coli types in causing invasive extraintestinal infections and suggest instead that ST131's epidemiological success may reflect enhanced fitness for upstream steps in pathogenesis or in colonization and transmission. Additionally, the extensive within-ST virulence diversity suggests an opportunity to compare closely related strains to identify the responsible genetic determinants.

  5. Conversion and correction factors for historical measurements of Iodine-131 in Hanford-area vegetation, 1945--1947: Draft

    Energy Technology Data Exchange (ETDEWEB)

    Mart, E.I.; Denham, D.H.; Thiede, M.E.

    1993-05-01

    This report is a result of the Hanford Environmental Dose Reconstruction (HEDR) Project whose goal is to estimate the radiation dose that individuals could have received from emissions since 1944 at the US Department of Energy's (DOE) Hanford Site near Richland, Washington. The report describes in detail the reconstructed conversion and correction factors for historical measurements of iodine-131 in Hanford-area vegetation which was collected from the beginning of October 1945 through the end of December 1947.

  6. Synthesis and Bioevaluation of Iodine-131 Directly Labeled Cyclic RGD-PEGylated Gold Nanorods for Tumor-Targeted Imaging

    Directory of Open Access Journals (Sweden)

    Yingying Zhang

    2017-01-01

    Full Text Available Introduction. Radiolabeled gold nanoparticles play an important role in biomedical application. The aim of this study was to prepare iodine-131 (131I-labeled gold nanorods (GNRs conjugated with cyclic RGD and evaluate its biological characteristics for targeted imaging of integrin αvβ3-expressing tumors. Methods. HS-PEG(5000-COOH molecules were applied to replace CTAB covering the surface of bare GNRs for better biocompatibility, and c(RGDfK peptides were conjugated onto the carboxyl terminal of GNR-PEG-COOH via EDC/NHS coupling reactions. The nanoconjugate was characterized, and 131I was directly tagged on the surface of GNRs via AuI bonds for SPECT/CT imaging. We preliminarily studied the characteristics of the probe and its feasibility for tumor-targeting SPECT/CT imaging. Results. The [131I]GNR-PEG-cRGD probe was prepared in a simple and rapid manner and was stable in both PBS and fetal bovine serum. It targeted selectively and could be taken up by tumor cells mainly via integrin αvβ3-receptor-mediated endocytosis. In vivo imaging, biodistribution, and autoradiography results showed evident tumor uptake in integrin αvβ3-expressing tumors. Conclusions. These promising results showed that this smart nanoprobe can be used for angiogenesis-targeted SPECT/CT imaging. Furthermore, the nanoprobe possesses a remarkable capacity for highly efficient photothermal conversion in the near-infrared region, suggesting its potential as a multifunctional theranostic agent.

  7. Alternating use of /sup 123/I and /sup 131/I hippuran for routine postoperative monitoring of transplanted kidneys is impracticable

    Energy Technology Data Exchange (ETDEWEB)

    Thomsen, H.S.; Hvid-Jacobsen, K.; Nielsen, S.L.

    During a 7-week period /sup 123/I hippuran was used instead of /sup 131/I hippuran for all renographies of transplanted kidneys on Wednesdays. Only in well functioning grafts with a diuresis above 2 ml/min during the examination a scintigraphic improvement of renal and upper urinary visualization was obtained. It is concluded that alternating routine use of the expensive /sup 123/I hippuran in control of renal grafts cannot be recommended.

  8. A Comparative Pharmacokinetic and Biodistributional Study of {sup 131}I OIH and {sup 99m}Tc-MAG{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Jae Min; Yeom, Mi Kyoung; Kim, Moon Hae [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1990-03-15

    {sup 99m}Tc-MAG, was synthesized, and biodistribution and blood clearance rate were compared with those of {sup 131}I-OIH in mice and rats respectively. Finally renal image was obtained from a normal male volunteer before and after prescription of probenecid. The results obtained were as follows: 1) The uptake of {sup 99m}Tc-MAG{sub 3} by kidney was higher than that of {sup 131}I-OIH in mice 10 mins after injection (n=6, p<0.05), but slightly lower uptakes were found in all organs (kidney, blood, stomach, intestinge and liver) 2 hrs after injection. 2) For {sup 99m}Tc-MAG{sub 3} t{sub 1}/2 alpha=2.4 +- 0.0 min, t{sub 1}/2beta=44.3 +- +7.4 min, and blood clearance=3.4 +- 0.5 ml/min, and for {sup 131}I-OIH t{sub 1}/2 alpha=1.8 +- 0.2 min, t{sub 1}/2beta=69.1 +- 9.5 min, and blood clearance=1.3 +- 0.l min were found in rats. 3) From the renogram of normal male volunteer, we could find that tmax=130 sec and t{sub 1}/2=430 sec before probenecid prescription, and tmax 150-170 sec and t{sub 1}/2=810-1,170 sec after probenecid prescription. From these results we concluded that {sup 99m}Tc-MAG{sub 3}, can be used instead of {sup 131}I-OIH for obtaining renal image.

  9. Long-range transport of gaseous 131I and other radionuclides from Fukushima accident to Southern Poland

    Science.gov (United States)

    Mietelski, Jerzy W.; Kierepko, Renata; Brudecki, Kamil; Janowski, Paweł; Kleszcz, Krzysztof; Tomankiewicz, Ewa

    2014-07-01

    A serious accident at Fukushima Dai-Ichi NPP triggered radioactive emission to the atmosphere on 12 March 2011. The results of gamma spectrometric measurements of both gaseous and aerosol fraction of the air, collected in Krakow over the period from March 21 till the end of May 2011, as well as wet and dry deposition recorded from March till the end of October 2011, are presented in this paper. Krakow happened to be the first Polish location where radioactive isotopes characteristic for reactor releases, such as 131I, 132I, 129mTe, 132Te, 134Cs, 136Cs, and 137Cs, were detected. The maximum activity for aerosols equal to (5.73 ± 0.35) mBq/m3, (0.461 ± 0.041) mBq/m3 and (0.436 ± 0.038) mBq/m3 for 131I, 134Cs and 137Cs, respectively, was recorded for March 29, 2011. The data on the fallout are also given. The results of the radiochemical analysis of aerosol samples showed no traces of plutonium or americium isotopes associated with the disaster to be detected. The results of air activity concentration from Fukushima accident observed in Central Europe, Poland, in comparison to those of Chernobyl accident observed in Japan are presented and discussed. The comparison has revealed a discrepancy in the recognized relative scale of both accidents, and important difference in long distance transport of contamination, to exist. An attempt to explain the variation in the activity ratios between the aerosol fraction for 131I and 137Cs as resulting from exchange between the gaseous and aerosol fractions of 131I while the contamination had been propagating, is made.

  10. Standard Operating Procedure for In-house Preparation of 131I-rituximab for Radioimmunotherapy of Non-Hodgkin's Lymphoma

    OpenAIRE

    Pickford, Matthew D.; Turner, J. Harvey

    2012-01-01

    A Standard Operating Procedure (SOP) has been formulated for in-house preparation, quality control, dispensing and administration of 131I-rituximab appropriate for the safe, effective, radioimmunotherapy of non-Hodgkin lymphoma. A decade of experience of semi-automated radioiodination of rituximab in our hospital radiopharmaceutical laboratory was analysed. The methodology was then refined for safe, practical, affordable application to radioimmunotherapy of lymphoma in departments of nuclear ...

  11. A physiologically based pharmacokinetic model for lactational transfer of Na-131I

    Science.gov (United States)

    Turner, Anita Loretta

    The excretion of radionuclides in human breast milk after administration of radiopharmaceuticals is a concern as a radiation risk to nursing infants. It is not uncommon to administer radiopharmaceuticals to lactating patients due to emergency nuclear medicine investigations such as thyroid complications, kidney failure, and pulmonary embolism. There is a need to quantify the amount of radioactivity translocated into breast milk in cases of ingestion by a breast-fed infant. A physiologically based pharmacokinetic model (PBPK) and a modified International Commission on Radiological Protection (ICRP) model have been developed to predict iodine concentrations in breast milk after ingestion of radioiodine by the mother. In the PBPK model, all compartments are interconnected by blood flow and represent real anatomic tissue regions in the body. All parameters involved are measurable values with physiological or physiochemical meaning such as tissue masses, blood flow rates, partition coefficients and cardiac output. However, some of the parameters such as the partition coefficients and metabolic constants are not available for iodine and had to be inferred from other information. The structure of the PBPK model for the mother consists of the following tissue compartments: gastrointestinal tract, blood, kidney, thyroid, milk, and other tissues. With the exception of the milk compartment, the model for the nursing infant is structured similarly to the mother. The ICRP model describing iodine metabolism in a standard 70-kg man was modified to represent iodine metabolism in a lactating woman and nursing infant. The parameters involved in this model are transfer rates and biological half-lives which are based on experimental observations. The results of the PBPK model and the modified ICRP model describing the lactational transfer of iodine were compared. When administering 1 mCi of Na131I to the lactating mother, the concentration reaches a maximum of 0.1 mCi/liter in 24

  12. Evaluation of the uncertainties associated to the in vivo monitoring of iodine-131 in the thyroid

    Energy Technology Data Exchange (ETDEWEB)

    Gontijo, Rodrigo Modesto Gadelha; Lucena, Eder Augusto; Dantas, Ana Leticia A.; Dantas, Bernardo Maranhao [Instituto de Radioprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)

    2011-07-01

    The internal dose from the incorporation of radionuclides by humans can be estimated by in vivo direct measurements in the human body and in vitro analysis of biological indicators. In vivo techniques consist on the identification and quantification of radionuclides present in the whole body and in specific organs and tissues. The results obtained in measurements may present small uncertainties which are within pre-set limits in monitoring programs for occupationally exposed individuals. This study aims to evaluate the sources of uncertainty associated with the results of in vivo monitoring of iodine 131 in the thyroid. The benchmarks adopted in this study are based on the criteria suggested by the General Guide for Estimating Effective Doses from Monitoring Data (Project IDEAS/European Community). The reference values used were the ones for high-energy photons (>100 keV). Besides the parameters suggested by the IDEAS Guide, it has also been evaluated the fluctuation of the counting due to the phantom repositioning, which represents the reproducibility of the counting geometry. Measurements were performed at the Whole Body Counter Unit of the IRD using a scintillation detector NaI (Tl) 3'' x 3'' and a neck-thyroid phantom developed at the In Vivo Monitoring Laboratory of IRD. This phantom contains a standard source of barium-133 added to a piece of filter paper with the dimension and shape of a thyroid gland. Scattering factors were calculated and compared in different counting geometries. The results show that the technique studied presents reproducibility equivalent to the values suggested in the IDEAS Guide and measurement uncertainties compatible to international quality standards for this type of in vivo monitoring. (author)

  13. Health effects of therapeutic use of {sup 131}I in hyperthyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Pauwels, E. K. J.; Slats, A.; Overbeek, F. [Leiden Univ. Medical Centre, Leiden (Netherlands). Dept. of Radiology, Div. of Nuclear Medicine; Smit, J. W. A.; Bourguignon, M. [Office de Protection contre le Rayonnements Ionisant, Le Vesinet (France)

    2000-12-01

    Since 1942, therapy with radioiodine (Na{sup 131}I) has gained a major role in the treatment of benign thyroid disorders, notably hyperthyroidism caused by Graves' disease or toxic multi nodular goiter. The very large series of patients treated so far offer the opportunity for an assessment of both benign and malignant side effects. Hyperthyroidism is sometimes observed after radioiodine therapy due to radiation induced thyroid hormone or by an immunological mechanism. Despite the numerous attempts to design dosage schedules aiming at euthyroidism, hypothyroidism occurs in the majority of patients throughout life. Transient hypothyroidism may be observed within the first year after therapy and is caused by an immunological mechanism. Radioiodine therapy in Graves' disease may induce or worsen ophthalmopathy, which can be prevented by steroids effectively. Hypoparathyroidism and hyperparathyroidism have been reported after radioiodine therapy but probably do not exceed the normal incidence. Sialitis is commonly observed but mostly in patients treated with radioiodine for thyroid cancer. There are no indications for induction of genetic abnormalities after radioiodine therapy although no definite conclusion can be reached. Much attention has been paid to malignant disease. In very large series, no effects of radioiodine therapy on survival have been observed. Some studies report an increased relative risk for certain types of cancer (notably thyroid cancer, stomach cancer, bladder and kidney cancer or hematological malignancies). However, these observations were not confirmed by other large studies, so that no definite conclusion with respect to risk for certain types of malignant disease can be drawn. However, radioiodine therapy for benign thyroid disorders has generally considered safe and without major side effects, hypothyroidism being the most frequent one.

  14. Measurement of the internal dose to families of outpatients treated with {sup 131}I for hyperthyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Barrington, S.F.; O' Doherty, M.J. [St. Thomas' Hospital, PET Imaging Centre, London (United Kingdom); Anderson, P. [Queen Elizabeth Hospital, Department of Nuclear Medicine, Birmingham (United Kingdom); Kettle, A.G. [Kent and Canterbury Hospital, East Kent Hospitals NHS Trust, Department of Nuclear Medicine, Canterbury (United Kingdom); Gadd, R.; Mountford, P.J. [University Hospital of North Staffordshire, Directorate of Medical Physics and Clinical Technology, Stoke-on-Trent (United Kingdom); Thomson, W.H.; Harding, L.K. [City Hospital, Department of Physics and Nuclear Medicine, Birmingham (United Kingdom); Batchelor, S. [Guy' s and St Thomas' Hospital, Department of Medical Physics, London (United Kingdom)

    2008-11-15

    The aim of this study was to measure the internal dose received by family members from ingestion of radioactive contamination after outpatient therapy. Advice was given to minimise transfer of radioiodine. Home visits were made approximately 2, 7 and 21 days after treatment to measure radioactivity in the thyroids of family members. A decay correction was applied to radioactivity detected assuming ingestion had occurred at the earlier contact time, either the day of treatment or the previous home visit. An effective half-life of 6 or 7 days was used depending on age. Thyroid activity was summed if activity was found at more than one visit in excess of the amount attributable to radioactive decay. Effective dose (ED) was calculated using ICRP72. Fifty-three adults and 92 children, median age 12 (range 4-17) years participated. Median administered activity was 576 (range 329-690) MBq {sup 131}I. Thyroid activity ranged from 0 to 5.4 kBq in the adults with activity detected in 17. Maximum adult ED was 0.4 mSv. Thyroid activity ranged from 0 to 11.8 kBq in the children with activity detected in 26. The two highest values of 5.0 and 11.8 kBq occurred in children aged 5 and 14 years from different families. Eighty-five children had no activity or <1 kBq detected. ED was <0.2 mSv in 86 out of 92 children (93%). Previous published data showed 93% of children received an ED {<=}0.8 mSv from external irradiation. With advice, families of outpatients receiving radioiodine should be able to comply with statutory dose limits and constraints. (orig.)

  15. Validation of Immunohistochemical Assays for Integral Biomarkers in the NCI-MATCH EAY131 Clinical Trial.

    Science.gov (United States)

    Khoury, Joseph D; Wang, Wei-Lien; Prieto, Victor G; Medeiros, L Jeffrey; Kalhor, Neda; Hameed, Meera; Broaddus, Russell; Hamilton, Stanley R

    2017-08-24

    Biomarkers that guide therapy selection are gaining unprecedented importance as targeted therapy options increase in scope and complexity. In conjunction with high-throughput molecular techniques, therapy-guiding biomarker assays based upon immunohistochemistry (IHC) have a critical role in cancer care in that they inform about the presence of a protein target. Here, we describe the validation procedures for four clinically available IHC biomarker assays - PTEN, RB, MLH1 and MSH2 - for use as integral biomarkers in the nationwide NCI-MATCH (Molecular Analysis for Therapy Choice) EAY131 clinical trial. Validation procedures were developed through an iterative process based on collective experience and adaptation of broad guidelines from the United State Food and Drug Administration (FDA). The steps included primary antibody selection, assay optimization, development of assay interpretation criteria incorporating biological considerations and expected staining patterns, including indeterminate results, orthogonal validation, and tissue validation. Following assay lockdown, patient samples and cell lines were used for analytical and clinical validation. The assays were then approved as laboratory developed tests and used for clinical trial decisions for treatment selection. Calculations of sensitivity and specificity were undertaken using various definitions of gold standard references, and external validation was required for the PTEN IHC assay. In conclusion, validation of IHC biomarker assays critical for guiding therapy in clinical trials is feasible using comprehensive pre-analytical, analytical and post-analytical steps. Implementation of standardized guidelines provides a useful framework for validating IHC biomarker assays that allow for reproducibility across institutions for routine clinical use. Copyright ©2017, American Association for Cancer Research.

  16. Immunological Characterizations of a Cloned 13.1-Kilodalton Protein from Pathogenic Naegleria fowleri

    Science.gov (United States)

    Cho, Myoung-Soo; Jung, Suk-Yul; Park, Sun; Kim, Kyongmin Hwang; Kim, Hyung-Il; Sohn, Seonghyang; Kim, Han-Jip; Im, Kyung-Il; Shin, Ho-Joon

    2003-01-01

    We previously cloned an antigenic gene (named nfa1) from a cDNA library of Naegleria fowleri by immunoscreening. The nfa1 gene had a coding nucleotide sequence consisting of 357 bases and produced a recombinant 13.1-kDa protein (Nfa1). In this study, to get more information regarding the recombinant Nfa1 protein (rNfa1), we produced an anti-Nfa1 polyclonal antibody from mice immunized with rNfa1 and used a peroxidase staining method to carry out immunocytochemistry experiments. In addition, we observed the effect of the presence of an anti-Nfa1 antibody on the in vitro cytotoxicity of N. fowleri against Chinese hamster ovary (CHO) cells. Trophozoites of N. fowleri in cultivation reacted strongly with a peroxidase-labeled anti-Nfa1 antibody. In inflammatory and necrotic regions of brain tissue infected with N. fowleri, labeled trophozoites that were stained brown were also observed. When examined using a transmission electron microscope, the Nfa1 protein showed pseudopodium-specific immunolocalization on a trophozoite of N. fowleri. When examined using a light microscope, CHO cells grown in cocultures with N. fowleri trophozoites (group I) for 48 h showed morphologically severe destruction but CHO cells grown in cocultures with N. fowleri trophozoites and an anti-Nfa1 polyclonal antibody (group II) showed less destruction. The results of a lactate dehydrogenase release assay showed that group I CHO cells exhibited 81% cytotoxicity and group II CHO cells exhibited 13.8% cytotoxicity. PMID:12965933

  17. Improvement of the obtention process of {sup 131} I of ININ through studies of equipment design and process parameters fitting in the simulator; Perfeccionamiento del proceso de obtencion del {sup 131} I del ININ mediante estudios de diseno del equipo y ajustes de parametros del proceso en el simulador

    Energy Technology Data Exchange (ETDEWEB)

    Zepeda M, M.C

    2006-07-01

    The main objective of the work was to achieve a high yield of the reaction that happens among the vapors of {sup 131} I and the NaOH to obtain sodium iodide (Na{sup 131} I) in solution optimizing the contact time of the molecules in gaseous state of {sup 131} I with the NaOH molecules through the bubbling velocity of the {sup 131} I in the solution of NaOH 0.1 N, as well as the operation temperature during the distillation process by dry via starting from tellurium dioxide (TeO{sub 2}) with the purpose of that the {sup 131} I that is obtained in the form of Na{sup 131} I solution presents the necessary quality that allows to distribute it in the market. The particular objectives were: a) To improve the distillation equipment used for the obtaining of {sup 131} I starting from irradiated tellurium dioxide redrawing the dilution system with the purpose of recovering the {sup 131} I in a minimum volume of sodium hydroxide (NaOH). b) To achieve a bigger time of contact among the molecules of {sup 131} I in gaseous state with the molecules of NaOH in solution through the bubbling velocity and of the redrawing of the dilution system. c) To implement the production of {sup 131} I by dry distillation via starting from tellurium dioxide, obtaining it with a high radionuclide and radiochemical purity. d) To obtain {sup 131} I with the necessary specifications that it marks the pharmacopoeia and it can be used with medical ends. (Author)

  18. Biodistribution and SPECT imaging of {sup 125/131}I-crotoxin on mice bearing Ehrlich solid tumour

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Marcella Araugio; Santos, Raquel Gouvea dos [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marcellaaraugio@yahoo.com.br, e-mail: santosr@cdtn.br; Silveira, Marina B.; Simal, Carlos [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Medicina; Dias, Consuelo L. Fortes [Fundacao Ezequiel Dias (FUNED), Belo Horizonte, MG (Brazil)

    2009-07-01

    The search of specific radiopharmaceuticals to be used in breast tumour diagnosis is relevant to complement the techniques applied in conventional medicine. Crotalus durissus terrificus venom (CV) and its main polypeptide, Crotoxin (Crtx), are natural source of several bioactive substances with therapeutical potential. The aim of this work was to evaluate the binding of Crtx with tumour targets in vivo, as well as, evaluate its applicability for breast tumours diagnosis. Crtx was labelled with {sup 125/131}I using lactoperoxidase method and radiochemical analysis was performed by chromatography. {sup 125}I-Crtx was used for biodistribution and pharmacokinetics studies on swiss mice bearing Ehrlich solid tumour, while {sup 131}I-Crtx was used for single photon emission computed tomography (SPECT) imaging. Crtx presented specific binding sites on Ehrlich tumour cells and had a rapid blood clearance (T{sub 1/2}= 201.1 min.). Intratumoral administration increased significantly the activity delivered into the tumour site (128-fold higher) and reduced the kidney burden (7.2-fold lower). {sup 131}I-Crxt demonstrated to interact with tumour cells for until 72 hours allowing good quality images of tumour. Our results indicate the biotechnological potential of Crtx as template for radiopharmaceutical design for cancer diagnosis. (author)

  19. A False Positive I-131 Metastatic Survey Caused by Radioactive Iodine Uptake by a Benign Thymic Cyst

    Directory of Open Access Journals (Sweden)

    Avneet K. Singh

    2017-01-01

    Full Text Available Thyroid carcinoma is the most common endocrine malignancy in the United States with increasing incidence and diagnosis but stable mortality. Differentiated thyroid cancer rarely presents with distant metastases and is associated with a low risk of morbidity and mortality. Despite this, current protocols recommend remnant ablation with radioactive iodine and evaluation for local and distant metastasis in some patients with higher risk disease. There are several case reports of false positive results of metastatic surveys that are either normal physiologic variants or other pathological findings. Most false positive findings are associated with tissue that has physiologic increased uptake of I-131, such as breast tissue or lung tissue; pathological findings such as thymic cysts are also known to have increased uptake. Our case describes a rare finding of a thymic cyst found on a false positive I-131 metastatic survey. The patient was taken for surgical excision and the final pathology was a benign thymic cyst. Given that pulmonary metastases of differentiated thyroid cancer are rare, thymic cysts, though also rare, must be part of the differential diagnosis for false positive findings on an I-131 survey.

  20. Monte Carlo microdosimetry of {sup 188}Re- and {sup 131}I-labelled anti-CD20

    Energy Technology Data Exchange (ETDEWEB)

    Torres-GarcIa, E [Coordinacion de Posgrado, Facultad de Medicina, Universidad Autonoma del Estado de Mexico, Paseo Tollocan S/N, Toluca, Estado de Mexico 50180 (Mexico); Garnica-Garza, H M [Coordinacion de Posgrado, Facultad de Medicina, Universidad Autonoma del Estado de Mexico, Paseo Tollocan S/N, Toluca, Estado de Mexico 50180 (Mexico); Ferro-Flores, G [Instituto Nacional de Investigaciones Nucleares, Carretera Mexico-Toluca, Ocoyoacac, Estado de Mexico 52750 (Mexico)

    2006-10-07

    The radiolabelled monoclonal antibody anti-CD20 has the property of binding to the CD20 antigen expressed on the cell surface of B-lymphocytes, thus making it a useful tool in the treatment of non-Hodgkin's lymphoma. In this work, the event-by-event Monte Carlo code NOREC is used to calculate the single-event distribution function f{sub 1}(z) in the cell nucleus using the beta spectra of the {sup 188}Re and {sup 131}I radionuclides. The simulated geometry consists of two concentric spheres representing the nucleus and the cell surface embedded in a semi-infinite water medium. An isotropic point source was placed on the cell surface to simulate the binding of the anti-CD20 labelled with either {sup 188}Re or {sup 131}I. The simulations were carried out for two combinations of cell surface and nucleus radii. A method was devised that allows one to calculate the contribution of betas of energy greater than 1 MeV, which cannot be simulated by the NOREC code, to the single-event distribution function. It is shown that disregarding this contribution leads to an overestimation of the frequency-mean specific energy of the order of 9-12%. In general, the antibody radiolabelled with {sup 131}I produces single-event distribution functions that yield higher frequency-mean specific energies. (note)

  1. A simple and safe method for 131I radiolabeling of rituximab for myeloablative high-dose radioimmunotherapy.

    Science.gov (United States)

    Tran, Ly; Baars, Joke W; Maessen, Harry J; Hoefnagel, Cornelis A; Beijnen, Jos H; Huitema, Alwin D R

    2009-02-01

    The aim of this study was to develop a safe and simple radiolabeling and purification procedure for high-dose (131)I-rituximab for treatment of patients with non-Hodgkin's lymphoma. As the starting point, the conventional Iodogen-coated vial method was applied. After the iodogen-coated monoclonal antibody (mAb) method, a labeling method involving much lower amounts of iodogen was assessed. Subsequently, (131)I-rituximab was purified with a tangential flow filtration system. Quality control of the final product was performed by using size-exclusion chromatography with ultraviolet detection and by instant high-performance thin-layer chromatography. Immunoreactivity was determined by using a cell-binding assay. During the labeling procedure, radiation exposure was monitored. The coated vial method resulted in a low radiation exposure, but immunoreactivity was highly compromised (37%). Also, formation of aggregates was observed. The maximal observed effective dose was 18 microSv, finger thermoluminescence dosemeters revealed a hand-dose measurement of 0.8 mSv. The second method resulted in an immunoreactivity of 70%. Radiochemical purity was >97% after purification. The maximal measured effective dose was 31 microSv, and detected exposure to the hands was 1.9 mSv. We have developed a simple labeling technique for the preparation of high-dose (131)I-rituximab. The method offers a high purity and retained immunoreactivity with minimal radiation exposure for involved personnel.

  2. Comparative Genomic Analysis of Globally Dominant ST131 Clone with Other Epidemiologically Successful Extraintestinal PathogenicEscherichia coli(ExPEC) Lineages.

    Science.gov (United States)

    Shaik, Sabiha; Ranjan, Amit; Tiwari, Sumeet K; Hussain, Arif; Nandanwar, Nishant; Kumar, Narender; Jadhav, Savita; Semmler, Torsten; Baddam, Ramani; Islam, Mohammed Aminul; Alam, Munirul; Wieler, Lothar H; Watanabe, Haruo; Ahmed, Niyaz

    2017-10-24

    Escherichia coli sequence type 131 (ST131), a pandemic clone responsible for the high incidence of extraintestinal pathogenic E. coli (ExPEC) infections, has been known widely for its contribution to the worldwide dissemination of multidrug resistance. Although other ExPEC-associated and extended-spectrum-β-lactamase (ESBL)-producing E. coli clones, such as ST38, ST405, and ST648 have been studied widely, no comparative genomic data with respect to other genotypes exist for ST131. In this study, comparative genomic analysis was performed for 99 ST131 E. coli strains with 40 genomes from three other STs, including ST38 ( n = 12), ST405 ( n = 10), and ST648 ( n = 18), and functional studies were performed on five in-house strains corresponding to the four STs. Phylogenomic analysis results from this study corroborated with the sequence type-specific clonality. Results from the genome-wide resistance profiling confirmed that all strains were inherently multidrug resistant. ST131 genomes showed unique virulence profiles, and analysis of mobile genetic elements and their associated methyltransferases (MTases) has revealed that several of them were missing from the majority of the non-ST131 strains. Despite the fact that non-ST131 strains lacked few essential genes belonging to the serum resistome, the in-house strains representing all four STs demonstrated similar resistance levels to serum antibactericidal activity. Core genome analysis data revealed that non-ST131 strains usually lacked several ST131-defined genomic coordinates, and a significant number of genes were missing from the core of the ST131 genomes. Data from this study reinforce adaptive diversification of E. coli strains belonging to the ST131 lineage and provide new insights into the molecular mechanisms underlying clonal diversification of the ST131 lineage. IMPORTANCE E. coli , particularly the ST131 extraintestinal pathogenic E. coli (ExPEC) lineage, is an important cause of community- and

  3. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  4. Selected Radiation Safety Aspects Including Transportation and Lodging After Outpatient131I Therapy for Differentiated Thyroid Cancer.

    Science.gov (United States)

    Gomes-Lima, Cristiane J; Wu, Di; Kharazi, Pejman H; Khojekar, Gauri J; Ringel, Matthew D; Vetter, Richard J; Bloom, Gary; Burman, Kenneth D; Wartofsky, Leonard; Van Nostrand, Douglas

    2017-12-01

    Whether radioactive iodine ( 131 I) treatments for differentiated thyroid cancer should be performed as an outpatient or inpatient remains controversial. The objective of this study was to survey selected aspects of radiation safety of patients treated with 131 I for differentiated thyroid cancer as an outpatient. An e-mail invitation was sent to over 15,000 members of ThyCa: Thyroid Cancer Survivors' Association, Inc. to complete a web-based survey on selected aspects of radiation safety regarding their last outpatient 131 I treatment. A total of 1549 patients completed the survey. Forty-five percent (699/1541) of the respondents reported no discussion on the choice of an inpatient or outpatient treatment. Moreover, 5% (79/1541) of the respondents reported that their insurance company made the decision. Survey respondents recalled receiving oral and written radiation safety instructions 97% (1459/1504) and 93% (1351/1447) of the time, respectively. Nuclear medicine physicians delivered oral and written instructions to 54% (807/1504) and 41% (602/1462) of the respondents, respectively. Eighty-eight percent (1208/1370) of the respondents were discharged within 1 hour after receiving their 131 I treatment, and 97% (1334/1373) traveled in their own car after being released from the treating facility. Immediately post-therapy, 94% (1398/1488) of the respondents stayed at their own home or a relative's home, while 5% (76/1488) resided in a public lodging. The specific recommendations received by patients about radiation precautions varied widely among the respondents. Ninety-nine percent (1451/1467) of the respondents believed they were compliant with the instructions. This is the largest, patient-based survey published regarding selected radiation safety aspects of outpatient 131 I treatment. This survey suggests several concerns about radiation safety, such as the decision process regarding inpatient versus outpatient treatment, instructions about radiation safety

  5. The AEC/NRC 30 mCi rule: regulatory origins and clinical consequences for 131I remnant ablative doses.

    Science.gov (United States)

    Siegel, Jeffry A; Silberstein, Edward B

    2014-11-01

    Clinical and historical uncertainty exists surrounding the regulations of the Atomic Energy Commission/Nuclear Regulatory Commission (AEC/NRC) requiring patient hospitalization when (131)I activities exceed 30 mCi. This review investigates the sometimes disturbing regulatory and clinical origins and consequences of the use of this low, 30 mCi dose as a prescription for thyroid remnant ablation. As early as in the 1940s, activities of (131)I between 30 and 200 mCi, often fractionated, were employed. The AEC deliberated from 1947 to the early 1960s before imposing as a license condition the requirement of hospitalizing patients until they contained material. The written AEC record throughout these years contains no supportive data to suggest safety issues requiring hospitalization at this activity level of (131)I. Yet the techniques for making the necessary calculations for determining radiation safety were available at this time. Declarations on the subject by nongovernmental bodies were misinterpreted as confirming such hospitalization as a legal requirement. The 30 mCi license condition was codified into NRC regulations in 1987 and was subsequently removed in 1997. Without any data, these U.S. regulatory agencies caused significant expense, inconvenience, and fear, affecting thyroid cancer patients and their families. This 30 mCi regulatory activity limit morphed, by a fortunate coincidence, into an acceptable ablative activity before there were solid confirmatory data. Studies on this 30 mCi ablative dose indicate that this activity was never associated with radiation health and safety issues, and was never more effective than higher ablative doses but led slightly more often to the need for a second (131)I dose. Nevertheless, the available data generally support the American Thyroid Association and Society of Nuclear Medicine and Molecular Imaging Guidelines, which indicate, without a treatment activity preference, that 30-100 mCi of (131)I provide adequate

  6. Tumor resection cavity administered iodine-131-labeled antitenascin 81C6 radioimmunotherapy in patients with malignant glioma: neuropathology aspects

    Energy Technology Data Exchange (ETDEWEB)

    McLendon, Roger E. [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States)]. E-mail: mclen001@mc.duke.edu; Akabani, Gamal [Department of Radiology, Duke University Medical Center, Durham, NC 27710 (United States); Friedman, Henry S. [Department of Pediatrics, Duke University Medical Center, Durham, NC 27710 (United States); Reardon, David A. [Department of Medicine, Duke University Medical Center, Durham, NC 27710 (United States); Cleveland, Linda [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States); Cokgor, Ilkcan [Department of Pediatrics, Duke University Medical Center, Durham, NC 27710 (United States); Herndon, James E. [Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC 27710 (United States); Wikstrand, Carol [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States); Boulton, Susan T. [Department of Surgery, Duke University Medical Center, Durham, NC 27710 (United States); Friedman, Allan H. [Department of Surgery, Duke University Medical Center, Durham, NC 27710 (United States); Bigner, Darell D. [Department of Pathology, Duke University Medical Center, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, Durham, NC 27710 (United States)

    2007-05-15

    Introduction: The neurohistological findings in patients treated with targeted {beta} emitters such as {sup 131}I are poorly described. We report a histopathologic analysis from patients treated with combined external beam therapy and a brachytherapy consisting of a {sup 131}I-labeled monoclonal antibody (mAb) injected into surgically created resection cavities during brain tumor resections. Methods: Directed tissue samples of the cavity walls were obtained because of suspected tumor recurrence from 28 patients. Samples and clinical follow-up were evaluated on all patients (Group A) based on total radiation dose received and a subset of these (n=18; Group B, proximal therapy subset) who had received external beam therapy within {<=}3 months of mAb therapy and undergoing 26 biopsies over 37 months. Histologic outcomes were 'proliferative glioma,' 'quiescent glioma' and negative for neoplasm. Statistical analysis was used to assess the casual relation between total absorbed dose ({sup 131}I-mAb+external beam) and histologic diagnosis. Results: The lesions observed after {sup 131}I-mAb therapy were qualitatively similar to those reported for other types of radiation therapy; however, the high localized dose rate and absorbed doses produced by the short range of {sup 131}I {beta} particles seem to have resulted in an earlier necrotic reaction in the tumor bed. Among all 28 (Group A) patients, median survival from tissue analysis after mAb therapy depended on histopathology and total radiation absorbed dose. Median survival for patients with tissue classified as proliferative glioma, quiescent glioma and negative for neoplasm were 3.5, 15 and 27.5 months, respectively. Without categorization, total dose was a significant predictor of survival (P<.002) where patients with higher doses had better prognoses. For example, median survival in patients receiving a total radiation dose greater than 86 Gy was 19 months compared with 7 months for those

  7. A predictive mathematical model for the calculation of the final mass of Graves' disease thyroids treated with 131I

    Science.gov (United States)

    Traino, Antonio C.; Di Martino, Fabio; Grosso, Mariano; Monzani, Fabio; Dardano, Angela; Caraccio, Nadia; Mariani, Giuliano; Lazzeri, Mauro

    2005-05-01

    Substantial reductions in thyroid volume (up to 70-80%) after radioiodine therapy of Graves' hyperthyroidism are common and have been reported in the literature. A relationship between thyroid volume reduction and outcome of 131I therapy of Graves' disease has been reported by some authors. This important result could be used to decide individually the optimal radioiodine activity A0 (MBq) to administer to the patient, but a predictive model relating the change in gland volume to A0 is required. Recently, a mathematical model of thyroid mass reduction during the clearance phase (30-35 days) after 131I administration to patients with Graves' disease has been published and used as the basis for prescribing the therapeutic thyroid absorbed dose. It is well known that the thyroid volume reduction goes on until 1 year after therapy. In this paper, a mathematical model to predict the final mass of Graves' diseased thyroids submitted to 131I therapy is presented. This model represents a tentative explanation of what occurs macroscopically after the end of the clearance phase of radioiodine in the gland (the so-called second-order effects). It is shown that the final thyroid mass depends on its basal mass, on the radiation dose absorbed by the gland and on a constant value α typical of thyroid tissue. α has been evaluated based on a set of measurements made in 15 reference patients affected by Graves' disease and submitted to 131I therapy. A predictive equation for the calculation of the final mass of thyroid is presented. It is based on macroscopic parameters measurable after a diagnostic 131I capsule administration (0.37-1.85 MBq), before giving the therapy. The final mass calculated using this equation is compared to the final mass of thyroid measured 1 year after therapy administration in 22 Graves' diseased patients. The final masses calculated and measured 1 year after therapy are in fairly good agreement (R = 0.81). The possibility, for the physician, to decide a

  8. Cytogenetic and dosimetric effects of {sup 131}I in lymphocyte of patients with differentiated thyroid cancer with and without r-hTSH stimulation. Study in thyroid tumor cells (WRO) treated with {sup 131}I and {sup 60}Co in vitro; Efeitos citogenetico e dosimetrico do {sup 131}I em pacientes com cancer diferenciado da tireoide com e sem estimulacao com r-hTSH. Estudo em celulas tumorais tireoidianas (WRO) tratadas com {sup 131}I e {sup 60}Co in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Valgode, Flavia Gomes Silva

    2015-11-01

    Differentiated thyroid cancer (DTC) represents about 90% of thyroid malignancies with increasing incidence in the recent decades. Treatment modalities include thyroidectomy, {sup 131}I therapy (with or without r-hTSH), radio and chemotherapy. Little is known about the effects of these treatments at the cellular level. This work was proposed in order to assess to what extent radioiodine therapy can cause damage in peripheral lymphocytes of patients with DTC, preceded or not by r-hTSH, taking into account acute, slow and dosimetric effects of {sup 131}I (in vivo study). An in vitro study was also carried out on thyroid tumor target cells (WRO) by cytotoxicity and genotoxicity analysis and radioiodine uptake. For this, blood samples from patients divided into two groups (group A, r-hTSH + {sup 131}I and group B,{sup 131}I only) were collected before, 24 hours, 1 week, 1 month and 1 year after {sup 131}I administration for aberration chromosome analysis (CA). A dose-response curve for {sup 131}I in vitro was developed for estimating the absorbed dose in patients, comparing the dicentric frequencies obtained in vitro with in vivo data by Monte Carlo program. Radioiodine therapy induced an increase in the number of CA in lymphocytes of patients peaking 24 hours after treatment, with gradual decline over time and with more chromosomal damage in group B than in group A, reaching baseline levels one year after radioiodine administration. The frequency of dicentric found inpatient lymphocytes, 24h after treatment, was equivalent to that induced in vitro (0.354 ± 0.153 MBq / mL for group A and 0.309 ± 0.154 MBq / mL for group B), which corresponds to absorbed doses of 0.8 ± 0.3 Gy and 0.7 ± 0.3 Gy for groups A and B, respectively, with no significant difference between the groups. WRO cells showed a cell cycle relatively slow: 96,3h with an unstable karyotype. The genotoxic test showed a relatively high radioresistance (0.07 to 3.70 MBq/mL), with no statistical

  9. Update on the rational use of tositumomab and iodine-131 tositumomab radioimmunotherapy for the treatment of non-Hodgkin’s lymphoma

    Directory of Open Access Journals (Sweden)

    Michael J Burdick

    2009-08-01

    Full Text Available Michael J Burdick, Roger M MacklisDepartment of Radiation Oncology, Taussig Cancer Center and Cleveland Clinic Lerner College of Medicine, Cleveland, OH, USAAbstract: Targeted radioimmunotherapy in non-Hodgkin’s B-cell lymphoma (NHL offers an efficacious therapy and minimal toxicity compared to conventional chemotherapy. Iodine 131 tositumomab (131I-TST is a murine monoclonal antibody against the CD20 cell surface protein and is directly covalently conjugated to 131I, a radioactive β and γ emitter. While initially approved for use in relapsed, refractory, or transformed low grade B-cell NHL, investigational uses with promising results include autologous stem cell transplant, intermediate grade NHL, and the frontline management of indolent NHL. This review summarizes the 131I-TST literature on mechanism of action, treatment indications, treatment delivery, efficacy, investigational uses, and future prospects.Keywords: tositumomab, radioimmunotherapy, non-Hodgkin’s lymphoma, Bexxar

  10. Non-surgical approach to the benign nodular goiter: new opportunities by recombinant human TSH-stimulated (131)I-therapy

    DEFF Research Database (Denmark)

    Bonnema, Steen Joop; Fast, Søren; Hegedüs, Laszlo

    2011-01-01

    and this treatment is of particular benefit, as compared with conventional (131)I-therapy, in patients with a low baseline thyroid (131)I uptake and a large goiter. If the rhTSH dose does not exceed 0.1 mg the risk of temporary hyperthyroidism and acute thyroid swelling is low. Since patient satisfaction seemingly......The optimal treatment strategy in a goiter patient depends-among other factors-on goiter size, the degree of cosmetic or compressive symptoms, the age of the patient, the impact on the upper airways, the wish to maintain normal thyroid function, the ability of the thyroid gland to take up (131)I......, and the possibility of thyroid malignancy. When treatment is warranted in a patient with benign goiter, the choice usually stands between surgery and (131)I-therapy. Focal destructive treatment, by ethanol sclerotherapy or interstitial laser photocoagulation, may be considered in patients with a solitary benign...

  11. Can we remove iodine-131 from tap water in Japan by boiling? - Experimental testing in response to the Fukushima Daiichi Nuclear Power Plant accident.

    Science.gov (United States)

    Tagami, K; Uchida, S

    2011-08-01

    Iodine-131 concentrations in tap water higher than 100 BqL(-1) were reported by several local governments in Japan following the Fukushima Daiichi Nuclear Power Plant accident. Some individuals in the emergency-response community recommended the boiling of tap water to remove iodine-131. However, the tap water boiling tests in this study showed no iodine-131 loss from the tap water with either short-term boiling (1-10 min) or prolonged boiling (up to 30 min) resulting in up to 3-fold volume reductions. In this situation, boiling was shown to be not effective in removing iodine-131 from tap water; indeed even higher concentrations may result from the liquid-volume reduction accompanying this process. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Quantitative Analysis of High Dose Radioimmunotherapy with I-131 Anti-CD20 Monoclonal Antibody (Rituximab) in Patients with Non-Hodgkin's Lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyeong Min; Kang, Hye Jin; Choi, Tae Hyun; Cheon, Gi Jeong; Choi, Chang Woon; Lim, Sang Moo [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2006-07-01

    Radioimmunotherapy (RIT) is therapeutic method for treatment of patient with incurable disease. I-131 is an radioisotope widely used for both diagnostic imaging and therapy, because of simultaneous emitting both gamma- and beta-ray. Recently, RIT using I-131 anti- CD20 rituximab has been introduced as one of the promising therapeutic model to treat patient with non- Hodgkin's Lymphoma (NHL). Although dosimetric approaches of low-dose I-131 rituximab imaging have been reported, there is no study of dosimetry with high dose imaging in patient with NHL yet. In this study, we evaluated strategy of high-dose RIT and investigated the kinetic behavior and absorbed dose to bone marrow and whole body in RIT study with high-dose strategy using I-131 rituximab for NHL.

  13. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma.

    Science.gov (United States)

    Lin, J D; Kao, P F; Weng, H F; Lu, W T; Huang, M J

    1998-07-01

    Radioactive iodine (131I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. 201Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative 131I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of 201Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of 131I and 201Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative 201Tl and 131I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. 201Tl imaging was performed before the 131I studies. Of the 62 patients who underwent 201Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the 201Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic 131I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by 201Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative 201Tl scans, 11 had positive findings on 131I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on 131I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative 201Tl and 131I scans, 15 had elevated serum Tg levels. Among these, local recurrence followed by lung metastases was manifested in

  14. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lin Jen-Der; Weng Hsiao-Fen; Lu Wen-Tsoung [Division of Endocrinology and Metabolism, Chang Gung Memorial Hospital (Taiwan, Province of China); Kao Pan-Fu; Huang Miau-Ju [Department of Nuclear Medicine, Chang Gung Memorial Hospital, Taiwan (Taiwan, Province of China)

    1998-07-01

    Radioactive iodine ({sup 131}I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. {sup 201}Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative {sup 131}I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of {sup 201}Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of {sup 131}I and {sup 201}Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative {sup 201}Tl and {sup 131}I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. {sup 201}Tl imaging was performed before the {sup 131}I studies. Of the 62 patients who underwent {sup 201}Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the {sup 201}Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic {sup 131}I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by {sup 201}Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative {sup 201}Tl scans, 11 had positive findings on {sup 131}I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on {sup 131}I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative {sup 201}Tl and {sup 131}I

  15. Superparamagnetic iron oxide nanoparticles mediated (131)I-hVEGF siRNA inhibits hepatocellular carcinoma tumor growth in nude mice.

    Science.gov (United States)

    Chen, Jing; Zhu, Shu; Tong, Liangqian; Li, Jiansha; Chen, Fei; Han, Yunfeng; Zhao, Ming; Xiong, Wei

    2014-02-21

    Hepatocellular carcinoma (HCC) is a primary liver tumor and is the most difficult human malignancy to treat. In this study, we sought to develop an integrative approach in which real-time tumor monitoring, gene therapy, and internal radiotherapy can be performed simultaneously. This was achieved through targeting HCC with superparamagnetic iron oxide nanoparticles (SPIOs) carrying small interfering RNA with radiolabled iodine 131 (131I) against the human vascular endothelial growth factor (hVEGF). hVEGF siRNA was labeled with 131I by the Bolton-Hunter method and conjugated to SilenceMag, a type of SPIOs. 131I-hVEGF siRNA/SilenceMag was then subcutaneously injected into nude mice with HCC tumors exposed to an external magnetic field (EMF). The biodistribution and cytotoxicity of 131I-hVEGF siRNA/SilenceMag was assessed by SPECT (Single-Photon Emission Computed Tomography) and MRI (Magnetic Resonance Imaging) studies and blood kinetics analysis. The body weight and tumor size of nude mice bearing HCC were measured daily for the 4-week duration of the experiment. 131I-hVEGF siRNA/SilenceMag was successfully labeled; with a satisfactory radiochemical purity (>80%) and biological activity in vitro. External application of an EMF successfully attracted and retained more 131I-hVEGF siRNA/SilenceMag in HCC tumors as shown by SPECT, MRI and biodistribution studies. The tumors treated with 131I-hVEGF siRNA/SilenceMag grew nearly 50% slower in the presence of EMF than those without EMF and the control. Immunohistochemical assay confirmed that the tumor targeted by 131I-hVEGF siRNA/SilenceMag guided by an EMF had a lower VEGF protein level compared to that without EMF exposure and the control. EMF-guided 131I-hVEGF siRNA/SilenceMag exhibited an antitumor effect. The synergic therapy of 131I-hVEGF siRNA/SilenceMag might be a promising future treatment option against HCC with the dual functional properties of tumor therapy and imaging.

  16. Acute versus chronic loss of mammalian Azi1/Cep131 results in distinct ciliary phenotypes.

    Directory of Open Access Journals (Sweden)

    Emma A Hall

    Full Text Available Defects in cilium and centrosome function result in a spectrum of clinically-related disorders, known as ciliopathies. However, the complex molecular composition of these structures confounds functional dissection of what any individual gene product is doing under normal and disease conditions. As part of an siRNA screen for genes involved in mammalian ciliogenesis, we and others have identified the conserved centrosomal protein Azi1/Cep131 as required for cilia formation, supporting previous Danio rerio and Drosophila melanogaster mutant studies. Acute loss of Azi1 by knock-down in mouse fibroblasts leads to a robust reduction in ciliogenesis, which we rescue by expressing siRNA-resistant Azi1-GFP. Localisation studies show Azi1 localises to centriolar satellites, and traffics along microtubules becoming enriched around the basal body. Azi1 also localises to the transition zone, a structure important for regulating traffic into the ciliary compartment. To study the requirement of Azi1 during development and tissue homeostasis, Azi1 null mice were generated (Azi1(Gt/Gt. Surprisingly, Azi1(Gt/Gt MEFs have no discernible ciliary phenotype and moreover are resistant to Azi1 siRNA knock-down, demonstrating that a compensation mechanism exists to allow ciliogenesis to proceed despite the lack of Azi1. Cilia throughout Azi1 null mice are functionally normal, as embryonic patterning and adult homeostasis are grossly unaffected. However, in the highly specialised sperm flagella, the loss of Azi1 is not compensated, leading to striking microtubule-based trafficking defects in both the manchette and the flagella, resulting in male infertility. Our analysis of Azi1 knock-down (acute loss versus gene deletion (chronic loss suggests that Azi1 plays a conserved, but non-essential trafficking role in ciliogenesis. Importantly, our in vivo analysis reveals Azi1 mediates novel trafficking functions necessary for flagellogenesis. Our study highlights the

  17. 131I therapy for hyperthyroidism and consequent appearing of anaplastic carcinoma of the thyroid: simple case-report or real pathophysiologic link?

    Directory of Open Access Journals (Sweden)

    G. Scanelli

    2013-05-01

    Full Text Available BACKGROUND 131I is usually employed for the therapy of hyperfunctioning thyroid diseases. This β-emitting radioisotope acts releasing its radiations in small tissue volumes, but it is mandatory to consider, also for the small doses, the carcinogenic risk, well documented with the high 131I dosages used to cure differentiated thyroid cancers. METHODS We describe a case of anaplastic thyroid carcinoma appeared 4 years after therapy with 131I for Graves’ disease. The patient was treated both surgically and with thyonamides for Graves’ disease 20 years before; thereafter she underwent simple nephrectomy owing to Grawitz disease. After some years of well being, she was treated with 131I for a relapse of Graves’ disease. Four years later, she was treated with interleukin-2 and TNF-α, owing to distant metastases (pancreas, liver and lung of Grawitz cancer. Some months later, because of a rapid enlargement of the thyroid gland, she was thyroidectomized and anaplastic thyroid cancer was histologically documented. DISCUSSION AND CONCLUSIONS It is very difficult to investigate the possible transformation of a benign thyroid lesion to a malignant one, and data from the literature are conflicting. Fractioned doses of 131I are known to induce less cancers than high doses: they allow DNA to repair. Nevertheless, in patients with altered or non valid genetic repair’s mechanisms (i.e. patients with p53 mutations and, for this reason, prone to develop cancers, even low doses of 131I can induce carcinogenetic effects. In a patient with a history of cancer, who subsequently develops hyperthyroidism, even low doses of 131I can induce anaplastic thyroid cancer; in these subjects, therefore, other treatments than 131I could be preferred for the therapy of Graves’ disease. In our peculiar case, moreover, some studies have noteworthy demonstrated that certain cytokines (IL-1, TGF-β1 e TNF-α can, rather than inhibit, induce anaplastic thyroid cancer cells

  18. Bilateral renal metastasis of 261-265huerthle cell thyroid cancer with discordant uptake between I-131 sodium iodide and F-18 FDG

    Energy Technology Data Exchange (ETDEWEB)

    Claimon, Apichaya; Suh, Min Seok; Cheon, Gi Jeong; Lee, Dong Soo; Chung, June Key [Dept. of Nuclear Medicine, Seoul National University Hospital, Seoul (Korea, Republic of); Kim, E. Edmund [Dept. of Radiological Sciences, University of California, Irvine (United States)

    2017-09-15

    Renal metastasis of thyroid cancer is extremely rare. We report the case of a 62-year-old woman with Hürthle cell thyroid cancer (HCTC) with lungs, bones, and bilateral kidneys metastases. The renal metastatic lesions were clearly demonstrated by {sup 131}I whole body scan (WBS) with SPECT/CT. However, they exhibited false-negative results in {sup 18}F-FDG PET/CT, kidney ultrasonography, and contrast-enhanced CT scan. The findings imply that tumors have low glucose metabolism and are able to accumulate radioiodine, which is not commonly found in the relatively aggressive nature of HCTC. The patient received two sessions of 200 mCi {sup 131}I therapy within 6 months duration. There was complete treatment response as evaluated by the second post-therapeutic {sup 131}I SPECT/CT and serum thyroglobulin. To our knowledge, renal metastasis from HCTC with positive {sup 131}I but negative {sup 18}F-FDG uptake has not been reported in the literature. This case suggests that {sup 131}I SPECT/CT is useful for lesion localization and prediction of {sup 131}I therapy response.

  19. A case of therapy-related acute myeloid leukemia with inv(16)(p13.1q22) after single low-dose iodine-131 treatment for thyroid cancer

    OpenAIRE

    Jeong, Ji Hun; Ahn, Jeong Yeal; Park, Soon Ho; Park, Mi Jung; Kim, Kyung Hee; Hong, Jun Shik

    2012-01-01

    Radioiodine is regularly used in the treatment of thyroid cancer to eliminate residual malignant tissue after thyroidectomy and to treat metastasis. Because of the low dose of radioiodine used to treat thyroid cancer patients, leukemia is an uncommon complication of exposure to radioiodine. Here, we present a patient who developed therapy-related acute myeloid leukemia with inv(16)(p13.1q22);CBFβ-MYH11, eosinophilia, and K-ras mutation and who had been treated with very low-dose radioiodine f...

  20. Analysis of the duration of the recommendation of radiation protection in the treatment of metabolic therapy with iodine-131; Analisis de la duracion de las recomendaciones sobre proteccion radiologica en los tratamientos de terapia metabolica con yodo-131

    Energy Technology Data Exchange (ETDEWEB)

    Castro Ramirez, I. J.; Quinones Rodriguez, L. A.; Iborra Oquendo, M. a.; Urena Llinares, A.; Ramos Caballero, L. J.; Seguro Fernandez, A.; Mora Melendez, R.; Angulo Pain, E.

    2013-07-01

    The iodine-131 therapy has become the treatment with radiopharmaceuticals more frequent in our country, as well as the largest source of exposure to ionizing radiation for members who surround the patient. The aim of this article is to analyse the recommendations of radiological protection which are delivered to the patient receiving radiation discharge, in terms of the duration of the same time, taking into account the radiopharmaceutical dose, the time of entry, the dose rate measured at one meter and the family environment among others. (Author)