Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui
2017-01-01
Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.
Crowdus, Carolyn A; Marsh, Antoinette E; Saville, Willliam J; Lindsay, David S; Dubey, J P; Granstrom, David E; Howe, Daniel K
2008-11-25
Sarcocystis neurona is an obligate intracellular parasite that causes equine protozoal myeloencephalitis (EPM). Previous work has identified a gene family of paralogous surface antigens in S. neurona called SnSAGs. These surface proteins are immunogenic in their host animals, and are therefore candidate molecules for development of diagnostics and vaccines. However, SnSAG diversity exists in strains of S. neurona, including the absence of the major surface antigen gene SnSAG1. Instead, sequence for an alternative SnSAG has been revealed in two of the SnSAG1-deficient strains. Herein, we present data characterizing this new surface protein, which we have designated SnSAG5. The results indicated that the protein encoded by the SnSAG5 sequence is indeed a surface-associated molecule that has characteristics consistent with the other SAGs identified in S. neurona and related parasites. Importantly, Western blot analyses of a collection of S. neurona strains demonstrated that 6 of 13 parasite isolates express SnSAG5 as a dominant surface protein instead of SnSAG1. Conversely, SnSAG5 was not detected in SnSAG1-positive strains. One strain, which was isolated from the brain of a sea otter, did not express either SnSAG1 or SnSAG5. Genetic analysis with SnSAG5-specific primers confirmed the presence of the SnSAG5 gene in Western blot-positive strains, while also suggesting the presence of a novel SnSAG sequence in the SnSAG1-deficient, SnSAG5-deficient otter isolate. The findings provide further indication of S. neurona strain diversity, which has implications for diagnostic testing and development of vaccines against EPM as well as the population biology of Sarcocystis cycling in the opossum definitive host.
Salivary agglutinin/DMBT1SAG expression is up-regulated in the presence of salivary gland tumors
DEFF Research Database (Denmark)
Bikker, F J; van der Wal, J E; Ligtenberg, A J M
2004-01-01
Salivary agglutinin (SAG) is encoded by the gene Deleted in Malignant Brain Tumors 1 (DMBT1) and represents the salivary variant of DMBT1 (DMBT1(SAG)). While SAG is a bona fide anti-caries factor, DMBT1 was proposed as a candidate tumor-suppressor for brain, digestive tract, and lung cancer. Thou...
Jones, G W; Hooley, P; Farrington, S M; Shawcross, S G; Iwanejko, L A; Strike, P
1999-03-01
Mutations within the sagA gene of Aspergillus nidulans cause sensitisation to DNA-damaging chemicals but have no effect upon spontaneous or damage-induced mutation frequency. The sagA gene was cloned on a 19-kb cosmid-derived fragment by functional complementation of a sagA1 sagC3 double mutant; subsequently, a fragment of the gene was also isolated on a 3.9-kb genomic subclone. Initial sequencing of a small section of the 19-kb fragment allowed the design of primers that were subsequently used in RTPCR experiments to show that this DNA is transcribed. A 277-bp fragment derived from the transcribed region was used to screen an A. nidulans cDNA library, resulting in the isolation of a 1.4-kb partial cDNA clone which had sequence overlap with the genomic sagA fragment. This partial cDNA was incomplete but appeared to contain the whole coding region of sagA. The sagA1 mutant was shown to possess two mutations; a G-T transversion and a+ 1 frameshift due to insertion of a T. causing disruption to the C-terminal region of the SagA protein. Translation of the sagA cDNA predicts a protein of 378 amino acids, which has homology to the Saccharomyces cerevisiae End3 protein and also to certain mammalian proteins capable of causing cell transformation.
Leito, Jelani T. D.; Ligtenberg, Antoon J. M.; van Houdt, Michel; van den Berg, Timo K.; Wouters, Diana
2011-01-01
Salivary agglutinin (SAG), also known as gp-340 and Deleted in Malignant Brain Tumours 1, is a glycoprotein that is present in tears, lung fluid and mucosal surfaces along the gastrointestinal tract. It is encoded by the Deleted in Malignant Brain Tumours 1 gene, a member of the Scavenger Receptor
Gupta, Kajal; Marques, Cláudia N. H.; Petrova, Olga E.
2013-01-01
A hallmark characteristic of biofilms is their extraordinary tolerance to antimicrobial agents. While multiple factors are thought to contribute to the high level of antimicrobial tolerance of biofilms, little is known about the timing of induction of biofilm tolerance. Here, we asked when over the course of their development do biofilms gain their tolerance to antimicrobial agents? We demonstrate that in Pseudomonas aeruginosa, biofilm tolerance is linked to biofilm development, with transition to the irreversible attachment stage regulated by the two-component hybrid SagS, marking the timing when biofilms switch to the high-level tolerance phenotype. Inactivation of sagS rendered biofilms but not planktonic cells more susceptible to tobramycin, norfloxacin, and hydrogen peroxide. Moreover, inactivation of sagS also eliminated the recalcitrance of biofilms to killing by bactericidal antimicrobial agents, a phenotype comparable to that observed upon inactivation of brlR, which encodes a MerR-like transcriptional regulator required for biofilm tolerance. Multicopy expression of brlR in a ΔsagS mutant restored biofilm resistance and recalcitrance to killing by bactericidal antibiotics to wild-type levels. In contrast, expression of sagS did not restore the susceptibility phenotype of ΔbrlR mutant biofilms to wild-type levels, indicating that BrlR functions downstream of SagS. Inactivation of sagS correlated with reduced BrlR levels in biofilms, with the produced BrlR being impaired in binding to the previously described BrlR-activated promoters of the two multidrug efflux pump operons mexAB-oprM and mexEF-oprN. Our findings demonstrate that biofilm tolerance is linked to early biofilm development and SagS, with SagS contributing indirectly to BrlR activation. PMID:23995639
Dingemans, Jozef; Poudyal, Bandita
2018-01-01
ABSTRACT The formation of inherently drug-tolerant biofilms by the opportunistic pathogen Pseudomonas aeruginosa requires the sensor-regulator hybrid SagS, with ΔsagS biofilms being unstructured and exhibiting increased antimicrobial susceptibility. Recent findings indicated SagS to function as a switch to control biofilm formation and drug tolerance independently. Moreover, findings suggested the periplasmic sensory HmsP domain of SagS is likely to be the control point in the regulation of biofilm formation and biofilm cells transitioning to a drug-tolerant state. We thus asked whether specific amino acid residues present in the HmsP domain contribute to the switch function of SagS. HmsP domain residues were therefore subjected to alanine replacement mutagenesis to identify substitutions that block the sensory function(s) of SagS, which is apparent by attached cells being unable to develop mature biofilms and/or prevent transition to an antimicrobial-resistant state. Mutant analyses revealed 32 residues that only contribute to blocking one sensory function. Moreover, amino acid residues affecting attachment and subsequent biofilm formation but not biofilm tolerance also impaired histidine kinase signaling via BfiS. In contrast, residues affecting biofilm drug tolerance but not attachment and subsequent biofilm formation negatively impacted BrlR transcription factor levels. Structure prediction suggested the two sets of residues affecting sensory functions are located in distinct areas that were previously described as being involved in ligand binding interactions. Taken together, these studies identify the molecular basis for the dual regulatory function of SagS. IMPORTANCE The membrane-bound sensory protein SagS plays a pivotal role in P. aeruginosa biofilm formation and biofilm cells gaining their heightened resistance to antimicrobial agents, with SagS being the control point at which both pathways diverge. Here, we demonstrate for the first time that the two
Howe, Daniel K; Gaji, Rajshekhar Y; Mroz-Barrett, Meaghan; Gubbels, Marc-Jan; Striepen, Boris; Stamper, Shelby
2005-02-01
Sarcocystis neurona is a member of the Apicomplexa that causes myelitis and encephalitis in horses but normally cycles between the opossum and small mammals. Analysis of an S. neurona expressed sequence tag (EST) database revealed four paralogous proteins that exhibit clear homology to the family of surface antigens (SAGs) and SAG-related sequences of Toxoplasma gondii. The primary peptide sequences of the S. neurona proteins are consistent with the two-domain structure that has been described for the T. gondii SAGs, and each was predicted to have an amino-terminal signal peptide and a carboxyl-terminal glycolipid anchor addition site, suggesting surface localization. All four proteins were confirmed to be membrane associated and displayed on the surface of S. neurona merozoites. Due to their surface localization and homology to T. gondii surface antigens, these S. neurona proteins were designated SnSAG1, SnSAG2, SnSAG3, and SnSAG4. Consistent with their homology, the SnSAGs elicited a robust immune response in infected and immunized animals, and their conserved structure further suggests that the SnSAGs similarly serve as adhesins for attachment to host cells. Whether the S. neurona SAG family is as extensive as the T. gondii SAG family remains unresolved, but it is probable that additional SnSAGs will be revealed as more S. neurona ESTs are generated. The existence of an SnSAG family in S. neurona indicates that expression of multiple related surface antigens is not unique to the ubiquitous organism T. gondii. Instead, the SAG gene family is a common trait that presumably has an essential, conserved function(s).
Howe, Daniel K.; Gaji, Rajshekhar Y.; Mroz-Barrett, Meaghan; Gubbels, Marc-Jan; Striepen, Boris; Stamper, Shelby
2005-01-01
Sarcocystis neurona is a member of the Apicomplexa that causes myelitis and encephalitis in horses but normally cycles between the opossum and small mammals. Analysis of an S. neurona expressed sequence tag (EST) database revealed four paralogous proteins that exhibit clear homology to the family of surface antigens (SAGs) and SAG-related sequences of Toxoplasma gondii. The primary peptide sequences of the S. neurona proteins are consistent with the two-domain structure that has been described for the T. gondii SAGs, and each was predicted to have an amino-terminal signal peptide and a carboxyl-terminal glycolipid anchor addition site, suggesting surface localization. All four proteins were confirmed to be membrane associated and displayed on the surface of S. neurona merozoites. Due to their surface localization and homology to T. gondii surface antigens, these S. neurona proteins were designated SnSAG1, SnSAG2, SnSAG3, and SnSAG4. Consistent with their homology, the SnSAGs elicited a robust immune response in infected and immunized animals, and their conserved structure further suggests that the SnSAGs similarly serve as adhesins for attachment to host cells. Whether the S. neurona SAG family is as extensive as the T. gondii SAG family remains unresolved, but it is probable that additional SnSAGs will be revealed as more S. neurona ESTs are generated. The existence of an SnSAG family in S. neurona indicates that expression of multiple related surface antigens is not unique to the ubiquitous organism T. gondii. Instead, the SAG gene family is a common trait that presumably has an essential, conserved function(s). PMID:15664946
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas
2007-12-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known
Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O.; Podbielski, Andreas
2007-01-01
Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known
A Simple Sag Generator Using SSRs
DEFF Research Database (Denmark)
Senturk, Osman Selcuk; Hava, Ahmet M.
2010-01-01
conditions (critical loads) and this property often may not be accommodated inside the device itself and sag compensating power conditioners have been developed for such purposes. While in practice voltage sags are not wanted, generating sags becomes necessary for the purpose of experimentally verifying...... the performances of the equipment (both the equipment under sag condition and the sag compensating power conditioner) under sag conditions. In this work, a simple and economical, yet highly performing sag generator is developed, its design discussed, and its feasibility demonstrated by experiments. The proposed...... is evaluated and finally the utilization of the sag generator in the test of a series active filter based power quality conditioner is demonstrated. The proposed approach provides an effective solution for voltage sag generation....
Sun, Yun; Sun, Li; Xing, Ming-qing; Liu, Chun-sheng; Hu, Yong-hua
2013-11-12
Streptococcus iniae is a Gram-positive bacterium and a severe pathogen of a wide range of farmed fish. S. iniae possesses a virulence-associated streptolysin S cluster composed of several components, one of which is SagE. SagE a transmembrane protein with one major extracellular region named ECR. This study aimed to develop a SagE-based DNA candidate vaccine against streptococcosis and examine the immunoprotective mechanism of the vaccine. We constructed a DNA vaccine, pSagE, based on the sagE gene and examined its immunological property in a Japanese flounder (Paralichthys olivaceus) model. The results showed that at 7 days post-vaccination, expression of SagE at transcription and translation levels was detected in the tissues of the vaccinated fish. After challenge with S. iniae at one and two months post-vaccination, pSagE-vaccinated fish exhibited relative percent survival (RPS) of 95% and 88% respectively. Immunological analysis showed that (i) pSagE significantly upregulated the expression of a wide range of immune genes, (ii) pSagE induced the production of specific serum antibodies that bound whole-cell S. iniae, and (iii) treatment of S. iniae with pSagE-induced antibodies blocked bacterial invasion of host cells. To localize the immunoprotective domain of SagE, the ECR-expressing DNA vaccine pSagEECR was constructed. Immunization analysis showed that flounder vaccinated with pSagEECR exhibited a RPS of 68%, and that pSagEECR induced serum antibody production and immune gene expression in a manner similar to, though to lower magnitudes than, those induced by pSagE. We in this study developed a DNA vaccine, pSagE, which induces highly protective immunity against S. iniae. The protective effect of pSagE is probably due to its ability to elicit systemic immune response, in particular that of the humoral branch, which leads to production of specific serum antibodies that impair bacterial infection. These results add insights to the immunoprotective mechanism
Liu, Tingqi; Huang, Jingwei; Li, Yanlin; Ehsan, Muhammad; Wang, Shuai; Zhou, Zhouyang; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2018-05-30
Coccidiosis is recognised as a major parasitic disease in chickens. Eimeria maxima is considered as a highly immunoprotective species within the Eimeria spp. family that infects chickens. In the present research, the surface antigen gene of E. maxima (EmSAG) was cloned, and the ability of EmSAG to stimulate protection against E. maxima was evaluated. Prokaryotic and eukaryotic plasmids expressing EmSAG were constructed. The EmSAG transcription and expression in vivo was performed based on the RT-PCR and immunoblot analysis. The expression of EmSAG in sporozoites and merozoites was detected through immunofluorescence analyses. The immune protection was assessed based on challenge experiments. Flow cytometry assays were used to determine the T cell subpopulations. The serum antibody and cytokine levels were evaluated by ELISA. The open reading frame (ORF) of EmSAG gene contained 645 bp encoding 214 amino acid residues. The immunoblot and RT-PCR analyses indicated that the EmSAG gene were transcribed and expressed in vivo. The EmSAG proteins were expressed in sporozoite and merozoite stages of E. maxima by the immunofluorescence assay. Challenge experiments showed that both pVAX1-SAG and the recombinant EmSAG (rEmSAG) proteins were successful in alleviating jejunal lesions, decreasing loss of body weight and the oocyst ratio. Additionally, these experiments possessed anticoccidial indices (ACI) of more than 170. Higher percentages of CD4 + and CD8 + T cells were detected in both EmSAG-inoculated birds than those of the negative control groups (P maxima.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
An Estimation Method of System Voltage Sag Profile using Recorded Sag Data
Tanaka, Kazuyuki; Sakashita, Tadashi
The influence of voltage sag to electric equipment has become big issues because of wider utilization of voltage sensitive devices. In order to reduce the influence of voltage sag appearing at each customer side, it is necessary to recognize the level of receiving voltage drop due to lightning faults for transmission line. However it is hard to measure directly those sag level at every load node. In this report, a new method of efficiently estimating system voltage sag profile is proposed based on symmetrical coordinate. In the proposed method, limited recorded sag data is used as the estimation condition which is recorded at each substation in power systems. From the point of view that the number of the recorded node is generally far less than those of the transmission route, a fast solution method is developed to calculate only recorder faulted voltage by applying reciprocity theorem for Y matrix. Furthermore, effective screening process is incorporated, in which the limited candidate of faulted transmission line can be chosen. Demonstrative results are presented using the IEEJ East10 standard system and actual 1700 bus system. The results show that estimation accuracy is sufficiently acceptable under less computation labor.
Cytokine Gene Expression in Response to SnSAG1 in Horses with Equine Protozoal Myeloencephalitis
Spencer, Jennifer A.; Deinnocentes, Patricia; Moyana, Edith M.; Guarino, Anthony J.; Ellison, Siobhan E.; Bird, R. Curtis; Blagburn, Byron L.
2005-01-01
Equine protozoal myeloencephalitis (EPM) is a neurologic syndrome seen in horses from the Americas and is mainly caused by Sarcocystis neurona. Recently, a 29-kDa surface antigen from S. neurona merozoites was identified as being highly immunodominant on a Western blot. This antigen has been sequenced and cloned, and the expressed protein has been named SnSAG1. In a previous study, cell-mediated immune responses to SnSAG1 were shown to be statistically significantly reduced in horses with EPM in comparison to EPM-negative control horses. It therefore appears as though the parasite is able to induce immunosuppression towards parasite-derived antigens as parasite-specific responses are decreased. Isolated peripheral blood lymphocytes from 21 EPM (cerebrospinal fluid [CSF] Western blot)-negative horses with no clinical signs and 21 horses with clinical signs of EPM (CSF Western blot positive) were cocultured with SnSAG1 for 48 and 72 h, and the effect on cytokine production was investigated by means of reverse transcriptase PCR. Cytokines assayed include gamma interferon (IFN-γ), tumor necrosis factor alpha, interleukin (IL)-2, IL-4, and IL-6. β-Actin was used as the housekeeping gene. A Wilcoxon signed-rank test of the findings indicated that there was a statistically significant decrease in IFN-γ production after 48 h in culture for samples from horses with clinical disease. There was also a statistically significant increase in IL-4 production after 72 h in culture for samples from horses with EPM. These results further support the notion that this parasite is able to subvert the immune system in horses with clinical disease. PMID:15879026
Traffic Flow at Sags : Theory, Modeling and Control
Goni-Ros, B.
2016-01-01
Sag vertical curves (sags) are roadway sections along which the gradient increases gradually in the direction of traffic. Empirical observations show that, on freeways, traffic congestion often occurs at sags; actually, in some countries (e.g., Japan), sags are one of the most common types of
Mendes, Érica Araújo; Fonseca, Flavio G; Casério, Bárbara M; Colina, Janaína P; Gazzinelli, Ricardo Tostes; Caetano, Braulia C
2013-01-01
The use of recombinant viral vectors expressing T. gondii antigens is a safe and efficient approach to induce immune response against the parasite and a valuable tool for vaccine development. We have previously protected mice from toxoplasmosis by immunizing the animals with an adenovirus expressing the protein SAG1 (AdSAG1) of T. gondii. We are now looking for ways to improve the vaccination strategy and enhance protection. One limitation of homologous vaccinations (sequential doses of the same vector) is induction of anti-vector immune response that blocks cell transduction, restricts transgene expression and, consequently, compromises the overall outcome of vaccination. One way to avert the effects of anti-vector response is to use different viruses in prime and boost (heterologous vaccination). Bearing this in mind, we generated a modified Vaccinia Virus Ankara encoding SAG1 (MVASAG1), to be tested as boost agent after prime with AdSAG1. Although minor differences were observed in the magnitude of the anti-SAG1 immune response induced by each vaccination protocol, the heterologous immunization with AdSAG1 followed by MVASAG1 resulted in improved capacity to control brain cyst formation in a model of chronic toxoplasmosis in C57BL/6 mice.
Directory of Open Access Journals (Sweden)
Érica Araújo Mendes
Full Text Available The use of recombinant viral vectors expressing T. gondii antigens is a safe and efficient approach to induce immune response against the parasite and a valuable tool for vaccine development. We have previously protected mice from toxoplasmosis by immunizing the animals with an adenovirus expressing the protein SAG1 (AdSAG1 of T. gondii. We are now looking for ways to improve the vaccination strategy and enhance protection. One limitation of homologous vaccinations (sequential doses of the same vector is induction of anti-vector immune response that blocks cell transduction, restricts transgene expression and, consequently, compromises the overall outcome of vaccination. One way to avert the effects of anti-vector response is to use different viruses in prime and boost (heterologous vaccination. Bearing this in mind, we generated a modified Vaccinia Virus Ankara encoding SAG1 (MVASAG1, to be tested as boost agent after prime with AdSAG1. Although minor differences were observed in the magnitude of the anti-SAG1 immune response induced by each vaccination protocol, the heterologous immunization with AdSAG1 followed by MVASAG1 resulted in improved capacity to control brain cyst formation in a model of chronic toxoplasmosis in C57BL/6 mice.
Howe, Daniel K; Gaji, Rajshekhar Y; Marsh, Antoinette E; Patil, Bhagyashree A; Saville, William J; Lindsay, David S; Dubey, J P; Granstrom, David E
2008-05-01
A gene family of surface antigens is expressed by merozoites of Sarcocystis neurona, the primary cause of equine protozoal myeloencephalitis (EPM). These surface proteins, designated SnSAGs, are immunodominant and therefore excellent candidates for development of EPM diagnostics or vaccines. Prior work had identified an EPM isolate lacking the major surface antigen SnSAG1, thus suggesting there may be some diversity in the SnSAGs expressed by different S. neurona isolates. Therefore, a bioinformatic, molecular and immunological study was conducted to assess conservation of the SnSAGs. Examination of an expressed sequence tag (EST) database revealed several notable SnSAG polymorphisms. In particular, the EST information implied that the EPM strain SN4 lacked the major surface antigen SnSAG1. The absence of this surface antigen from the SN4 strain was confirmed by both Western blot and Southern blot. To evaluate SnSAG polymorphisms in the S. neurona population, 14 strains were examined by Western blots using monospecific polyclonal antibodies against the four described SnSAGs. The results of these analyses demonstrated that SnSAG2, SnSAG3, and SnSAG4 are present in all 14 S. neurona strains tested, although some variance in SnSAG4 was observed. Importantly, SnSAG1 was not detected in seven of the strains, which included isolates from four cases of EPM and a case of fatal meningoencephalitis in a sea otter. Genetic analyses by PCR using gene-specific primers confirmed the absence of the SnSAG1 locus in six of these seven strains. Collectively, the data indicated that there is heterogeneity in the surface antigen composition of different S. neurona isolates, which is an important consideration for development of serological tests and prospective vaccines for EPM. Furthermore, the diversity reported herein likely extends to other phenotypes, such as strain virulence, and may have implications for the phylogeny of the various Sarcocystis spp. that undergo sexual stages
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Antigenic evaluation of a recombinant baculovirus-expressed Sarcocystis neurona SAG1 antigen.
Gupta, G D; Lakritz, J; Saville, W J; Livingston, R S; Dubey, J P; Middleton, J R; Marsh, A E
2004-10-01
Sarcocystis neurona is the primary parasite associated with equine protozoal myeloencephalitis (EPM). This is a commonly diagnosed neurological disorder in the Americas that infects the central nervous system of horses. Current serologic assays utilize culture-derived parasites as antigen. This method requires large numbers of parasites to be grown in culture, which is labor intensive and time consuming. Also, a culture-derived whole-parasite preparation contains conserved antigens that could cross-react with antibodies against other Sarcocystis species and members of Sarcocystidae such as Neospora spp., Hammondia spp., and Toxoplasma gondii. Therefore, there is a need to develop an improved method for the detection of S. neurona-specific antibodies. The sera of infected horses react strongly to surface antigen 1 (SnSAG1), an approximately 29-kDa protein, in immunoblot analysis, suggesting that it is an immunodominant antigen. The SnSAG1 gene of S. neurona was cloned, and recombinant S. neurona SAG1 protein (rSnSAG1-Bac) was expressed with the use of a baculovirus system. By immunoblot analysis, the rSnSAG1-Bac antigen detected antibodies to S. neurona from naturally infected and experimentally inoculated equids, cats, rabbit, mice, and skunk. This is the first report of a baculovirus-expressed recombinant S. neurona antigen being used to detect anti-S. neurona antibodies in a variety of host species.
Installation of the sag compensator for HANARO
International Nuclear Information System (INIS)
Kim, Hyung Kyoo; Jung, Hoan Sung; Lim, In Cheol; Ahn, Guk Hoon
2008-01-01
Electric power is essential for all industrial plants and also for nuclear facilities. HANARO is a research reactor which produces a 30MW thermal power. HANARO is designed to be tripped automatically when interruptions or some extent of sags occur. HANARO has the reactor regulation system(RRs) and reactor protection system(RPS). HANARO is designed so as to be tripped automatically by insertion of control absorber rods(CAR) and shut off rods(SOR). When voltage sag or momentary interruption occurs, the reactor has an unwanted trip by insertion of CARs and SORs even though the process systems are still in operation. HANARO was experienced in a nuisance trip as often as the unexpected voltage sag and/or momentary interruption occurs. We installed the voltage sag compensator voltage sag assessment of the AC coil contactor which is a component of the power supply unit for the SORs. The compensation time is determined to be less than 1 sec in consideration of the reactor safety. This paper is concerned with the impact of the momentary interruption on the reactor and the effect of the voltage sag compensator
Gautam, A; Dubey, J P; Saville, W J; Howe, D K
2011-12-29
Sarcocystis neurona is a two-host coccidian parasite whose complex life cycle progresses through multiple developmental stages differing at morphological and molecular levels. The S. neurona merozoite surface is covered by multiple, related glycosylphosphatidylinositol-linked proteins, which are orthologous to the surface antigen (SAG)/SAG1-related sequence (SRS) gene family of Toxoplasma gondii. Expression of the SAG/SRS proteins in T. gondii and another related parasite Neospora caninum is life-cycle stage specific and seems necessary for parasite transmission and persistence of infection. In the present study, the expression of S. neurona merozoite surface antigens (SnSAGs) was evaluated in the sporozoite and bradyzoite stages. Western blot analysis was used to compare SnSAG expression in merozoites versus sporozoites, while immunocytochemistry was performed to examine expression of the SnSAGs in merozoites versus bradyzoites. These analyses revealed that SnSAG2, SnSAG3 and SnSAG4 are expressed in sporozoites, while SnSAG5 was appeared to be downregulated in this life cycle stage. In S. neurona bradyzoites, it was found that SnSAG2, SnSAG3, SnSAG4 and SnSAG5 were either absent or expression was greatly reduced. As shown for T. gondii, stage-specific expression of the SnSAGs may be important for the parasite to progress through its developmental stages and complete its life cycle successfully. Thus, it is possible that the SAG switching mechanism by these parasites could be exploited as a point of intervention. As well, the alterations in surface antigen expression during different life cycle stages may need to be considered when designing prospective approaches for protective vaccination. Copyright © 2011 Elsevier B.V. All rights reserved.
Installation of the sag compensator for HANARO
International Nuclear Information System (INIS)
Kim, Hyungkyoo; Jung, Hoansung; Lim, Incheol; Ahn, Gukhoon
2008-01-01
Electric power is essential for all industrial plants and also for nuclear facilities. HANARO is a research reactor which produces a 30 MW thermal power. HANARO is designed to be tripped automatically when interruptions or some extent of sags occur. HANARO has the reactor regulation system(RRS) and reactor protection system(RPS). HANARO is designed so as to be tripped automatically by insertion of control absorber rods(CAR) and shut-off rods(SOR). When voltage sag or momentary interruption occurs, the reactor has an unwanted trip by insertion of CARs and SORs even though the process systems are still in operation. HANARO was experienced in a nuisance trip as often as the unexpected voltage sag and/or momentary interruption occurs. We installed the voltage sag compensator on the power supply for CARs and SORs so as to prevent an unwanted trip. We undertook voltage sag assessment of the AC coil contactor which is a component of the power supply unit for the SORs. The compensation time is determined to be less than 1 sec in consideration of the reactor safety. This paper is concerned with the impact of the momentary interruption on the reactor and the effect of the voltage sag compensator. (author)
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
A Simple Sag Generator Using SSRs
DEFF Research Database (Denmark)
Senturk, Osman Selcuk; Hava, Ahmet M.
2012-01-01
SSR (solid state relay, a semiconductor power module of triac characteristics) and variable transformer (variac) based sag generator is built for three-phase 10kVA ratings and balanced/imbalanced voltage sags are demonstrated in the laboratory. The performance under resistive and inductive loads...
Yu, Haijie; Huang, Bin; Zhuo, Xunhui; Chen, Xueqiu; Du, Aifang
2013-11-08
Real-time PCR-based detection of Toxoplasma gondii is very sensitive and convenient for diagnosing toxoplasmosis. However, the performance of the PCR assays could be influenced by the target gene chosen. Here we evaluate a real-time PCR assay using double-stranded DNA dyes (SYBR(®) Green I assay) with a new set of primers targeting the SAG1 gene for the fast and specific detection of T. gondii. The assay showed higher sensitivity than conventional PCR protocols using T. gondii DNA as template. The detection limit of the developed real-time PCR assay was in the order of 1 tachyzoite. The assay was also assessed by experimentally infected mice and showed positive results for blood (25%), spleen (50%) and lung (50%) as early as 1 dpi. The specificity of the assay was confirmed by using DNA from Neospora caninum, Escherichia coli, Babesia bovis, Trypanosoma brucei, Cryptosporidium parvum, and Toxocara canis. Assay applicability was successfully tested in blood samples collected from slaughtered pigs. These results indicate that, based on SYBR(®) green I, the quantitative SAG1 assay may also be useful in the study of the pathogenicity, immunoprophylaxis, and treatment of T. gondii. Copyright © 2013 Elsevier B.V. All rights reserved.
Model Predictive Control for an Industrial SAG Mill
DEFF Research Database (Denmark)
Ohan, Valeriu; Steinke, Florian; Metzger, Michael
2012-01-01
identication. When applied to MIMO systems we call this controller a MIMO-ARX based MPC. We use an industrial Semi-Autogenous Grinding (SAG) mill to illustrate the performance of this controller. SAG mills are the primary units in a grinding chain and also the most power consuming units. Therefore, improved...... control of SAG mills has the potential to signicantly improve eciency and reduce the specic energy consumption for mineral processes. Grinding circuits involving SAG mills are multivariate processes. Commissioning of a control system based on a classical single-loop controllers with logic is time...
Haryati, Sri; Agung Prasetyo, Afiono; Sari, Yulia; Dharmawan, Ruben
2018-05-01
Toxoplasma gondii Surface Antigen 1 (SAG1) is often used as a diagnostic tool due to its immunodominant-specific as antigen. However, data of the Toxoplasma gondii SAG1 protein from Indonesian isolate is limited. To study the protein, genomic DNA was isolated from a Javanese acute toxoplasmosis blood samples patient. A complete coding sequence of Toxoplasma gondii SAG1 was cloned and inserted into an Escherichia coli expression plasmid and sequenced. The sequencing results were subjected to bioinformatics analysis. The Toxoplasma gondii SAG1 complete coding sequences were successfully cloned. Physicochemical analysis revealed the 336 aa of SAG1 had 34.7 kDa of weight. The isoelectric point and aliphatic index were 8.4 and 78.4, respectively. The N-terminal methionine half-life in Escherichia coli was more than 10 hours. The antigenicity, secondary structure, and identification of the HLA binding motifs also had been discussed. The results of this study would contribute information about Toxoplasma gondii SAG1 and benefits for further works willing to develop diagnostic and therapeutic strategies against the parasite.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Down-regulation of OsSAG12-1 results in enhanced senescence ...
Indian Academy of Sciences (India)
2013-07-22
Jul 22, 2013 ... vides staple food nearly half of the world's population and accounts .... Healthy and fresh onion ... served domain comprising approximate 210 aa belongs to the peptidase ..... Lim PO, Kim HJ and Nam HG 2007 Leaf senescence. Annu. Rev. ... Effects of P(SAG12)-IPT gene expression on development and.
The rice OsSAG12-2 gene codes for a functional protease that ...
Indian Academy of Sciences (India)
2016-07-11
Jul 11, 2016 ... Senescence is the final stage of plant development. Although ... Down-regulation of OsSAG12-1 in transgenic rice .... Plants were germinated on soil and grown for 15 days under normal conditions before taking photograph.
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Installation of the sag compensator for HANARO
International Nuclear Information System (INIS)
Kim, H. K.; Jung, H. S.; Ahn, G. H.; Lim, I. C.
2008-01-01
Electric power is essential for all industrial plants and also for nuclear facilities. HANARO is a research reactor which produces a 30MW thermal power. HANARO is designed to be tripped automatically when interruptions or some extents of sags occur. HANARO has the reactor regulation system (RRS) and reactor protection system (RPS). HANARO is designed so as to tripped automatically by insertion of control absorber rods (CAR) and shut-off rods (SOR). When voltage or momentary interruption occurs, the reactor has an unwanted trip by insertion of CARs and SORs even though the process systems are still in operation. HANARO was experienced in a nuisance trip as often as the unexpected voltage sag and/or momentary interruption occurs. We installed the voltage sag compensator on the power supply for CARs and SORs so as to prevent an unwanted trip. We undertook voltage sag assessment of the AC coil contactor which is a component of the power supply unit for the SORs. The compensation time is determined to be less than 1 sec in consideration of the reactor safety. This paper is concerned with the impact of the momentary interruption on the reactor and the effect of the voltage sag compensator
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
A new approach to voltage sag detection based on wavelet transform
Energy Technology Data Exchange (ETDEWEB)
Gencer, Oezguer; Oeztuerk, Semra; Erfidan, Tarik [Kocaeli University, Faculty of Engineering, Department of Electrical Engineering, Veziroglu Kampuesue, Eski Goelcuek Yolu, Kocaeli (Turkey)
2010-02-15
In this work, a new voltage sag detection method based on wavelet transform is developed. Voltage sag detection algorithms, so far have proved their efficiency and computational ability. Using several windowing techniques take long computational times for disturbance detection. Also researchers have been working on separating voltage sags from other voltage disturbances for the last decade. Due to increasing power quality standards new high performance disturbance detection algorithms are necessary to obtain high power quality standards. For this purpose, the wavelet technique is used for detecting voltage sag duration and magnitude. The developed voltage sag detection algorithm is implemented with high speed microcontroller. Test results show that, the new approach provides very accurate and satisfactory voltage sag detection. (author)
Voltage sags impact on CAR and SOR of HANARO
International Nuclear Information System (INIS)
Kim, Hyung Kyoo; Jung, Hoan Sung; Wu, Jong Sup
2004-01-01
The combination of the unstable electric power and sensitive equipment may cause the nuisance of reactor trip. The reactor is tripped by the RRS and RPS during the occurrence of the voltage sags or momentary interruptions. We tested the components of RRS and RPS for the immunity from voltage sags and momentary interruptions. The tested components are DC power supply for CAR (control absorbed rod) of RRS and AC coil contactor for SOR (shut off rod) of RPS. We briefly describe the power quality standard for the voltage sags. This paper summarizes the magnitudes and durations of the voltage sags which impact on the CAR and SOR system
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Research on uncertainty evaluation measure and method of voltage sag severity
Liu, X. N.; Wei, J.; Ye, S. Y.; Chen, B.; Long, C.
2018-01-01
Voltage sag is an inevitable serious problem of power quality in power system. This paper focuses on a general summarization and reviews on the concepts, indices and evaluation methods about voltage sag severity. Considering the complexity and uncertainty of influencing factors, damage degree, the characteristics and requirements of voltage sag severity in the power source-network-load sides, the measure concepts and their existing conditions, evaluation indices and methods of voltage sag severity have been analyzed. Current evaluation techniques, such as stochastic theory, fuzzy logic, as well as their fusion, are reviewed in detail. An index system about voltage sag severity is provided for comprehensive study. The main aim of this paper is to propose thought and method of severity research based on advanced uncertainty theory and uncertainty measure. This study may be considered as a valuable guide for researchers who are interested in the domain of voltage sag severity.
Zakizadeh, Hedayat; Lütken, Henrik; Sriskandarajah, Sridevy; Serek, Margrethe; Müller, Renate
2013-02-01
KEY MESSAGE : The P ( SAG12 ) -ipt gene was transferred to miniature rose, as the first woody species, resulting in increased ethylene resistance due to specific up-regulation of the ipt gene under senescence promoting conditions. Transgenic plants of Rosa hybrida 'Linda' were obtained via transformation with Agrobacterium tumefaciens strain harboring the binary vector pSG529(+) containing the P( SAG12 )-ipt construct. A. tumefaciens strains AGL1, GV3850 and LBA4404 (containing P(35S)-INTGUS gene) were used for transformation of embryogenic callus, but transgenic shoots were obtained only when AGL1 was applied. The highest transformation frequency was 10 % and it was achieved when half MS medium was used for the dilution of overnight culture of Agrobacterium. Southern blot confirmed integration of 1-6 copies of the nptII gene into the rose genome in the tested lines. Four transgenic lines were obtained which were morphologically true-to-type and indistinguishable from Wt shoots while they were in in vitro cultures. Adventitious root induction was more difficult in transgenic shoots compared to the Wt shoots, however, one of the transgenic lines (line 6) was rooted and subsequently analyzed phenotypically. The ipt expression levels were determined in this line after exposure to exogenous ethylene (3.5 μl l(-1)) and/or darkness. Darkness resulted in twofold up-regulation of ipt expression, whereas darkness combined with ethylene caused eightfold up-regulation in line 6 compared to Wt plants. The transgenic line had significantly higher content of chlorophyll at the end of the treatment period compared to Wt plants.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Voltage sags: Their impact on the utility and industrial customers
International Nuclear Information System (INIS)
Davis, T.; Beam, G.E.; Melhorn, C.J.
1995-01-01
This paper describes the impact of voltage sags on the utility and industrial customers. Several utility measures are presented to minimize the customer's exposure to voltage sags. However, these measures cannot completely eliminate the impact of voltage sags on sensitive equipment. A case study is presented in this paper that includes measurement results that were used to characterize the voltage sags experienced on the utility system and in the industrial facility, simulation results that were used to develop area of vulnerability curves for the industrial facility, mitigation equipment that was employed to improve the sensitive equipment's ride through capability, and the lessons learned from the systems approach analysis
Transmission line sag calculations using interval mathematics
Energy Technology Data Exchange (ETDEWEB)
Shaalan, H. [Institute of Electrical and Electronics Engineers, Washington, DC (United States)]|[US Merchant Marine Academy, Kings Point, NY (United States)
2007-07-01
Electric utilities are facing the need for additional generating capacity, new transmission systems and more efficient use of existing resources. As such, there are several uncertainties associated with utility decisions. These uncertainties include future load growth, construction times and costs, and performance of new resources. Regulatory and economic environments also present uncertainties. Uncertainty can be modeled based on a probabilistic approach where probability distributions for all of the uncertainties are assumed. Another approach to modeling uncertainty is referred to as unknown but bounded. In this approach, the upper and lower bounds on the uncertainties are assumed without probability distributions. Interval mathematics is a tool for the practical use and extension of the unknown but bounded concept. In this study, the calculation of transmission line sag was used as an example to demonstrate the use of interval mathematics. The objective was to determine the change in cable length, based on a fixed span and an interval of cable sag values for a range of temperatures. The resulting change in cable length was an interval corresponding to the interval of cable sag values. It was shown that there is a small change in conductor length due to variation in sag based on the temperature ranges used in this study. 8 refs.
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Responsive demand to mitigate slow recovery voltage sags
DEFF Research Database (Denmark)
Garcia-Valle, Rodrigo; da Silva, Luiz Carlos Pereira; Xu, Zhao
2012-01-01
, and reactive power reserve for peak load management through price responsive methods and also as energy providers through embedded generation technologies. This article introduces a new technology, called demand as voltagecontrolled reserve, which can help mitigation of momentary voltage sags. The technology...... faults. This article presents detailed models, discussion, and simulation tests to demonstrate the technical viability and effectiveness of the demand as voltage-controlled reserve technology for mitigating voltage sags....... can be provided by thermostatically controlled loads as well as other types of load. This technology has proven to be effective in distribution systems with a large composition of induction motors, when voltage sags present slow recovery characteristics because of the deceleration of the motors during...
Voltage Sag due to Pollution Induced Flashover Across Ceramic Insulator Strings
Reddy B, Subba; Goswami, Arup Kumar
2017-11-01
Voltage sag or voltage dips are significant to industrial reliability. There is a necessity to characterize the feeder level power quality (PQ) and the PQ performance among various utility companies. Contamination/pollution induced flashover is the ultimate consequence of the creeping discharges across the insulator strings which induce voltage sag. These have a severe threat on the safe and reliable operation of power systems. In the present work an attempt has been made to experimentally investigate the occurrence of voltage sag/dips during pollution induced flashovers. Results show significant dip/sag in the voltage magnitude during the flashover process.
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Effects of balanced and unbalanced voltage sags on DC adjustable-speed drives
Energy Technology Data Exchange (ETDEWEB)
Pedra, Joaquin; Sainz, Luis; Corcoles, Felipe; Bergas, Joan [Department of Electrical Engineering, ETSEIB-UPC, Av. Diagonal, 647, 08028 Barcelona (Spain); de Blas, Alfredo [Department of Electrical Engineering, EUETIB-UPC, C. d' Urgell, 187, 08036 Barcelona (Spain)
2008-06-15
This paper analyzes the sensitivity of DC adjustable-speed drives to balanced and unbalanced voltage sags. The influence of sag type, depth, duration and phase-angle jump on DC drives is studied. The control of the DC drive has been taken into account to understand drive behavior in the presence of voltage sags. Two working modes of the DC motor are considered in the study: as a consumer load and as a regenerative load. When the DC motor works as a consumer load, the study shows that sag type and depth have a significant influence on drive behavior. However, the voltage sag can be ridden through if the rectifier firing angle is set correctly by the control. When the DC motor works as a regenerative load, the study shows the consequences of the three-phase rectifier commutation failure due to the voltage sag. (author)
Compensation for gravitational sag of bent mirror
Energy Technology Data Exchange (ETDEWEB)
Mao, Chengwen; Jiang, Hui; He, Yan; Liang, Dongxu; Lan, Xuying; Yan, Shuai [Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, CAS, Shanghai 201800 (China); Shu, De-ming [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 (United States); Li, Aiguo, E-mail: aiguo.li@sinap.ac.cn [Shanghai Synchrotron Radiation Facility, Shanghai Institute of Applied Physics, CAS, Shanghai 201800 (China)
2017-05-01
The gravitational sag of aspheric bent mirrors with face-up or face-down geometry produces a nonnegligible optical error. As an effective compensation, width optimization is used to match the combined effects of the gravitational and bending moments. This method is described by analytical expressions and two calculation algorithms. The results of theoretical simulations and finite element analysis have proved that this method can reduce the slope error resulting from gravitational sag to the level of nano radians.
Compensation for gravitational sag of bent mirror
International Nuclear Information System (INIS)
Mao, Chengwen; Jiang, Hui; He, Yan; Liang, Dongxu; Lan, Xuying; Yan, Shuai; Shu, De-ming; Li, Aiguo
2017-01-01
The gravitational sag of aspheric bent mirrors with face-up or face-down geometry produces a nonnegligible optical error. As an effective compensation, width optimization is used to match the combined effects of the gravitational and bending moments. This method is described by analytical expressions and two calculation algorithms. The results of theoretical simulations and finite element analysis have proved that this method can reduce the slope error resulting from gravitational sag to the level of nano radians.
Computation and measurement of calandria tube sag in PHWR
International Nuclear Information System (INIS)
Kim, Tae Ryong; Sohn, Seok Man
2003-01-01
Calandria tubes and liquid injection shutdown system (LISS) tubes in a pressurized heavy water reactor (PHWR) is known to sag due to irradiation creep and growth during plant operation. When the sag of calandria tube becomes bigger, the calandria tube possibly comes in contact with LISS tube crossing beneath and calandria tube. The contact subsequently may cause the damage on the calandria tube resulting in unpredicted outage of the plant. It is therefore necessary to check the gap between the two tubes in order to periodically confirm no contact by using a proper measure during the plant life. An ultrasonic gap measuring probe assembly which can be inserted into two viewing ports of the calandria was developed in Korea and utilized to measure the sags of both tubes in the PHWR. It was found that the centerlines of calandria tubes and liquid injection shutdown system tubes can be precisely detected by ultrasonic wave. The gaps between two tubes were easily obtained from the relative distance of the measured centerline elevations of the tubes. Based on the irradiation creep equation and the measurement data, a computer program to calculate the sags was also developed. With the computer program, the sag at the end of plant life was predicted. (author)
Semwal, Vimal Kumar; Singh, Bhupinder; Khanna-Chopra, Renu
2014-04-01
Reproductive sinks regulate monocarpic senescence in crop plants. Monocarpic senescence was studied in wheat fertile (cv. HW 2041) and its isonuclear cytoplasmic male sterile (CMS) line. CMS plants exhibited slower rate of senescence accompanied by longer green leaf area duration and slower deceleration in chlorophyll, protein content, PN and rubisco content coupled with lower protease activities than fertile (F) plants. CMS plants also exhibited lower ROS levels and less membrane damage than F plants. CMS plants maintained better antioxidant defense, less oxidative damage in chloroplast and higher transcript levels of both rbcL and rbcS genes during senescence than F plants. F plants exhibited early induction and higher expression of SAGs like serine and cysteine proteases, glutamine synthetases GS1 and GS2, WRKY53 transcription factor and decline in transcript levels of CAT1 and CAT2 genes than CMS plants. Hence, using genetically fertile and its CMS line of wheat it is confirmed that delayed senescence in the absence of reproductive sinks is linked with slower protein oxidation, rubisco degradation and delayed activation of SAGs. Better antioxidant defense in chloroplasts at later stages of senescence was able to mitigate the deleterious effects of ROS in CMS plants. We propose that delayed increase in ROS in cytoplasmic male sterile wheat plants resulted in delayed activation of WRKY53, SAGs and the associated biochemical changes than fertile plants.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Effects of symmetrical voltage sags on squirrel-cage induction motors
Energy Technology Data Exchange (ETDEWEB)
Pedra, Joaquin; Sainz, Luis; Corcoles, Felipe [Department of Electrical Engineering, ETSEIB-UPC, Av. Diagonal, 647, 08028 Barcelona (Spain)
2007-10-15
This paper analyzes the symmetrical voltage sag consequences on the induction motor behavior when single- and double-cage models are considered, namely current and torque peaks, and speed loss. These effects depend on several variables like sag type, duration and depth. Voltage sag effects are studied by using single- and double-cage models for three motors of different rated power. The double-cage model always predicts torque and current peaks higher than those of the single-cage model. The single-cage model predicts that voltage sags can produce motor instability, whereas the double-cage model is always stable. Therefore, the double-cage model must be used for the simulation of the squirrel-cage induction motor, because the single-cage model can give erroneous results in some situations. (author)
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Quantifying the gantry sag on linear accelerators and introducing an MLC-based compensation strategy
Energy Technology Data Exchange (ETDEWEB)
Du Weiliang; Gao Song; Wang Xiaochun; Kudchadker, Rajat J. [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas 77030 (United States)
2012-04-15
Purpose: Gantry sag is one of the well-known sources of mechanical imperfections that compromise the spatial accuracy of radiation dose delivery. The objectives of this study were to quantify the gantry sag on multiple linear accelerators (linacs), to investigate a multileaf collimator (MLC)-based strategy to compensate for gantry sag, and to verify the gantry sag and its compensation with film measurements. Methods: The authors used the Winston-Lutz method to measure gantry sag on three Varian linacs. A ball bearing phantom was imaged with megavolt radiation fields at 10 deg. gantry angle intervals. The images recorded with an electronic portal imaging device were analyzed to derive the radiation isocenter and the gantry sag, that is, the superior-inferior wobble of the radiation field center, as a function of the gantry angle. The authors then attempted to compensate for the gantry sag by applying a gantry angle-specific correction to the MLC leaf positions. The gantry sag and its compensation were independently verified using film measurements. Results: Gantry sag was reproducible over a six-month measurement period. The maximum gantry sag was found to vary from 0.7 to 1.0 mm, depending on the linac and the collimator angle. The radiation field center moved inferiorly (i.e., away from the gantry) when the gantry was rotated from 0 deg. to 180 deg. After the MLC leaf position compensation was applied at 90 deg. collimator angle, the maximum gantry sag was reduced to <0.2 mm. The film measurements at gantry angles of 0 deg. and 180 deg. verified the inferior shift of the radiation fields and the effectiveness of MLC compensation. Conclusions: The results indicate that gantry sag on a linac can be quantitatively measured using a simple phantom and an electronic portal imaging device. Reduction of gantry sag is feasible by applying a gantry angle-specific correction to MLC leaf positions at 90 deg. collimator angle.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
A rationale for the observed non-linearity in pressure tube creep sag with time in service
International Nuclear Information System (INIS)
Sedran, P.J.
2013-01-01
In 2012, a paper was presented at the CNS SGC Conference which included an explanation for measured non-linear trends in Pressure Tube (PT) creep sag. The section of the 2012 paper covering this topic was revised and is presented as the main subject of this paper. The practical applications for the prediction of long-term Fuel Channel (FC) creep sag include the analysis of Calandria Tube - Liquid Injection Nozzle (CT-LIN) contact, and fuel passage and PT replacement assessments. The current practice for predicting FC creep sag in life cycle management applications is to use a linear model for creep sag versus time in service. However, PT sag measurements from the Point Lepreau Generating Station (PLGS) and Gentilly-2 (G-2) have displayed a non-linear trend with a creep sag rate that is decreasing with time in service. As an example, for PT F06 in PLGS, a 60% reduction in the nominal creep sag rate was observed for measurements taken 18 years apart. Subsequently, it was found that a 56% reduction in the creep sag rate for F06 over 18 years could be attributed to a fundamental geometric property of the PT creep sag profile. In addition, a further 1.6% decrease in the creep sag rate of the CT over the same period could be attributed to bending stress reductions due to the deformation of the CT. The resultant reduction in the PT creep sag rate for F06 was predicted to be 57.6%, closely matching the observed PT creep sag rate reduction of 60%. Therefore, this paper provides a rationale to explain the observed non-linear trends in PT creep sag, the use of which could benefit stations engaging in asset management as a means of FC life extension. This paper presents a summary of the worked performed to correlate the observed reductions in PT creep sag rate to the geometrical properties of the PT creep sag profile and the predicted bending stress reductions in the CT. (author)
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
The negative temperature coefficient resistivities of Ag2S-Ag core–shell structures
International Nuclear Information System (INIS)
Yu, Mingming; Liu, Dongzhi; Li, Wei; Zhou, Xueqin
2014-01-01
In this paper, the conductivity of silver nanoparticle films protected by 3-mercaptopropionic acid (Ag/MPA) has been investigated. When the nanoparticles were annealed in air at 200 °C, they converted to stable Ag 2 S-Ag core–shell structures. The mechanism for the formation of the Ag 2 S-Ag core–shell structures along with the compositional changes and the microstructural evolution of the Ag/MPA nanoparticles during the annealing process are discussed. It is proposed that the Ag 2 S-Ag core–shell structure was formed through a solid-state reduction reaction, in which the Ag + ions coming from Ag 2 S were reduced by sulfonate species and sulfur ions. The final Ag 2 S-Ag films display an exponentially decreased resistivity with increasing temperature from 25 to 170 °C. The negative temperature coefficient resistivity of Ag 2 S-Ag films can be adjusted by changing the S/Ag molar ratio used for the synthesis of the Ag/MPA nanoparticles, paving the way for the preparation of negative temperature-coefficient thermistors via printing technology for use in the electronics.
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Voltage Sag Compensator for CAR and SOR of HANARO
International Nuclear Information System (INIS)
Kim, Hyung-Kyoo; Jung, Hoan-Sung; Wu, Jong-Sup
2007-01-01
HANARO is designed so as to be tripped automatically by insertion of control absorber rods(CAR) and shut-off rods(SOR) and the process systems, such as primary cooling system, secondary cooling system and reflector cooling system, etc., stop whenever the off-site power failure occurs, the reactor trips automatically. When voltage sag or momentary interruption occurs, the process systems are in operation but the reactor has an unwanted trip by insertion of CARs and SORs. We installed the voltage sag compensator on the power supply for CARs and SORs so as to prevent a nuisance trip. The compensated time is decided not to exceed 1 sec in consideration of reactor safety. This paper is concerned with the impact of the momentary interruption on the reactor and the effect of the voltage sag compensator
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
Allocation of Load-Loss Cost Caused by Voltage Sag
Gao, X.
2017-10-01
This paper focuses on the allocation of load-loss cost caused by voltage sag in the environment of electricity market. To compensate the loss of loads due to voltage sags, the load-loss cost is allocated to both sources and power consumers. On the basis of Load Drop Cost (LDC), a quantitative evaluation index of load-loss cost caused by voltage sag is identified. The load-loss cost to be allocated to power consumers themselves is calculated according to load classification. Based on the theory of power component the quantitative relation between sources and loads is established, thereby a quantitative calculation method for load-loss cost allocated to each source is deduced and the quantitative compensation from individual source to load is proposed. A simple five-bus system illustrates the main features of the proposed method.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Wang, Dong; Zhang, Limei; Yong, Changfu; Shen, Mingliang; Ali, Tariq; Shahid, Muhammad; Han, Kun; Zhou, Xuezhang; Han, Bo
2017-06-01
Staphylococcus aureus is one of the major etiological agents of bovine mastitis, harboring a wide variety of staphylococcal superantigen (SAg) toxin genes. The SAg toxin genes are reported to be closely associated with the pathogenicity of the Staph. aureus causing the bovine mastitis. This study was conducted to investigate SAg toxin gene profiles and to assess the relationships among SAg toxin genes, genotypes of Staph. aureus, and their pathogenic properties. A total of 327 quarter milk samples were collected from bovine mastitis cases for isolation and identification of pathogens. In total, 35 isolates were identified as Staph. aureus, and the prevalence of Staph. aureus in milk samples was 13.6% (35/256). Polymerase chain reaction (PCR) and randomly amplified polymorphic DNA (RAPD) assays were used to detect the SAg toxin genes and to genotype Staph. aureus strains isolated from milk samples of bovine mastitis in 10 dairy herds located in Ningxia, China, respectively. The results showed that among the Staph. aureus isolates (n = 35), 71.4% (n = 25) of isolates carried at least one SAg toxin gene. In total, 18 SAg genes and 21 different gene combination patterns were detected among these isolates. The most common SAg genes in Staph. aureus isolates were sei, sen, and seu (44.0% each), followed by seo, tst, and etB (28.0% each), etA (24.0%), sem and sep (16.0% each), seb, sec, sed, and sek (12.0% each), and sea and seh genes (8.0% each); the seg, sej, and ser genes were present in 4.0% of the isolates. Three gene combinations were found to be related to mobile genetic elements that carried 2 or more genes. The egc-cluster of the seg-sei-sem-sen-seo genes, located on the pathogenicity island Type I υSaβ, was detected in 16% of isolates. Interestingly, we observed 6 RAPD genotypes (I to VI) in Staph. aureus isolates, and 2 of these genotypes were strongly associated with the severity of bovine mastitis; there was a close relationship between the RAPD genotypes
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Directory of Open Access Journals (Sweden)
Yock-Ping Chow
Full Text Available At least 19 glycosylphosphatidylinositol (GPI-anchored surface antigens (SAGs are expressed specifically by second-generation merozoites of Eimeria tenella, but the ability of these proteins to stimulate immune responses in the chicken is unknown.Ten SAGs, belonging to two previously defined multigene families (A and B, were expressed as soluble recombinant (r fusion proteins in E. coli. Chicken macrophages were treated with purified rSAGs and changes in macrophage nitrite production, and in mRNA expression profiles of inducible nitric oxide synthase (iNOS and of a panel of cytokines were measured. Treatment with rSAGs 4, 5, and 12 induced high levels of macrophage nitric oxide production and IL-1β mRNA transcription that may contribute to the inflammatory response observed during E. tenella infection. Concomitantly, treatment with rSAGs 4, 5 and 12 suppressed the expression of IL-12 and IFN-γ and elevated that of IL-10, suggesting that during infection these molecules may specifically impair the development of cellular mediated immunity.In summary, some E. tenella SAGs appear to differentially modulate chicken innate and humoral immune responses and those derived from multigene family A (especially rSAG 12 may be more strongly linked with E. tenella pathogenicity associated with the endogenous second generation stages.
Jairo Blanco; Ruben Darío Leal; Jonathan Jacome; Johann F. Petit; Gabriel Ordoñez; Víctor Barrera
2011-01-01
This article presents an analysis of voltage sag propagation. The ATPDraw tool was selected for simulating the IEEE 34 node test feeder. It takes into account both voltage sags caused by electrical fault network, as well as voltage sag propagation characteristics caused by induction motor starting and transformer energising. The analysis was aimed at assessing the influence of transformer winding connections, the impedance of these transformers, lines and cables, summarising the...
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Directory of Open Access Journals (Sweden)
Mingjia Tan
2006-12-01
Full Text Available Skp1-cullin-F-box protein (SCF is a multicomponent E3 ubiquitin (Ub ligase that ubiquitinates a number of important biologic molecules such as p27, β-catenin, and lκB for proteasomal degradation, thus regulating cell proliferation and survival. One SCF component, SAG/ROC2/Rbx2/Hrt2, a RING finger protein, was first identified as a redox-inducible protein, which, when overexpressed, inhibited apoptosis both in vitro and in vivo. We report here that sensitive to apoptosis gene (SAG, as well as its family member ROC1/Rbxi, bound to the proinactive form of caspase-3 (pro-caspase-3. Binding was likely mediated through F-box protein, β-transducin repeat-containing protein (β-TrCP, which binds to the first 38 amino acids of pro-caspase-3. Importantly, β-TrCP1 expression significantly shortened the protein half-life of pro-caspase-3, whereas expression of a dominant-negative β-TrCP1 mutant with the F-box domain deleted extended it. An in vitro ubiquitination assay showed that SAG/ROC-SCF -Trcp promoted ubiquitination of pro-caspase-3. Furthermore, endogenous levels of pro-caspase-3 were decreased by overexpression of SAG/ROC-SCFβ-TrCP E3 Ub ligases, but increased on siRNA silencing of SAG, regulator of cullin-1 (ROC1, or β-TrCPs, leading to increased apoptosis by etoposide and TNF-related apoptosis-inducing ligand through increased activation of caspase-3. Thus, pro-caspase-3 appears to be a substrate of SAG/ROC-SCFβ-TrCP E3 Ub ligase, which protects cells from apoptosis through increased apoptosis threshold by reducing the basal level of pro-caspase-3.
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
CARACTERIZACIÓN DE LUMINARIAS TIPO HALURO METÁLICO ANTE EVENTOS SAG
Directory of Open Access Journals (Sweden)
Bonie Johana Restrepo Cuestas
Full Text Available Este artículo plantea una metodología para la caracterización de luminarias de haluro metálico, ante eventos sag. Inicialmente, se diseñó y construyó un generador de eventos sag. Luego, se planteó un esquema de pruebas, que fue utilizado para analizar el comportamiento de un tipo de luminarias de alta densidad de descarga tipo Metal Halide, ante eventos sag. Finalmente, tomando como referente el estándar SEMI F-47, se realizó la construcción de una curva característica que muestra la región de operación de la luminaria.
International Nuclear Information System (INIS)
Horvath, J.
1993-01-01
The relationship between gravity sag of a precision cathode strip chamber and its sandwich panel structural design is explored parametrically. An algorithm for estimating the dominant component of gravity sag is defined. Graphs of normalized gravity sag as a function of gap frame width and material, sandwich core edge filler width and material, panel skin thickness, gap height, and support location are calculated using the gravity sag algorithm. The structural importance of the sandwich-to-sandwich ''gap frame'' connection is explained
Yeargan, Michelle R; Howe, Daniel K
2011-02-28
Equine protozoal myeloencephalitis (EPM) is a common neurologic disease of horses that is caused by the apicomplexan pathogen Sarcocystis neurona. To help improve serologic diagnosis of S. neurona infection, we have modified existing enzyme-linked immunosorbent assays (ELISAs) based on the immunogenic parasite surface antigens SnSAG2, SnSAG3, and SnSAG4 to make the assays polyvalent, thereby circumventing difficulties associated with parasite antigenic variants and diversity in equine immune responses. Two approaches were utilized to achieve polyvalence: (1) mixtures of the individual recombinant SnSAGs (rSnSAGs) were included in single ELISAs; (2) a collection of unique SnSAG chimeras that fused protein domains from different SnSAG surface antigens into a single recombinant protein were generated for use in the ELISAs. These new assays were assessed using a defined sample set of equine sera and cerebrospinal fluids (CSFs) that had been characterized by Western blot and/or were from confirmed EPM horses. While all of the polyvalent ELISAs performed relatively well, the highest sensitivity and specificity (100%/100%) were achieved with assays containing the rSnSAG4/2 chimera (Domain 1 of SnSAG4 fused to SnSAG2) or using a mixture of rSnSAG3 and rSnSAG4. The rSnSAG4 antigen alone and the rSnSAG4/3 chimera (Domain 1 of SnSAG4 fused to Domain 2 of SnSAG3) exhibited the next best accuracy at 95.2% sensitivity and 100% specificity. Binding ratios and percent positivity (PP) ratios, determined by comparing the mean values for positive versus negative samples, showed that the most advantageous signal to noise ratios were provided by rSnSAG4 and the rSnSAG4/3 chimera. Collectively, our results imply that a polyvalent ELISA based on SnSAG4 and SnSAG3, whether as a cocktail of two proteins or as a single chimeric protein, can give optimal results in serologic testing of serum or CSF for the presence of antibodies against S. neurona. The use of polyvalent SnSAG ELISAs will
An impact analysis of the fault impedance on voltage sags
Energy Technology Data Exchange (ETDEWEB)
Ramos, Alessandro Candido Lopes [CELG - Companhia Energetica de Goias, Goiania, GO (Brazil). Generation and Transmission. System' s Operation Center], E-mail: alessandro.clr@celg.com.br; Batista, Adalberto Jose [Federal University of Goias (UFG), Goiania, GO (Brazil)], E-mail: batista@eee.ufg.br; Leborgne, Roberto Chouhy [Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil)], E-mail: rcl@ece.ufrgs.br; Emiliano, Pedro Henrique Mota, E-mail: ph@phph.com.br
2009-07-01
This paper presents an impact analysis of the fault impedance, in terms of its module and angle, on voltage sags caused by faults. Symmetrical and asymmetrical faults are simulated, at transmission and distribution lines, by using a frequency-domain fault simulation software called ANAFAS. Voltage sags are monitored at buses where sensitive end-users are connected. In order to overcome some intrinsic limitations of this software concerning its automatic execution for several cases, a computational tool was developed in Java programming language. This solution allows the automatic simulation of cases including the effect of the fault position, the fault type, and the proper fault impedance. The main conclusion is that the module and angle of the fault impedance can have a significant influence on voltage sag depending on the fault characteristics. (author)
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Directory of Open Access Journals (Sweden)
Mustafa Inci
2018-01-01
Full Text Available Voltage harmonics, sag, and swell are the most harmful disturbances in distribution systems. This paper introduces a novel effective controller method for simultaneous compensation of both voltage sag/swell and voltage harmonics by using multifunctional dynamic voltage restorer. In proposed controller method called FFT with integrated ISRF, ISRF detects the magnitudes of voltage sag/swell quickly and precisely, and FFT extracts the selective components of voltage harmonics very effectively. The proposed method integrates the superior properties of ISRF and FFT methods. FFT integrated ISRF is applied for the first time to provide the compensation of both sag/swell and selective harmonics together. The proposed system has ability to compensate symmetrical/asymmetrical sag/swell and symmetrical/asymmetrical selective harmonics which are 5th, 7th, 11th and 13th. The controlled system is modelled in PSCAD/EMDTC and compared with conventional methods. The performance results verify that the proposed method compensates voltage disturbances effectively in the system.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Early Prediction of Transient Voltage Sags caused by Rotor Swings
DEFF Research Database (Denmark)
Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Van Cutsem, Thierry
2014-01-01
The paper investigates various methods to predict voltage sags at load buses caused by large generator rotor swings and following a transient disturbance. Three different prediction methods are proposed, which all use real-time measurements from PMUs. One of the methods uses a slightly extended v...... version of the E-SIME method. The other two methods use Measurements and process them by recursive least square estimation. It is shown that the prediction method employing E-SIME allows the earliest detection of a critical voltage sag with satisfactory accuracy....
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Directory of Open Access Journals (Sweden)
Shugen Liu
2017-01-01
Full Text Available The older and deeper hydrocarbon accumulations receive increasing attention across the world, providing more technical and commercial challenges to hydrocarbon exploration. We present a study of an asymmetrical, N-S striking intracratonic sag which developed across the Sichuan basin, south China, from Late Ediacaran to Early Cambrian times. The Mianyang-Changning intracratonic sag is ~50 km wide, with its steepest part in the basin center. In particular the eastern margin shows its greatest steepness. Five episodes in the evolutions of the sag can be recognized. It begins in the Late Ediacaran with an uplift and erosion correlated to Tongwan movement. Initial extension occurred during the Early Cambrian Maidiping period, when more strata of the Maidiping Formation were deposited across the sag. Subsequently, maximum extension occurred during the Early Cambrian Qiongzhusi period that resulted in 450–1700 m thick Maidiping-Canglangpu Formations being deposited in the sag. Then, the sag disappeared at the Longwangmiao period, as it was infilled by the sediments. The intracratonic sag has significant influence on the development of high-quality reservoirs in the Dengying and Longwangmiao Formations and source-rock of the Niutitang Formation. It thus indicates that a high probability for oil/gas accumulation exists along the intracratonic sag, across the central Sichuan basin.
Yeargan, Michelle; de Assis Rocha, Izabela; Morrow, Jennifer; Graves, Amy; Reed, Stephen M; Howe, Daniel K
2015-05-01
Enzyme-linked immunosorbent assays (ELISAs) based on the SnSAG surface antigens of Sarcocystis neurona provide reliable detection of infection by the parasite. Moreover, accurate serodiagnosis of equine protozoal myeloencephalitis (EPM) is achieved with the SnSAG ELISAs by measuring antibodies in serum and cerebrospinal fluid (CSF) to reveal active infection in the central nervous system. Two independent ELISAs based on recombinant (r)SnSAG2 or a chimeric fusion of SnSAG3 and SnSAG4 (rSnSAG4/3) are currently used together for EPM serodiagnosis to overcome varied antibody responses in different horses. To achieve reliable antibody detection with a single ELISA instead of 2 separate ELISAs, rSnSAG2 was fused with rSnSAG4/3 into a single trivalent protein, designated rSnSAG2/4/3. Paired serum and CSF from 163 horses were tested with all 3 ELISAs. When the consensus antibody titers obtained with the rSnSAG2 and rSnSAG4/3 ELISAs were compared to the single SAG2/4/3 ELISA titers, Spearman rank correlation coefficients of ρ = 0.74 and ρ = 0.90 were obtained for serum and CSF, respectively, indicating strong agreement between the tests. When the rSnSAG2 and rSnSAG4/3 consensus serum-to-CSF titer ratio was compared to the rSnSAG2/4/3 serum-to-CSF titer ratio, the Spearman correlation coefficient was ρ = 0.87, again signifying strong agreement. Importantly, comparing the diagnostic interpretation of the serum-to-CSF titer ratios yielded a Cohen kappa value of 0.77. These findings suggest that the single ELISA based on the trivalent rSnSAG2/4/3 will provide serologic and diagnostic results that are highly comparable to the consensus of the 2 independent ELISAs based on rSnSAG2 and rSnSAG4/3. © 2015 The Author(s).
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
The sagging rope sign in achondroplasia - different from Perthes' disease
International Nuclear Information System (INIS)
Shingade, Viraj U.; Song, Hae-Ryong; Lee, Seok-Hyun; Suh, Seung-Woo; Oh, Chang-Wug; Hong, Jun-Seok
2006-01-01
The sagging rope sign is a radio-opaque line, seen on radiographs of the hips, with Perthes' disease. The main purpose of this study was to determine the incidence, cause and importance of this sign in achondroplasia, and to reveal how it differs from in Perthes' disease. Serial radiograms, along with 2-dimensional and 3-dimensional CT images were studied in 42 achondroplasic patients. Forty-two achondroplasic patients, reported at our institute (for routine outpatient consultation, spine surgeries, deformity corrections, limb-lengthening procedures) were included in this study. There were 26 males and 16 females. The sign was observed bilaterally, in all patients. Evaluation of CT images revealed spherical heads, with presence of circumferential overhang in all hips. This circumferential overhang, seen on 3-D CT scan, corresponded to the sagging rope sign on radiographs. Presence of the sagging rope sign in bilateral hips is a characteristic feature of achondroplasia. It usually appears before epiphyseal closure. Its cause, incidence, and nature differ from Perthes' disease, and its presence does not carry a bad prognosis in achondroplasia. (orig.)
Synthesis, morphological control, and antibacterial properties of hollow/solid Ag2S/Ag heterodimers
Pang, Maolin; Hu, Jiangyong; Zeng, Huachun
2010-01-01
of this highly asymmetric dipolar composite, photocatalytic inactivation of Escherichia coli K-12 in the presence of the as-prepared Ag 2S/Ag heterodimers has been carried out under UV irradiation. The added Ag2S/Ag heterodimers show good chemical stability under
International Nuclear Information System (INIS)
Najafi, E.; Yatim, A.H.M.
2011-01-01
Research highlights: → We proposed a new current control method for STATCOM. → The current control method maintains a fixed switching frequency. → It also produces fewer harmonics compared to conventional hysteresis method. → A new voltage dip (sag) detection method was used in STATCOM. → The control method can mitigate voltage sag in each phase separately. -- Abstract: Static compensator (STATCOM) has been widely proposed for power quality and network stability improvement. It is easily connected in parallel to the electric network and has many advantages for electrical grids. It can improve network stability; power factor, power transfer rating and can avoid some disturbances such as sags and swells. Most of STATCOM controllers are based on voltage controllers that are based on balanced d-q transform. However, they are not thorough solutions for network disturbances since in most cases single-phase disturbances occur in electrical networks that cannot be avoided by the conventional controllers. Voltage mode controllers are also not capable of responding fast enough to the changes expected of a network system. This paper proposes a new current mode controller to overcome the mentioned problem. The approach uses a fixed frequency current controller to maintain voltage levels in voltage sags (dips). This approach is also simple and can be easily implemented by digitally. It has superior performance over conventional methods in terms of harmonic reduction in STATCOM output current. Another important factor for STATCOM effectiveness in sag mitigation is its sag detection method. This paper also introduces a new sag detection method based on Goertzel algorithm which is both effective and simple for practical applications. The simulation results presented illustrate the superiority of the proposed controller and sag detection algorithm to be utilized in the STATCOM.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Measurement and computation for sag of calandria tube due to irradiation creep in PHWR
International Nuclear Information System (INIS)
Son, S. M.; Lee, W. R.; Lee, S. K.; Lee, J. S.; Kim, T. R.; Na, B. K.; Namgung I.
2003-01-01
Calandria tubes and Liquid Injection Shutdown System(LISS) tubes in a Pressurized Heavy Water Reactor(PHWR) are to sag due to irradiation creep and growth during plant operation. When the sag of calandria tube becomes bigger, the calandria tube possibly comes in contact with LISS tube crossing beneath the calandria tube. The contact subsequently may cause the damage on the calandria tube resulting in unpredicted outage of the plant. It is therefore necessary to check the gap between the two tubes in order to periodically confirm no contact by using a proper measure during the plant life. An ultrasonic gap measuring probe assembly which can be inserted into two viewing ports of the calandria was developed in Korea and utilized to measure the sags of both tubes in the PHWR. It was found that the centerlines of calandria tubes and liquid injection shutdown system tubes can be precisely detected by ultrasonic wave. The gaps between two tubes were easily obtained from the relative distance of the measured centerline elevations of the tubes. Based on the irradiation creep equation and the measurement data, a computer program to calculate the sags was also developed. With the computer program, the sag at the end of plant life was predicted
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong
2017-01-01
ICE Sag37 , a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae . Two clinical strains of S. agalactiae , Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. Sma I-PFGE revealed a new Sma I fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICE Sag37 , which was characterized using several molecular methods and in silico analyses. ICE Sag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae . Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA , which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICE Sag37 carried genes for resistance to multiple antibiotics, including erythromycin [ erm(B) ], tetracycline [ tet(O) ], and aminoglycosides [ aadE, aphA , and ant(6) ]. Potential virulence factors, including a two-component signal transduction system ( nisK/nisR ), were also observed in ICE Sag37 . S1-PFGE analysis ruled out the existence of plasmids. ICE Sag37 is the first ICE Sa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae .
Valadas, Samantha Y O B; da Silva, Juliana I G; Lopes, Estela Gallucci; Keid, Lara B; Zwarg, Ticiana; de Oliveira, Alice S; Sanches, Thaís C; Joppert, Adriana M; Pena, Hilda F J; Oliveira, Tricia M F S; Ferreira, Helena L; Soares, Rodrigo M
2016-05-01
Although few species of Sarcocystis are known to use marsupials of the genus Didelphis as definitive host, an extensive diversity of alleles of surface antigen genes (sag2, sag3, and sag4) has been described in samples of didelphid opossums in Brazil. In this work, we studied 25 samples of Sarcocystis derived from gastrointestinal tract of opossums of the genus Didelphis by accessing the variability of sag2, sag3, sag4, gene encoding cytochrome b (cytB) and first internal transcribed spacer (ITS1). Reference samples of Sarcocystis neurona (SN138) and Sarcocystis falcatula (SF1) maintained in cell culture were also analyzed. We found four allele variants of cytB, seven allele variants of ITS1, 10 allele variants of sag2, 13 allele variants of sag3, and 6 allele variants of sag4. None of the sporocyst-derived sequences obtained from Brazilian opossums revealed 100% identity to SN138 at cytB gene, nor to SN138 or SF1 at ITS1 locus. In addition, none of the sag alleles were found identical to either SF1 or SN138 homologous sequences, and a high number of new sag allele types were found other than those previously described in Brazil. Out of ten sag2 alleles, four are novel, while eight out of 13 sag3 alleles are novel and one out of six sag4 alleles is novel. Further studies are needed to clarify if such a vast repertoire of allele variants of Sarcocystis is the consequence of re-assortments driven by sexual exchange, in order to form individuals with highly diverse characteristics, such as pathogenicity, host spectrum, among others or if it only represents allele variants of different species with different biological traits. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Complete characterization of voltage sags: an alternative to achieve energy quality
International Nuclear Information System (INIS)
Zuniga Medina, Edgar Andres; Vasco Garcia, Carlos Andres
1992-01-01
In this paper, the meaning of the power quality and its negative influence in the automation processes are presented. Voltage sags, the problems they cause and a methodology to characterize the phenomenon are also presented. Once the problems associated with the different sensible loads connected to a power system are identified, the cause of the bad quality of the electrical energy provided those loads is then established; voltage sags are one of the most common phenomenon that requires characterization in order to diminish their negative impact on the industrial processes
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Synthesis, morphological control, and antibacterial properties of hollow/solid Ag2S/Ag heterodimers
Pang, Maolin
2010-08-11
Ag2S and Ag are important functional materials that have received considerable research interest in recent years. In this work, we develop a solution-based synthetic method to combine these two materials into hollow/solid Ag2S/Ag heterodimers at room temperature. Starting from monodisperse Cu2O solid spheres, CuS hollow spheres can be converted from Cu2O through a modified Kirkendall process, and the obtained CuS can then be used as a solid precursor for preparation of the Ag2S/Ag heterodimers through ion exchange and photo-assisted reduction. We have found that formation of the Ag2S/Ag heterodimers is instantaneous, and the size of Ag nanocrystals on the hollow spheres of Ag2S can be controlled by changing the concentration and power of reducing agents in the synthesis. The growth of Ag nanoparticles on hollow spheres of Ag2S in the dimers is along the [111] direction of the silver crystal; the light absorption properties have also been investigated. Furthermore, coupling or tripling of Ag2S/Ag heterodimers into dumbbell-like trimers ((Ag 2S)2/Ag, linear) and triangular tetramers ((Ag 2S)3/Ag, coplanar) can also be attained at 60°C by adding the bidentate ligand ethylenediamine as a cross-linking agent. To test the applicability of this highly asymmetric dipolar composite, photocatalytic inactivation of Escherichia coli K-12 in the presence of the as-prepared Ag 2S/Ag heterodimers has been carried out under UV irradiation. The added Ag2S/Ag heterodimers show good chemical stability under prolonged UV irradiation, and no appreciable solid dissolution is found. Possible mechanisms regarding the enhanced antibacterial activity have also been addressed. © 2010 American Chemical Society.
Experimental testing of a SAG digital SILT application
International Nuclear Information System (INIS)
Haapanen, P.; Maskuniitty, M.; Heikkinen, J.; Korhonen, J.
1995-10-01
A prototype dynamic testing harness for programmable automation systems has been specified and implemented at the Technical Research Centre of Finland (VTT). In order to get experience on the methodology and equipment for the testing of systems important to the safety of nuclear power plants, where the safety and reliability requirements often are very high, two different pilot systems have been tested. One system was an ABB Master application, which was loaned for testing from ABB Atom by Teollisuuden Voima Oy (TVO). Another system, loaned from Siemens AG(SAG) by IVO International Oy (IVO), was an application realized with SAG's digital SILT technology. The report describes the testing of the SAG application. The purpose of the testing was not to assess the pilot system, but to get experience in the testing methodology and find out the further development needs and potentials of the test methodology and equipment. The experience show that dynamic testing is one feasible way to get more confidence about the safety and reliability of a programmable system that would be hard to achieve by other means. It also shows that more development of the test harness is still needed, especially concerning the comparison of the obtained test response to the expected response provided by the logical model of the system. Also the user interface of the on-line part of the test harness needs development. Methods for generation of the test cases also need further development eg. for achieving statistical significance for the reliability estimates. (10 refs., 90 figs., 9 tabs.)
The sagging rope sign in achondroplasia - different from Perthes' disease
Energy Technology Data Exchange (ETDEWEB)
Shingade, Viraj U. [Korea University, Department of Paediatric Orthopaedics, College of Medicine, Guro Hospital, Seoul (Korea); Song, Hae-Ryong [Korea University, Department of Paediatric Orthopaedic Surgery, College of Medicine, Guro Hospital, Seoul (Korea); Lee, Seok-Hyun; Suh, Seung-Woo [Korea University, Department of Orthopaedic Surgery, College of Medicine, Guro Hospital, Seoul (Korea); Oh, Chang-Wug [Kyungpook National University Hospital, Department of Orthopaedic Surgery, Daegu (Korea); Hong, Jun-Seok [Ansan Hospital, Department of Orthopaedic Surgery, Korea University, Ansan, Gyeonggi do (Korea)
2006-12-15
The sagging rope sign is a radio-opaque line, seen on radiographs of the hips, with Perthes' disease. The main purpose of this study was to determine the incidence, cause and importance of this sign in achondroplasia, and to reveal how it differs from in Perthes' disease. Serial radiograms, along with 2-dimensional and 3-dimensional CT images were studied in 42 achondroplasic patients. Forty-two achondroplasic patients, reported at our institute (for routine outpatient consultation, spine surgeries, deformity corrections, limb-lengthening procedures) were included in this study. There were 26 males and 16 females. The sign was observed bilaterally, in all patients. Evaluation of CT images revealed spherical heads, with presence of circumferential overhang in all hips. This circumferential overhang, seen on 3-D CT scan, corresponded to the sagging rope sign on radiographs. Presence of the sagging rope sign in bilateral hips is a characteristic feature of achondroplasia. It usually appears before epiphyseal closure. Its cause, incidence, and nature differ from Perthes' disease, and its presence does not carry a bad prognosis in achondroplasia. (orig.)
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Gravity sag view of lateral radiography of the knee
International Nuclear Information System (INIS)
Hidaka, Kuniyuki; Yanagawa, Yasuhiro; Kawamoto, Kiyosumi; Maeda, Daisuke; Komizu, Mitsuru
2007-01-01
The gravity sag view (GSV) is a lateral radiograph taken in the same position when the posterior sag sign is observed. The purpose of this study was to standardize the radiography technique for GSV by adjusting lateral rotation. To confirm the benchmark and correction angle (CA) for the GSV position, we assessed three-dimensional (3D) CT of the GSV position of the knee using normal volunteers. The benchmark is established at the 3-point of the leg and adjusting the CA of the knee is established by estimating from Rosenberg technique radiography. This helped not only to correct external rotation in the initial radiography but also to correct rotation for repeat radiography. Our method is quantitative and highly reproducible, and it increases the success rate in adjusting lateral radiography of the knee. (author)
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Effect of voltage sags on digitally controlled line connected switched-mode power supplies
DEFF Research Database (Denmark)
Török, Lajos; Munk-Nielsen, Stig
2012-01-01
Different voltage disorders like voltage fluctuations, sags, frequency variations may occur in the power supply networks due to different fault conditions. These deviations from normal operation affects in different ways the line connected devices. Standards were developed to protect and ensure...... of voltage sags is analyzed. Fault tolerant control algorithm was designed, implemented and is discussed. The fault conditions and their effects were investigated at different power levels....
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Facile synthesis, structure, and properties of Ag{sub 2}S/Ag heteronanostructure
Energy Technology Data Exchange (ETDEWEB)
Sadovnikov, S. I., E-mail: sadovnikov@ihim.uran.ru; Gusev, A. I. [Ural Branch of the Russian Academy of Sciences, Institute of Solid State Chemistry (Russian Federation)
2016-09-15
Ag{sub 2}S/Ag heteronanostructure has been produced by a simple one-stage chemical deposition from aqueous solutions of silver nitrate, sodium sulfide, and sodium citrate with the use of monochromatic light irradiation. For simultaneous synthesis of Ag{sub 2}S and Ag nanoparticles, deposition has been performed from reaction mixtures with reduced sodium sulfide concentration. The size of Ag{sub 2}S and Ag nanoparticles is 45–50 and 15–20 nm, respectively. It is established that in the contact layer between silver sulfide and silver, nonconducting α-Ag{sub 2}S acanthite transforms into superionic β-Ag{sub 2}S argentite under the action of external electric field. The scheme of the operation of a resistive switch based on an Ag{sub 2}S/Ag heteronanostructure is proposed. The UV–Vis optical absorption spectra of colloidal solutions of Ag{sub 2}S/Ag heteronanostructures have been studied.Graphical Abstract.
Doubly-Fed Induction Generator Control Under Voltage Sags
DEFF Research Database (Denmark)
Teodorescu, Remus; Blaabjerg, Frede; Lima, K.
2008-01-01
This paper proposes a new control technique to improve the fault-ride through capability of doubly fed induction generators (DFIG). In such generators the appearance of severe voltage sags at the coupling point make rise to high over currents at the rotor/stator windings, something that makes...
Guan, Yue
2017-05-11
Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.
Guan, Yue; Haroon, Mohamed; Alam, Intikhab; Ferry, James G.; Stingl, Ulrich
2017-01-01
Pyrrolysine (Pyl), the 22nd canonical amino acid, is only decoded and synthesized by a limited number of organisms in the domains Archaea and Bacteria. Pyl is encoded by the amber codon UAG, typically a stop codon. To date, all known Pyl-decoding archaea are able to carry out methylotrophic methanogenesis. The functionality of methylamine methyltransferases, an important component of corrinoid-dependent methyltransfer reactions, depends on the presence of Pyl. Here, we present a putative pyl gene cluster obtained from single-cell genomes of the archaeal Mediterranean Sea Brine Lakes group 1 (MSBL1) from the Red Sea. Functional annotation of the MSBL1 single cell amplified genomes (SAGs) also revealed a complete corrinoid-dependent methyl-transfer pathway suggesting that members of MSBL1 may possibly be capable of synthesizing Pyl and metabolizing methylated amines. This article is protected by copyright. All rights reserved.
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Detection and correction for EPID and gantry sag during arc delivery using cine EPID imaging.
Rowshanfarzad, Pejman; Sabet, Mahsheed; O'Connor, Daryl J; McCowan, Peter M; McCurdy, Boyd M C; Greer, Peter B
2012-02-01
Electronic portal imaging devices (EPIDs) have been studied and used for pretreatment and in-vivo dosimetry applications for many years. The application of EPIDs for dosimetry in arc treatments requires accurate characterization of the mechanical sag of the EPID and gantry during rotation. Several studies have investigated the effects of gravity on the sag of these systems but each have limitations. In this study, an easy experiment setup and accurate algorithm have been introduced to characterize and correct for the effect of EPID and gantry sag during arc delivery. Three metallic ball bearings were used as markers in the beam: two of them fixed to the gantry head and the third positioned at the isocenter. EPID images were acquired during a 360° gantry rotation in cine imaging mode. The markers were tracked in EPID images and a robust in-house developed MATLAB code was used to analyse the images and find the EPID sag in three directions as well as the EPID + gantry sag by comparison to the reference gantry zero image. The algorithm results were then tested against independent methods. The method was applied to compare the effect in clockwise and counter clockwise gantry rotations and different source-to-detector distances (SDDs). The results were monitored for one linear accelerator over a course of 15 months and six other linear-accelerators from two treatment centers were also investigated using this method. The generalized shift patterns were derived from the data and used in an image registration algorithm to correct for the effect of the mechanical sag in the system. The Gamma evaluation (3%, 3 mm) technique was used to investigate the improvement in alignment of cine EPID images of a fixed field, by comparing both individual images and the sum of images in a series with the reference gantry zero image. The mechanical sag during gantry rotation was dependent on the gantry angle and was larger in the in-plane direction, although the patterns were not
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Mitigation of voltage sags in the distribution system with dynamic voltage restorer
International Nuclear Information System (INIS)
Viglas, D.; Belan, A.
2012-01-01
Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Modelling voltage sag mitigation using dynamic voltage restorer and analyzing power quality issue
Ismail, Nor Laili; Hidzir, Hizrin Dayana Mohd; Thanakodi, Suresh; Nazar, Nazatul Shiema Moh; Ibrahim, Pungut; Ali, Che Ku Muhammad Sabri Che Ku
2018-02-01
Power quality problem which are arise due to a fault or a pulsed load can have caused an interruption of critical load. The modern power systems are becoming more sensitive to the quality of the power supplied by the utility company. Voltage sags and swells, flicker, interruptions, harmonic distortion and other distortion to the sinusoidal waveform are the examples of the power quality problems. The most affected due to these problems is industrial customers who use a lot of sensitive equipment. There has suffered a huge loss to these problems. Resulting of broken or damage equipment if voltage sag exceeds the sensitive threshold of the equipment. Thus, device such as Static Synchronous Compensator (STATCOM) and Dynamic Voltage Restorer (DVR) has been created to solve this problem among users. DVR is a custom power device that most effective and efficient. This paper intended to report the DVR operations during voltage sag compensation.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems
Directory of Open Access Journals (Sweden)
Dung Vo Tien
2018-01-01
Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Screening and identification of novel B cell epitopes of Toxoplasma gondii SAG1
Wang, Yanhua; Wang, Guangxiang; Zhang, Delin; Yin, Hong; Wang, Meng
2013-01-01
Background The identification of protein epitopes is useful for diagnostic purposes and for the development of peptide vaccines. In this study, the epitopes of Toxoplasma gondii SAG1 were identified using synthetic peptide techniques with the aid of bioinformatics. Findings Eleven peptides derived from T. gondii SAG1 were assessed by ELISA using pig sera from different time points after infection. Four (PS4, PS6, PS10 and PS11), out of the eleven peptides tested were recognized by all sera. T...
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Screening and identification of novel B cell epitopes of Toxoplasma gondii SAG1.
Wang, Yanhua; Wang, Guangxiang; Zhang, Delin; Yin, Hong; Wang, Meng
2013-04-30
The identification of protein epitopes is useful for diagnostic purposes and for the development of peptide vaccines. In this study, the epitopes of Toxoplasma gondii SAG1 were identified using synthetic peptide techniques with the aid of bioinformatics. Eleven peptides derived from T. gondii SAG1 were assessed by ELISA using pig sera from different time points after infection. Four (PS4, PS6, PS10 and PS11), out of the eleven peptides tested were recognized by all sera. Then, shorter peptides that were derived from PS4, PS6, PS10 and PS11 were predicted using bioinformatics and tested by experimentation. Four out of nine shorter peptides were identified successfully (amino acids 106-120, 166-180, 289-300 and 313-332). We have precisely located the epitopes of T. gondii SAG1 using pig sera collected at different time points after infection. The identified epitopes may be useful for the further study of epitope-based vaccines and diagnostic reagents.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Reed, S M; Howe, D K; Morrow, J K; Graves, A; Yeargan, M R; Johnson, A L; MacKay, R J; Furr, M; Saville, W J A; Williams, N M
2013-01-01
Recent work demonstrated the value of antigen-specific antibody indices (AI and C-value) to detect intrathecal antibody production against Sarcocystis neurona for antemortem diagnosis of equine protozoal myeloencephalitis (EPM). The study was conducted to assess whether the antigen-specific antibody indices can be reduced to a simple serum : cerebrospinal fluid (CSF) titer ratio to achieve accurate EPM diagnosis. Paired serum and CSF samples from 128 horses diagnosed by postmortem examination. The sample set included 44 EPM cases, 35 cervical-vertebral malformation (CVM) cases, 39 neurologic cases other than EPM or CVM, and 10 non-neurologic cases. Antibodies against S. neurona were measured in serum and CSF pairs using the SnSAG2 and SnSAG4/3 (SnSAG2, 4/3) ELISAs, and the ratio of each respective serum titer to CSF titer was determined. Likelihood ratios and diagnostic sensitivity and specificity were calculated based on serum titers, CSF titers, and serum : CSF titer ratios. Excellent diagnostic sensitivity and specificity was obtained from the SnSAG2, 4/3 serum : CSF titer ratio. Sensitivity and specificity of 93.2 and 81.1%, respectively, were achieved using a ratio cutoff of ≤100, whereas sensitivity and specificity were 86.4 and 95.9%, respectively, if a more rigorous cutoff of ≤50 was used. Antibody titers in CSF also provided good diagnostic accuracy. Serum antibody titers alone yielded much lower sensitivity and specificity. The study confirms the value of detecting intrathecal antibody production for antemortem diagnosis of EPM, and they further show that the antigen-specific antibody indices can be reduced in practice to a simple serum : CSF titer ratio. Copyright © 2013 by the American College of Veterinary Internal Medicine.
The influence of motor re-acceleration on voltage sags
Bollen, M.H.J.
1995-01-01
The assumption that a voltage sag is rectangular is not correct in a power system with large induction motor loads. The motors decelerate during the short circuit. After fault-clearing, they will accelerate again, drawing a high reactive current from the supply, causing a prolonged postfault voltage
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
A robust and fast generic voltage sag detection technique
DEFF Research Database (Denmark)
L. Dantas, Joacillo; Lima, Francisco Kleber A.; Branco, Carlos Gustavo C.
2015-01-01
In this paper, a fast and robust voltage sag detection algorithm, named VPS2D, is introduced. Using the DSOGI, the algorithm creates a virtual positive sequence voltage and monitories the fundamental voltage component of each phase. After calculating the aggregate value in the o:;3-reference fram...
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Morici, Eleonora; Simoni, Serena; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E; Mingoia, Marina
2017-01-01
To investigate the genetic basis of catQ-mediated chloramphenicol resistance in Streptococcus agalactiae. Two clinical strains of catQ-positive chloramphenicol-resistant S. agalactiae (Sag236 and Sag403) were recently isolated, typed (MLST, PFGE pulsotypes, capsular types) and their antibiotic resistances investigated by phenotypic and genotypic approaches. Several molecular methods (PCR mapping, restriction assays, Southern blotting, sequencing and sequence analysis, conjugal transfer assays) were used to determine the genetic context of catQ and characterize a genetic element detected in the isolates. Sag236 and Sag403 shared the same ST (ST19), but exhibited a different capsular type (III and V, respectively) and pulsotype. Both harboured the macrolide resistance genes mef(I) and erm(TR) and the tetracycline resistance gene tet(M). Accordingly, they were resistant to chloramphenicol, erythromycin and tetracycline. catQ and mef(I) were associated in an IQ module that was indistinguishable in Sag236 and Sag403. In mating assays, chloramphenicol and erythromycin resistance proved transferable, at low frequency, only from Sag236. Transconjugants carried not only catQ and mef(I), but also erm(TR), suggesting a linkage of the three resistance genes in a mobile element, which, though seemingly non-mobile, was also detected in Sag403. The new element (designated ICESag236, ∼110 kb) results from recombination of two integrative and conjugative elements (ICEs) originally described in different streptococcal species: S. agalactiae ICESagTR7, carrying erm(TR); and Streptococcus pneumoniae ICESpn529IQ, carrying the prototype IQ module. These findings strengthen the notion that widespread streptococcal ICEs may form mosaics that enhance their diversity and spread, broaden their host range and carry new cargo genes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions
Zhou, Zhichao; Mei, Lianfu; Liu, Jun; Zheng, Jinyun; Chen, Liang; Hao, Shihao
2018-02-01
The rift architecture and deep crustal structure of the distal margin at the mid-northern margin of the South China Sea have been previously investigated by using deep seismic reflection profiles. However, one fundamental recurring problem in the debate is the extensional fault system and rift structure of the hyperextended rift basins (Baiyun Sag and Liwan Sag) within the distal margin because of the limited amount of seismic data. Based on new 3D seismic survey data and 2D seismic reflection profiles, we observe an array of fault blocks in the Baiyun Sag, which were tilted towards the ocean by extensional faulting. The extensional faults consistently dip towards the continent. Beneath the tilted fault blocks and extensional faults, a low-angle, high-amplitude and continuous reflection has been interpreted as the master detachment surface that controls the extension process. During rifting, the continentward-dipping normal faults evolved in a sequence from south to north, generating the asymmetric rift structure of the Baiyun Sag. The Baiyun Sag is separated from the oceanic domain by a series of structural highs that were uplifted by magmatic activity in response to the continental breakup at 33 Ma and a ridge jump to the south at 26-24 Ma. Therefore, we propose that magmatism played a significant role in the continental extension and final breakup in the South China Sea.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Ellison, Siobhan; Witonsky, Sharon
2009-07-01
Sarcocystis neurona is the principal etiologic agent of equine protozoal myeloencephalitis (EPM). An immunodominant protein of S. neurona, SnSAG-1, is expressed by the majority of S. neurona merozoites isolated from spinal tissues of horses diagnosed with EPM and may be a candidate for diagnostic tests and prophylaxis for EPM. Five horses were vaccinated with adjuvanted recombinant SnSAG1 (rSnSAG1) and 5 control (sham vaccinated) horses were vaccinated with adjuvant only. Serum was evaluated pre- and post-vaccination, prior to challenge, for antibodies against rSnSAG1 and inhibitory effects on the infectivity of S. neurona by an in vitro serum neutralization assay. The effect of vaccination with rSnSAG1 on in vivo infection by S. neurona was evaluated by challenging all the horses with S. neurona merozoites. Blinded daily examinations and 4 blinded neurological examinations were used to evaluate the presence of clinical signs of EPM. The 5 vaccinated horses developed serum and cerebrospinal fluid (CSF) titers of SnSAG1, detected by enzyme-linked immunosorbent assay (ELISA), post-vaccination. Post-vaccination serum from vaccinated horses was found to have an inhibitory effect on merozoites, demonstrated by in vitro bioassay. Following the challenge, the 5 control horses displayed clinical signs of EPM, including ataxia. While 4 of the 5 vaccinated horses did not become ataxic. One rSnSAG-1 vaccinated horse showed paresis in 1 limb with muscle atrophy. All horses showed mild, transient, cranial nerve deficits; however, disease did not progress to ataxia in rSnSAG-1 vaccinated horses. The study showed that vaccination with rSnSAG-1 produced antibodies in horses that neutralized merozoites when tested by in vitro culture and significantly reduced clinical signs demonstrated by in vivo challenge.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Evolutionary paths of streptococcal and staphylococcal superantigens
Directory of Open Access Journals (Sweden)
Okumura Kayo
2012-08-01
Full Text Available Abstract Background Streptococcus pyogenes (GAS harbors several superantigens (SAgs in the prophage region of its genome, although speG and smez are not located in this region. The diversity of SAgs is thought to arise during horizontal transfer, but their evolutionary pathways have not yet been determined. We recently completed sequencing the entire genome of S. dysgalactiae subsp. equisimilis (SDSE, the closest relative of GAS. Although speG is the only SAg gene of SDSE, speG was present in only 50% of clinical SDSE strains and smez in none. In this study, we analyzed the evolutionary paths of streptococcal and staphylococcal SAgs. Results We compared the sequences of the 12–60 kb speG regions of nine SDSE strains, five speG+ and four speG–. We found that the synteny of this region was highly conserved, whether or not the speG gene was present. Synteny analyses based on genome-wide comparisons of GAS and SDSE indicated that speG is the direct descendant of a common ancestor of streptococcal SAgs, whereas smez was deleted from SDSE after SDSE and GAS split from a common ancestor. Cumulative nucleotide skew analysis of SDSE genomes suggested that speG was located outside segments of steeper slopes than the stable region in the genome, whereas the region flanking smez was unstable, as expected from the results of GAS. We also detected a previously undescribed staphylococcal SAg gene, selW, and a staphylococcal SAg -like gene, ssl, in the core genomes of all Staphylococcus aureus strains sequenced. Amino acid substitution analyses, based on dN/dS window analysis of the products encoded by speG, selW and ssl suggested that all three genes have been subjected to strong positive selection. Evolutionary analysis based on the Bayesian Markov chain Monte Carlo method showed that each clade included at least one direct descendant. Conclusions Our findings reveal a plausible model for the comprehensive evolutionary pathway of streptococcal and
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
Directory of Open Access Journals (Sweden)
Yongchun Yang
2018-04-01
Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.
Directory of Open Access Journals (Sweden)
Rafael Cisneros-Magaña
2018-06-01
Full Text Available This paper proposes a time-domain methodology based on the unscented Kalman filter to estimate voltage sags and their characteristics, such as magnitude and duration in power systems represented by nonlinear models. Partial and noisy measurements from the electrical network with nonlinear loads, used as data, are assumed. The characteristics of voltage sags can be calculated in a discrete form with the unscented Kalman filter to estimate all the busbar voltages; being possible to determine the rms voltage magnitude and the voltage sag starting and ending time, respectively. Voltage sag state estimation results can be used to obtain the power quality indices for monitored and unmonitored busbars in the power grid and to design adequate mitigating techniques. The proposed methodology is successfully validated against the results obtained with the time-domain system simulation for the power system with nonlinear components, being the normalized root mean square error less than 3%.
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Analysis of doubly-fed induction machine operating at motoring mode subjected to voltage sag
Directory of Open Access Journals (Sweden)
Navneet Kumar
2016-09-01
Full Text Available Variable Speed (VS Pumped Storage Plants (PSP equipped with large asynchronous (Doubly-Fed Induction machines are emerging now in hydropower applications. Motoring mode of operation of Doubly-Fed Induction Machine (DFIM is essential and techno-economical in this application due to: (1 its uniqueness in active power controllability, (2 bulk power handing capability with less rated power converters in rotor circuit, and (3 integrating Renewable Energy Sources (RES. This paper investigates the performance of two DFIMs at different power ratings (2.2 kW and 2 MW under voltage sag with different attribute. The test results are analyzed in terms of the peaks in torque, speed, power taken and transient currents in rotor and stator circuits. During sag, stable region for DFIM operation along with speed and stator side reactive power input control is also illustrated. The negative effects of voltage sag are briefly discussed. MATLAB simulation is validated with experimentation. The various observations during simulation and experimental analysis are also supported by the theoretical explanations.
SVC or VSC for reduction of voltage sags and flicker. Trends in power electronics
Energy Technology Data Exchange (ETDEWEB)
Haeusler, M; Schnettler, A [ABB Calor Emag Schaltanlagen AG, Mannheim (Germany); Halvarsson, P [ABB Power Systems AB, Vaesteraas (Sweden)
1997-07-01
In the past complaints about insufficient power quality were often caused by flicker observed in the neighbourhood of industrial networks. Voltage sags due to faults in the power system pass, however, mostly unnoticed as not-so-common events. Now electronic controls are penetrating more and more in industry. Electronic controllers on factory machines - particularly those for variable speed motors - are vulnerable to voltage sags. A one-tenth second sag can cause a $200.000 downtime incident in a big factory. Therefore the demands on power quality are rising in industry as well. The costly separation in clean networks for residential areas and dirty networks for industrial grids is no perfect solution to avoid such problems. Static VAr Compensators (SVC) are traditionally one means to control the voltage in industrial networks. Because of the recent development of powerful gate turn-off semiconductor devices another type of converter has gained new interest for mitigation of system disturbances, the voltage-source converter (VSC). The characteristics of both types of power electronics in view of their possibilities for this application are presented. (orig.)
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Simulation and experiment of a YBCO SMES prototype in voltage sag compensation
International Nuclear Information System (INIS)
Zhu Jiahui; Yuan Weijia; Coombs, T.A.; Ming, Q.
2011-01-01
Research highlights: → YBCO conductors are used in SMES. → The SMES is successfully used to compensate voltage sag by both simulation and experiment. → A new control strategy for the power converter in the SMES. - Abstract: This paper gives a introduction of a SMES unit using 2G HTS wires. A complete SMES system including both superconducting coils and control circuit has been designed to operate at 77 K. Three single-phase H-bridge converters have been used in the control circuit. A loop control signal is sent out by using 32 fixed point Digital Signal Processor (DSP). The complete circuit has been both modelled in simulation and built experimentally. The results validate that this SMES successfully compensates a voltage sag in a power system.
Simulation and experiment of a YBCO SMES prototype in voltage sag compensation
Energy Technology Data Exchange (ETDEWEB)
Zhu Jiahui, E-mail: zhujiahui@epri.sgcc.com.c [China Electric Power Research Institute, No. 15 Xiaoying Rd(E), Qinghe, Beijing 100192 (China); Yuan Weijia; Coombs, T.A. [Electrical Engineering Division, Engineering Department, University of Cambridge, CB3 0FA (United Kingdom); Ming, Q. [China Electric Power Research Institute, No. 15 Xiaoying Rd(E), Qinghe, Beijing 100192 (China)
2011-03-15
Research highlights: {yields} YBCO conductors are used in SMES. {yields} The SMES is successfully used to compensate voltage sag by both simulation and experiment. {yields} A new control strategy for the power converter in the SMES. - Abstract: This paper gives a introduction of a SMES unit using 2G HTS wires. A complete SMES system including both superconducting coils and control circuit has been designed to operate at 77 K. Three single-phase H-bridge converters have been used in the control circuit. A loop control signal is sent out by using 32 fixed point Digital Signal Processor (DSP). The complete circuit has been both modelled in simulation and built experimentally. The results validate that this SMES successfully compensates a voltage sag in a power system.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Directory of Open Access Journals (Sweden)
Yu Su
2014-03-01
Full Text Available Camera robots are high-speed redundantly cable-driven parallel manipulators that realize the aerial panoramic photographing. When long-span cables and high maneuverability are involved, the effects of cable sags and inertias on the dynamics must be carefully dealt with. This paper is devoted to the optimal cable tension distribution (OCTD for short of the camera robots. Firstly, each fast varying-length cable is discretized into some nodes for computing the cable inertias. Secondly, the dynamic equation integrated with the cable inertias is set up regarding the large-span cables as catenaries. Thirdly, an iterative optimization algorithm is introduced for the cable tension distribution by using the dynamic equation and sag-to-span ratios as constraint conditions. Finally, numerical examples are presented to demonstrate the effects of cable sags and inertias on determining tensions. The results justify the convergence and effectiveness of the algorithm. In addition, the results show that it is necessary to take the cable sags and inertias into consideration for the large-span manipulators.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Sanchita Das
Full Text Available Sodium antimony gluconate (SAG unresponsiveness of Leishmania donovani (Ld had effectively compromised the chemotherapeutic potential of SAG. 60s ribosomal L23a (60sRL23a, identified as one of the over-expressed protein in different resistant strains of L.donovani as observed with differential proteomics studies indicates towards its possible involvement in SAG resistance in L.donovani. In the present study 60sRL23a has been characterized for its probable association with SAG resistance mechanism.The expression profile of 60s ribosomal L23a (60sRL23a was checked in different SAG resistant as well as sensitive strains of L.donovani clinical isolates by real-time PCR and western blotting and was found to be up-regulated in resistant strains. Ld60sRL23a was cloned, expressed in E.coli system and purified for raising antibody in swiss mice and was observed to have cytosolic localization in L.donovani. 60sRL23a was further over-expressed in sensitive strain of L.donovani to check its sensitivity profile against SAG (Sb V and III and was found to be altered towards the resistant mode.This study reports for the first time that the over expression of 60sRL23a in SAG sensitive parasite decreases the sensitivity of the parasite towards SAG, miltefosine and paramomycin. Growth curve of the tranfectants further indicated the proliferative potential of 60sRL23a assisting the parasite survival and reaffirming the extra ribosomal role of 60sRL23a. The study thus indicates towards the role of the protein in lowering and redistributing the drug pressure by increased proliferation of parasites and warrants further longitudinal study to understand the underlying mechanism.
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Optimum distributed generation placement with voltage sag effect minimization
International Nuclear Information System (INIS)
Biswas, Soma; Goswami, Swapan Kumar; Chatterjee, Amitava
2012-01-01
Highlights: ► A new optimal distributed generation placement algorithm is proposed. ► Optimal number, sizes and locations of the DGs are determined. ► Technical factors like loss, voltage sag problem are minimized. ► The percentage savings are optimized. - Abstract: The present paper proposes a new formulation for the optimum distributed generator (DG) placement problem which considers a hybrid combination of technical factors, like minimization of the line loss, reduction in the voltage sag problem, etc., and economical factors, like installation and maintenance cost of the DGs. The new formulation proposed is inspired by the idea that the optimum placement of the DGs can help in reducing and mitigating voltage dips in low voltage distribution networks. The problem is configured as a multi-objective, constrained optimization problem, where the optimal number of DGs, along with their sizes and bus locations, are simultaneously obtained. This problem has been solved using genetic algorithm, a traditionally popular stochastic optimization algorithm. A few benchmark systems radial and networked (like 34-bus radial distribution system, 30 bus loop distribution system and IEEE 14 bus system) are considered as the case study where the effectiveness of the proposed algorithm is aptly demonstrated.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
S. S. Deswal; Ratna Dahiya; D. K. Jain
2008-01-01
Process control and energy conservation are the two primary reasons for using an adjustable speed drive. However, voltage sags are the most important power quality problems facing many commercial and industrial customers. The development of boost converters has raised much excitement and speculation throughout the electric industry. Now utilities are looking to these devices for performance improvement and reliability in a variety of areas. Examples of these include sags,...
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Deriving Sight Distance on a Compound Sag and Circular Curve in a Three Dimensional Space
Directory of Open Access Journals (Sweden)
Chiu Liu, PhD, PE, PTOE
2012-09-01
Full Text Available Insufficient roadway sight distance (SD may become a contribution factor to traffic collisions or other unsafe traffic maneuvers. The sight distance (SD for a two-dimensional (2-d sag or circular curve has been addressed in detail in various traffic engineering literatures. Although three-dimensional (3-d compound sag and circular curves are often found along ramps, connectors, and mountain roads, the sight distances for these compound curves are yet to be analyzed on an exact analytic setting. By considering human-vehicle-roadway interaction, the formulas for computing the SD on a 3-d curve are derived the first time on a unified analytic framework. The 2-d sag curve SD can also be deduced from these derived formulas as special limiting cases. Practitioners can easily program these formulas or equations on a user-friendly Microsoft Excel spread sheet to calculate 3-d SD on most roadways with roadside clearance. This framework can be extended to estimate SD on roadways with obstacles partially blocking vehicle headlight beams. 6.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
SAG2 locus genotyping of Toxoplasma gondii in meat products of ...
African Journals Online (AJOL)
Jane
2011-10-12
Oct 12, 2011 ... restriction fragment length polymorphism (RFLP) analysis of SAG2 locus revealed that all of the samples belonged to genotype I. The detection of the parasite in uncooked meat and commercial meat products, and the high ratio of seropositive slaughtered animals, emphasis that the risk still exists for.
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Directory of Open Access Journals (Sweden)
Beco Jacques
2008-07-01
Full Text Available Abstract Background Levator plate sagging (LPS, usually called descending perineum syndrome, is one of the main defects encountered in perineology. This defect is classically associated with colo-proctologic functional troubles (dyschesia and anal incontinence but can also induce perineodynia, gynaecological and lower urinary tract symptoms. Methods A retrospective case series of nine female patients (mean age: 44.3 underwent an isolated retro-anal levator plate myorrhaphy (RLPM to treat symptomatic LPS confirmed by rectal examination and/or Perineocaliper®. An anti-sagging test (support of the posterior perineum must significantly improve the symptoms that were resistant to conservative treatment. The effect of the procedure on the symptoms of the 3 axes of the perineum (urological, colo-proctologic and gynecological and on perineodynia was evaluated during a follow up consultation more than 9 months after surgery. The effect of RLPM on the position of the anal margin and on the levator plate angle was studied using rectal examination, Perineocaliper® and retro-anal ultrasound. Results Before surgery, anti-sagging tests were positive for dyschesia, urinary urgency and pain. After a mean follow-up of 16.1 months, RLPM resolved or improved 2/2 cases of stress urinary incontinence, 3/5 of urinary urgency, 3/4 of dysuria, 3/3 of anal incontinence, 7/8 of dyschesia, 3/4 of cystocele, 4/5 of rectocele, 5/8 of dyspareunia and 6/7 of perineodynia. Rectal examination showed a complete suppression of sagging in 4 patients and an improvement in the 5 others. The mean reduction of perineal descent was 1.08 cm (extremes: 0–1.5. Using retro-anal ultrasound of the levator plate, the mean reduction of sagging was 12.67 degrees (extremes: 1 – 21. Conclusion Anti-sagging tests can be used before surgery to simulate the effect of RLPM. This surgical procedure seems to improve stress urinary incontinence, frequency, nocturia, urgency, dysuria, anal
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Voltage Sag Mitigation and Load Reactive Power Compensation by UPQC
Ajitha, P; Jananisri, D
2014-01-01
This paper presents Unified Power Quality Conditioner(UPQC) that consist of series inverter and shunt inverter in back to back configuration which simultaneously compensate the power quality(PQ) problems of both voltage sag and load reactive power compensation . In this paper ,Neural network is tool which is considered for solving power quality problems. The simulation results from MATLAB/SIMULINK are discussed to validate the proposed method.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
International Nuclear Information System (INIS)
Zhang Zhijie; Yu Xinghe; Zhang Chuanheng; Chen Zhankun
2005-01-01
Damoguaihe Formation, which is mainly of alluvial fan, fan delta and lacustrine depositional systems, is the target horizon for the prospecting of sandstone-type uranium deposit in Kelulun sag, Hailaer basin. According to the depositional environment and sediment characteristics, alluvial fan facies is subdivided into upper fan, middle fan and lower fan subfacies; the fan delta facies is subadivided into upper fan delta plain, lower fan delta plain, fan delta front and fan prodelta subfacies. At the northern edge of the sag occurred one fan delta and one alluvial fan, which can mutually transform one into another. The terrigenous coarse-grained clastic deposits in the study area provide favorable condition for the concentration of uranium and especially the main channels and distributary channels on the fan delta and alluvial fan are the most favorable sites for uranium concentration. (authors)
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu
2018-01-10
Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Control of hybrid fuel cell/energy storage distributed generation system against voltage sag
Energy Technology Data Exchange (ETDEWEB)
Hajizadeh, Amin; Golkar, Masoud Aliakbar [Electrical Engineering Department, K.N. Toosi University of Technology, Seyedkhandan, Dr. Shariati Ave, P.O. Box 16315-1355, Tehran (Iran)
2010-06-15
Fuel cell (FC) and energy storage (ES) based hybrid distributed power generation systems appear to be very promising for satisfying high energy and high power requirements of power quality problems in distributed generation (DG) systems. In this study, design of control strategy for hybrid fuel cell/energy storage distributed power generation system during voltage sag has been presented. The proposed control strategy allows hybrid distributed generation system works properly when a voltage disturbance occurs in distribution system and hybrid system stays connected to the main grid. Hence, modeling, controller design, and simulation study of a hybrid distributed generation system are investigated. The physical model of the fuel cell stack, energy storage and the models of power conditioning units are described. Then the control design methodology for each component of the hybrid system is proposed. Simulation results are given to show the overall system performance including active power control and voltage sag ride-through capability of the hybrid distributed generation system. (author)
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Nhu Y, Do
2018-03-01
Vietnam has many advantages of wind power resources. Time by time there are more and more capacity as well as number of wind power project in Vietnam. Corresponding to the increase of wind power emitted into national grid, It is necessary to research and analyze in order to ensure the safety and reliability of win power connection. In national distribution grid, voltage sag occurs regularly, it can strongly influence on the operation of wind power. The most serious consequence is the disconnection. The paper presents the analysis of distribution grid's transient process when voltage is sagged. Base on the analysis, the solutions will be recommended to improve the reliability and effective operation of wind power resources.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Li, Zhongyu; Zhao, Rende; Xin, Zhen
2016-01-01
The Inrush Transient Current (ITC) in the output of the photovoltaic grid-connected inverters is usually generated when grid voltage sag occurs, which can trigger the protection of the grid-connected inverters, and even destroy the semiconductor switches. Then, the grid-connected inverters...
Gaji, Rajshekhar Y; Howe, Daniel K
2009-07-01
The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.
Imokawa, Genji; Ishida, Koichi
2015-01-01
The repetitive exposure of skin to ultraviolet B (UVB) preferentially elicits wrinkling while ultraviolet A (UVA) predominantly elicits sagging. In chronically UVB or UVA-exposed rat skin there is a similar tortuous deformation of elastic fibers together with decreased skin elasticity, whose magnitudes are greater in UVB-exposed skin than in UVA-exposed skin. Comparison of skin elasticity with the activity of matrix metalloproteinases (MMPs) in the dermis of ovariectomized rats after UVB or UVA irradiation demonstrates that skin elasticity is more significantly decreased in ovariectomized rats than in sham-operated rats, which is accompanied by a reciprocal increase in elastase activity but not in the activities of collagenases I or IV. Clinical studies using animal skin and human facial skin demonstrated that topical treatment with a specific inhibitor or an inhibitory extract of skin fibroblast-derived elastase distinctly attenuates UVB and sunlight-induced formation of wrinkling. Our results strongly indicated that the upregulated activity of skin fibroblast-derived elastase plays a pivotal role in wrinkling and/or sagging of the skin via the impairment of elastic fiber configuration and the subsequent loss of skin elasticity. PMID:25856675
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Modelling of V-Hz and vector controlled ASDs in PSCAD/EMTDC for voltage sag studies
Energy Technology Data Exchange (ETDEWEB)
Vegunta, S.C. [TNEI Services Ltd, Manchester M1 2PW (United Kingdom); Milanovic, J.V. [School of Electrical and Electronic Engineering of The University of Manchester, PO Box 88, Manchester M60 1QD (United Kingdom); Djokic, S.Z. [School of Engineering of The University of Edinburgh, The King' s Buildings, Mayfield Road, Edinburgh EH9 3JL (United Kingdom)
2010-01-15
This paper deals with modelling and performance of adjustable speed drives (ASDs) subjected to voltage disturbances in electric supply. The aim of this study was to develop appropriate models of typical ASD and investigate their sensitivity to voltage disturbances under various practical modes of operation and control. Accordingly, scalar controlled open and closed loop volts-hertz (V-Hz) and vector controlled closed loop ASDs are modelled in PSCAD/EMTDC environment, and their performance in the presence of voltage disturbances is investigated under typical operating and loading conditions. The drive sensitivity to three-phase, two-phase and single-phase voltage sags and short interruptions was assessed, and the findings are discussed in the paper. Depending on the type of drive control, type of voltage sag, applied load torque and adjusted speed, various sensitivity curves were established and analyzed. (author)
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Wendte, J M; Miller, M A; Nandra, A K; Peat, S M; Crosbie, P R; Conrad, P A; Grigg, M E
2010-04-19
Sarcocystis neurona is an apicomplexan parasite identified as a cause of fatal neurological disease in the threatened southern sea otter (Enhydra lutris nereis). In an effort to characterize virulent S. neurona strains circulating in the marine ecosystem, this study developed a range of markers relevant for molecular genotyping. Highly conserved sequences within the 18S ribosomal gene array, the plastid-encoded RNA polymerase (RPOb) and the cytochrome c oxidase subunit 1 mitochondrial gene (CO1) were assessed for their ability to distinguish isolates at the genus and species level. For within-species comparisons, five surface antigens (SnSAG1-SnSAG5) and one high resolution microsatellite marker (Sn9) were developed as genotyping markers to evaluate intra-strain diversity. Molecular analysis at multiple loci revealed insufficient genetic diversity to distinguish terrestrial isolates from strains infecting marine mammals. Furthermore, SnSAG specific primers applied against DNA from the closely related species, Sarcocystis falcatula, lead to the discovery of highly similar orthologs to SnSAG2, 3, and 4, calling into question the specificity of diagnostic tests based on these antigens. The results of this study suggest a population genetic structure for S. neurona similar to that reported for the related parasite, Toxoplasma gondii, dominated by a limited number of successful genotypes. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Ramos, Alessandro Candido Lopes [CELG - Companhia Energetica de Goias, Goiania, GO (Brazil). Generation and Transmission. System' s Operation Center], E-mail: alessandro.clr@celg.com.br; Batista, Adalberto Jose [Universidade Federal de Goias (UFG), Goiania, GO (Brazil)], E-mail: batista@eee.ufg.br; Leborgne, Roberto Chouhy [Universidade Federal do Rio Grande do Sul (UFRS), Porto Alegre, RS (Brazil)], E-mail: rcl@ece.ufrgs.br; Emiliano, Pedro Henrique Mota, E-mail: ph@phph.com.br
2009-07-01
This article presents the impact of distributed generation in studies of voltage sags caused by faults in the electrical system. We simulated short-circuit-to-ground in 62 lines of 230, 138, 69 and 13.8 kV that are part of the electrical system of the city of Goiania, of Goias state . For each fault position was monitored the bus voltage of 380 V in an industrial consumer sensitive to such sags. Were inserted different levels of GD near the consumer. The simulations of a short circuit, with the monitoring bar 380 V, were performed again. A study using stochastic simulation Monte Carlo (SMC) was performed to obtain, at each level of GD, the probability curves and sags of the probability density and its voltage class. With these curves were obtained the average number of sags according to each class, that the consumer bar may be submitted annually. The simulations were performed using the Program Analysis of Simultaneous Faults - ANAFAS. In order to overcome the intrinsic limitations of the methods of simulation of this program and allow data entry via windows, a computational tool was developed in Java language. Data processing was done using the MATLAB software.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Senescence is a highly regulated process accompanied by changes in gene expression. While the mRNA levels of most genes decline, the mRNA levels of specific genes (senescence associated genes, SAGs) increase during senescence. Arabidopsis SAG12 (AtSAG12) gene codes for papain-like cysteine protease.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
DEFF Research Database (Denmark)
Zhou, Q.; Nielsen, Søren R.K.; Qu, W. L.
2006-01-01
Three-dimensional semi-active vibration control of an inclined sag cable with discrete magnetorheological (MR) dampers is investigated in this paper using the finite difference method (FDM). A modified Dahl model is used to describe the dynamic property of MR damper. The nonlinear equations...
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Control Method Stretches Suspensions by Measuring the Sag of Strands in Cable-Stayed Bridges
Bętkowski, Piotr
2017-10-01
In the article is described the method that allows on evaluation and validation of measurement correctness of dynamometers (strain gauges, tension meters) used in systems of suspensions. Control of monitoring devices such as dynamometers is recommended in inspections of suspension bridges. Control device (dynamometer) works with an anchor, and the degree of this cooperation could have a decisive impact on the correctness of the results. Method, which determines the stress in the strand (cable), depending on the sag of stayed cable, is described. This method can be used to control the accuracy of measuring devices directly on the bridge. By measuring the strand sag, it is possible to obtain information about the strength (force) which occurred in the suspension cable. Digital camera is used for the measurement of cable sag. Control measurement should be made independently from the controlled parameter but should verify this parameter directly (it is the best situation). In many cases in practice the controlled parameter is not designation by direct measurement, but the calculations, i.e. relation measured others parameters, as in the method described in the article. In such cases occurred the problem of overlapping error of measurement of intermediate parameters (data) and the evaluation of the reliability of the results. Method of control calculations made in relation to installed in the bridge measuring devices is doubtful without procedure of uncertainty estimation. Such an assessment of the accuracy can be performed using the interval numbers. With the interval numbers are possible the analysis of parametric relationship accuracy of the designation of individual parameters and uncertainty of results. Method of measurements, relations and analytical formulas, and numerical example can be found in the text of the article.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Improving Energy Efficiency Via Optimized Charge Motion and Slurry Flow in Plant Scale Sag Mills
Energy Technology Data Exchange (ETDEWEB)
Raj K. Rajamani
2006-07-21
A research team from the University of Utah is working to make inroads into saving energy in these SAG mills. In 2003, Industries of the Future Program of the Department of Energy tasked the University of Utah team to build a partnership between the University and the mining industry for the specific purpose of reducing energy consumption in SAG mills. A partnership was formed with Cortez Gold Mines, Outokumpu Technology, Kennecott Utah Copper Corporation, and Process Engineering Resources Inc. At Cortez Gold Operations the shell and pulp lifters of the semiautogenous grinding mill was redesigned. The redesigned shell lifter has been in operation for over three years and the redesigned pulp lifter has been in operation for over nine months now. This report summarizes the dramatic reductions in energy consumption. Even though the energy reductions are very large, it is safe to say that a 20% minimum reduction would be achieved in any future installations of this technology.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Zhao, J-L; Ding, Y-X; Zhao, H-X; He, X-L; Li, P-F; Li, Z-F; Guan, H; Guo, X
2014-10-11
Clinical endometritis is an important disease of dairy cattle and results in decreased reproductive performance. This disease is caused by contamination of the uterus with a broad spectrum of microorganisms after calving. In this study, staphylococcal isolates from the uterus of dairy cows with clinical endometritis were tested for their distribution of superantigen (SAg) genes and antimicrobial resistance. Between the 127 staphylococcal isolates collected in this study, 10 species were identified. The predominant strain identified was Staphylococcus aureus (n=53), followed by Staphylococcus saprophyticus (n=38) and Staphylococcus chromogenes (n=22). PCR analysis demonstrated that most isolates (63.0 per cent) harboured at least one SAg gene. The most commonly observed SAg gene and genotype was selj (38.6 per cent) and sec-selj-seln (24.0 per cent), respectively. Most isolates were resistant to penicillin (79.5 per cent), ampicillin (71.7 per cent), erythromycin (56.7 per cent), and tetracycline (52.0 per cent). PCR analysis demonstrated that the antimicrobial resistance determinants ermA, ermB, ermC, tetK, tetM and blaZ were detected in 0 per cent, 44.4 per cent, 51.4 per cent, 68.2 per cent, 13.6 per cent and 86.1 per cent of the erythromycin, tetracycline and β-lactam resistant isolates, respectively. There were 22 (17.3 per cent of all isolates) coagulase-negative staphylococci shown to be methicillin resistant. In the methicillin-resistant isolates, significant resistances to ampicillin, erythromycin and penicillin were observed (P<0.01). The results of this study demonstrate that staphylococci recovered from dairy cows with clinical endometritis contain an extensive and complex prevalence of SAg genes. Significant resistances to antibiotics were also seen, highlighting the need for the rational appliance of antibiotics in veterinary medicine. British Veterinary Association.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
Directory of Open Access Journals (Sweden)
Genji Imokawa
2015-04-01
Full Text Available Our previous studies strongly indicated that the up-regulated activity of skin fibroblast-derived elastase plays a pivotal role in wrinkling and/or sagging of the skin via the impairment of elastic fiber configuration and the subsequent loss of skin elasticity. Fortunately, we succeeded in identifying human skin fibroblast-derived elastase as a previously known enzyme, neprilysin or neutral endopeptidase (NEP. We have also characterized epithelial-mesenchymal paracrine cytokine interactions between UVB-exposed-keratinocytes and dermal fibroblasts and found that interleukin-1α and granulocyte macrophage colony stimulatory factor (GM-CSF are intrinsic cytokines secreted by UVB-exposed keratinocytes that stimulate the expression of neprilysin by fibroblasts. On the other hand, direct UVA exposure of human fibroblasts significantly stimulates the secretion of IL-6 and also elicits a significant increase in the gene expression of matrix metallo-protease(MMP-1 as well as neprilysin (to a lesser extent, which is followed by distinct increases in their protein and enzymatic activity levels. Direct UVA exposure of human keratinocytes also stimulates the secretion of IL-6, IL-8 and GM-CSF but not of IL-1 and endothelin-1. These findings suggest that GM-CSF secreted by UVA-exposed keratinocytes as well as IL-6 secreted by UVA-exposed dermal fibroblasts play important and additional roles in UVA-induced sagging and wrinkling by up-regulation of neprilysin and MMP-1, respectively, in dermal fibroblasts.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
An Enhanced LVRT Scheme for DFIG-based WECSs under Both Balanced and Unbalanced Grid Voltage Sags
DEFF Research Database (Denmark)
Mohammadi, Jafar; Afsharnia, Saeed; Ebrahimzadeh, Esmaeil
2017-01-01
reactive power into the grid. The passive compensator is based on a three-phase stator damping resistor (SDR) located in series with the stator windings. The proposed scheme decreases the negative effects of grid voltage sags in the DFIG system including the rotor over-currents, electromagnetic torque...
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
DEFF Research Database (Denmark)
Nielsen, Hans Jørgen; Hammer, J H; Moesgaard, F
1991-01-01
The influence of perioperative whole-blood transfusion and transfusion with erythrocyte suspension (SAG-M blood) on postoperative depression of cell-mediated immunity (CMI) was investigated in 67 patients who underwent elective resection for colorectal cancer. Cell-mediated immunity was assessed...
International Nuclear Information System (INIS)
Wenzel, R.P.; Teates, C.D.; Galapon, Q.; Barczak, R.; Ling, C.M.; Overby, L.R.
1975-01-01
The radioimmunoassay (RIA) and counterimmunoelectrophoretic (CIE) methods were compared in detecting hepatitis B antigen (HB/sub s/Ag) in 407 acute and 336 convalescent sera of adults with viral hepatitis. The CIE method demonstrated that 41 percent of acute and 28 percent of 14- to 17-day serum specimens were HB/sub s/Ag-positive. The RIA method demonstrated seropositivity in 60 percent of acute and 56 percent of convalescent specimens (P less than .001). Eighty-four percent of coded specimens initially positive for HB/sub s/Ag by RIA were found to have subtype antigenic determinants d or y; 92 percent of the HB/sub s/Ag-negative controls were negative for subtype antigens, confirming the specificity of the RIA test. RIA subtyping data corroborated earlier work with immunodiffusion techniques. (U.S.)
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Grötzinger, Stefan W.; Alam, Intikhab; Ba Alawi, Wail; Bajic, Vladimir B.; Stingl, Ulrich; Eppinger, Jörg
2014-01-01
Reliable functional annotation of genomic data is the key-step in the discovery of novel enzymes. Intrinsic sequencing data quality problems of single amplified genomes (SAGs) and poor homology of novel extremophile's genomes pose significant challenges for the attribution of functions to the coding sequences identified. The anoxic deep-sea brine pools of the Red Sea are a promising source of novel enzymes with unique evolutionary adaptation. Sequencing data from Red Sea brine pool cultures and SAGs are annotated and stored in the Integrated Data Warehouse of Microbial Genomes (INDIGO) data warehouse. Low sequence homology of annotated genes (no similarity for 35% of these genes) may translate into false positives when searching for specific functions. The Profile and Pattern Matching (PPM) strategy described here was developed to eliminate false positive annotations of enzyme function before progressing to labor-intensive hyper-saline gene expression and characterization. It utilizes InterPro-derived Gene Ontology (GO)-terms (which represent enzyme function profiles) and annotated relevant PROSITE IDs (which are linked to an amino acid consensus pattern). The PPM algorithm was tested on 15 protein families, which were selected based on scientific and commercial potential. An initial list of 2577 enzyme commission (E.C.) numbers was translated into 171 GO-terms and 49 consensus patterns. A subset of INDIGO-sequences consisting of 58 SAGs from six different taxons of bacteria and archaea were selected from six different brine pool environments. Those SAGs code for 74,516 genes, which were independently scanned for the GO-terms (profile filter) and PROSITE IDs (pattern filter). Following stringent reliability filtering, the non-redundant hits (106 profile hits and 147 pattern hits) are classified as reliable, if at least two relevant descriptors (GO-terms and/or consensus patterns) are present. Scripts for annotation, as well as for the PPM algorithm, are available
Grötzinger, Stefan W.
2014-04-07
Reliable functional annotation of genomic data is the key-step in the discovery of novel enzymes. Intrinsic sequencing data quality problems of single amplified genomes (SAGs) and poor homology of novel extremophile\\'s genomes pose significant challenges for the attribution of functions to the coding sequences identified. The anoxic deep-sea brine pools of the Red Sea are a promising source of novel enzymes with unique evolutionary adaptation. Sequencing data from Red Sea brine pool cultures and SAGs are annotated and stored in the Integrated Data Warehouse of Microbial Genomes (INDIGO) data warehouse. Low sequence homology of annotated genes (no similarity for 35% of these genes) may translate into false positives when searching for specific functions. The Profile and Pattern Matching (PPM) strategy described here was developed to eliminate false positive annotations of enzyme function before progressing to labor-intensive hyper-saline gene expression and characterization. It utilizes InterPro-derived Gene Ontology (GO)-terms (which represent enzyme function profiles) and annotated relevant PROSITE IDs (which are linked to an amino acid consensus pattern). The PPM algorithm was tested on 15 protein families, which were selected based on scientific and commercial potential. An initial list of 2577 enzyme commission (E.C.) numbers was translated into 171 GO-terms and 49 consensus patterns. A subset of INDIGO-sequences consisting of 58 SAGs from six different taxons of bacteria and archaea were selected from six different brine pool environments. Those SAGs code for 74,516 genes, which were independently scanned for the GO-terms (profile filter) and PROSITE IDs (pattern filter). Following stringent reliability filtering, the non-redundant hits (106 profile hits and 147 pattern hits) are classified as reliable, if at least two relevant descriptors (GO-terms and/or consensus patterns) are present. Scripts for annotation, as well as for the PPM algorithm, are available
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Stefan Wolfgang Grötzinger
2014-04-01
Full Text Available Reliable functional annotation of genomic data is the key-step in the discovery of novel enzymes. Intrinsic sequencing data quality problems of single amplified genomes (SAGs and poor homology of novel extremophile’s genomes pose significant challenges for the attribution of functions to the coding sequences identified. The anoxic deep-sea brine pools of the Red Sea are a promising source of novel enzymes with unique evolutionary adaptation. Sequencing data from Red Sea brine pool cultures and SAGs are annotated and stored in the INDIGO data warehouse. Low sequence homology of annotated genes (no similarity for 35% of these genes may translate into false positives when searching for specific functions. The Profile & Pattern Matching (PPM strategy described here was developed to eliminate false positive annotations of enzyme function before progressing to labor-intensive hyper-saline gene expression and characterization. It utilizes InterPro-derived Gene Ontology (GO-terms (which represent enzyme function profiles and annotated relevant PROSITE IDs (which are linked to an amino acid consensus pattern. The PPM algorithm was tested on 15 protein families, which were selected based on scientific and commercial potential. An initial list of 2,577 E.C. numbers was translated into 171 GO-terms and 49 consensus patterns. A subset of INDIGO-sequences consisting of 58 SAGs from six different taxons of bacteria and archaea were selected from 6 different brine pool environments. Those SAGs code for 74,516 genes, which were independently scanned for the GO-terms (profile filter and PROSITE IDs (pattern filter. Following stringent reliability filtering, the non-redundant hits (106 profile hits and 147 pattern hits are classified as reliable, if at least two relevant descriptors (GO-terms and/or consensus patterns are present. Scripts for annotation, as well as for the PPM algorithm, are available through the INDIGO website.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Tang, Y.
2009-12-01
Northern South China Sea Margin locates in Eurasian plate,Indian-Australia plate,Pacific Plates.The South China Sea had underwent a complicated tectonic evolution in Cenozoic.During rifting,the continental shelf and slope forms a series of Cenozoic sedimentary basins,including Qiongdongnan basin,Pearl River Mouth basin,Taixinan basin.These basins fill in thick Cenozoic fluviolacustrine facies,transitional facies,marine facies,abyssal facies sediment,recording the evolution history of South China Sea Margin rifting and ocean basin extending.The studies of tectonics and deposition of depression in the Southern Chaonan Sag of lower continental slope in the Norther South China Sea were dealt with,based on the sequence stratigraphy and depositional facies interpretation of seismic profiles acquired by cruises of“China and Germany Joint Study on Marine Geosciences in the South China Sea”and“The formation,evolution and key issues of important resources in China marginal sea",and combining with ODP 1148 cole and LW33-1-1 well.The free-air gravity anomaly of the break up of the continental and ocean appears comparatively low negative anomaly traps which extended in EW,it is the reflection of passive margin gravitational effect.Bouguer gravity anomaly is comparatively low which is gradient zone extended NE-SW.Magnetic anomaly lies in Magnetic Quiet Zone at the Northern Continental Margin of the South China Sea.The Cenozoic sediments of lower continental slope in Southern Chaonan Sag can be divided into five stratum interface:SB5.5,SB10.5,SB16.5,SB23.8 and Hg,their ages are of Pliocene-Quaternary,late Miocene,middle Miocene,early Miocene,paleogene.The tectonic evolution of low continental slope depressions can be divided into rifting,rifting-depression transitional and depression stages,while their depositional environments change from river to shallow marine and abyssa1,which results in different topography in different stages.The topographic evolvement in the study
A sagging along the eastern Chianti Mts., Italy
Coltorti, M.; Ravani, S.; Cornamusini, G.; Ielpi, A.; Verrazzani, F.
2009-11-01
A deep-seated gravitational slope deformation (DGSD) affects the eastern side of the Chianti Mts. Ridge. It develops in an N-S to NW-SE direction and is > 10 km wide and 3-4 km long. This area corresponds to the eastern side of a main antiform, characterised by east-verging folds and thrusts involving bedrock of the Mesozoic-Paleogene Tuscan Units, particularly sandstones containing interlayered highly fractured and deformed Ligurian rocks (shales and limestones with olistostromes). The foot of the slope is characterised by tilted Plio-Pleistocene deposits unconformably sealing the bedrock structures as folds, thrusts and faults. The most significant morphological features are a main escarpment, trenches, several secondary and counter-slope escarpments that together indicate large-scale gravitational phenomena. The main escarpment is responsible for the headward retreat of the slope, and is deeply segmented by numerous arcuate niches that reveal differential movements of single blocks. The DGSD is also dissected by SW-NE trending streams that often deepen inside the N-S trenches. Minor landslides due to local instability are also present. At the foot of the slope, the older continental Pliocene deposits of the Upper Valdarno Basin crop out. Although tilted by tectonic movements, the deposits have not been severely affected by gravitational deformations. This indicates that the movement is a typical sagging, a large landslide at an embryonic stage, affecting the upper part of the slope but not reaching the valley bottom. The deformations are absorbed in the rock mass which is also partially drained by stream incision that prevents high pore pressure. The occurrence of down-slope and down-movement facing escarpments and up-slope and up-movement facing counter-slope escarpments indicate a sagging characterised by a listric spoon-shaped geometry. The DGSD has a style similar to crustal extensional tectonics such as Morton and Black's crustal attenuation model. Although
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Effects of PSAG12-IPT gene expression on development and senescence in transgenic Lettuce
McCabe, M.S.; Garratt, L.C.; Schepers, F.; Jordi, W.J.R.M.; Stoopen, G.M.; Davelaar, E.; Rhijn, van J.H.A.; Power, J.B.; Davey, M.R.
2001-01-01
An ipt gene under control of the senescence-specific SAG12 promoter from Arabidopsis (PSAG12-IPT) significantly delayed developmental and postharvest leaf senescence in mature heads of transgenic lettuce (Lactuca sativa L. cv Evola) homozygous for the transgene. Apart from retardation of leaf
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
International Nuclear Information System (INIS)
Watanabe, Takuya; Akutsu, Yasushi; Okazaki, Osamu
1995-01-01
Regional myocardial blood flow (RMBF) associated with exercise-induced ST depression was assessed using 13 NH 3 positron emission tomography (PET) to determine the significance of horizontal and sagging type ST segments. The subjects were 25 patients with angina pectoris, 25 patients with myocardial infarction, and 5 healthy male volunteers. Eleven regions of interests (ROI) were prepared to calculate RMBF. ST segments were unchanged in 27 patients (Group A) and were depressed in 23 patients (Group B). A 10% increase in RMBF was significantly observed in Group A (74.1%) than Group B (34.8%). In Group B, ST depression was divided into horizontal type (8 patients) and sagging type (15 patients). According to the type of ST depression, RMBF was increased by 10% or more in 50% (4/8) for horizontal type and in 26.7% (4/15) for sagging type. These findings suggested that unfavorable increase in RMBF in stenosiss-related coronary vessels may contribute to the development of ST depression induced by exercise. A constant increase in RMBF in all ROIs, including those with unfavorable RMBF increase, may be involved in the occurrence of horizontal type ST depression; sagging type ST depression may, however, occur by an increased difference in blood flow between unfavorable and favorable RMBF. (N.K.)
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Alejandro Castillo Guasca
2013-07-01
Full Text Available Es de gran importancia conocer cuáles son las causas para que se presenten sags en las barrajes de distribución, debido a que la afectación sobre los clientes industriales es de carácter relevante. Por esta razón se planteó una metodología para buscar la correlación existente entre sags y los eventos ambientales u operativos del sistema de distribución. A manera de ejemplo, se aplicó en tres subestaciones, las cuales se encuentran ubicadas en diferentes sectores de la ciudad. Para el desarrollo de esta metodología, se realizó la correlación de los datos mediante la implementación de tablas dinámicas y programación en Access, donde se evidenció qué tipo de eventos son los que tienen un mayor impacto sobre los clientes. De acuerdo a los resultados obtenidos se sugiere algunas recomendaciones para mitigar este tipo de eventos en el sistema de distribución.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Endogenous MMTV proviruses induce susceptibility to both viral and bacterial pathogens.
Directory of Open Access Journals (Sweden)
Sanchita Bhadra
2006-12-01
Full Text Available Most inbred mice carry germline proviruses of the retrovirus, mouse mammary tumor virus (MMTV (called Mtvs, which have multiple replication defects. A BALB/c congenic mouse strain lacking all endogenous Mtvs (Mtv-null was resistant to MMTV oral and intraperitoneal infection and tumorigenesis compared to wild-type BALB/c mice. Infection of Mtv-null mice with an MMTV-related retrovirus, type B leukemogenic virus, also resulted in severely reduced viral loads and failure to induce T-cell lymphomas, indicating that resistance is not dependent on expression of a superantigen (Sag encoded by exogenous MMTV. Resistance to MMTV in Mtv-null animals was not due to neutralizing antibodies. Further, Mtv-null mice were resistant to rapid mortality induced by intragastric inoculation of the Gram-negative bacterium, Vibrio cholerae, but susceptibility to Salmonella typhimurium was not significantly different from BALB/c mice. Susceptibility to both MMTV and V. cholerae was reconstituted by the presence of any one of three endogenous Mtvs located on different chromosomes and was associated with increased pathogen load. One of these endogenous proviruses is known to encode only Sag. Therefore, Mtv-encoded Sag appears to provide a unique genetic susceptibility to specific viruses and bacteria. Since human endogenous retroviruses also encode Sags, these studies have broad implications for pathogen-induced responses in mice and humans.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Directory of Open Access Journals (Sweden)
Olivia eMason
2014-07-01
Full Text Available During the Deepwater Horizon (DWH oil spill in the Gulf of Mexico a deep-sea hydrocarbon plume developed resulting in a rapid succession of bacteria. Colwellia eventually supplanted Oceanospirillales, which dominated the plume early in the spill. These successional changes may have resulted, in part, from the changing composition and abundance of hydrocarbons over time. Colwellia abundance peaked when gaseous and simple aromatic hydrocarbons increased, yet the metabolic pathway used by Colwellia in hydrocarbon disposition is unknown. Here we used single-cell genomics to gain insights into the genome properties of a Colwellia enriched during the DWH deep-sea plume. A single amplified genome (SAG of a Colwellia cell isolated from a DWH plume, closely related (avg. 98% 16S rRNA gene similarity to other plume Colwellia, was sequenced and annotated. The SAG was similar to the sequenced isolate Colwellia psychrerythraea 34H (84% avg. nucleotide identity. Both had genes for denitrification, chemotaxis and motility, adaptations to cold environments, and a suite of nutrient acquisition genes. The Colwellia SAG may be capable of gaseous and aromatic hydrocarbon degradation, which contrasts with a DWH plume Oceanospirillales SAG genome which encoded non-gaseous n-alkane and cycloalkane degradation. The disparate hydrocarbon degradation pathways are consistent with hydrocarbons that were abundant at different times in the deep-sea plume; first, non-gaseous n-alkanes and cycloalkanes that could be degraded by Oceanospirillales, followed by gaseous, and simple aromatic hydrocarbons that may have been degraded by Colwellia. These insights into the genomic properties of a Colwellia species, which were supported by existing metagenomic sequence data from the plume and DWH contaminated sediments, help further our understanding of the successional changes in the dominant microbial players in the plume over the course of the DWH spill.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
Liu, Mao-Sen; Li, Hui-Chun; Lai, Ying-Mi; Lo, Hsiao-Feng; Chen, Long-Fang O
2013-11-20
Previously, we investigated transgenic broccoli harboring senescence-associated-gene (SAG) promoter-triggered isopentenyltransferase (ipt), which encodes the key enzyme for cytokinin (CK) synthesis and mimics the action of exogenous supplied CK in delaying postharvest senescence of broccoli. Here, we used proteomics and transcriptomics to compare the mechanisms of ipt-transgenic and N(6)-benzylaminopurine (BA) CK treatment of broccoli during postharvest storage. The 2 treatments conferred common and distinct mechanisms. BA treatment decreased the quantity of proteins involved in energy and carbohydrate metabolism and amino acid metabolism, and ipt-transgenic treatment increased that of stress-related proteins and molecular chaperones and slightly affected levels of carbohydrate metabolism proteins. Both treatments regulated genes involved in CK signaling, sugar transport, energy and carbohydrate metabolism, amino acid metabolism and lipid metabolism, although ipt-transgenic treatment to a lesser extent. BA treatment induced genes encoding molecular chaperones, whereas ipt-transgenic treatment induced stress-related genes for cellular protection during storage. Both BA and ipt-transgenic treatments acted antagonistically on ethylene functions. We propose a long-term acclimation of metabolism and protection systems with ipt-transgenic treatment of broccoli and short-term modulation of metabolism and establishment of a protection system with both BA and ipt-transgenic treatments in delaying senescence of broccoli florets. Transgenic broccoli harboring senescence-associated-gene (SAG) promoter-triggered isopentenyltransferase (ipt), which encodes the key enzyme for cytokinin (CK) synthesis and N(6)-benzylaminopurine (BA) CK treated broccoli both showed retardation of postharvest senescence during storage. The mechanisms underlying the two treatments were compared. The combination of proteomic and transcriptomic evidences revealed that the 2 treatments conferred common
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
DEFF Research Database (Denmark)
Shokri, Yunes; Ebrahimzadeh, Esmaeil; Lesani, Hamid
2014-01-01
under unbalanced grid voltage and small voltage sag conditions without needing additional DC link capacitor or energy storage unlike other methods. The control system includes negative and positive sequence controllers which make the stator voltage balanced and keep it constant at the nominal value...
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Deng, Peng; Mei, Lianfu; Liu, Jun; Zheng, Jinyun; Liu, Minghui; Cheng, Zijie; Guo, Fengtai
2018-03-01
Considerable post-breakup extensional deformation is recorded in the continental margins of the South China Sea (SCS). To recognize the nature and origin of the significant deformation during the syn-spreading stage (32-15.5 Ma) in the SCS, we comprehensively analyzed the geometry and kinematics of the faults and contemporaneous magmas in the Baiyun sag, northern margin of the SCS, using high-resolution regional three-dimensional seismic data. The kinematic analyses indicate that the faults in the Baiyun sag are recently formed following the onset of seafloor spreading in the SCS. The faults exhibit multiple episodes of growth history, with three active episodes, 32-29, 23.8-21 and 18.5-16.5 Ma, separated by periods of inactivity. Four volcanic groups comprising 98 volcanic mounds have been identified and described, located separately in the northwestern, the central, the southeastern and the northern slope areas. The occurrence of multiple palaeo-seafloors, complemented by the biostratigraphic and K-Ar dating data, reveals multiple extrusive events of the syn-spreading magmas in the Baiyun sag, with three active periods of 23.8-21, 18.5-17.5 and 17.5-16.5 Ma. This study confirms that the normal faulting has a shared genetic origin with the contemporaneous magmatism during the syn-spreading stage in the deep-offshore Baiyun sag, northern margin of the SCS. The episodic fault growth and magmatic extrusive events reveal that the Baiyun sag has undergone at least three episodic tectonic events during the syn-spreading stage, which evolved in response to the multi-stage seafloor spreading of the SCS.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Tang, Xiaoyin; Yang, Shuchun; Hu, Shengbiao
2017-11-01
The Baiyun Sag, located in the deep-water area of the northern South China Sea, is the largest and deepest subbasin in the Pearl River Mouth Basin and one of the most important hydrocarbon-accumulation depression areas in China. Thermal history is widely thought to be of great importance in oil and gas potential assessment of a basin as it controls the timing of hydrocarbon generation and expulsion from the source rock. In order to unravel the paleo-heat flow of the Baiyun Sag, we first analyzed tectonic subsidence of 55 pseudo-wells constructed based on newly interpreted seismic profiles, along with three drilled wells. We then carried out thermal modeling using the multi-stage finite stretching method and calibrated the results using collected present-day vitrinite reflectance data and temperature data. Results indicate that the first and second heating of the Baiyun Sag after 49 Ma ceased at 33.9 Ma and 23 Ma. Reconstructed average basal paleoheat flow values at the end of the rifting periods are 57.7-86.2 mW/m2 and 66.7-97.3 mW/m2, respectively. Following the last heating period at 23 Ma, the study area has undergone a persistent thermal attenuation phase, and basal heat flow has cooled down to 64.0-79.2 mW/m2 at present.
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Béla, Samantha Ribeiro
2007-01-01
Proteínas recombinantes têm sido utilizadas para o diagnóstico sorológico da infecção por Toxoplasma gondii para diferenciar entre as fases aguda e crônica da toxoplasmose. Neste estudo, foi avaliada a reatividade de anticorpos IgG e IgG1 através de imunoensaios em soros de pacientes com toxoplasmose aguda e crônica dirigidos contra dois antígenos recombinantes clonados e expressos em E. coli, SAG2A (molécula recombinante total) e SAG2A(DELTA) (molécula recombinante deletada do...
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
Lu, C.; Fedoroff, N.
2000-01-01
Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.
Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata
2017-07-01
Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip
2009-05-01
Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.
Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier
2006-01-01
NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
Energy Technology Data Exchange (ETDEWEB)
Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others
1994-09-15
Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
Howe, J G; Shu, M D
1988-08-01
Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H
2014-10-01
Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen
DEFF Research Database (Denmark)
Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup
2012-01-01
Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Methanogenesis and methane genes
International Nuclear Information System (INIS)
Reeve, J.N.; Shref, B.A.
1991-01-01
An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)
Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita
2015-10-01
Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Sørensen, Kim I.; Hove-Jensen, Bjarne
1996-01-01
. The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...
Directory of Open Access Journals (Sweden)
Martin Hampel
Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.
de Vries, R P; Poulsen, C H; Madrid, S; Visser, J
1998-01-01
An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.
de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap
1998-01-01
An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A
2013-01-01
Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Knudsen, K; Madsen, AS; Mygind, P
1999-01-01
Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...
A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...
Human Transcriptome and Chromatin Modifications: An ENCODE Perspective
Directory of Open Access Journals (Sweden)
Li Shen
2013-06-01
Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.
Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya
2008-11-01
A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.
Xu, Han; Wang, Xin-Wen; Yan, Dan-Ping; Qiu, Liang
2018-06-01
The Dongpu Sag, located in the Bohai Bay Basin, NE China, is a Cenozoic continental rift basin. The post-rift evolution of the Dongpu Sag is associated with the development of petroleum reservoirs and has implications for Neogene-Quaternary basin evolution along the eastern margin of Eurasia. To determine the nature and origin of post-rift subsidence in the Dongpu Sag, we apply backstripping, modified strain-rate inversion, and revised finite extension modelling techniques, using data from 14 real and synthetic wells that are intersected by three seismic lines. Our results reveal discrepancies by subsidence based on backstripping of well data (the observed subsidence) minus that predicted by modified strain-rate inversion and revised finite extension modelling (the predicted subsidence). During the Miocene, the observed subsidence was smaller than the predicted subsidence, leaving negative discrepancies referred to here as "insufficient subsidence" ranging from -343 to -96 m. In contrast, during the Pliocene-Quaternary the observed subsidence was greater than the predicted subsidence by +123 to +407 m, which left positive discrepancies referred to as "over-sufficient subsidence". Therefore, we infer a transition from insufficient to over-sufficient subsidence during the post-rift stage. Normal faulting that started at ca. 5.3 Ma is estimated to have produced only ∼20% of the over-sufficient subsidence. Therefore, the remaining over-sufficient subsidence, as well as the preceding insufficient subsidence and the transition between the two, were likely controlled by lithosphere processes. We propose a new tectonic model in which variations in the conditions (e.g. rate, direction, and angle) associated with subduction of the Pacific plate resulted in a change of heat flow decreasing from a linear to a curvilinear pattern, leading to a transition from insufficient to over-sufficient subsidence.
DEFF Research Database (Denmark)
Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther
2009-01-01
). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...
DEFF Research Database (Denmark)
Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.
2002-01-01
of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
International Nuclear Information System (INIS)
Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.
1989-01-01
The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Identification of functional elements and regulatory circuits by Drosophila modENCODE
Energy Technology Data Exchange (ETDEWEB)
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis
2010-12-22
To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions
International Nuclear Information System (INIS)
Cirullo, R.E.; Dana, S.; Wasmuth, J.J.
1983-01-01
A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure
DEFF Research Database (Denmark)
Maresca, Julia A; Gomez Maqueo Chew, Aline; Ponsatí, Marta Ros
2004-01-01
that restores the correct reading frame in bchU. The bchU gene was inactivated in C. tepidum, a BChl c-producing species, and the resulting mutant produced only BChl d. Growth rate measurements showed that BChl c- and d-producing strains of the same organism (C. tepidum or C. vibrioforme) have similar growth...... rates at high and intermediate light intensities but that strains producing BChl c grow faster than those with BChl d at low light intensities. Thus, the bchU gene encodes the C-20 methyltransferase for BChl c biosynthesis in Chlorobium species, and methylation at the C-20 position to produce BChl c...
Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.
2006-01-01
Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921
Directory of Open Access Journals (Sweden)
Mert Döşkaya
Full Text Available Toxoplasma gondii causes congenital toxoplasmosis in newborns resulting with fetal anomalies. Determining the initiation time of infection is very important for pregnant women and current serological assays have drawbacks in distinguishing the recently acute toxoplasmosis. Diagnosis of recently acute infection may be improved by using stage specific antigens in serological assays. In the present study, the diagnostic value of sporozoite specific SporoSAG, bradyzoite specific BAG1 proteins and GRA1 protein expressed by all forms of the parasite have been evaluated ELISA using sera systematically collected from mice administered orally with tissue cyst and oocysts. The anti-SporoSAG IgM antibodies in sera obtained from mice infected with oocysts peaked significantly at days 1, 10, and 15 (P<0.01. The anti-BAG1 IgM antibodies in sera obtained from mice infected with tissue cysts peaked significantly at days 15, 40, and 120 (P<0.05. The anti-GRA1 IgM antibodies in sera obtained from mice infected with oocysts peaked significantly at days 2, 10, and 40 (P<0.01. The anti-GRA1 IgM antibodies in sera obtained from mice infected with tissue cysts peaked significantly only at day 40 (P<0.05. The anti-SporoSAG, anti-BAG1, and anti-GRA1 IgG titers of mice showed significant increases at day 40 (P<0.05 and decrement started for only anti-GRA1 IgG at day 120. The presence of anti-SporoSAG IgM and IgG antibodies can be interpreted as recently acute infection between days 10-40 because IgM decreases at day 40. Similarly, presence of anti-BAG1 IgM and absence of IgG can be evaluated as a recently acute infection that occurred 40 days before because IgG peaks at day 40. A peak in anti-GRA1 antibody level at first testing and reduction in consecutive sample can be considered as an infection approximately around day 40 or prior. Overall, recombinant SporoSAG, BAG1 and GRA1 proteins can be accepted as valuable diagnostic markers of recently acute toxoplasmosis.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene
International Nuclear Information System (INIS)
Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.
1990-01-01
An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations
Energy Technology Data Exchange (ETDEWEB)
Santal, Anita Rani, E-mail: anita.gangotra@gmail.com [Department of Microbiology, Maharshi Dayanand University, Rohtak-124001, Haryana (India); Singh, N.P. [Centre for Biotechnology, Maharshi Dayanand University, Rohtak-124001, Haryana (India); Saharan, Baljeet Singh [Department of Microbiology, Kurukshetra University, Kurukshetra-136119, Haryana (India)
2011-10-15
Highlights: {yields} The Alcaligenes faecalis strain SAG{sub 5} decolorizes 72.6 {+-} 0.56% of melanoidins. {yields} The decolorization was achieved at pH 7.5 and temperature 37 {sup o}C on 5th day. {yields} The distillery effluent after biological treatment is environmentally safe. - Abstract: Distillery effluent retains very dark brown color even after anaerobic treatment due to presence of various water soluble, recalcitrant and coloring compounds mainly melanoidins. In laboratory conditions, melanoidin decolorizing bacteria was isolated and optimized the cultural conditions at various incubation temperatures, pH, carbon sources, nitrogen sources and combined effect of both carbon and nitrogen sources. The optimum decolorization (72.6 {+-} 0.56%) of melanoidins was achieved at pH 7.5 and temperature 37 {sup o}C on 5th day of cultivation. The toxicity evaluation with mung bean (Vigna radiata) revealed that the raw distillery effluent was environmentally highly toxic as compared to biologically treated distillery effluent, which indicated that the effluent after bacterial treatment is environmentally safe. This proves to be novel biological treatment technique for biodegradation and detoxification of melanoidin from distillery effluent using the bacterial strain SAG{sub 5}.
A site-specific endonuclease encoded by a typical archaeal intron
DEFF Research Database (Denmark)
Dalgaard, Jacob; Garrett, Roger Antony; Belfort, Malene
1993-01-01
The protein encoded by the archaeal intron in the 23S rRNA gene of the hyperthermophile Desulfurococcus mobilis is a double-strand DNase that, like group I intron homing endonucleases, is capable of cleaving an intronless allele of the gene. This enzyme, I-Dmo I, is unusual among the intron...
An encoding device and a method of encoding
DEFF Research Database (Denmark)
2012-01-01
The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....
Directory of Open Access Journals (Sweden)
GangQiang Li
Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.
A family of related proteins is encoded by the major Drosophila heat shock gene family
International Nuclear Information System (INIS)
Wadsworth, S.C.
1982-01-01
At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites
Directory of Open Access Journals (Sweden)
Xiaoyue Gao
2013-11-01
Full Text Available The unconformity surface at the bottom of the Paleogene is one of the most important migration pathways in the Sikeshu Sag of the Junggar Basin, which consists of three layers: upper coarse clastic rock, lower weathering crust and leached zone. The upper coarse clastic rock is characterized by higher density and lower SDT and gamma-ray logging parameters, while the lower weathering crust displays opposite features. The transport coefficient of the unconformity surface is controlled by its position in respect to the basal sandstone; it is higher in the ramp region but lower in the adjacent uplifted and sag areas. The content of saturated hydrocarbons increases with the decrease of the content of non-hydrocarbons and asphaltenes. The content of benzo[c] carbazole decreases as the content of benzo[a] carbazole and [alkyl carbazole]/[alkyl + benzo carbazole] increases. This suggests that the unconformity surface is an efficient medium for the transportation of hydrocarbons.
The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.
Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval
2012-07-30
In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Huang, Hao; Mackel, Brian J.; Grove, Anne
2013-01-01
Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report h...
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
International Nuclear Information System (INIS)
Li, G.C.; Li, Ligeng; Liu, Yunkang; Mak, J.Y.; Chen, Lili; Lee, W.M.F.
1991-01-01
The major heat shock protein hsp70 is synthesized by cells of a wide variety of organisms in response to heat shock or other environmental stresses and is assumed to play an important role in protecting cells from thermal stress. The authors have tested this hypothesis directly by transfecting a constitutively expressed recombinant human hsp70-encoding gene into rat fibroblasts and examining the relationship between the levels of human hsp70 expressed and thermal resistance of the stably transfected rat cells. Successful transfection and expression of the gene for human hsp70 were characterized by RNA hybridization analysis, low-dimensional gel electrophoresis, and immunoblot analysis. When individual cloned cell lines were exposed to 45C and their thermal survivals were determined by colony-formation assay, they found that the expression of human hsp70 conferred heat resistance to the rat cells. These results reinforce the hypothesis that hsp70 has a protective function against thermal stress
Energy Technology Data Exchange (ETDEWEB)
Maia, Reinaldo Moreira [Moinhos Vera Cruz, Santa Luzia, MG (Brazil); Silva, Selenio Rocha [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)
2010-10-15
The sensitiveness increasing of industrial equipment related to the perturbation of electric grid, resulting in losses to the productive chain, turns the energy quality in the subject more discussed by the electrical community. In this study case on the problems caused by voltage sags to equipment of an industrial plant from the food sector, it is presented the identification process and the adopted solutions. (author)
International Nuclear Information System (INIS)
Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin
2008-01-01
Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy
Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon
2010-01-01
Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.
Trapalis, Menelaos; Li, Song Feng; Parish, Roger W
2017-07-01
The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.