WorldWideScience

Sample records for rrna gene pcr

  1. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  2. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    Science.gov (United States)

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (Pnested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance 27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

  3. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    Science.gov (United States)

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  4. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    Science.gov (United States)

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  5. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

    Directory of Open Access Journals (Sweden)

    Kuchipudi Suresh V

    2012-10-01

    Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

  6. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  7. Nested PCR and RFLP analysis based on the 16S rRNA gene

    Science.gov (United States)

    Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...

  8. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Science.gov (United States)

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  9. Genomic GC-content affects the accuracy of 16S rRNA gene sequencing bsed microbial profiling due to PCR bias

    DEFF Research Database (Denmark)

    Laursen, Martin F.; Dalgaard, Marlene Danner; Bahl, Martin Iain

    2017-01-01

    Profiling of microbial community composition is frequently performed by partial 16S rRNA gene sequencing on benchtop platforms following PCR amplification of specific hypervariable regions within this gene. Accuracy and reproducibility of this strategy are two key parameters to consider, which may...... be influenced during all processes from sample collection and storage, through DNA extraction and PCR based library preparation to the final sequencing. In order to evaluate both the reproducibility and accuracy of 16S rRNA gene based microbial profiling using the Ion Torrent PGM platform, we prepared libraries...... be explained partly by premature read truncation, but to larger degree their genomic GC-content, which correlated negatively with the observed relative abundances, suggesting a PCR bias against GC-rich species during library preparation. Increasing the initial denaturation time during the PCR amplification...

  10. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  11. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    Science.gov (United States)

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  13. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

    Science.gov (United States)

    Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

    2013-01-01

    The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

  14. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  15. PCR-SSCP of the 16S rRNA gene, a simple methodology for species identification of fish eggs and larvae

    Directory of Open Access Journals (Sweden)

    Eva Garcia-Vazquez

    2006-10-01

    Full Text Available Patterns of the 16S rRNA gene obtained in 8 and 12% acrylamide gels by the SSCP (Single Strand Conformation Polymorphism method were different for various marine fish species (Macrorhamphosus scolopax, Scomber scombrus, Lepidorhombus boscii, L. whiffiagonis, Trachurus trachurus, T. mediterraneus, Molva molva, Merluccius merluccius. SSCP patterns of this gene were employed to successfully identify formaldehyde-fixed eggs of different species (Merluccius merluccius, Scomber scombrus, Macrorhamphosus scolopax and L. whiffiagonis in plankton samples. The advantages of SSCPs in comparison with current genetic methods of egg identification are based on their technical simplicity and low price. The application of the PCR-SSCP methodology is proposed for routine genetic analyses in plankton surveys.

  16. A nested PCR approach for improved recovery of archaeal 16S rRNA gene fragments from freshwater samples

    NARCIS (Netherlands)

    Vissers, E.W.; Bodelier, P.L.E.; Muyzer, G.; Laanbroek, R.

    2009-01-01

    In a survey on the presence of archaea in a number of European lakes, it was found that known archaeal primer sets for PCR were not suited for use in freshwater environment, as some lack selectivity, while others were too selective. A nested PCR was developed for denaturing gradient gel

  17. Exploiting 16S rRNA gene for the detection and quantification of fish as a potential allergenic food: A comparison of two real-time PCR approaches.

    Science.gov (United States)

    Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

    2018-04-15

    Fish is one of the most common allergenic foods that should be accurately labelled to protect the health of allergic consumers. In this work, two real-time PCR systems based on the EvaGreen dye and a TaqMan probe are proposed and compared. New primers were designed to target the 16S rRNA gene, as a universal maker for fish detection, with fully demonstrated specificity for a wide range of fish species. Both systems showed similar absolute sensitivities, down to 0.01 pg of fish DNA, and adequate real-time PCR performance parameters. The probe system showed higher relative sensitivity and dynamic range (0.0001-50%) than the EvaGreen (0.05-50%). They were both precise, but trueness was compromised at the highest tested level with the EvaGreen assay. Therefore, both systems were successful, although the probe one exhibited the best performance. Its application to verify labelling compliance of foodstuffs suggested a high level of mislabelling and/or fraudulent practices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  19. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

  20. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples.

    Science.gov (United States)

    Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal

    2015-03-01

    PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  1. Complex community of nitrite-dependent anaerobic methane oxidation bacteria in coastal sediments of the Mai Po wetland by PCR amplification of both 16S rRNA and pmoA genes.

    Science.gov (United States)

    Chen, Jing; Zhou, Zhichao; Gu, Ji-Dong

    2015-02-01

    In the present work, both 16S rRNA and pmoA gene-based PCR primers were employed successfully to study the diversity and distribution of n-damo bacteria in the surface and lower layer sediments at the coastal Mai Po wetland. The occurrence of n-damo bacteria in both the surface and subsurface sediments with high diversity was confirmed in this study. Unlike the two other known n-damo communities from coastal areas, the pmoA gene-amplified sequences in the present work clustered not only with some freshwater subclusters but also within three newly erected marine subclusters mostly, indicating the unique niche specificity of n-damo bacteria in this wetland. Results suggested vegetation affected the distribution and community structures of n-damo bacteria in the sediments and n-damo could coexist with sulfate-reducing methanotrophs in the coastal ecosystem. Community structures of the Mai Po n-damo bacteria based on 16S rRNA gene were different from those of either the freshwater or the marine. In contrast, structures of the Mai Po n-damo communities based on pmoA gene grouped with the marine ones and were clearly distinguished from the freshwater ones. The abundance of n-damo bacteria at this wetland was quantified using 16S rRNA gene PCR primers to be 2.65-6.71 × 10(5) copies/g dry sediment. Ammonium and nitrite strongly affected the community structures and distribution of n-damo bacteria in the coastal Mai Po wetland sediments.

  2. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    Science.gov (United States)

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

  3. PCR method for the rapid detection and discrimination of Legionella spp. based on the amplification of pcs, pmtA, and 16S rRNA genes.

    Science.gov (United States)

    Janczarek, Monika; Palusińska-Szysz, Marta

    2016-05-01

    Legionella bacteria are organisms of public health interest due to their ability to cause pneumonia (Legionnaires' disease) in susceptible humans and their ubiquitous presence in water supply systems. Rapid diagnosis of Legionnaires' disease allows the use of therapy specific for the disease. L. pneumophila serogroup 1 is the most common cause of infection acquired in community and hospital environments. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this work, simplex and duplex PCR assays with the use of new molecular markers pcs and pmtA involved in phosphatidylcholine synthesis were specified for rapid and cost-efficient identification and distinguishing Legionella species. The sets of primers developed were found to be sensitive and specific for reliable detection of Legionella belonging to the eight most clinically relevant species. Among these, four primer sets I, II, VI, and VII used for duplex-PCRs proved to have the highest identification power and reliability in the detection of the bacteria. Application of this PCR-based method should improve detection of Legionella spp. in both clinical and environmental settings and facilitate molecular typing of these organisms.

  4. Utility of 16S rRNA PCR performed on clinical specimens in patient management

    Directory of Open Access Journals (Sweden)

    A. Akram

    2017-04-01

    Conclusions: Despite the low diagnostic yield, results of 16S rRNA PCR can still have a significant impact on patient management due to rationalization or cessation of the antimicrobial therapy. The yield of 16S rRNA PCR was highest for heart valves.

  5. Bacteriological Analysis, Antimicrobial Susceptibility and Detection of 16S rRNA gene of Helicobacter pylori by PCR in Drinking Water Samples of Earthquake Affected Areas and Other Parts of Pakistan

    Directory of Open Access Journals (Sweden)

    Rasheed, F.

    2009-01-01

    Full Text Available In Pakistan, clean drinking water is not available to most of the population. Main source of drinking water in Hazara, Azad Jammu and Kashmir-Pakistan is underground and spring water, due to earthquake water reservoirs in these areas were immensely contaminated. Moreover, drinking water treatment and proper sanitary facilities were also lacking. This study was conducted to analyze the quality of drinking water available in most of the cities of Pakistan including earthquake hit areas. For this purpose, 112 water samples were collected and analyzed by membrane filtration method. Microbial isolates were identified using QTS-10 and biochemical tests. Almost all samples were found to be contaminated but in earthquake affected areas quality of drinking water was substandard than other areas of Pakistan. Results revealed the detection of following bacterial pathogens among the water samples: Enterobacter sp., Klebsiellasp., Stenotrophomonas sp., Salmonella sp., Proteus sp., Edwardsiella tarda, Pseudomonas aeruginosa, Vibrio parahaemolyticus, Vibrio cholerae, Escherichia coli, Acinetobacter baumanii, Aeromonas hydrophila, Citrobacter freundii, Shigella dysenteriae, Staphylococcus aureus, Staphylococcus sp. and Streptococcus sp. Furthermore, these bacterial isolates were found to be resistant to ampicillin (32.1%, amoxicillin (30.4%, sulphometoxazole (20.5% and cefaclor (31.3%. All drinking water samples were analyzed for 16S rRNA gene of Helicobacter pylori by using PCR, however no positive result was found in these samples. Based on our results it is suggested that authorities should pay attention to supply safe water and proper sanitary facilities to avoid epidemics of infectious diseases in future.

  6. Diagnostic Utility of Broad Range Bacterial 16S rRNA Gene PCR with Degradation of Human and Free Bacterial DNA in Bloodstream Infection Is More Sensitive Than an In-House Developed PCR without Degradation of Human and Free Bacterial DNA

    Directory of Open Access Journals (Sweden)

    Petra Rogina

    2014-01-01

    Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  7. Determining Fungi rRNA Copy Number by PCR

    Science.gov (United States)

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within ...

  8. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples

    Directory of Open Access Journals (Sweden)

    Ravindra P Turankar

    2015-01-01

    Conclusion: Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes.

  9. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  10. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  11. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  12. Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

    Science.gov (United States)

    Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

    2010-02-01

    Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

  13. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

  14. EFFICIENCY OF REAL-TIME PCR FOR 18S rRNA AMPLIFICATION OF SORBUS DOMESTICA, L.

    Directory of Open Access Journals (Sweden)

    Petronela Poláčeková

    2012-10-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE Nowadays, the awareness is given more and more to underutilized and  unusual fruits. One of them is Sorbus domestica, L. not only as an endangered species, but as well as a promising and economically usable crop. The work was aimed for finding a total genomic DNA isolating methods from fresh plant material and confirmation of the optimized method by the detection of 18S rRNA gene using real-time PCR. Two commercial isolation kits were tested -  Invisorb® Spin Plant Mini Kit and Wizard ® Genomic DNA. Higher purity and yield of DNA isolation kit showed Invisorb kit. The effective and pure PCR amplification was confirmed for Invisorb, too when 20 ng undiluted DNA at annealing temperature of 64.5 °C.doi:10.5219/203

  15. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  16. Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

    Science.gov (United States)

    Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

    2008-10-31

    A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  17. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  18. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances.

    Science.gov (United States)

    Piwat, S; Teanpaisan, R

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.

  19. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Science.gov (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  20. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  1. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    Science.gov (United States)

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  2. Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

    Science.gov (United States)

    Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

    2008-01-15

    The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

  3. Characterization of bovine ruminal epithelial bacterial communities using 16S rRNA sequencing, PCR-DGGE, and qRT-PCR analysis.

    Science.gov (United States)

    Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo

    2012-02-24

    Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons

    Science.gov (United States)

    Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.

    2011-01-01

    Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162

  5. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    Science.gov (United States)

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

  6. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  7. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    Science.gov (United States)

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  8. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  9. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  10. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  11. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    Science.gov (United States)

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  12. Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Harsi Dewantari Kusumaningrum

    2016-08-01

    Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

  13. Diversity of 23S rRNA genes within individual prokaryotic genomes.

    Directory of Open Access Journals (Sweden)

    Anna Pei

    Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

  14. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  15. Quantification of Listeria monocytogenes in minimally processed leafy vegetables using a combined method based on enrichment and 16S rRNA real-time PCR.

    Science.gov (United States)

    Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina

    2010-02-01

    Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.

  16. Prevalence of 16S rRNA methylase genes among b-lactamase ...

    African Journals Online (AJOL)

    2014-07-07

    Jul 7, 2014 ... School of Life Sciences, Pondicherry University, Pondicherry, India ... Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and .... Isolates positive for bla or 16S rRNA methylase genes.

  17. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  18. Analysis of rRNA gene methylation in Arabidopsis thaliana by CHEF-Conventional 2D gel electrophoresis

    Science.gov (United States)

    Mohannath, Gireesha; Pikaard, Craig S.

    2017-01-01

    Summary Contour-clamped homogenous electric field (CHEF) gel electrophoresis, a variant of Pulsed-field gel electrophoresis (PFGE), is a powerful technique for resolving large fragments of DNA (10 kb to 9 Mb). CHEF has many applications including the physical mapping of chromosomes, artificial chromosomes and sub-chromosomal DNA fragments, etc. Here we describe the use of CHEF and two-dimensional gel electrophoresis to analyze rRNA gene methylation patterns within the two ~ 4 million base pair nucleolus organizer regions (NORs) of Arabidopsis thaliana. The method involves CHEF gel electrophoresis of agarose-embedded DNA following restriction endonuclease digestion to cut the NORs into large but resolvable segments, followed by digestion with methylation-sensitive restriction endonucleases and conventional (or CHEF) gel electrophoresis, in a second dimension. Resulting products are then detected by Southern blotting or PCR analyses capable of discriminating rRNA gene subtypes. PMID:27576719

  19. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  20. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Irina S. Kolesnikova

    2017-09-01

    Sep 1, 2017 ... Asia R. Shorina d, Alexander S. Graphodatsky a, Ekaterina M. Galanina b, Dmitry V. Yudkin a,b,* ... rRNA gene copy numbers on affected acrocentric chromosomes in .... estimated using MS Excel software (Microsoft, USA).

  1. Robertsonian translocation 13/14 associated with rRNA genes ...

    African Journals Online (AJOL)

    Robertsonian translocation 13/14 associated with rRNA genes overexpression and intellectual disability. Alexander A. Dolskiy, Natalya A. Lemskaya, Yulia V. Maksimova, Asia R. Shorina, Irina S. Kolesnikova, Dmitry V. Yudkin ...

  2. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  3. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    Science.gov (United States)

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  4. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  5. Prevalence of 16S rRNA methylase genes among β-lactamase ...

    African Journals Online (AJOL)

    Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

  6. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

    Science.gov (United States)

    van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

    1995-06-01

    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

  7. Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

    2007-11-01

    Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

  8. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain

    2015-01-01

    communities in meat and the meat process environment with special focus on the Enterobacteriaceae family as a subpopulation comprising enteropathogens including Salmonella. Samples were analyzed by a nested PCR approach combined with MiSeq® Illumina®16S DNA sequencing and standardized culture methods as cross...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same...

  9. A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.

    Science.gov (United States)

    Whelan, Fiona J; Surette, Michael G

    2017-08-14

    Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .

  10. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  11. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  12. High prevalence of plasmid-mediated 16S rRNA methylase gene rmtB among Escherichia coli clinical isolates from a Chinese teaching hospital

    Directory of Open Access Journals (Sweden)

    Zhang Xue-qing

    2010-06-01

    Full Text Available Abstract Background Recently, production of 16S rRNA methylases by Gram-negative bacilli has emerged as a novel mechanism for high-level resistance to aminoglycosides by these organisms in a variety of geographic locations. Therefore, the spread of high-level aminoglycoside resistance determinants has become a great concern. Methods Between January 2006 and July 2008, 680 distinct Escherichia coli clinical isolates were collected from a teaching hospital in Wenzhou, China. PCR and DNA sequencing were used to identify 16S rRNA methylase and extended-spectrum β-lactamase (ESBL genes, including armA and rmtB, and in situ hybridization was performed to determine the location of 16S rRNA methylase genes. Conjugation experiments were subsequently performed to determine whether aminoglycoside resistance was transferable from the E. coli isolates via 16S rRNA methylase-bearing plasmids. Homology of the isolates harboring 16S rRNA methylase genes was determined using pulse-field gel electrophoresis (PFGE. Results Among the 680 E. coli isolates, 357 (52.5%, 346 (50.9% and 44 (6.5% isolates were resistant to gentamicin, tobramycin and amikacin, respectively. Thirty-seven of 44 amikacin-resistant isolates harbored 16S rRNA methylase genes, with 36 of 37 harboring the rmtB gene and only one harboring armA. The positive rates of 16S rRNA methylase genes among all isolates and amikacin-resistant isolates were 5.4% (37/680 and 84.1% (37/44, respectively. Thirty-one isolates harboring 16S rRNA methylase genes also produced ESBLs. In addition, high-level aminoglycoside resistance could be transferred by conjugation from four rmtB-positive donors. The plasmids of incompatibility groups IncF, IncK and IncN were detected in 34, 3 and 3 isolates, respectively. Upstream regions of the armA gene contained ISCR1 and tnpU, the latter a putative transposase gene,. Another putative transposase gene, tnpD, was located within a region downstream of armA. Moreover, a

  13. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  14. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  15. New polymorphic mtDNA restriction site in the 12S rRNA gene detected in Tunisian patients with non-syndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Charfeddine, Ilhem; Fakhfakh, Faiza

    2008-01-01

    The 12S rRNA gene was shown to be a hot spot for aminoglycoside-induced and non-syndromic hearing loss since several deafness-associated mtDNA mutations were identified in this gene. Among them, we distinguished the A1555G, the C1494T and the T1095C mutations and C-insertion or deletion at position 961. One hundred Tunisian patients with non-syndromic hearing loss and 100 hearing individuals were analysed in this study. A PCR-RFLP analysis with HaeIII restriction enzyme showed the presence of the A1555G mutation in the 12S rRNA gene in only one out of the 100 patients. In addition, PCR-RFLP and radioactive PCR revealed the presence of a new HaeIII polymorphic restriction site in the same gene of 12S rRNA site in 4 patients with non-syndromic hearing loss. UVIDOC-008-XD analyses showed the presence of this new polymorphic restriction site with a variable heteroplasmic rates at position +1517 of the human mitochondrial genome. On the other hand, direct sequencing of the entire mitochondrial 12S rRNA gene in the 100 patients and in 100 hearing individuals revealed the presence of the A750G and A1438G polymorphisms and the absence of the C1494T, T1095C and 961insC mutations in all the tested individuals. Sequencing of the whole mitochondrial genome in the 4 patients showing the new HaeIII polymorphic restriction site revealed only the presence of the A8860G transition in the MT-ATP6 gene and the A4769G polymorphism in the ND2 gene

  16. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this

  17. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  18. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    ... glycol plus control. All isolates exhibited good drought-tolerant efficiencies at 10% PEG. While most of the isolates could not tolerate up to 20% PEG, isolates of Rlv6, Rlv9, Rlv12 and Rlv13 tolerated up to 20% PEG. Keywords: Rhizobium leguminosarum, 23S rRNA gene, phylogenetic tree, diversity and drought tolerance ...

  19. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  20. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  1. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Science.gov (United States)

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  2. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  3. 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides species

    Energy Technology Data Exchange (ETDEWEB)

    Loeffler, F.E.; Sun, Q.; Li, J.; Tiedje, J.M.

    2000-03-01

    Members of the genera Desulfuromonas and Dehalococcoides reductively dechlorinate tetrachloroethene (PCE) and trichloroethene. Two primer pairs specific to hypervariable regions of the 16S rRNA genes of the Dehalococcoides group (comprising Dehalococcoides ethenogenes and Dehalococcoides sp. strain FL2) and the acetate-oxidizing, PCE-dechlorinating Desulfuromonas group (comprising Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica) were designed. The detection threshold of a nested PCR approach using universal bacterial primers followed by a second PCR with the Desulfuromonas dechlorinator-targeted primer pair was 1 x 10{sup 3} BB1 cells added per gram (wet weight) of sandy aquifer material. Total community DNA isolated from sediments of three Michigan rivers and six different chloroethene-contaminated aquifer samples was used as template in nested PCR. All river sediment samples yielded positive signals with the BB1- and the Dehalococcoides-targeted primers. One chloroethene-contaminated aquifer tested positive with the Dehalococcoides-targeted primers, and another contaminated aquifer tested positive with the Desulfuromonas dechlorinator-targeted primer pair. Restriction fragment analysis of the amplicons could discriminate strain BB1 from other known Desulfuromonas species. Microcosm studies confirmed the presence of PCE-dechlorinating, acetate-oxidizing Desulfuromonas and hydrogenotrophic Dehalococcoides species in samples yielding positive PCR signals with the specific primers.

  4. Microbial community in persistent apical periodontitis: a 16S rRNA gene clone library analysis.

    Science.gov (United States)

    Zakaria, M N; Takeshita, T; Shibata, Y; Maeda, H; Wada, N; Akamine, A; Yamashita, Y

    2015-08-01

    To characterize the microbial composition of persistent periapical lesions of root filled teeth using a molecular genetics approach. Apical lesion samples were collected from 12 patients (23-80 years old) who visited the Kyushu University Hospital for apicectomy with persistent periapical lesions associated with root filled teeth. DNA was directly extracted from each sample and the microbial composition was comprehensively analysed using clone library analysis of the 16S rRNA gene. Enterococcus faecalis, Candida albicans and specific fimA genotypes of Porphyromonas gingivalis were confirmed using polymerase chain reaction (PCR) analysis with specific primers. Bacteria were detected in all samples, and the dominant findings were P. gingivalis (19.9%), Fusobacterium nucleatum (11.2%) and Propionibacterium acnes (9%). Bacterial diversity was greater in symptomatic lesions than in asymptomatic ones. In addition, the following bacteria or bacterial combinations were characteristic to symptomatic lesions: Prevotella spp., Treponema spp., Peptostreptococcaceae sp. HOT-113, Olsenella uli, Slackia exigua, Selemonas infelix, P. gingivalis with type IV fimA, and a combination of P. gingivalis, F. nucleatum, and Peptostreptococcaceae sp. HOT-113 and predominance of Streptococcus spp. On the other hand, neither Enterococcus faecalis nor C. albicans were detected in any of the samples. Whilst a diverse bacterial species were observed in the persistent apical lesions, some characteristic patterns of bacterial community were found in the symptomatic lesions. The diverse variation of community indicates that bacterial combinations as a community may cause persistent inflammation in periapical tissues rather than specific bacterial species. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  5. Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

    Science.gov (United States)

    Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

    2018-05-14

    The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the

  6. Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation

    2010-04-15

    In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.

  7. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae.

    Directory of Open Access Journals (Sweden)

    Meng Sun

    Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  8. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  9. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  10. A renaissance for the pioneering 16S rRNA gene.

    Science.gov (United States)

    Tringe, Susannah G; Hugenholtz, Philip

    2008-10-01

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  11. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    International Nuclear Information System (INIS)

    Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

    2010-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

  12. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  13. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  14. Reference gene validation for qPCR in rat carotid body during postnatal development

    Directory of Open Access Journals (Sweden)

    Carroll John L

    2011-10-01

    Full Text Available Abstract Background The carotid bodies are the main arterial oxygen chemoreceptors in mammals. Afferent neural output from the carotid bodies to brainstem respiratory and cardiovascular nuclei provides tonic input and mediates important protective responses to acute and chronic hypoxia. It is widely accepted that the selection of reference genes for mRNA normalization in quantitative real-time PCR must be validated for a given tissue and set of conditions. This is particularly important for studies in carotid body during early postnatal maturation as the arterial oxygen tension undergoes major changes from fetal to postnatal life, which may affect reference gene expression. In order to determine the most stable and suitable reference genes for the study of rat carotid body during development, six commonly used reference genes, β-actin, RPII (RNA polymerase II, PPIA (peptidyl-proyl-isomerase A, TBP (TATA-box binding protein, GAPDH, and 18s rRNA, were evaluated in two age groups (P0-1 and P14-16 under three environmental oxygen conditions (normoxia, chronic hypoxia and chronic hyperoxia using the three most commonly used software programs, geNorm, NormFinder and BestKeeper. Findings The three programs produced similar results but the reference gene rankings were not identical between programs or experimental conditions. Overall, 18s rRNA was the least stable reference gene for carotid body and, when hyperoxia and/or hypoxia conditions were included, actin was similarly unstable. Conclusions Reference or housekeeping gene expression for qPCR studies of carotid body during postnatal development may vary with developmental stage and environmental conditions. Selection of the best reference gene or combination of reference genes for carotid body development studies should take environmental conditions into account. Two commonly used reference genes, 18s rRNA and actin, may be unsuitable for studies of carotid body maturation, especially if the study

  15. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  16. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR.

    Science.gov (United States)

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji

    2017-10-01

    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2005-12-01

    Full Text Available Abstract Background Real-time quantitative PCR is a sensitive and very efficient technique to examine gene transcription patterns in preimplantation embryos, in order to gain information about embryo development and to optimize assisted reproductive technologies. Critical to the succesful application of real-time PCR is careful assay design, reaction optimization and validation to maximize sensitivity and accuracy. In most of the studies published GAPD, ACTB or 18S rRNA have been used as a single reference gene without prior verification of their expression stability. Normalization of the data using unstable controls can result in erroneous conclusions, especially when only one reference gene is used. Results In this study the transcription levels of 8 commonly used reference genes (ACTB, GAPD, Histone H2A, TBP, HPRT1, SDHA, YWHAZ and 18S rRNA were determined at different preimplantation stages (2-cell, 8-cell, blastocyst and hatched blastocyst in order to select the most stable genes to normalize quantitative data within different preimplantation embryo stages. Conclusion Using the geNorm application YWHAZ, GAPD and SDHA were found to be the most stable genes across the examined embryonic stages, while the commonly used ACTB was shown to be highly regulated. We recommend the use of the geometric mean of those 3 reference genes as an accurate normalization factor, which allows small expression differences to be reliably measured.

  18. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  19. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    Science.gov (United States)

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  20. Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Yiwei Qian

    2018-05-01

    Full Text Available Emerging evidence suggests that the microbiota present in feces plays a role in Parkinson’s disease (PD. However, the alterations of the microbiome in the blood of PD patients remain unknown. To test this hypothesis, we conducted this case-control study to explore the microbiota compositions in the blood of Chinese PD patients. Microbiota communities in the blood of 45 patients and their healthy spouses were investigated using high-throughput Illumina HiSeq sequencing targeting the V3-V4 region of 16S ribosomal RNA (rRNA gene. The relationships between the microbiota in the blood and PD clinical characteristics were analyzed. No difference was detected in the structure and richness between PD patients and healthy controls. The following genera were enriched in the blood of PD patients: Isoptericola, Cloacibacterium, Enhydrobacter and Microbacterium; whereas genus Limnobacter was enriched in the healthy controls after adjusting for age, gender, body mass index (BMI and constipation. Additionally, the findings regarding these genera were validated in another independent group of 58 PD patients and 57 healthy controls using real-time PCR targeting genus-specific 16S rRNA genes. Furthermore, not only the genera Cloacibacterium and Isoptericola (which were identified as enriched in PD patients but also the genera Paludibacter and Saccharofermentans were positively associated with disease duration. Some specific genera in the blood were related to mood disorders. We believe this is the first report to provide direct evidence to support the hypothesis that the identified microbiota in the blood are associated with PD. Additionally, some microbiota in the blood are closely associated with the clinical characteristics of PD. Elucidating these differences in blood microbiomes will provide a foundation to improve our understanding of the role of microbiota in the pathogenesis of PD.

  1. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  2. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Directory of Open Access Journals (Sweden)

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  3. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  4. Molecular Characterization of the 16S rRNA Gene of Phytoplasmas Detected in Two Leafhopper Species Associated with Alfalfa Plants Infected with Witches' Broom in Oman

    Directory of Open Access Journals (Sweden)

    A.J. Khan

    2003-12-01

    Full Text Available Two leafhopper species, Austroagallia avicula and Empoasca sp., were consistently found in alfalfa fields infected with witches’ broom phytoplasma (OmanAlfWB in the Al-Batinah, Dakhliya, North and South Sharqiya, Muscat, and Al-Bureimi regions of the Sultanate of Oman. Phytoplasmas from both leafhoppers were detected by specific polymerase chain reaction (PCR amplification of the 16S rRNA gene and the spacer region in direct PCR using P1/P7 primer pairs. Comparative RFLP profiles of the amplified rRNA gene and the spacer region from leafhopper phytoplasmas and from 20 phytoplasma controls yielded patterns referable to phytoplasmas belonging to the peanut witches’ broom group (16SrII group. In particular, extensive RFLP analyses with the endonucleases HpaII, Tru9I, Tsp509I, and RsaI indicated that the phytoplasmas in A. avicula and Empoasca sp. were identical but showed some differences from OmanAlfWB; however, RFLP patterns obtained with TaqI showed the OmanAlfWB and the phytoplasmas from the two leafhoppers to be identical. Direct PCR products amplified from phytoplasma leafhopper DNA using the P1/P7 primer pair were cloned and sequenced yielding 1758 bp and 1755 bp products from A. avicula and Empoasca sp. respectively; the homology of these sequences with OmanAlfWB and papaya yellow crinkle phytoplasmas was more than 98%. A phylogenetic tree based on the 16S rRNA gene and spacer region sequences from 44 phytoplasmas revealed that the phytoplasmas from the leafhoppers clustered with OmanAlfWB, papaya yellow crinkle, and gerbera phyllody phytoplasmas, all belonging to 16SrII group, but were distinct from lime witches’ broom phytoplasma, the most commonly found phytoplasma in the Sultanate of Oman.

  5. Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Heather P McLaughlin

    Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

  6. Increased Pathogen Identification in Vascular Graft Infections by the Combined Use of Tissue Cultures and 16S rRNA Gene Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Evelyne Ajdler-Schaeffler

    2018-06-01

    Full Text Available Background: Vascular graft infections (VGI are difficult to diagnose and treat, and despite redo surgery combined with antimicrobial treatment, outcomes are often poor. VGI diagnosis is based on a combination of clinical, radiological, laboratory and microbiological criteria. However, as many of the VGI patients are already under antimicrobial treatment at the time of redo surgery, microbiological identification is often difficult and bacterial cultures often remain negative rendering targeted treatment impossible. We aimed to assess the benefit of 16S rRNA gene polymerase chain reaction (broad-range PCR for better microbiological identification in patients with VGI.Methods: We prospectively analyzed the clinical, microbiological, and treatment data of patients enrolled in the observational Vascular Graft Cohort Study (VASGRA, University Hospital Zurich, Switzerland. The routine diagnostic work-up involved microbiological cultures of minced tissue samples, and the use of molecular techniques in parallel. Patient-related and microbiological data were assessed in descriptive analyses, and we calculated sensitivity, specificity, negative and positive predictive value for broad-range 16S rRNA gene PCR versus culture (considered as gold standard.Results: We investigated 60 patients (median age 66 years (Interquartile range [IQR] 59–75 with confirmed VGI between May 2013 and July 2017. The prevalence of antimicrobial pretreatment at the time of sampling was high [91%; median days of antibiotics 7 days (IQR 1–18]. We investigated 226 microbiological specimens. Thereof, 176 (78% were culture-negative and 50 (22% were culture-positive. There was a concordance of 70% (158/226 between conventional culture and broad-range PCR (sensitivity 58% (95% CI 43–72; specificity 74% (67–80%. Among the group of 176 culture-negative specimens, 46 specimens were broad-range PCR-positive resulting in identification of overall 69 species. Among the culture and

  7. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    Directory of Open Access Journals (Sweden)

    Leyla Esfandiari

    2016-07-01

    Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  8. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

    Directory of Open Access Journals (Sweden)

    Chiari Ylenia

    2005-03-01

    Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

  9. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  10. Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

    Science.gov (United States)

    Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

    2017-12-30

    Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  12. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  13. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  14. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  15. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    Science.gov (United States)

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  16. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  17. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    Science.gov (United States)

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  18. Real-time PCR gene expression profiling

    Czech Academy of Sciences Publication Activity Database

    Kubista, Mikael; Sjögreen, B.; Forootan, A.; Šindelka, Radek; Jonák, Jiří; Andrade, J.M.

    2007-01-01

    Roč. 1, - (2007), s. 56-60 ISSN 1360-8606 R&D Projects: GA AV ČR KJB500520601 Institutional research plan: CEZ:AV0Z50520514 Keywords : real - time PCR, * expression profiling * statistical analysis Subject RIV: EB - Genetics ; Molecular Biology

  19. Evaluation of 16S rRNA qPCR for detection of Mycobacterium leprae DNA in nasal secretion and skin biopsy samples from multibacillary and paucibacillary leprosy cases.

    Science.gov (United States)

    Marques, Lívia Érika Carlos; Frota, Cristiane Cunha; Quetz, Josiane da Silva; Bindá, Alexandre Havt; Mota, Rosa Maria Salane; Pontes, Maria Araci de Andrade; Gonçalves, Heitor de Sá; Kendall, Carl; Kerr, Ligia Regina Franco Sansigolo

    2017-12-26

    Mycobacterium leprae bacilli are mainly transmitted by the dissemination of nasal aerosols from multibacillary (MB) patients to susceptible individuals through inhalation. The upper respiratory tract represents the main entry and exit routes of M. leprae. Therefore, this study aimed to evaluate the sensitivity and specificity of real-time quantitative polymerase chain reaction (qPCR) in detecting M. leprae in nasal secretion (NS) and skin biopsy (SB) samples from MB and paucibacillary (PB) cases. Fifty-four NS samples were obtained from leprosy patients at the Dona Libânia National Reference Centre for Sanitary Dermatology in Ceará, Brazil. Among them, 19 MB cases provided both NS and SB samples. Bacilloscopy index assays were conducted and qPCR amplification was performed using specific primers for M. leprae 16S rRNA gene, generating a 124-bp fragment. Primer specificity was verified by determining the amplicon melting temperature (T m  = 79.5 °C) and detection limit of qPCR was 20 fg of M. leprae DNA. Results were positive for 89.7 and 73.3% of NS samples from MB and PB cases, respectively. SB samples from MB patients were 100% positive. The number of bacilli detected in NS samples were 1.39 × 10 3 -8.02 × 10 5 , and in SB samples from MB patients were 1.87 × 10 3 -1.50 × 10 6 . Therefore, qPCR assays using SYBR Green targeting M. leprae 16S rRNA region can be employed in detecting M. leprae in nasal swabs from leprosy patients, validating this method for epidemiological studies aiming to identify healthy carriers among household contacts or within populations of an endemic area.

  20. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  1. Emergence of methicillin-resistant coagulase-negative staphylococci resistant to linezolid with rRNA gene C2190T and G2603T mutations.

    Science.gov (United States)

    Cidral, Thiago André; Carvalho, Maria Cícera; Figueiredo, Agnes Marie Sá; de Melo, Maria Celeste Nunes

    2015-10-01

    The aim of this article were to determinate the mechanism of linezolid resistance in coagulase-negative methicillin-resistant staphylococci from hospitals in the northeast of Brazil. We identified the isolates using VITEK(®) 2 and MALDI-TOF. Susceptibility to antibiotics was measured by the disk-diffusion method and by Etest(®) . Extraction of the whole genome DNA was performed, followed by screening of all the strains for the presence of mecA and cfr genes. The domain V region of 23S rRNA gene was sequenced and then aligned with a linezolid-susceptible reference strain. Pulsed-field gel electrophoresis (PFGE) macro-restriction analysis was performed. Three linezolid-resistant Staphylococcus hominis and two linezolid-resistant Staphylococcus epidermidis strains were analyzed. The isolates showed two point mutations in the V region of the 23S rRNA gene (C2190T and G2603T). We did not detect the cfr gene in any isolate by PCR. The S. hominis showed the same pulsotype, while the S. epidermidis did not present any genetic relation to each other. In conclusion, this study revealed three S. hominis and two S. epidermidis strains with resistance to linezolid due to a double mutation (C2190T and G2603T) in the domain V of the 23S rRNA gene. For the first time, the mutation of C2190T in S. epidermidis is described. This study also revealed the clonal spread of a S. hominis pulsotype between three public hospitals in the city of Natal, Brazil. These findings highlight the importance of continued vigilance of linezolid resistance in staphylococci. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  2. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Pyrosequencing 16S rRNA genes of bacteria associated with wild tiger mosquito Aedes albopictus: a pilot study

    Directory of Open Access Journals (Sweden)

    Guillaume eMinard

    2014-05-01

    Full Text Available The Asian tiger mosquito Aedes (Stegomya albopictus is an invasive species that has spread across the world in the last two decades, showing a great capacity to adapt to contrasting climates and environments. While demonstrated in many insects, the contribution of bacterial symbionts in Aedes ecology is a challenging aspect that needs to be investigated however. Some bacterial species have already been identified in Ae. albopictus using classical methods, but a more accurate survey of mosquito-associated bacterial diversity is needed to decipher the potential biological functions of bacterial symbionts in mediating or constraining insect adaptation. We surveyed the bacteria associated with field populations of Ae. albopictus from Madagascar by pyrosequencing 16S rRNA gene amplicons. Different aspects of amplicon preparation and sequencing depth were tested to optimise the breadth of bacterial diversity identified. The results revealed that all mosquitoes collected from different sites have a bacterial microbiota dominated by a single taxon, Wolbachia pipientis, which accounted for about 99% of all 98,520 sequences obtained. Ae. albopictus is known to harbour two Wolbachia strains, wAlbA and wAlbB, and quantitative PCR was used to estimate the relative densities, i.e. the bacteria-to-host gene ratios, of the strains in individual mosquitoes. Relative densities were between 6.25 × 100.01 and 5.47 × 100.1 for wAlbA and between 2.03 × 100.1 and 1.4 × 101 for wAlbB. Apart from Wolbachia, a total of 32 bacterial taxa were identified at the genus level using the different in method variations. Diversity index values were low and probably underestimated the true diversity due to the high abundance of Wolbachia sequences vastly outnumbering sequences from other taxa. Further studies should implement alternative strategies to specifically discard from analysis any sequences from Wolbachia, the dominant endosymbiotic bacterium in Ae. albopictus from

  4. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  5. Identification of sulfur-cycle prokaryotes in a low-sulfate lake (Lake Pavin) using aprA and 16S rRNA gene markers.

    Science.gov (United States)

    Biderre-Petit, Corinne; Boucher, Delphine; Kuever, Jan; Alberic, Patrick; Jézéquel, Didier; Chebance, Brigitte; Borrel, Guillaume; Fonty, Gérard; Peyret, Pierre

    2011-02-01

    Geochemical researches at Lake Pavin, a low-sulfate-containing freshwater lake, suggest that the dominant biogeochemical processes are iron and sulfate reduction, and methanogenesis. Although the sulfur cycle is one of the main active element cycles in this lake, little is known about the sulfate-reducer and sulfur-oxidizing bacteria. The aim of this study was to assess the vertical distribution of these microbes and their diversities and to test the hypothesis suggesting that only few SRP populations are involved in dissimilatory sulfate reduction and that Epsilonproteobacteria are the likely key players in the oxidative phase of sulfur cycle by using a PCR aprA gene-based approach in comparison with a 16S rRNA gene-based analysis. The results support this hypothesis. Finally, this preliminary work points strongly the likelihood of novel metabolic processes upon the availability of sulfate and other electron acceptors.

  6. Campylobacter jejuni, an uncommon cause of splenic abscess diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Piseth Seng

    2014-12-01

    Full Text Available Splenic abscess is a rare disease that primarily occurs in patients with splenic trauma, endocarditis, sickle cell anemia, or other diseases that compromise the immune system. This report describes a culture-negative splenic abscess in an immunocompetent patient caused by Campylobacter jejuni, as determined by 16S rRNA gene sequencing.

  7. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  8. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  9. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  10. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Science.gov (United States)

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  11. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Background: Intellectual disability (ID) is an important medical and social problem that can be caused by different genetic and environmental factors. One such factor could be rDNA amplification and changes in rRNA expression and maturation. Aim of the study: The aim of the present study was to investigate rRNA levels in ...

  12. Using PCR to Target Misconceptions about Gene Expression

    Directory of Open Access Journals (Sweden)

    Leslie K. Wright

    2013-02-01

    Full Text Available We present a PCR-based laboratory exercise that can be used with first- or second-year biology students to help overcome common misconceptions about gene expression. Biology students typically do not have a clear understanding of the difference between genes (DNA and gene expression (mRNA/protein and often believe that genes exist in an organism or cell only when they are expressed. This laboratory exercise allows students to carry out a PCR-based experiment designed to challenge their misunderstanding of the difference between genes and gene expression. Students first transform E. coli with an inducible GFP gene containing plasmid and observe induced and un-induced colonies. The following exercise creates cognitive dissonance when actual PCR results contradict their initial (incorrect predictions of the presence of the GFP gene in transformed cells. Field testing of this laboratory exercise resulted in learning gains on both knowledge and application questions on concepts related to genes and gene expression.

  13. Characterization of 16S rRNA genes from oil field microbial communities indicates the presence of a variety of sulfate-reducing, fermentative, and sulfide-oxidizing bacteria.

    OpenAIRE

    Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D

    1996-01-01

    Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira,...

  14. Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

    Science.gov (United States)

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2002-01-01

    An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

  15. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  16. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  17. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  18. The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.

    Science.gov (United States)

    Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C

    1994-12-01

    Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.

  19. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David; Stingl, Ulrich

    2012-01-01

    that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While

  20. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  1. Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

    Science.gov (United States)

    Rozi; Rahayu, K.; Daruti, D. N.

    2018-04-01

    The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

  2. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  3. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing.

    Science.gov (United States)

    Jaradat, Ziad W; Ababneh, Qotaiba O; Saadoun, Ismail M; Samara, Nawal A; Rashdan, Abrar M

    2009-10-27

    Cronobacter spp. (formerly Enterobacter sakazakii), are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%). The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (alpha-MUG, DFI and EsPM) and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences), 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable method for confirmation of the identity of the isolates

  4. Isolation of Cronobacter spp. (formerly Enterobacter sakazakii from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

    Directory of Open Access Journals (Sweden)

    Samara Nawal A

    2009-10-01

    Full Text Available Abstract Background Cronobacter spp. (formerly Enterobacter sakazakii, are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp. in an attempt to find its source. Twenty nine strains were isolated from samples of spices, herbs, infant foods, and dust obtained from household vacuum cleaners. Among the 76 samples of infant food, infant formula, milk powder and non-milk dairy products tested, only one sample of infant food contained Cronobacter spp. (1.4%. The other Cronobacter spp. isolates recovered include two from household vacuum dust, and 26 from 67 samples of herbs and spices. Among the food categories analyzed, herbs and spices harbored the highest number of isolates, indicating plants as a possible reservoir of this pathogen. Initial screening with API 20E test strips yielded 42 presumptive isolates. Further characterization using 3 chromogenic media (α-MUG, DFI and EsPM and 8 sets of PCR primers detecting ITS (internal transcribed spacer sequences, 16S rRNA, zpx, gluA, gluB, OmpA genes followed by nucleotide sequencing of some PCR amplicons did not confirm the identity of all the isolates as none of the methods proved to be free of both false positives or false negatives. The final confirmation step was done by 16S rRNA sequence analysis identifying only 29 of the 42 isolates as Cronobacter spp. Conclusion Our studies showed that Cronobacter spp. are highly diverse and share many phenotypic traits with other Enterobacteriaceae members highlighting the need to use several methods to confirm the identity of this pathogen. None of the biochemical, chromogenic or PCR primers proved to be a reliable

  5. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto; Vacherie, Benoî t; Benzoni, Francesca; Stefani, Fabrizio; Karsenti, Eric; Jaillon, Olivier; Not, Fabrice; Nunes, Flavia; Payri, Claude; Wincker, Patrick; Barbe, Valé rie

    2016-01-01

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  6. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  7. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  8. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Directory of Open Access Journals (Sweden)

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  9. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    Science.gov (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology

  10. SCREENING OF COMMON FLAX FAD GENES BY PCR

    Directory of Open Access Journals (Sweden)

    Veronika Štefúnová

    2013-02-01

    Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

  11. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

    for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  12. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  13. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    Science.gov (United States)

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  14. Dominant obligate anaerobes revealed in lower respiratory tract infection in horses by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kinoshita, Yuta; Niwa, Hidekazu; Katayama, Yoshinari; Hariu, Kazuhisa

    2014-04-01

    Obligate anaerobes are important etiological agents in pneumonia or pleuropneumonia in horses, because they are isolated more commonly from ill horses that have died or been euthanized than from those that survive. We performed bacterial identification and antimicrobial susceptibility testing for obligate anaerobes to establish effective antimicrobial therapy. We used 16S rRNA gene sequencing to identify 58 obligate anaerobes and compared the results with those from a phenotypic identification kit. The identification results of 16S rRNA gene sequencing were more reliable than those of the commercial kit. We concluded that genera Bacteroides and Prevotella-especially B. fragilis and P. heparinolytica-are dominant anaerobes in lower respiratory tract infection in horses; these organisms were susceptible to metronidazole, imipenem and clindamycin.

  15. An assessment of the hypervariable domains of the 16S rRNA genes for their value in determining microbial community diversity: the paradox of traditional ecological indices.

    Science.gov (United States)

    Mills, DeEtta K; Entry, James A; Voss, Joshua D; Gillevet, Patrick M; Mathee, Kalai

    2006-09-01

    Amplicon length heterogeneity PCR (LH-PCR) was investigated for its ability to distinguish between microbial community patterns from the same soil type under different land management practices. Natural sagebrush and irrigated mouldboard-ploughed soils from Idaho were queried as to which hypervariable domains, or combinations of 16S rRNA gene domains, were the best molecular markers. Using standard ecological indices to measure richness, diversity and evenness, the combination of three domains, V1, V3 and V1+V2, or the combined V1 and V3 domains were the markers that could best distinguish the undisturbed natural sagebrush communities from the mouldboard-ploughed microbial communities. Bray-Curtis similarity and multidimensional scaling were found to be better metrics to ordinate and cluster the LH-PCR community profiling data. The use/misuse of traditional ecological indices such as diversity and evenness to study microbial community profiles will remain a major point to consider when performing metagenomic studies.

  16. Validation of Suitable Reference Genes for RT-qPCR Data in Achyranthes bidentata Blume under Different Experimental Conditions

    Directory of Open Access Journals (Sweden)

    Jinting Li

    2017-05-01

    Full Text Available Real-time quantitative polymerase chain reaction (RT-qPCR is a sensitive technique for gene expression studies. However, choosing the appropriate reference gene is essential to obtain reliable results for RT-qPCR assays. In the present work, the expression of eight candidate reference genes, EF1-α (elongation factor 1-α, GAPDH (glyceraldehyde 3-phosphate dehydrogenase, UBC (ubiquitin-conjugating enzyme, UBQ (polyubiquitin, ACT (actin, β-TUB (β-tubulin, APT1 (adenine phosphoribosyltransferase 1, and 18S rRNA (18S ribosomal RNA, was evaluated in Achyranthes bidentata samples using two algorithms, geNorm and NormFinder. The samples were classified into groups according to developmental stages, various tissues, stresses (cold, heat, drought, NaCl, and hormone treatments (MeJA, IBA, SA. Suitable combination of reference genes for RT-qPCR normalization should be applied according to different experimental conditions. In this study, EF1-α, UBC, and ACT genes were verified as the suitable reference genes across all tested samples. To validate the suitability of the reference genes, we evaluated the relative expression of CAS, which is a gene that may be involved in phytosterol synthesis. Our results provide the foundation for gene expression analysis in A. bidentata and other species of Amaranthaceae.

  17. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  18. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    Science.gov (United States)

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  20. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis.

    Science.gov (United States)

    Virtanen, Seppo; Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal microbiota studies employing different

  1. Robertsonian translocation 13/14 associated with rRNA genes ...

    African Journals Online (AJOL)

    Alexander A. Dolskiy

    2017-12-01

    Dec 1, 2017 ... Results: We describe a family case of a translocation rob (13; 14) and elevated rRNA expression in the proband with ..... Clin Genet 2010;78:299–309. ... [9] Bertini V, Fogli A, Bruno R, Azzarà A, Michelucci A, Mattina T, et al.

  2. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  3. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  4. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    DEFF Research Database (Denmark)

    Holmsgaard, Peter Nikolai; Sørensen, Søren Johannes; Hansen, Lars H.

    2013-01-01

    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity...

  5. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Irina S. Kolesnikova

    2017-09-01

    Sep 1, 2017 ... conjugated avidin and anti-avidin antibody (both from New Eng- land Biolabs ... performed using an Aurum Total RNA Mini Kit (BioRad, USA) or .... 5.8S rRNA in CPG148 are 19.60 ± 0.82 and 20.09 ± 0.13 times the .... Science + Business Media Dordrecht; 2011. p. ... New York: Academic Press; 1977. p.

  6. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

    Science.gov (United States)

    Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

    2010-07-01

    Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

  7. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

    Science.gov (United States)

    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

    2005-11-01

    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  8. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    Science.gov (United States)

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  9. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  10. 16S rRNA gene metabarcoding and TEM reveals different ecological strategies within the genus Neogloboquadrina (planktonic foraminifer.

    Directory of Open Access Journals (Sweden)

    Clare Bird

    Full Text Available Uncovering the complexities of trophic and metabolic interactions among microorganisms is essential for the understanding of marine biogeochemical cycling and modelling climate-driven ecosystem shifts. High-throughput DNA sequencing methods provide valuable tools for examining these complex interactions, although this remains challenging, as many microorganisms are difficult to isolate, identify and culture. We use two species of planktonic foraminifera from the climatically susceptible, palaeoceanographically important genus Neogloboquadrina, as ideal test microorganisms for the application of 16S rRNA gene metabarcoding. Neogloboquadrina dutertrei and Neogloboquadrina incompta were collected from the California Current and subjected to either 16S rRNA gene metabarcoding, fluorescence microscopy, or transmission electron microscopy (TEM to investigate their species-specific trophic interactions and potential symbiotic associations. 53-99% of 16S rRNA gene sequences recovered from two specimens of N. dutertrei were assigned to a single operational taxonomic unit (OTU from a chloroplast of the phylum Stramenopile. TEM observations confirmed the presence of numerous intact coccoid algae within the host cell, consistent with algal symbionts. Based on sequence data and observed ultrastructure, we taxonomically assign the putative algal symbionts to Pelagophyceae and not Chrysophyceae, as previously reported in this species. In addition, our data shows that N. dutertrei feeds on protists within particulate organic matter (POM, but not on bacteria as a major food source. In total contrast, of OTUs recovered from three N. incompta specimens, 83-95% were assigned to bacterial classes Alteromonadales and Vibrionales of the order Gammaproteobacteria. TEM demonstrates that these bacteria are a food source, not putative symbionts. Contrary to the current view that non-spinose foraminifera are predominantly herbivorous, neither N. dutertrei nor N. incompta

  11. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  12. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  13. Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

    Science.gov (United States)

    Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

    2017-06-01

    We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues

  14. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  15. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-01-01

    We explored the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA Ser(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA Ser(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  16. Muscle contractures in patients with cerebral palsy and acquired brain injury are associated with extracellular matrix expansion, pro-inflammatory gene expression, and reduced rRNA synthesis.

    Science.gov (United States)

    von Walden, Ferdinand; Gantelius, Stefan; Liu, Chang; Borgström, Hanna; Björk, Lars; Gremark, Ola; Stål, Per; Nader, Gustavo A; Pontén, Eva

    2018-03-23

    Children with cerebral palsy (CP) and acquired brain injury (ABI) commonly develop muscle contractures with advancing age. An underlying growth defect contributing to skeletal muscle contracture formation in CP/ABI has been suggested. The biceps muscles of children and adolescents with CP/ABI (n=20) and typically developing controls (n=10) were investigated. We used immunohistochemistry, qRT-PCR and western blotting to assess gene expression relevant to growth and size homeostasis. Classical pro-inflammatory cytokines and genes involved in extracellular matrix production were elevated in skeletal muscle of children with CP/ABI. Intramuscular collagen content was increased and satellite cell number decreased and this was associated with reduced levels of RNA polymerase (POL) I transcription factors, 45s pre-rRNA and 28S rRNA. The present study provides novel data suggesting a role for pro-inflammatory cytokines and reduced ribosomal production in the development/maintenance of muscle contractures; possibly underlying stunted growth and perimysial extracellular matrix expansion. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  17. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    Science.gov (United States)

    Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E

    2012-01-01

    Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, pmicrobial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  18. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

    Science.gov (United States)

    Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  19. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

    Directory of Open Access Journals (Sweden)

    Ilias Lagkouvardos

    2017-01-01

    Full Text Available The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  20. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  1. Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

    Science.gov (United States)

    Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

    2017-06-01

    This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

  2. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  3. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    Directory of Open Access Journals (Sweden)

    Jia Yi Har

    2015-09-01

    Full Text Available We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing 99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e. Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P, polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins. We hypothesize that such activities may mediate acclimation and persistence of bacteria in N. vectensis.

  4. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

    Science.gov (United States)

    Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing 99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N. vectensis holobiont defined by both internal and external gradients of chemicals and

  5. Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.

    Science.gov (United States)

    Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang

    2018-02-01

    Whenever gene expression is being examined, it is essential that a normalization process is carried out to eliminate non-biological variations. The use of reference genes, such as glyceraldehyde-3-phosphate dehydrogenase, actin, and ribosomal protein genes, is the usual method of choice for normalizing gene expression. Although reference genes are used to normalize target gene expression, a major problem is that the stability of these genes differs among tissues, developmental stages, species, and responses to abiotic factors. Therefore, the use and validation of multiple reference genes are required. This review discusses the reasons that why RT-qPCR has become the preferred method for validating results of gene expression profiles, the use of specific and non-specific dyes and the importance of use of primers and probes for qPCR as well as to discuss several statistical algorithms developed to help the validation of potential reference genes. The conflicts arising in the use of classical reference genes in gene normalization and their replacement with novel references are also discussed by citing the high stability and low stability of classical and novel reference genes under various biotic and abiotic experimental conditions by employing various methods applied for the reference genes amplification.

  6. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  7. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Science.gov (United States)

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  8. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  9. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina

    2008-10-01

    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  10. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    Science.gov (United States)

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens.

    Directory of Open Access Journals (Sweden)

    Linxiang Chen

    Full Text Available Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests, which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05 were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains.

  12. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Directory of Open Access Journals (Sweden)

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  13. dinoref: A curated dinoflagellate (Dinophyceae) reference database for the 18S rRNA gene.

    Science.gov (United States)

    Mordret, Solenn; Piredda, Roberta; Vaulot, Daniel; Montresor, Marina; Kooistra, Wiebe H C F; Sarno, Diana

    2018-03-30

    Dinoflagellates are a heterogeneous group of protists present in all aquatic ecosystems where they occupy various ecological niches. They play a major role as primary producers, but many species are mixotrophic or heterotrophic. Environmental metabarcoding based on high-throughput sequencing is increasingly applied to assess diversity and abundance of planktonic organisms, and reference databases are definitely needed to taxonomically assign the huge number of sequences. We provide an updated 18S rRNA reference database of dinoflagellates: dinoref. Sequences were downloaded from genbank and filtered based on stringent quality criteria. All sequences were taxonomically curated, classified taking into account classical morphotaxonomic studies and molecular phylogenies, and linked to a series of metadata. dinoref includes 1,671 sequences representing 149 genera and 422 species. The taxonomic assignation of 468 sequences was revised. The largest number of sequences belongs to Gonyaulacales and Suessiales that include toxic and symbiotic species. dinoref provides an opportunity to test the level of taxonomic resolution of different 18S barcode markers based on a large number of sequences and species. As an example, when only the V4 region is considered, 374 of the 422 species included in dinoref can still be unambiguously identified. Clustering the V4 sequences at 98% similarity, a threshold that is commonly applied in metabarcoding studies, resulted in a considerable underestimation of species diversity. © 2018 John Wiley & Sons Ltd.

  14. Bone to pick: the importance of evaluating reference genes for RT-qPCR quantification of gene expression in craniosynostosis and bone-related tissues and cells

    Directory of Open Access Journals (Sweden)

    Yang Xianxian

    2012-05-01

    Full Text Available Abstract Background RT-qPCR is a common tool for quantification of gene expression, but its accuracy is dependent on the choice and stability (steady state expression levels of the reference gene/s used for normalization. To date, in the bone field, there have been few studies to determine the most stable reference genes and, usually, RT-qPCR data is normalised to non-validated reference genes, most commonly GAPDH, ACTB and 18 S rRNA. Here we draw attention to the potential deleterious impact of using classical reference genes to normalise expression data for bone studies without prior validation of their stability. Results Using the geNorm and Normfinder programs, panels of mouse and human genes were assessed for their stability under three different experimental conditions: 1 disease progression of Crouzon syndrome (craniosynostosis in a mouse model, 2 proliferative culture of cranial suture cells isolated from craniosynostosis patients and 3 osteogenesis of a mouse bone marrow stromal cell line. We demonstrate that classical reference genes are not always the most ‘stable’ genes and that gene ‘stability’ is highly dependent on experimental conditions. Selected stable genes, individually or in combination, were then used to normalise osteocalcin and alkaline phosphatase gene expression data during cranial suture fusion in the craniosynostosis mouse model and strategies compared. Strikingly, the expression trends of alkaline phosphatase and osteocalcin varied significantly when normalised to the least stable, the most stable or the three most stable genes. Conclusion To minimise errors in evaluating gene expression levels, analysis of a reference panel and subsequent normalization to several stable genes is strongly recommended over normalization to a single gene. In particular, we conclude that use of single, non-validated “housekeeping” genes such as GAPDH, ACTB and 18 S rRNA, currently a widespread practice by researchers in

  15. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  16. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  17. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jan S Suchodolski

    Full Text Available BACKGROUND: Canine idiopathic inflammatory bowel disease (IBD is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. METHODOLOGY/PRINCIPAL FINDINGS: Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6 and dogs with moderate IBD (n = 7 or severe IBD (n = 7 as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001. Proportions of Fusobacteria (p = 0.010, Bacteroidaceae (p = 0.015, Prevotellaceae (p = 0.022, and Clostridiales (p = 0.019 were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044 and Acinetobacter (p = 0.040, were either more abundant or more frequently identified in IBD dogs. CONCLUSIONS/SIGNIFICANCE: In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  18. Analysis of microbiota associated with peri-implantitis using 16S rRNA gene clone library

    Directory of Open Access Journals (Sweden)

    Tatsuro Koyanagi

    2010-05-01

    Full Text Available Background: Peri-implantitis (PI is an inflammatory disease which leads to the destruction of soft and hard tissues around osseointegrated implants. The subgingival microbiota appears to be responsible for peri-implant lesions and although the complexity of the microbiota has been reported in PI, the microbiota responsible for PI has not been identified. Objective: The purpose of this study was to identify the microbiota in subjects who have PI, clinically healthy implants, and periodontitis-affected teeth using 16S rRNA gene clone library analysis to clarify the microbial differences. Design: Three subjects participated in this study. The conditions around the teeth and implants were evaluated based on clinical and radiographic examinations and diseased implants, clinically healthy implants, and periodontally diseased teeth were selected. Subgingival plaque samples were taken from the deepest pockets using sterile paper points. Prevalence and identity of bacteria was analyzed using a 16S rRNA gene clone library technique. Results: A total of 112 different species were identified from 335 clones sequenced. Among the 112 species, 51 (46% were uncultivated phylotypes, of which 22 were novel phylotypes. The numbers of bacterial species identified at the sites of PI, periodontitis, and periodontally healthy implants were 77, 57, and 12, respectively. Microbiota in PI mainly included Gram-negative species and the composition was more diverse when compared to that of the healthy implant and periodontitis. The phyla Chloroflexi, Tenericutes, and Synergistetes were only detected at PI sites, as were Parvimonas micra, Peptostreptococcus stomatis, Pseudoramibacter alactolyticus, and Solobacterium moorei. Low levels of periodontopathic bacteria, such as Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans, were seen in peri-implant lesions. Conclusions: The biofilm in PI showed a more complex microbiota when compared to periodontitis and

  19. Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

    Science.gov (United States)

    Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

    1999-03-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

  20. Real-time PCR quantification and diversity analysis of the functional genes aprA and dsrA of sulfate-reducing bacteria in marine sediments of the Peru continental margin and the Black Sea

    OpenAIRE

    Axel eSchippers; Anna eBlazejak

    2011-01-01

    A quantitative, real-time PCR (Q-PCR) assay for the functional gene adenosine 5´-phosphosulfate reductase (aprA) of sulfate-reducing bacteria (SRB) was designed. This assay was applied together with described Q-PCR assays for dissimilatory sulfite reductase (dsrA) and the 16S rRNA gene of total Bacteria to marine sediments from the Peru margin (0 – 121 meters below seafloor (mbsf)) and the Black Sea (0 – 6 mbsf). Clone libraries of aprA show that all isolated sequences originate from SRB...

  1. Nearly Complete 28S rRNA Gene Sequences Confirm New Hypotheses of Sponge Evolution

    Science.gov (United States)

    Thacker, Robert W.; Hill, April L.; Hill, Malcolm S.; Redmond, Niamh E.; Collins, Allen G.; Morrow, Christine C.; Spicer, Lori; Carmack, Cheryl A.; Zappe, Megan E.; Pohlmann, Deborah; Hall, Chelsea; Diaz, Maria C.; Bangalore, Purushotham V.

    2013-01-01

    The highly collaborative research sponsored by the NSF-funded Assembling the Porifera Tree of Life (PorToL) project is providing insights into some of the most difficult questions in metazoan systematics. Our understanding of phylogenetic relationships within the phylum Porifera has changed considerably with increased taxon sampling and data from additional molecular markers. PorToL researchers have falsified earlier phylogenetic hypotheses, discovered novel phylogenetic alliances, found phylogenetic homes for enigmatic taxa, and provided a more precise understanding of the evolution of skeletal features, secondary metabolites, body organization, and symbioses. Some of these exciting new discoveries are shared in the papers that form this issue of Integrative and Comparative Biology. Our analyses of over 300 nearly complete 28S ribosomal subunit gene sequences provide specific case studies that illustrate how our dataset confirms new hypotheses of sponge evolution. We recovered monophyletic clades for all 4 classes of sponges, as well as the 4 major clades of Demospongiae (Keratosa, Myxospongiae, Haploscleromorpha, and Heteroscleromorpha), but our phylogeny differs in several aspects from traditional classifications. In most major clades of sponges, families within orders appear to be paraphyletic. Although additional sampling of genes and taxa are needed to establish whether this pattern results from a lack of phylogenetic resolution or from a paraphyletic classification system, many of our results are congruent with those obtained from 18S ribosomal subunit gene sequences and complete mitochondrial genomes. These data provide further support for a revision of the traditional classification of sponges. PMID:23748742

  2. Establishment of a continuous culture system for Entamoeba muris and analysis of the small subunit rRNA gene

    Directory of Open Access Journals (Sweden)

    Kobayashi S.

    2009-06-01

    Full Text Available We established a culture system for Entamoeba muris (MG-EM-01 strain isolated from a Mongolian gerbil using a modified Balamuth’s egg yolk infusion medium supplemented with 4% adult bovine serum and Bacteroides fragilis cocultured with Escherichia coli. Further, encystation was observed in the culture medium. The morphological characteristics of E. muris are similar to those of Entamoeba coli (E. coli; moreover, the malic isoenzyme electrophoretic band, which shows species-specific electrophoretic mobility, of E. muris had almost the same mobility as that observed with the malic isoenzyme electrophorectic band of E. coli (UZG-EC-01 strain isolated from a gorilla. We determined the small subunit rRNA (SSU-rRNA gene sequence of the MG-EM-01 strain, and this sequence was observed to show 82.7% homology with that of the UZG-EC-01 strain. Further, the resultant phylogenetic tree for molecular taxonomy based on the SSU-rRNA genes of the 21 strains of the intestinal parasitic amoeba species indicated that the MG-EM-01 strain was most closely related to E. coli.

  3. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  4. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  5. A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform.

    Science.gov (United States)

    de Muinck, Eric J; Trosvik, Pål; Gilfillan, Gregor D; Hov, Johannes R; Sundaram, Arvind Y M

    2017-07-06

    Advances in sequencing technologies and bioinformatics have made the analysis of microbial communities almost routine. Nonetheless, the need remains to improve on the techniques used for gathering such data, including increasing throughput while lowering cost and benchmarking the techniques so that potential sources of bias can be better characterized. We present a triple-index amplicon sequencing strategy to sequence large numbers of samples at significantly lower c ost and in a shorter timeframe compared to existing methods. The design employs a two-stage PCR protocol, incorpo rating three barcodes to each sample, with the possibility to add a fourth-index. It also includes heterogeneity spacers to overcome low complexity issues faced when sequencing amplicons on Illumina platforms. The library preparation method was extensively benchmarked through analysis of a mock community in order to assess biases introduced by sample indexing, number of PCR cycles, and template concentration. We further evaluated the method through re-sequencing of a standardized environmental sample. Finally, we evaluated our protocol on a set of fecal samples from a small cohort of healthy adults, demonstrating good performance in a realistic experimental setting. Between-sample variation was mainly related to batch effects, such as DNA extraction, while sample indexing was also a significant source of bias. PCR cycle number strongly influenced chimera formation and affected relative abundance estimates of species with high GC content. Libraries were sequenced using the Illumina HiSeq and MiSeq platforms to demonstrate that this protocol is highly scalable to sequence thousands of samples at a very low cost. Here, we provide the most comprehensive study of performance and bias inherent to a 16S rRNA gene amplicon sequencing method to date. Triple-indexing greatly reduces the number of long custom DNA oligos required for library preparation, while the inclusion of variable length

  6. Changes in the diversity of pig ileal lactobacilli around weaning determined by means of 16S rRNA gene amplification and denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Janzcyk, P.; Pieper, R.; Smidt, H.; Souffrant, W.B.

    2007-01-01

    Our study aimed to provide a comprehensive characterization of changes in porcine intestinal Lactobacillus populations around the time of weaning based on 16S rRNA gene amplification and denaturing gradient gel electrophoresis (DGGE). DNA was extracted from the ileal contents of piglets at weaning

  7. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  8. [Archaeal diversity in permafrost deposits of Bunger Hills Oasis and King George Island (Antarctica) according to the 16S rRNA gene sequencing].

    Science.gov (United States)

    Karaevskaia, E S; Demchenko, L S; Demidov, N É; Rivkina, E M; Bulat, S A; Gilichinskiĭ, D A

    2014-01-01

    Archaeal communities of permafrost deposits of King George Island and Bunger Hills Oasis (Antarctica) differing in the content of biogenic methane were analyzed using clone libraries of two 16S rRNA gene regions. Phylotypes belonging to methanogenic archaea were identified in all horizons.

  9. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies

    DEFF Research Database (Denmark)

    Thorsen, Jonathan; Brejnrod, Asker Daniel; Mortensen, Martin Steen

    2016-01-01

    BACKGROUND: There is an immense scientific interest in the human microbiome and its effects on human physiology, health, and disease. A common approach for examining bacterial communities is high-throughput sequencing of 16S rRNA gene hypervariable regions, aggregating sequence-similar amplicons...

  10. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš

    2013-01-01

    Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

  11. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten

    2011-01-01

    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  12. Evolutionary relationships of Spirurina (Nematoda: Chromadorea: Rhabditida) with special emphasis on dracunculoid nematodes inferred from SSU rRNA gene sequences

    Czech Academy of Sciences Publication Activity Database

    Wijová, Martina; Moravec, František; Horák, Aleš; Lukeš, Julius

    2006-01-01

    Roč. 36, č. 9 (2006), s. 1067-1075 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GA524/06/0170 Institutional research plan: CEZ:AV0Z60220518 Keywords : Nematoda * Spirurina * SSU rRNA gene sequences Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 3.337, year: 2006

  13. Routine DNA analysis based on 12S rRNA gene sequencing as a tool in the management of captive primates

    NARCIS (Netherlands)

    van der Kuyl, A. C.; van Gennep, D. R.; Dekker, J. T.; Goudsmit, J.

    2000-01-01

    Automated DNA sequencing of a fragment of the relatively slowly evolving mitochondrial 12S rRNA gene was used to distinguish primate species, and the method was compared with species determination based upon classical taxonomy. DNA from blood from 53 monkeys housed at the Stichting AAP Shelter for

  14. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  15. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  16. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    Science.gov (United States)

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  17. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    Science.gov (United States)

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

  18. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Science.gov (United States)

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  19. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    Science.gov (United States)

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  20. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David

    2012-11-20

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  1. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  2. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    Science.gov (United States)

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  3. Characterization of the Fecal Microbial Communities of Duroc Pigs Using 16S rRNA Gene Pyrosequencing

    Directory of Open Access Journals (Sweden)

    Edward Alain B. Pajarillo

    2015-04-01

    Full Text Available This study characterized the fecal bacterial community structure and inter-individual variation in 30-week-old Duroc pigs, which are known for their excellent meat quality. Pyrosequencing of the V1–V3 hypervariable regions of the 16S rRNA genes generated 108,254 valid reads and 508 operational taxonomic units at a 95% identity cut-off (genus level. Bacterial diversity and species richness as measured by the Shannon diversity index were significantly greater than those reported previously using denaturation gradient gel electrophoresis; thus, this study provides substantial information related to both known bacteria and the untapped portion of unclassified bacteria in the population. The bacterial composition of Duroc pig fecal samples was investigated at the phylum, class, family, and genus levels. Firmicutes and Bacteroidetes predominated at the phylum level, while Clostridia and Bacteroidia were most abundant at the class level. This study also detected prominent inter-individual variation starting at the family level. Among the core microbiome, which was observed at the genus level, Prevotella was consistently dominant, as well as a bacterial phylotype related to Oscillibacter valericigenes, a valerate producer. This study found high bacterial diversity and compositional variation among individuals of the same breed line, as well as high abundance of unclassified bacterial phylotypes that may have important functions in the growth performance of Duroc pigs.

  4. Physical localization and DNA methylation of 45S rRNA gene loci in Jatropha curcas L.

    Directory of Open Access Journals (Sweden)

    Zhiyun Gong

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n=2x=22=12m+10 sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation.

  5. Physical Localization and DNA Methylation of 45S rRNA Gene Loci in Jatropha curcas L.

    Science.gov (United States)

    Gong, Zhiyun; Xue, Chao; Zhang, Mingliang; Guo, Rui; Zhou, Yong; Shi, Guoxin

    2013-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n = 2x = 22 = 12m+10sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation. PMID:24386362

  6. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying

    2017-01-01

    The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  7. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Yu Zuo

    Full Text Available The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  8. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    Science.gov (United States)

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  9. A molecular phylogeny of the marine red algae (Rhodophyta) based on the nuclear small-subunit rRNA gene.

    Science.gov (United States)

    Ragan, M A; Bird, C J; Rice, E L; Gutell, R R; Murphy, C A; Singh, R K

    1994-01-01

    A phylogeny of marine Rhodophyta has been inferred by a number of methods from nucleotide sequences of nuclear genes encoding small subunit rRNA from 39 species in 15 orders. Sequence divergences are relatively large, especially among bangiophytes and even among congeners in this group. Subclass Bangiophycidae appears polyphyletic, encompassing at least three lineages, with Porphyridiales distributed between two of these. Subclass Florideophycidae is monophyletic, with Hildenbrandiales, Corallinales, Ahnfeltiales, and a close association of Nemaliales, Acrochaetiales, and Palmariales forming the four deepest branches. Cermiales may represent a convergence of vegetative and reproductive morphologies, as family Ceramiaceae is at best weakly related to the rest of the order, and one of its members appears to be allied to Gelidiales. Except for Gigartinales, for which more data are required, the other florideophyte orders appear distinct and taxonomically justified. A good correlation was observed with taxonomy based on pit-plug ultrastructure. Tests under maximum-likelihood and parsimony of alternative phylogenies based on structure and chemistry refuted suggestions that Acrochaetiales is the most primitive florideophyte order and that Gelidiales and Hildenbrandiales are sister groups. PMID:8041780

  10. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mu Peng

    2015-09-01

    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  11. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    Science.gov (United States)

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-09-24

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  12. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  13. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  14. Discriminating activated sludge flocs from biofilm microbial communities in a novel pilot-scale reciprocation MBR using high-throughput 16S rRNA gene sequencing.

    Science.gov (United States)

    De Sotto, Ryan; Ho, Jaeho; Lee, Woonyoung; Bae, Sungwoo

    2018-03-29

    Membrane bioreactors (MBRs) are a well-established filtration technology that has become a popular solution for treating wastewater. One of the drawbacks of MBRs, however, is the formation of biofilm on the surface of membrane modules. The occurrence of biofilms leads to biofouling, which eventually compromises water quality and damages the membranes. To prevent this, it is vital to understand the mechanism of biofilm formation on membrane surfaces. In this pilot-scale study, a novel reciprocation membrane bioreactor was operated for a period of 8 months and fed with domestic wastewater from an aerobic tank of a local WWTP. Water quality parameters were monitored and the microbial composition of the attached biofilm and suspended aggregates was evaluated in this reciprocating MBR configuration. The abundance of nitrifiers and composition of microbial communities from biofilm and suspended solids samples were investigated using qPCR and high throughput 16S amplicon sequencing. Removal efficiencies of 29%, 16%, and 15% of chemical oxygen demand, total phosphorus and total nitrogen from the influent were observed after the MBR process with average effluent concentrations of 16 mg/L, 4.6 mg/L, and 5.8 mg/L respectively. This suggests that the energy-efficient MBR, apart from reducing the total energy consumption, was able to maintain effluent concentrations that are within regulatory standards for discharge. Molecular analysis showed the presence of amoA Bacteria and 16S Nitrospira genes with the occurrence of nitrification. Candidatus Accumulibacter, a genus with organisms that can accumulate phosphorus, was found to be present in both groups which explains why phosphorus removal was observed in the system. High-throughput 16S rRNA amplicon sequencing revealed the genus Saprospira to be the most abundant species from the total OTUs of both the membrane tank and biofilm samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  16. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  17. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

    Directory of Open Access Journals (Sweden)

    Rahul Gopalam

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For Salvia hispanica, an economically important oilseed crop, there are no reports of stable reference genes till date. In this study, we chose 13 candidate reference genes viz. Actin11 (ACT, Elongation factor 1-alpha (EF1-α, Eukaryotic translation initiation factor 3E (ETIF3E, alpha tubulin (α-TUB, beta tubulin (β-TUB, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cyclophilin (CYP, Clathrin adaptor complex (CAC, Serine/threonine-protein phosphatase 2A (PP2A, FtsH protease (FtsH, 18S ribosomal RNA (18S rRNA, S-adenosyl methionine decarboxylase (SAMDC and Rubisco activase (RCA and the expression levels of these genes were assessed in a diverse set of tissue samples representing vegetative stages, reproductive stages and various abiotic stress treatments. Two of the widely used softwares, geNorm and Normfinder were used to evaluate the expression stabilities of these 13 candidate reference genes under different conditions. Results showed that GAPDH and CYP expression remain stable throughout in the different abiotic stress treatments, CAC and PP2A expression were relatively stable under reproductive stages and α-TUB, PP2A and ETIF3E were found to be stably expressed in vegetative stages. Further, the expression levels of Diacylglycerol acyltransferase (DGAT1, a key enzyme in triacylglycerol synthesis was analyzed to confirm the validity of reference genes identified in the study. This is the first systematic study of selection of reference genes in S. hispanica, and will benefit future expression studies in this crop.

  18. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C

    2014-10-01

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  19. Combining flow cytometry and 16S rRNA gene pyrosequencing: a promising approach for drinking water monitoring and characterization.

    Science.gov (United States)

    Prest, E I; El-Chakhtoura, J; Hammes, F; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S

    2014-10-15

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5 min intervals for 1 h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345 ± 15 × 10(3) to 425 ± 35 × 10(3) cells mL(-1)) and in the percentage of intact bacterial cells (from 39 ± 3.5% to 53 ± 4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. 16S rRNA gene sequencing reveals effects of photoperiod on cecal microbiota of broiler roosters

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2018-02-01

    Full Text Available Photoperiod is an important factor in stimulating broiler performance in commercial poultry practice. However, the mechanism by which photoperiod affects the performance of broiler chickens has not been adequately explored. The current study evaluated the effects of three different photoperiod regimes (short day (LD = 8 h light, control (CTR = 12.5 h light, and long day (SD = 16 h light on the cecal microbiota of broiler roosters by sequencing bacterial 16S rRNA genes. At the phylum level, the dominant bacteria were Firmicutes (CTR: 68%, SD: 69%, LD: 67% and Bacteroidetes (CTR: 25%, SD: 26%, and LD: 28%. There was a greater abundance of Proteobacteria (p < 0.01 and Cyanobacteria (p < 0.05 in chickens in the LD group than in those in the CTR group. A significantly greater abundance of Actinobacteria was observed in CTR chickens than in SD and LD chickens (p < 0.01. The abundance of Deferribacteres was significantly higher in LD chickens than in SD chickens (p < 0.01. Fusobacteria and Proteobacteria were more abundant in SD chickens than in CTR and LD chickens. The predicted functional properties indicate that cellular processes may be influenced by photoperiod. Conversely, carbohydrate metabolism was enhanced in CTR chickens as compared to that in SD and LD chickens. The current results indicate that different photoperiod regimes may influence the abundance of specific bacterial populations and then contribute to differences in the functional properties of gut microbiota of broiler roosters.

  1. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  2. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    Science.gov (United States)

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  3. Broilers fed dietary vitamins harbor higher diversity of cecal bacteria and higher ratio of Clostridium, Faecalibacterium, and Lactobacillus than broilers with no dietary vitamins revealed by 16S rRNA gene clone libraries.

    Science.gov (United States)

    Luo, Yu-heng; Peng, Huan-wei; Wright, André-Denis G; Bai, Shi-ping; Ding, Xue-mei; Zeng, Qiu-feng; Li, Hua; Zheng, Ping; Su, Zhuo-wei; Cui, Ren-yong; Zhang, Ke-ying

    2013-09-01

    Research on the interaction between dietary vitamins and intestinal bacteria is poorly understood. To investigate the effect of dietary vitamins on the cecal bacterial communities, 2 bacterial 16S rRNA gene clone libraries were constructed from pooled PCR products obtained from the cecal digesta of 28-d broilers fed diets with vitamins (V) at the NRC level or with no vitamins (NV). The results showed that BW gain and average feed intake of V broilers was significantly higher (P vitamins can increase the ratio of facultative pathogenic bacteria and decrease the diversity of bacteria in the cecum of broilers. Our results provide new leads for further investigations on the interaction between dietary vitamin additives and the gut health of broilers.

  4. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16......S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing......-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains...

  5. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  6. [Characterizing Beijing's Airborne Bacterial Communities in PM2.5 and PM1 Samples During Haze Pollution Episodes Using 16S rRNA Gene Analysis Method].

    Science.gov (United States)

    Wang, Bu-ying; Lang, Ji-dong; Zhang, Li-na; Fang, Jian-huo; Cao, Chen; Hao, Ji-ming; Zhu, Ting; Tian, Geng; Jiang, Jing-kun

    2015-08-01

    During 8th-14th Jan., 2013, severe particulate matter (PM) pollution episodes happened in Beijing. These air pollution events lead to high risks for public health. In addition to various PM chemical compositions, biological components in the air may also impose threaten. Little is known about airborne microbial community in such severe air pollution conditions. PM2.5 and PM10 samples were collected during that 7-day pollution period. The 16S rRNA gene V3 amplification and the MiSeq sequencing were performed for analyzing these samples. It is found that there is no significant difference at phylum level for PM2.5 bacterial communities during that 7-day pollution period both at phylum and at genus level. At genus level, Arthrobacter and Frankia are the major airborne microbes presented in Beijing winter.samples. At genus level, there are 39 common genera (combined by first 50 genera bacterial of the two analysis) between the 16S rRNA gene analysis and those are found by Metagenomic analysis on the same PM samples. Frankia and Paracoccus are relatively more abundant in 16S rRNA gene data, while Kocuria and Geodermatophilus are relatively more abundant in Meta-data. PM10 bacterial communities are similar to those of PM2.5 with some noticeable differences, i.e., at phylum level, more Firmicutes and less Actinobacteria present in PM10 samples than in PM2.5 samples, while at genus level, more Clostridium presents in PM10 samples. The findings in Beijing were compared with three 16S rRNA gene studies in other countries. Although the sampling locations and times are different from each other, compositions of bacterial community are similar for those sampled at the ground atmosphere. Airborne microbial communities near the ground surface are different from those sampled in the upper troposphere.

  7. Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

    Science.gov (United States)

    Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

    2010-04-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

  8. Abundance and activity of 16S rRNA, amoA and nifH bacterial genes during assisted phytostabilization of mine tailings

    OpenAIRE

    Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2015-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nif...

  9. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    Science.gov (United States)

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  10. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  11. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    Science.gov (United States)

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  12. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

    Science.gov (United States)

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-12-31

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

  13. Analysis of dissimilatory sulfite reductase and 16S rRNA gene fragments from deep-sea hydrothermal sites of the Suiyo Seamount, Izu-Bonin Arc, Western Pacific.

    Science.gov (United States)

    Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu

    2004-01-01

    This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5 degrees C and natural vent fluids at 7 degrees C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and gamma- and epsilon-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with "Nanoarchaeota." The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300 degrees C were affiliated with the delta-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4 degrees C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments.

  14. The use of laser microdissection in the identification of suitable reference genes for normalization of quantitative real-time PCR in human FFPE epithelial ovarian tissue samples.

    Directory of Open Access Journals (Sweden)

    Jing Cai

    Full Text Available Quantitative real-time PCR (qPCR is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD, an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA and nonparametric (Kruskal-Wallis tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.

  15. The use of laser microdissection in the identification of suitable reference genes for normalization of quantitative real-time PCR in human FFPE epithelial ovarian tissue samples.

    Science.gov (United States)

    Cai, Jing; Li, Tao; Huang, Bangxing; Cheng, Henghui; Ding, Hui; Dong, Weihong; Xiao, Man; Liu, Ling; Wang, Zehua

    2014-01-01

    Quantitative real-time PCR (qPCR) is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M) were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD), an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA) and nonparametric (Kruskal-Wallis) tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP) and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.

  16. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  17. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    NARCIS (Netherlands)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  18. Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs.

    Science.gov (United States)

    Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P

    2016-02-01

    Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Science.gov (United States)

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Bacterial 16S rRNA gene analysis revealed that bacteria related to Arcobacter spp. constitute an abundant and common component of the oyster microbiota (Tiostrea chilensis).

    Science.gov (United States)

    Romero, J; García-Varela, M; Laclette, J P; Espejo, R T

    2002-11-01

    To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.

  1. Comparison of two poultry litter qPCR assays targeting the 16S rRNA gene of Brevibacterium sp

    Science.gov (United States)

    Chicken feces are vectors of human pathogens and are also important sources of fecal pollution in environmental waters. Consequently, methods that can detect chicken fecal pollution are needed in public health and environmental monitoring studies. In this study, we compared a pre...

  2. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    Science.gov (United States)

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  3. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    OpenAIRE

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...

  4. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015

  5. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  6. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton

    2002-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  7. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  8. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  9. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  10. PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

    Directory of Open Access Journals (Sweden)

    Iris Wundrack

    1994-01-01

    Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

  11. PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...

    African Journals Online (AJOL)

    Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.

  12. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Directory of Open Access Journals (Sweden)

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  13. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  14. Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

    Science.gov (United States)

    Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

    2017-02-01

    Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

  15. Validation of reference genes for RT-qPCR analysis in Herbaspirillum seropedicae.

    Science.gov (United States)

    Pessoa, Daniella Duarte Villarinho; Vidal, Marcia Soares; Baldani, José Ivo; Simoes-Araujo, Jean Luiz

    2016-08-01

    The RT-qPCR technique needs a validated set of reference genes for ensuring the consistency of the results from the gene expression. Expression stabilities for 9 genes from Herbaspirillum seropedicae, strain HRC54, grown with different carbon sources were calculated using geNorm and NormFinder, and the gene rpoA showed the best stability values. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. [Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

    Science.gov (United States)

    Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

    2009-07-01

    Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

  17. ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization.

    Science.gov (United States)

    Sang, Jian; Wang, Zhennan; Li, Man; Cao, Jiabao; Niu, Guangyi; Xia, Lin; Zou, Dong; Wang, Fan; Xu, Xingjian; Han, Xiaojiao; Fan, Jinqi; Yang, Ye; Zuo, Wanzhu; Zhang, Yang; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Hu, Songnian; Hao, Lili; Zhang, Zhang

    2018-01-04

    Real-time quantitative PCR (RT-qPCR) has become a widely used method for accurate expression profiling of targeted mRNA and ncRNA. Selection of appropriate internal control genes for RT-qPCR normalization is an elementary prerequisite for reliable expression measurement. Here, we present ICG (http://icg.big.ac.cn), a wiki-driven knowledgebase for community curation of experimentally validated internal control genes as well as their associated experimental conditions. Unlike extant related databases that focus on qPCR primers in model organisms (mainly human and mouse), ICG features harnessing collective intelligence in community integration of internal control genes for a variety of species. Specifically, it integrates a comprehensive collection of more than 750 internal control genes for 73 animals, 115 plants, 12 fungi and 9 bacteria, and incorporates detailed information on recommended application scenarios corresponding to specific experimental conditions, which, collectively, are of great help for researchers to adopt appropriate internal control genes for their own experiments. Taken together, ICG serves as a publicly editable and open-content encyclopaedia of internal control genes and accordingly bears broad utility for reliable RT-qPCR normalization and gene expression characterization in both model and non-model organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. [Tracing the Fecal Contamination Sources Based on Bacteroides 16S rRNA PCR- DGGE in Karst Groundwater: Taking Laolongdong Underground River System, Nanshan, Chongqing as an Example].

    Science.gov (United States)

    Zhang, Hong; Jiang, Yong-jun; Zhang, Yuan-zhu; Duan, Yi-fan; Lü, Xian-fu; He, Qiu-fang

    2016-05-15

    Microbial contamination in karst groundwater continually increases and tracing the source researches has become a hot topic for international researchers. In this study, Laolongdong underground river at Nanshan, Chongqing was chosen as an example to adopt filter membrane methods to monitor the fecal microbial contaminations including the total bacterial concentration (TB), the total E. coli concentration (TE), the total fecal coliform (FC) and the total fecal Streptocoocci (FS). Bacteriodes was used as an indicator and PCR-DGGE analysis was used to trace fecal contamination sources in karst groundwater. The results suggested that groundwater in this area was seriously polluted by microbes from feces. The concentrations of microbial parameters exceeded limited levels greatly and the total bacterial amounts ranged 10-2.9 x 10⁷ CFU · mL⁻¹, the concentrations of E. coli were between 4.3-4.0 x 10⁵ CFU · mL⁻¹, the max concentration of FC was 1.1 x 10⁶ CFU · (100 mL)⁻¹ and the max concentration of FS was 1.1 x 10⁵ CFU · (100 mL)⁻¹. The FC/FS ratios were mostly over 2 which suggested that the main fecal source in groundwater was human feces. In addition, PCR-DGGE contrastive analysis of Bacteroides communities showed that the similarities between groundwater samples and human feces were in range of 7. 1% -69. 1% , and the similarity of the groundwater sample from Laolongdong underground river outlet was 69.1% . Bacteroides community similarities between groundwater samples and swine feces were in range of 1.1%-53.4%, and the similarity of Laolongdong underground river outlet was merely 1.5%. The similarity data implied that groundwater contamination resulted mainly from human feces, swine feces contamination composed part of animals' fecal contamination, and other animals' feces participated too. Furthermore, sequencing results of PCR-DGGE products revealed that most Bacteroides in groundwater originated from human intestinal tract and human feces.

  19. Complementary techniques: validation of gene expression data by quantitative real time PCR.

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone

    2007-01-01

    Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.

  20. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  1. Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus

    Science.gov (United States)

    Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng

    2018-06-01

    The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.

  2. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... Calpastatin has been known as candidate gene in muscle growth efficiency and ... population, AA, AB, BB genotype have been identified with the 70.27, .... of cimaterol on rabbit growth and myofibrillar protein degradation.

  3. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    Science.gov (United States)

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  4. In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

    Directory of Open Access Journals (Sweden)

    Kristiansen Glen

    2007-06-01

    Full Text Available Abstract Background Housekeeping genes are commonly used as endogenous reference genes for the relative quantification of target genes in gene expression studies. No conclusive systematic study comparing the suitability of different candidate reference genes in clear cell renal cell carcinoma has been published to date. To remedy this situation, 10 housekeeping genes for normalizing purposes of RT-PCR measurements already recommended in various studies were examined with regard to their usefulness as reference genes. Results The expression of the potential reference genes was examined in matched malignant and non-malignant tissue specimens from 25 patients with clear cell renal cell carcinoma. Quality assessment of isolated RNA performed with a 2100 Agilent Bioanalyzer showed a mean RNA integrity number of 8.7 for all samples. The between-run variations related to the crossing points of PCR reactions of a control material ranged from 0.17% to 0.38%. The expression of all genes did not depend on age, sex, and tumour stage. Except the genes TATA box binding protein (TBP and peptidylprolyl isomerase A (PPIA, all genes showed significant differences in expression between malignant and non-malignant pairs. The expression stability of the candidate reference genes was additionally controlled using the software programs geNorm and NormFinder. TBP and PPIA were validated as suitable reference genes by normalizing the target gene ADAM9 using these two most stably expressed genes in comparison with up- and down-regulated housekeeping genes of the panel. Conclusion Our study demonstrated the suitability of the two housekeeping genes PPIA and TBP as endogenous reference genes when comparing malignant tissue samples with adjacent normal tissue samples from clear cell renal cell carcinoma. Both genes are recommended as reference genes for relative gene quantification in gene profiling studies either as single gene or preferably in combination.

  5. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    Science.gov (United States)

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  6. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  7. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China.

    Science.gov (United States)

    Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin

    2015-09-01

    The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.

  8. Detection of Malaria parasite species based on 18S rRNA and assessment of its resistance to the drug for DHPS gene to support the development of irradiation Malaria vaccine

    International Nuclear Information System (INIS)

    Mukh Syaifudin; Darlina; Siti Nurhayati

    2016-01-01

    Malaria remains a major public health problem because it causes 1-2 million mortality per year. Therefore the development of its vaccine, including vaccine created by ionizing radiation, is urgently needed to control the disease. Aim of this research was to determine the species of malaria parasite infecting the blood of malaria suspected patients and its resistance to sulfadoxine-pyrimethamine (SP). The number of samples used were 10 blood specimens that obtained from Dok II Hospital in Jayapura. Microscopic examination on thin blood smear was done according to standard procedure, followed by Polymerase Chain Reaction (PCR) based diagnosis to further confirm the parasite using 18S rRNA gene on deoxyribonucleic acid extract. The presence of mutation in the dhps (dihydropteroate synthetase) gene related to SP drugs was examined using restriction fragment length polymorphism (RFLP) method. Results showed that 9 samples were infected with Plasmodium falciparum and 1 infected with P. vivax. Allelic mutants of dhps gene at codon K540E were detected in 3 (33.3%) samples. Even though only in very limited number of samples analyzed, the information obtained will be a great value in additional knowledge for vaccine development with irradiation. (author)

  9. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    DEFF Research Database (Denmark)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results......, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected...... by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori...

  10. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  11. Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

    Science.gov (United States)

    Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

    2014-12-01

    The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

  12. Different bacterial communities in heat and gamma irradiation treated replant disease soils revealed by 16S rRNA gene analysis – contribution to improved aboveground apple plant growth?

    Directory of Open Access Journals (Sweden)

    Bunlong eYim

    2015-11-01

    Full Text Available Replant disease (RD severely affects apple production in propagation tree nurseries and in fruit orchards worldwide. This study aimed to investigate the effects of soil disinfection treatments on plant growth and health in a biotest in two different RD soil types under greenhouse conditions and to link the plant growth status with the bacterial community composition at the time of plant sampling. In the biotest performed we observed that the aboveground growth of apple rootstock M26 plants after eight weeks was improved in the two RD soils either treated at 50 °C or with gamma irradiation compared to the untreated RD soils. Total community DNA was extracted from soil loosely adhering to the roots and quantitative real-time PCR revealed no pronounced differences in 16S rRNA gene copy numbers. 16S rRNA gene-based bacterial community analysis by denaturing gradient gel electrophoresis (DGGE and 454-pyrosequencing revealed significant differences in the bacterial community composition even after eight weeks of plant growth. In both soils, the treatments affected different phyla but only the relative abundance of Acidobacteria was reduced by both treatments. The genera Streptomyces, Bacillus, Paenibacillus and Sphingomonas had a higher relative abundance in both heat treated soils, whereas the relative abundance of Mucilaginibacter, Devosia and Rhodanobacter was increased in the gamma-irradiated soils and only the genus Phenylobacterium was increased in both treatments. The increased abundance of genera with potentially beneficial bacteria, i.e. potential degraders of phenolic compounds might have contributed to the improved plant growth in both treatments.

  13. Biphasic Study to Characterize Agricultural Biogas Plants by High-Throughput 16S rRNA Gene Amplicon Sequencing and Microscopic Analysis.

    Science.gov (United States)

    Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas

    2017-02-28

    Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.

  14. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Directory of Open Access Journals (Sweden)

    Arzu Coleri Cihan

    2012-03-01

    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  15. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  16. Selection of reference genes for qPCR in hairy root cultures of peanut

    Directory of Open Access Journals (Sweden)

    Medrano Giuliana

    2011-10-01

    Full Text Available Abstract Background Hairy root cultures produced via Agrobacterium rhizogenes-mediated transformation have emerged as practical biological models to elucidate the biosynthesis of specialized metabolites. To effectively understand the expression patterns of the genes involved in the metabolic pathways of these compounds, reference genes need to be systematically validated under specific experimental conditions as established by the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines. In the present report we describe the first validation of reference genes for RT-qPCR in hairy root cultures of peanut which produce stilbenoids upon elicitor treatments. Results A total of 21 candidate reference genes were evaluated. Nineteen genes were selected based on previous qPCR studies in plants and two were from the T-DNAs transferred from A. rhizogenes. Nucleotide sequences of peanut candidate genes were obtained using their homologous sequences in Arabidopsis. To identify the suitable primers, calibration curves were obtained for each candidate reference gene. After data analysis, 12 candidate genes meeting standard efficiency criteria were selected. The expression stability of these genes was analyzed using geNorm and NormFinder algorithms and a ranking was established based on expression stability of the genes. Candidate reference gene expression was shown to have less variation in methyl jasmonate (MeJA treated root cultures than those treated with sodium acetate (NaOAc. Conclusions This work constitutes the first effort to validate reference genes for RT-qPCR in hairy roots. While these genes were selected under conditions of NaOAc and MeJA treatment, we anticipate these genes to provide good targets for reference genes for hairy roots under a variety of stress conditions. The lead reference genes were a gene encoding for a TATA box binding protein (TBP2 and a gene encoding a ribosomal protein (RPL8C. A

  17. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  18. Polyphasic characterization of Dolichospermum spp. and Sphaerospermopsis spp. (Nostocales, cyanobacteria): morphology, 16S rRNA gene sequences and fatty acid and secondary metabolite profiles

    Czech Academy of Sciences Publication Activity Database

    Zapomělová, Eliška; Hrouzek, Pavel; Řezanka, Tomáš; Jezberová, Jitka; Řeháková, Klára; Hisem, D.; Komárková, Jaroslava

    2011-01-01

    Roč. 47, č. 5 (2011), s. 1152-1163 ISSN 0022-3646 R&D Projects: GA AV ČR(CZ) KJB600960703; GA ČR(CZ) GAP504/10/1501; GA ČR(CZ) GA206/09/0309 Institutional research plan: CEZ:AV0Z60170517; CEZ:AV0Z50200510; CEZ:AV0Z60050516 Keywords : taxonomy * cyanobacteria * Anabaena * Dolichospermum * Sphaerospermopsis * phylogeny * 16S rRNA gene * fatty acids * secondary metabolites Subject RIV: EE - Microbiology, Virology Impact factor: 2.071, year: 2011

  19. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

  20. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Directory of Open Access Journals (Sweden)

    Mariza M. Coêlho

    2011-01-01

    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  1. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...

  2. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  3. Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

    Science.gov (United States)

    You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

    2018-05-01

    Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

  4. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Science.gov (United States)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  5. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris

    Directory of Open Access Journals (Sweden)

    Biffali Elio

    2009-07-01

    Full Text Available Abstract Background Quantitative real-time polymerase chain reaction (RT-qPCR is valuable for studying the molecular events underlying physiological and behavioral phenomena. Normalization of real-time PCR data is critical for a reliable mRNA quantification. Here we identify reference genes to be utilized in RT-qPCR experiments to normalize and monitor the expression of target genes in the brain of the cephalopod mollusc Octopus vulgaris, an invertebrate. Such an approach is novel for this taxon and of advantage in future experiments given the complexity of the behavioral repertoire of this species when compared with its relatively simple neural organization. Results We chose 16S, and 18S rRNA, actB, EEF1A, tubA and ubi as candidate reference genes (housekeeping genes, HKG. The expression of 16S and 18S was highly variable and did not meet the requirements of candidate HKG. The expression of the other genes was almost stable and uniform among samples. We analyzed the expression of HKG into two different set of animals using tissues taken from the central nervous system (brain parts and mantle (here considered as control tissue by BestKeeper, geNorm and NormFinder. We found that HKG expressions differed considerably with respect to brain area and octopus samples in an HKG-specific manner. However, when the mantle is treated as control tissue and the entire central nervous system is considered, NormFinder revealed tubA and ubi as the most suitable HKG pair. These two genes were utilized to evaluate the relative expression of the genes FoxP, creb, dat and TH in O. vulgaris. Conclusion We analyzed the expression profiles of some genes here identified for O. vulgaris by applying RT-qPCR analysis for the first time in cephalopods. We validated candidate reference genes and found the expression of ubi and tubA to be the most appropriate to evaluate the expression of target genes in the brain of different octopuses. Our results also underline the

  6. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

    Science.gov (United States)

    Chakravorty, S; Sarkar, S; Gachhui, R

    2015-01-01

    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  7. Evaluation of Housekeeping Genes for Quantitative Real-Time PCR Analysis of Bradysia odoriphaga (Diptera: Sciaridae

    Directory of Open Access Journals (Sweden)

    Caihua Shi

    2016-07-01

    Full Text Available The soil insect Bradysia odoriphaga (Diptera: Sciaridae causes substantial damage to Chinese chive. Suitable reference genes in B. odoriphaga (Bradysia odoriphaga have yet to be identified for normalizing target gene expression among samples by quantitative real-time PCR (qRT-PCR. This study was focused on identifying the expression stability of 12 candidate housekeeping genes in B. odoriphaga under various experiment conditions. The final stability ranking of 12 housekeeping genes was obtained with RefFinder, and the most suitable number of reference genes was analyzed by GeNorm. The results revealed that the most appropriate sets of internal controls were RPS15, RPL18, and RPS18 across developmental phases; RPS15, RPL28, and GAPDH across temperatures; RPS15 and RPL18 across pesticide treatments; RSP5, RPS18, and SDHA across photoperiods; ACTb, RPS18, and RPS15 across diets; RPS13 and RPL28 across populations; and RPS15, ACTb, and RPS18 across all samples. The use of the most suitable reference genes versus an arbitrarily selected reference gene resulted in significant differences in the analysis of a target gene expression. HSP23 in B. odoriphaga was found to be up-regulated under low temperatures. These results will contribute to the standardization of qRT-PCR and will also be valuable for further research on gene function in B. odoriphaga.

  8. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  9. Cloning and evaluation of reference genes for quantitative real-time PCR analysis in Amorphophallus

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2017-04-01

    Full Text Available Quantitative real-time reverse transcription PCR (RT-qPCR has been widely used in the detection and quantification of gene expression levels because of its high accuracy, sensitivity, and reproducibility as well as its large dynamic range. However, the reliability and accuracy of RT-qPCR depends on accurate transcript normalization using stably expressed reference genes. Amorphophallus is a perennial plant with a high content of konjac glucomannan (KGM in its corm. This crop has been used as a food source and as a traditional medicine for thousands of years. Without adequate knowledge of gene expression profiles, there has been no report of validated reference genes in Amorphophallus. In this study, nine genes that are usually used as reference genes in other crops were selected as candidate reference genes. These putative sequences of these genes Amorphophallus were cloned by the use of degenerate primers. The expression stability of each gene was assessed in different tissues and under two abiotic stresses (heat and waterlogging in A. albus and A. konjac. Three distinct algorithms were used to evaluate the expression stability of the candidate reference genes. The results demonstrated that EF1-a, EIF4A, H3 and UBQ were the best reference genes under heat stress in Amorphophallus. Furthermore, EF1-a, EIF4A, TUB, and RP were the best reference genes in waterlogged conditions. By comparing different tissues from all samples, we determined that EF1-α, EIF4A, and CYP were stable in these sets. In addition, the suitability of these reference genes was confirmed by validating the expression of a gene encoding the small heat shock protein SHSP, which is related to heat stress in Amorphophallus. In sum, EF1-α and EIF4A were the two best reference genes for normalizing mRNA levels in different tissues and under various stress treatments, and we suggest using one of these genes in combination with 1 or 2 reference genes associated with different

  10. Evaluation of five antibiotic resistance genes in wastewater treatment systems of swine farms by real-time PCR.

    Science.gov (United States)

    Tao, Chi-Wei; Hsu, Bing-Mu; Ji, Wen-Tsai; Hsu, Tsui-Kang; Kao, Po-Min; Hsu, Chun-Po; Shen, Shu-Min; Shen, Tzung-Yu; Wan, Terng-Jou; Huang, Yu-Li

    2014-10-15

    Antibiotics are widely used in livestock for infection treatment and growth promotion. Wastes from animal husbandry are a potential environmental source of antibiotic-insensitive pathogens, and the removal efficiency of the resistance genotypes in current wastewater treatment plants (WWTPs) is unknown. In this study, quantitative PCR was used for evaluating antibiotic resistance genes in wastewater treatment processes. Six wastewater treatment plants in different swine farms were included in this study, and five antibiotic resistance genes (ARGs) were tested for each treatment procedure. All of the tested ARGs including tetA, tetW, sulI, sulII, and blaTEM genes were detected in six swine farms with considerable amounts. The results showed that antibiotic resistance is prevalent in livestock farming. The ARG levels were varied by wastewater treatment procedure, frequently with the highest level at anaerobic treatment tank and lowest in the activated sludge unit and the effluents. After normalizing the ARG levels to 16S rRNA gene copies, the results showed that ARGs in WWTP units fluctuated partly with the quantity of bacteria. Regardless of its importance in biodegradation, the anaerobic procedure may facilitate bacterial growth thus increasing the sustainability of the antibiotic resistance genotypes. After comparing the copy numbers in influx and efflux samples, the mean removal efficiency of ARGs ranged between 33.30 and 97.56%. The results suggested that treatments in the WWTP could partially reduce the spread of antibiotic-resistant bacteria, and additional procedures such as sedimentation may not critically affect the removal efficiency. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Diversity, Dynamics, and Activity of Bacterial Communities during Production of an Artisanal Sicilian Cheese as Evaluated by 16S rRNA Analysis†

    OpenAIRE

    Randazzo, Cinzia L.; Torriani, Sandra; Akkermans, Antoon D. L.; de Vos, Willem M.; Vaughan, Elaine E.

    2002-01-01

    The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene...

  12. Differential gene expression in Neurospora crassa cell types: heterogeneity and amplification of rRNA genes. Progress report, July 1980-June 30, 1981

    International Nuclear Information System (INIS)

    Dutta, S.K.

    1981-01-01

    The significant results obtained during 1980-1981 year of the current research program are as follows: I. Studies on heterogeneity of multiple copies of rDNAs from N. crassa cell types are being continued, such as: (1) Autoradiographs of Southern transfers of EcoR 1 restricted fragments of nuclear DNA from conidia, germinated conidia (sprouts) and mycelia of N. crassa were compared after hybridization with 32 P-rDNA probe. The nuclear DNA of two hours sprout and of 16 hours mycelia gave similar hybridization patterns with EcoR 1 digest, but no such hybridization pattern was evident in conidial DNA digest; (2) Procedure for concentration of rDNAs from Neurospora species and cell types was standardized; restriction analysis of purified rDNAs is being done; (3) 35S total rDNA clone, 17S rDNA clone and 26S rDNA subclone are being used to see gross differences in the precursor rRNAs of different cell types; (4) Comparison of DNA:DNA homologies of rRNA genes with different Neurospora species. II. Post-mitochondrial DNAs of N. crassa are found to be rDNA-like and were further characterized by electron microscopic studies and are found to be approximately twice the size of SV-40 DNAs. These N. crassa post-mitochondrial DNAs hybridized with 32 P-labeled N. crassa nuclear DNAs. III. Previous studies on differential RNase sensitive DNA polymerase activity in N. Crassa cell types and on evolution of sexual morphogenesis in the genus Neurospora are completed and published. RNase sensitive DNA polymerase activity is found to be in the post-mitochondrial fraction. Heterothallism in the genus Neurospora is evolved from homothallism

  13. Real-time PCR quantification and diversity analysis of the functional genes aprA and dsrA of sulfate-reducing bacteria in marine sediments of the Peru continental margin and the Black Sea

    Directory of Open Access Journals (Sweden)

    Axel eSchippers

    2011-12-01

    Full Text Available A quantitative, real-time PCR (Q-PCR assay for the functional gene adenosine 5´-phosphosulfate reductase (aprA of sulfate-reducing bacteria (SRB was designed. This assay was applied together with described Q-PCR assays for dissimilatory sulfite reductase (dsrA and the 16S rRNA gene of total Bacteria to marine sediments from the Peru margin (0 – 121 meters below seafloor (mbsf and the Black Sea (0 – 6 mbsf. Clone libraries of aprA show that all isolated sequences originate from SRB showing a close relationship to aprA of characterised species or form a new cluster with only distant relation to aprA of isolated SRB. Below 40 mbsf no aprA genes could be amplified. This finding corresponds with results of the applied new Q-PCR assay for aprA. In contrast to the aprA the dsrA gene could be amplified up to sediment depths of 121 mbsf. Even in such an extreme environment a high diversity of this gene was detected. The 16S rRNA gene copy numbers of total Bacteria were much higher than those of the functional genes at all sediment depths and used to calculate the proportion of SRB to the total Bacteria. The aprA and dsrA copy numbers comprised in average 0.5 - 1 % of the 16S rRNA gene copy numbers of total Bacteria in the sediments up to a depth of ca. 40 mbsf. Depth profiles of the aprA and dsrA copy numbers were almost equal for all sites. Gene copy numbers decreased concomitantly with depth from around 108 / g sediment close to the sediment surface to less than 105 / g sediment at 5 mbsf. In the zone without detectable sulfate in the pore water from ca. 40 – 121 mbsf (Peru margin ODP site 1227, only dsrA (but not aprA was detected with copy numbers of less than 104 / g sediment, comprising ca. 14 % of the 16S rRNA gene copy numbers of total Bacteria. In this zone sulfate might be provided for SRB by anaerobic sulfide oxidation.

  14. Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Zou Ruiyang

    2011-04-01

    Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

  15. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  16. In Situ Dark Adaptation Enhances the Efficiency of DNA Extraction from Mature Pin Oak (Quercus palustris Leaves, Facilitating the Identification of Partial Sequences of the 18S rRNA and Isoprene Synthase (IspS Genes

    Directory of Open Access Journals (Sweden)

    Csengele E. Barta

    2017-10-01

    Full Text Available Mature oak (Quercus spp. leaves, although abundantly available during the plants’ developmental cycle, are rarely exploited as viable sources of genomic DNA. These leaves are rich in metabolites difficult to remove during standard DNA purification, interfering with downstream molecular genetics applications. The current work assessed whether in situ dark adaptation, to deplete sugar reserves and inhibit secondary metabolite synthesis could compensate for the difficulties encountered when isolating DNA from mature leaves rich in secondary metabolites. We optimized a rapid, commercial kit based method to extract genomic DNA from dark- and light-adapted leaves. We demonstrated that in situ dark adaptation increases the yield and quality of genomic DNA obtained from mature oak leaves, yielding templates of sufficiently high quality for direct downstream applications, such as PCR amplification and gene identification. The quality of templates isolated from dark-adapted pin oak leaves particularly improved the amplification of larger fragments in our experiments. From DNA extracts prepared with our optimized method, we identified for the first time partial segments of the genes encoding 18S rRNA and isoprene synthase (IspS from pin oak (Quercus palustris, whose full genome has not yet been sequenced.

  17. Selection of Suitable Reference Genes for Quantitative Real-time PCR in Sapium sebiferum

    Directory of Open Access Journals (Sweden)

    Xue Chen

    2017-05-01

    Full Text Available Chinese tallow (Sapium sebiferum L. is a promising landscape and bioenergy plant. Measuring gene expression by quantitative real-time polymerase chain reaction (qRT-PCR can provide valuable information on gene function. Stably expressed reference genes for normalization are a prerequisite for ensuring the accuracy of the target gene expression level among different samples. However, the reference genes in Chinese tallow have not been systematically validated. In this study, 12 candidate reference genes (18S, GAPDH, UBQ, RPS15, SAND, TIP41, 60S, ACT7, PDF2, APT, TBP, and TUB were investigated with qRT-PCR in 18 samples, including those from different tissues, from plants treated with sucrose and cold stresses. The data were calculated with four common algorithms, geNorm, BestKeeper, NormFinder, and the delta cycle threshold (ΔCt. TIP41 and GAPDH were the most stable for the tissue-specific experiment, GAPDH and 60S for cold treatment, and GAPDH and UBQ for sucrose stresses, while the least stable genes were 60S, TIP41, and 18S respectively. The comprehensive results showed APT, GAPDH, and UBQ to be the top-ranked stable genes across all the samples. The stability of 60S was the lowest during all experiments. These selected reference genes were further validated by comparing the expression profiles of the chalcone synthase gene in Chinese tallow in different samples. The results will help to improve the accuracy of gene expression studies in Chinese tallow.

  18. Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos Shown with 16S rRNA Gene-Based Microbial Community Analysis

    Directory of Open Access Journals (Sweden)

    Isamu Maeda

    2013-01-01

    Full Text Available Jungle Crows (Corvus macrorhynchos prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

  19. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Science.gov (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  20. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller

    2013-04-01

    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  1. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  2. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2012-01-01

    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  3. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  4. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing

    Directory of Open Access Journals (Sweden)

    Ekaterina Avershina

    2018-05-01

    Full Text Available The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis. Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.

  5. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  6. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    DEFF Research Database (Denmark)

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  7. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies

    NARCIS (Netherlands)

    van der Kuyl, A. C.; Kuiken, C. L.; Dekker, J. T.; Perizonius, W. R.; Goudsmit, J.

    1995-01-01

    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S

  8. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  9. Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture

    Science.gov (United States)

    Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy

    2007-01-01

    It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones

  10. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Filipe Pinto

    Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.

  11. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  12. Methylation pattern of the intergenic spacer of rRNA genes in excised cotyledons of Cucurbita pepo L. (Zucchini) after hormone treatment

    International Nuclear Information System (INIS)

    Ananiev, E.; Abdulova, G.; Grozdanov, P.; Karagyozov, L.

    2003-01-01

    High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32 P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)

  13. A multiplex real-time PCR assay targeting virulence and resistance genes in Salmonella enterica serotype Typhimurium

    Directory of Open Access Journals (Sweden)

    Brisabois Anne

    2011-06-01

    Full Text Available Abstract Background Typhimurium is the main serotype of Salmonella enterica subsp. enterica implicated in food-borne diseases worldwide. This study aimed to detect the prevalence of ten markers combined in a macro-array based on multiplex real-time PCR. We targeted characteristic determinants located on pathogenicity islands (SPI-2 to -5, virulence plasmid pSLT and Salmonella genomic island 1 (SGI1 as well as a specific 16S-23S rRNA intergenic spacer sequence of definitive type 104 (DT104. To investigate antimicrobial resistance, the study also targeted the presence of genes involved in sulfonamide (sul1 and beta-lactam (blaTEM resistance. Finally, the intI1 determinant encoding integrase from class 1 integron was also investigated. Results A total of 538 unrelated S. Typhimurium strains isolated between 1999 and 2009 from various sources, including food animals, food products, human and environmental samples were studied. Based on the combined presence or absence of these markers, we distinguished 34 different genotypes, including three major genotypes encountered in 75% of the studied strains, Although SPI determinants were almost always detected, SGI1, intI1, sul1 and blaTEM determinants were found 47%, 52%, 54% and 12% of the time respectively, varying according to isolation source. Low-marker patterns were most often detected in poultry sources whereas full-marker patterns were observed in pig, cattle and human sources. Conclusion The GeneDisc® assay developed in this study madeit easier to explore variability within serotype Typhimurium by analyzing ten relevant gene determinants in a large collection of strains. This real-time multiplex method constitutes a valuable tool for strains characterization on epidemiological purposes.

  14. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  15. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  16. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  17. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  18. [Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].

    Science.gov (United States)

    Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M

    2010-04-01

    Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  19. Symmetric dimeric bisbenzimidazoles DBP(n reduce methylation of RARB and PTEN while significantly increase methylation of rRNA genes in MCF-7 cancer cells.

    Directory of Open Access Journals (Sweden)

    Svetlana V Kostyuk

    Full Text Available Hypermethylation is observed in the promoter regions of suppressor genes in the tumor cancer cells. Reactivation of these genes by demethylation of their promoters is a prospective strategy of the anticancer therapy. Previous experiments have shown that symmetric dimeric bisbenzimidazoles DBP(n are able to block DNA methyltransferase activities. It was also found that DBP(n produces a moderate effect on the activation of total gene expression in HeLa-TI population containing epigenetically repressed avian sarcoma genome.It is shown that DBP(n are able to penetrate the cellular membranes and accumulate in breast carcinoma cell MCF-7, mainly in the mitochondria and in the nucleus, excluding the nucleolus. The DBP(n are non-toxic to the cells and have a weak overall demethylation effect on genomic DNA. DBP(n demethylate the promoter regions of the tumor suppressor genes PTEN and RARB. DBP(n promotes expression of the genes RARB, PTEN, CDKN2A, RUNX3, Apaf-1 and APC "silent" in the MCF-7 because of the hypermethylation of their promoter regions. Simultaneously with the demethylation of the DNA in the nucleus a significant increase in the methylation level of rRNA genes in the nucleolus was detected. Increased rDNA methylation correlated with a reduction of the rRNA amount in the cells by 20-30%. It is assumed that during DNA methyltransferase activity inhibition by the DBP(n in the nucleus, the enzyme is sequestered in the nucleolus and provides additional methylation of the rDNA that are not shielded by DBP(n.It is concluded that DBP (n are able to accumulate in the nucleus (excluding the nucleolus area and in the mitochondria of cancer cells, reducing mitochondrial potential. The DBP (n induce the demethylation of a cancer cell's genome, including the demethylation of the promoters of tumor suppressor genes. DBP (n significantly increase the methylation of ribosomal RNA genes in the nucleoli. Therefore the further study of these compounds is needed

  20. RPE65 gene: multiplex PCR and mutation screening in patients from ...

    Indian Academy of Sciences (India)

    Unknown

    The RPE65 protein is believed to play an important role in the metabolism of vitamin A in the ... PCR and mutation screening in patients from India with retinal degenerative diseases. ..... Bennett J. 2001 Gene therapy restores vision in a canine.

  1. Detection of Legionella pneumophila by real-time PCR for the mip gene.

    Science.gov (United States)

    Wilson, Deborah A; Yen-Lieberman, Belinda; Reischl, Udo; Gordon, Steve M; Procop, Gary W

    2003-07-01

    A real-time PCR assay for the mip gene of Legionella pneumophila was tested with 27 isolates of L. pneumophila, 20 isolates of 14 other Legionella species, and 103 non-Legionella bacteria. Eight culture-positive and 40 culture-negative clinical specimens were tested. This assay was 100% sensitive and 100% specific for L. pneumophila.

  2. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases.

    Science.gov (United States)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-11-17

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain samples from two brain regions from Alzheimer's disease (AD), Parkinson's disease (PD), Multiple System Atrophy, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori validation of RGs for RT-qPCR studies.

  3. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues

    Directory of Open Access Journals (Sweden)

    Lauralie Mangeot-Peter

    2016-09-01

    Full Text Available Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L., whose tissues (isolated bast fibres and core are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  4. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues.

    Science.gov (United States)

    Mangeot-Peter, Lauralie; Legay, Sylvain; Hausman, Jean-Francois; Esposito, Sergio; Guerriero, Gea

    2016-09-15

    Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L.), whose tissues (isolated bast fibres and core) are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  5. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  6. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  7. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  8. Influence of heavy metals on rhizosphere microbial communities of Siam weed (Chromolaena odorata (L. using a 16S rRNA gene amplicon sequencing approach

    Directory of Open Access Journals (Sweden)

    Thanyaporn Ruangdech

    2017-06-01

    Full Text Available A 16S rRNA amplicon sequencing approach was used to assess the impacts of cadmium (Cd and zinc (Zn contamination on populations of rhizobacteria on Siam weed (Chromolaena odorata (L.. Bacterial communities were characterized using the Illumina MiSeq platform and the V6 hypervariable region of the 16S rRNA gene. Among the 54,026 unique operational taxonomic units (OTUs identified, 99.7% were classified as bacteria and the rest were classified as archaea. Several dominant bacterial phyla were observed in all samples—Proteobacteria, Actinobacteria, Acidobacteria, Firmicutes and Bacteroidetes. These five phyla accounted for 89.2% of all OTUs identified among all sites, and only two OTUs could not be classified to a phylum. Comparison among samples containing low and high levels of Cd contamination using nonparametric Shannon and Shannon diversity indices showed that soils with low levels of diversity had a higher level of Cd (p < 0.05. These results indicated that levels of Cd may significantly alter bacterial species selection. The Cd- and Zn-resistant bacteria from each sample were subjected to heavy-metal minimum inhibitory concentration (MIC analyses. The MIC values obtained from 1152 isolates were used to individually analyze the pattern of gene function using the BioNumerics software. The results of this analysis showed that 26.7% of the bacteria were resistant to Cd concentrations up to 320 mg/L and only 2.3% of bacteria were resistant to Zn at concentrations up to 3200 mg/L. The MIC analyses indicated that the number of resistant bacteria decreased with increasing metal concentrations and those bacteria resistant to Cd and Zn may contain more than one group of metal-resistance genes.

  9. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  10. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  11. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  12. Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-06-01

    Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the qPCR

  13. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  14. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    OpenAIRE

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacter...

  15. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Directory of Open Access Journals (Sweden)

    Dawyndt Peter

    2010-01-01

    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  16. From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

    Science.gov (United States)

    Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

    2010-01-30

    Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

  17. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Science.gov (United States)

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  18. Whole-Cell MALDI-TOF MS Versus 16S rRNA Gene Analysis for Identification and Dereplication of Recurrent Bacterial Isolates

    Directory of Open Access Journals (Sweden)

    Michal Strejcek

    2018-06-01

    Full Text Available Many ecological experiments are based on the extraction and downstream analyses of microorganisms from different environmental samples. Due to its high throughput, cost-effectiveness and rapid performance, Matrix Assisted Laser Desorption/Ionization Mass Spectrometry with Time-of-Flight detector (MALDI-TOF MS, which has been proposed as a promising tool for bacterial identification and classification, could be advantageously used for dereplication of recurrent bacterial isolates. In this study, we compared whole-cell MALDI-TOF MS-based analyses of 49 bacterial cultures to two well-established bacterial identification and classification methods based on nearly complete 16S rRNA gene sequence analyses: a phylotype-based approach, using a closest type strain assignment, and a sequence similarity-based approach involving a 98.65% sequence similarity threshold, which has been found to best delineate bacterial species. Culture classification using reference-based MALDI-TOF MS was comparable to that yielded by phylotype assignment up to the genus level. At the species level, agreement between 16S rRNA gene analysis and MALDI-TOF MS was found to be limited, potentially indicating that spectral reference databases need to be improved. We also evaluated the mass spectral similarity technique for species-level delineation which can be used independently of reference databases. We established optimal mass spectral similarity thresholds which group MALDI-TOF mass spectra of common environmental isolates analogically to phylotype- and sequence similarity-based approaches. When using a mass spectrum similarity approach, we recommend a mass range of 4–10 kDa for analysis, which is populated with stable mass signals and contains the majority of phylotype-determining peaks. We show that a cosine similarity (CS threshold of 0.79 differentiate mass spectra analogously to 98.65% species-level delineation sequence similarity threshold, with corresponding precision

  19. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  20. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Science.gov (United States)

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  1. Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

    Directory of Open Access Journals (Sweden)

    Huali Huang

    Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

  2. Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

    Science.gov (United States)

    Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

    2013-01-01

    Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

  3. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  4. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

    Directory of Open Access Journals (Sweden)

    Liang Rubing

    2010-08-01

    Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

  5. Early diagnosis of typhoid fever by nested PCR for flagellin gene of Salmonella enterica serotype Typhi.

    Science.gov (United States)

    Khan, S; Harish, B N; Menezes, G A; Acharya, N S; Parija, S C

    2012-11-01

    Typhoid fever caused by Salmonella Typhi continues to be a major health problem in spite of the use of antibiotics and the development of newer antibacterial drugs. Inability to make an early laboratory diagnosis and resort to empirical therapy, often lead to increased morbidity and mortality in cases of typhoid fever. This study was aimed to optimize a nested PCR for early diagnosis of typhoid fever and using it as a diagnostic tool in culture negative cases of suspected typhoid fever. Eighty patients with clinical diagnosis of typhoid fever and 40 controls were included in the study. The blood samples collected were subjected to culture, Widal and nested PCR targeting the flagellin gene of S. Typhi. The sensitivity of PCR on blood was found to be 100 per cent whereas the specificity was 76.9 per cent. The positive predictive value (PPV) of PCR was calculated to be 76.9 per cent with an accuracy of 86 per cent. None of the 40 control samples gave a positive PCR. Due to its high sensitivity and specificity nested PCR can be used as a useful tool to diagnose clinically suspected, culture negative cases of typhoid fever.

  6. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  7. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  8. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  9. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Mannalamkunnath Alikunhi, Nabeel; Batang, Zenon B.; AlJahdali, Haitham A.; Aziz, Mohammed A.M.; Al-Suwailem, Abdulaziz M.

    2016-01-01

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  10. Culture-dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Nabeel M. Alikunhi

    2017-09-01

    Full Text Available Fish contamination has been extensively investigated along the Saudi coasts, but studies pertaining to bacterial pathogens are scarce. We conducted qualitative assessment and molecular identification of culture-dependent bacteria in 13 fish species from three coastal sites and a local fish market in Jeddah, Saudi Arabia. Bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac, Eosin Methylene Blue (EMB and Thiosulfate Citrate Bile Salts (TCBS culture media. Bacterial counts significantly differed between species, sources and feeding habits of examined fishes. Mugil cephalus exhibited higher counts on TCBS (all body parts, Mac (gills, muscle and gut and EMB (gills and muscle. Fishes from Area I had higher bacterial loads, coinciding with those in seawater and sediment from the same site, indicating direct association between habitat conditions and the levels of bacterial contamination. By feeding habit, detritivorous fish harbored higher counts than herbivorous and carnivorous species. Bacterial counts of skin were higher in fish from market than field sites, and positively correlated with other body parts indicating the relation of surface bacterial load on the overall quality of fish. Rahnella aquatilis (Enterobacteriaceae and Photobacterium damselae (Vibrionaceae were among the dominant species from fish muscle based on 16S rRNA sequencing. These species are known human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens, e.g. Hafnia sp. (Enterobacteriaceae and Pseudomonas stutzeri (Pseudomonadaceae also occurred in fish muscle. The inclusion of bacterial contamination in future monitoring efforts is thus crucial.

  11. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.

    2016-05-27

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  12. Characterization of 16S rRNA genes from oil field microbial communities indicates the presence of a variety of sulfate-reducing, fermentative, and sulfide-oxidizing bacteria.

    Science.gov (United States)

    Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D

    1996-05-01

    Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira, Arcobacter, Campylobacter, and Oceanospirillum spp.) were also detected. The first two were prominently amplified from uncultured production water DNA and represented 28 and 47% of all clones, respectively. Growth on media containing sulfide as the electron donor and nitrate as the electron acceptor and designed for the isolation of Thiomicrospira spp. gave only significant enrichment of the Campylobacter sp., which was shown to be present in different western Canadian oil fields. This newly discovered sulfide oxidizer may provide a vital link in the oil field sulfur cycle by reoxidizing sulfide formed by microbial sulfate or sulfur reduction.

  13. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...... results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial...

  14. 16S rRNA gene-based association study identified microbial taxa associated with pork intramuscular fat content in feces and cecum lumen.

    Science.gov (United States)

    Fang, Shaoming; Xiong, Xingwei; Su, Ying; Huang, Lusheng; Chen, Congying

    2017-07-19

    Intramuscular fat (IMF) that deposits among muscle fibers or within muscle cells is an important meat quality trait in pigs. Previous studies observed the effects of dietary nutrients and additives on improving the pork IMF. Gut microbiome plays an important role in host metabolism and energy harvest. Whether gut microbiota exerts effect on IMF remains unknown. In this study, we investigated the microbial community structure of 500 samples from porcine cecum and feces using high-throughput 16S rRNA gene sequencing. We found that phylogenetic composition and potential function capacity of microbiome varied between two types of samples. Bacteria wide association study identified 119 OTUs significantly associated with IMF in the two types of samples (FDR microbiome associated with IMF might be caused by the IMF-associated microbial taxa. This study firstly evaluated the contribution of gut microbiome to porcine IMF content. The results presented a potential capacity for improving IMF through modulating gut microbiota.

  15. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    Directory of Open Access Journals (Sweden)

    Yu Wang

    2016-01-01

    Full Text Available A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  16. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  17. DIVERSITY OF THE TYPE 1 INTRON-ITS REGION OF THE 18S rRNA GENE IN PSEUDOGYMNOASCUS SPECIES FROM THE RED HILLS OF KANSAS.

    Science.gov (United States)

    Chen, Xi; Crupper, Scott S

    2016-09-01

    Gypsum caves found throughout the Red Hills of Kansas have the state's most diverse and largest population of cave-roosting bats. White-nose syndrome (WNS), a disease caused by the fungus Pseudogymnoascus destructans, which threatens all temperate bat species, has not been previously detected in the gypsum caves as this disease moves westward from the eastern United States. Cave soil was obtained from the gypsum caves, and using the polymerase chain reaction, a 624-nucleotide DNA fragment specific to the Type 1 intron-internal transcribed spacer region of the 18S rRNA gene from Pseudogymnoascus species was amplified. Subsequent cloning and DNA sequencing indicated P. destructans DNA was present, along with 26 uncharacterized Pseudogymnoascus DNA variants. However, no evidence of WNS was observed in bat populations residing in these caves.

  18. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  19. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination.

    Science.gov (United States)

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.

  20. Segal’s Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project

    Directory of Open Access Journals (Sweden)

    James B. Pettengill

    2017-06-01

    Full Text Available Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella, we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria, respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb. These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species, but it was surprising how often methods differ in classifying reads—even at higher taxonomic ranks (e.g., family. This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal’s Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype.

  1. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    Science.gov (United States)

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  2. Expression Stabilities of Ten Candidate Reference Genes for RT-qPCR in Zanthoxylum bungeanum Maxim.

    Science.gov (United States)

    Fei, Xitong; Shi, Qianqian; Yang, Tuxi; Fei, Zhaoxue; Wei, Anzhi

    2018-03-30

    Real-time reverse transcription quantitative PCR has become a common method for studying gene expression, however, the optimal selection of stable reference genes is a prerequisite for obtaining accurate quantification of transcript abundance. Suitable reference genes for RT-qPCR have not yet been identified for Chinese prickly ash ( Zanthoxylum bungeanum Maxim.). Chinese prickly ash is the source of an important food seasoning in China. In recent years, Chinese prickly ash has also been developed as a medicinal plant. The expression stabilities of ten genes ( 18S , 28S , EF , UBA , UBQ , TIF , NTB , TUA , RPS , and TIF5A ) were evaluated in roots, stems, leaves, flowers and fruits at five developmental stages and also under stress from cold, drought, and salt. To do this we used three different statistical algorithms: geNorm, NormFinder and BestKeeper. Among the genes investigated, UBA and UBQ were found to be most stable for the different cultivars and different tissues examined, UBQ and TIF for fruit developmental stage. Meanwhile, EF and TUA were most stable under cold treatment, EF and UBQ under drought treatment and NTB and RPS under salt treatment. UBA and UBQ for all samples evaluated were most stably expressed, but 18S , TUA and RPS were found to be generally unreliable as reference genes. Our results provide a basis for the future selection of reference genes for biological research with Chinese prickly ash, under a variety of conditions.

  3. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia

    Directory of Open Access Journals (Sweden)

    Serena Joaquín

    2009-06-01

    Full Text Available Abstract Background Studies of gene expression in experimental cerebral ischaemia models can contribute to understanding the pathophysiology of brain ischaemia and to identifying prognostic markers and potential therapeutic targets. The normalization of relative qRT-PCR data using a suitable reference gene is a crucial prerequisite for obtaining reliable conclusions. No validated housekeeping genes have been reported for the relative quantification of the mRNA expression profile activated in in-vitro ischaemic conditions, whereas for the in-vivo model different reference genes have been used. The present study aims to determine the expression stability of ten housekeeping genes (Gapdh, β2m, Hprt, Ppia, Rpl13a, Oaz1, 18S rRNA, Gusb, Ywhaz and Sdha to establish their suitability as control genes for in-vitro and in-vivo cerebral ischaemia models. Results The expression stability of the candidate reference genes was evaluated using the 2-ΔC'T method and ANOVA followed by Dunnett's test. For the in-vitro model using primary cultures of rat astrocytes, all genes analysed except for Rpl13a and Sdha were found to have significantly different levels of mRNA expression. These different levels were also found in the case of the in-vivo model of pMCAO in rats except for Hprt, Sdha and Ywhaz mRNA, where the expression did not vary. Sdha and Ywhaz were identified by geNorm and NormFinder as the two most stable genes. Conclusion We have validated endogenous control genes for qRT-PCR analysis of gene expression in in-vitro and in-vivo cerebral ischaemia models. For normalization purposes, Rpl13a and Sdha are found to be the most suitable genes for the in-vitro model and Sdha and Ywhaz for the in-vivo model. Genes previously used as housekeeping genes for the in-vivo model in the literature were not validated as good control genes in the present study, showing the need for careful evaluation for each new experimental setup.

  4. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  5. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  6. Identification of Acinetobacter baumannii of Human and Animal Origins by a Gene-Specific PCR.

    Science.gov (United States)

    Hamouda, Ahmed

    2017-09-01

    Acinetobacter baumannii is a notorious nosocomial pathogen known for its ability to cause severe infections, especially in intensive care units. The identification of a conserved gene encoding a hypothetical protein in A. baumannii isolates but not in other Acinetobacter species during a comparative genomic analysis was reported. For the purpose of this study, we call this gene, A.b_hyp gene. The aim of this study was to report the results of screening for the presence of the A.b_hyp gene in a worldwide collection of well-characterized A. baumannii collected from clinical and animal specimens. A total of 83 clinical, animal, and type strains were used. These comprised 73 A. baumannii isolates of clinical (n = 60) and animal origin (n = 13), and ten type strains, including a positive control strain, A. baumannii ATCC 19606. All isolates were examined by PCR amplification of the A.b_hyp gene. The A.b_hyp gene was detected in 72 isolates (99%) of A. baumannii but one clinical isolate failed to produce an amplicon. The control strain, A. baumannii ATCC 19606, was also positive for this gene. No bands were detected in non-A. baumannii species and therefore the isolates are thought to be negative for the gene. No bands were detected in non-A. baumannii isolates and therefore they are thought to be negative for the gene. The PCR A.b_ hyp method provides evidence that detection of this gene can be used as a reliable, easy, and low-cost biomarker for A. baumannii identification.

  7. Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

    Directory of Open Access Journals (Sweden)

    Ashton Kevin J

    2010-04-01

    Full Text Available Abstract Background Elasmobranch fishes are an ancient group of vertebrates which have high potential as model species for research into evolutionary physiology and genomics. However, no comparative studies have established suitable reference genes for quantitative PCR (qPCR in elasmobranchs for any physiological conditions. Oxygen availability has been a major force shaping the physiological evolution of vertebrates, especially fishes. Here we examined the suitability of 9 reference candidates from various functional categories after a single hypoxic insult or after hypoxia preconditioning in epaulette shark (Hemiscyllium ocellatum. Results Epaulette sharks were caught and exposed to hypoxia. Tissues were collected from 10 controls, 10 individuals with single hypoxic insult and 10 individuals with hypoxia preconditioning (8 hypoxic insults, 12 hours apart. We produced sequence information for reference gene candidates and monitored mRNA expression levels in four tissues: cerebellum, heart, gill and eye. The stability of the genes was examined with analysis of variance, geNorm and NormFinder. The best ranking genes in our study were eukaryotic translation elongation factor 1 beta (eef1b, ubiquitin (ubq and polymerase (RNA II (DNA directed polypeptide F (polr2f. The performance of the ribosomal protein L6 (rpl6 was tissue-dependent. Notably, in one tissue the analysis of variance indicated statistically significant differences between treatments for genes that were ranked as the most stable candidates by reference gene software. Conclusions Our results indicate that eef1b and ubq are generally the most suitable reference genes for the conditions and tissues in the present epaulette shark studies. These genes could also be potential reference gene candidates for other physiological studies examining stress in elasmobranchs. The results emphasise the importance of inter-group variation in reference gene evaluation.

  8. RT-qPCR normalization genes in the red alga Chondrus crispus.

    Directory of Open Access Journals (Sweden)

    Nathalie Kowalczyk

    Full Text Available Chondrus crispus is a common red macroalga living on the rocky shores of the North Atlantic Ocean. It has a long research history, being a major source of carrageenan, a thickener widely used in the food industry, but also for physiological and ecological studies. To establish it as a model for red algae, its genome has been sequenced, allowing the development of molecular tools such as quantification of gene expression, including RNAseq and RT-qPCR. To determine appropriate genes for RT-qPCR normalization, the expression of 14 genes was monitored in 18 conditions using two sets of algal samples: samples from the sequenced strain, cultured and stressed in laboratory conditions and C. crispus collected on the shore and stressed in situ. The expression stability of the genes between the samples was evaluated by comparing the Ct range and using the programs geNorm and NormFinder. The candidate genes encoded translation related proteins (initiation factors IF4A-1 and IF4A-2, elongation factor EF1α and eRF3, an eukaryotic polypeptide chain release factor, cytoskeleton proteins (two β-tubulins, α-tubulin and actin, enzymes involved in the pentose phosphate pathway (glucose 6-phosphate deshydrogenase, protein recycling process (ubiquitin and ubiquitin-conjugating enzyme and glycolysis (isocitrate dehydrogenase. The two sets of samples showed different expression patterns. Most of the genes were stable in the algae cultivated in the laboratory, whereas environmental samples showed a more important variation in gene expression. When analyzing the two sets separately, the ranking of the most stables genes were different from one method to another. When considering all samples, the two statistical methods were concordant, revealing translation initiation factor 4A-2 and eukaryotic polypeptide chain release factor 3 as pertinent normalization genes. This study highlights thus the importance of testing reference genes according to the experiments as well

  9. 16S rRNA gene-based molecular analysis of mat-forming and accompanying bacteria covering organically-enriched marine sediments underlying a salmon farm in Southern Chile (Calbuco Island)

    OpenAIRE

    Aranda, Carlos; Paredes, Javier; Valenzuela, Cristian; Lam, Phyllis; Guillou, Laure

    2010-01-01

    The mat forming bacteria covering organic matter-enriched and anoxic marine sediments underlying a salmon farm in Southern Chile, were examined using 16S rRNA gene phylogenies. This mat was absent in the sea bed outside the direct influence of the farm (360 m outside fish cages). Based on nearly complete 16S rRNA gene sequences (-1500 bp), mat-forming filamentous cells were settled as the sulphur-oxidizing and putatively dissimilative nitrate-reducing Beggiatoa spp., being closely related (up...

  10. Real-time PCR quantification of human complement C4A and C4B genes

    Directory of Open Access Journals (Sweden)

    Fust George

    2006-01-01

    Full Text Available Abstract Background The fourth component of human complement (C4, an essential factor of the innate immunity, is represented as two isoforms (C4A and C4B in the genome. Although these genes differ only in 5 nucleotides, the encoded C4A and C4B proteins are functionally different. Based on phenotypic determination, unbalanced production of C4A and C4B is associated with several diseases, such as systemic lupus erythematosus, type 1 diabetes, several autoimmune diseases, moreover with higher morbidity and mortality of myocardial infarction and increased susceptibility for bacterial infections. Despite of this major clinical relevance, only low throughput, time and labor intensive methods have been used so far for the quantification of C4A and C4B genes. Results A novel quantitative real-time PCR (qPCR technique was developed for rapid and accurate quantification of the C4A and C4B genes applying a duplex, TaqMan based methodology. The reliable, single-step analysis provides the determination of the copy number of the C4A and C4B genes applying a wide range of DNA template concentration (0.3–300 ng genomic DNA. The developed qPCR was applied to determine C4A and C4B gene dosages in a healthy Hungarian population (N = 118. The obtained data were compared to the results of an earlier study of the same population. Moreover a set of 33 samples were analyzed by two independent methods. No significant difference was observed between the gene dosages determined by the employed techniques demonstrating the reliability of the novel qPCR methodology. A Microsoft Excel worksheet and a DOS executable are also provided for simple and automated evaluation of the measured data. Conclusion This report describes a novel real-time PCR method for single-step quantification of C4A and C4B genes. The developed technique could facilitate studies investigating disease association of different C4 isotypes.

  11. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Genotyping of the Holstein-Friesian crossbred cattle for CD18 gene using PCR-RFLP

    Directory of Open Access Journals (Sweden)

    A. S. Khade

    2014-05-01

    Full Text Available Aim: The present study was undertaken in Holstein-Friesian (HF crossbred cattle with the objective to find out genotype of HF crossbred cattle for Bovine Leucocyte Adhesion Deficiency (BLAD by using PCR-RFLP. Materials and Methods: 50 blood samples were collected from HF crossbred cattle and subjected to PCR. The amplified PCR products were digested using Taq I restriction enzyme at 65 oC overnight. After restriction digestion, the final PCR products were electrophoresed on 2.5 % agarose gel. Results: All the 50 animals under present investigation were found to be normal as the amplified PCR product upon digestion with Taq I restriction enzyme, revealed two bands of 313 bp and 54 bp for normal animals. Conclusions: In the present investigation D128G carrier frequency was found to be 0 %. However, recent reports suggest that the mutant gene has already been observed in the HF crossbred cattle population of India, which makes it necessary to screen the animals to avoid the risk of spreading BLAD in the breeding cattle population.

  13. Recommended Reference Genes for Quantitative PCR Analysis in Soybean Have Variable Stabilities during Diverse Biotic Stresses.

    Directory of Open Access Journals (Sweden)

    Raman Bansal

    Full Text Available For real-time reverse transcription-PCR (qRT-PCR in soybean, reference genes in different tissues, developmental stages, various cultivars, and under stress conditions have been suggested but their usefulness for research on soybean under various biotic stresses occurring in North-Central U.S. is not known. Here, we investigated the expression stabilities of ten previously recommended reference genes (ABCT, CYP, EF1A, FBOX, GPDH, RPL30, TUA4, TUB4, TUA5, and UNK2 in soybean under biotic stress from Bean pod mottle virus (BPMV, powdery mildew (PMD, soybean aphid (SBA, and two-spotted spider mite (TSSM. BPMV, PMD, SBA, and TSSM are amongst the most common pest problems on soybean in North-Central U.S. and other regions. Reference gene stability was determined using three software algorithms (geNorm, NormFinder, BestKeeper and a web-based tool (RefFinder. Reference genes showed variability in their expression as well as stability across various stressors and the best reference genes were stress-dependent. ABCT and FBOX were found to be the most stable in soybean under both BPMV and SBA stress but these genes had only minimal to moderate stability during PMD and TSSM stress. Expression of TUA4 and CYP was found to be most stable during PMD stress; TUB4 and TUA4 were stable under TSSM stress. Under various biotic stresses on soybean analyzed, GPDH expression was found to be consistently unstable. For all biotic stressors on soybean, we obtained pairwise variation (V2/3 values less than 0.15 which suggested that combined use of the two most stable reference genes would be sufficient for normalization. Further, we demonstrated the utility of normalizing the qRT-PCR data for target genes using the most stable reference genes validated in current study. Following of the recommendations from our current study will enable an accurate and reliable normalization of qRT-PCR data in soybean under biotic stress.

  14. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  15. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  16. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  17. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  18. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  19. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  20. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  1. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  2. Abundance and activity of 16S rRNA, amoA and nifH bacterial genes during assisted phytostabilization of mine tailings

    Science.gov (United States)

    Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2014-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings. PMID:25495940

  3. Abundance and Activity of 16S rRNA, AmoA and NifH Bacterial Genes During Assisted Phytostabilization of Mine Tailings.

    Science.gov (United States)

    Nelson, Karis N; Neilson, Julia W; Root, Robert A; Chorover, Jon; Maier, Raina M

    2015-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings.

  4. 16S rRNA and Omp31 Gene Based Molecular Characterization of Field Strains of B. melitensis from Aborted Foetus of Goats in India

    Science.gov (United States)

    Singh, Ajay; Gupta, Vivek Kumar; Kumar, Amit; Singh, Vikas Kumar; Nayakwadi, Shivasharanappa

    2013-01-01

    Brucellosis is a reemerging infectious zoonotic disease of worldwide importance. In human, it is mainly caused by Brucella melitensis, a natural pathogen for goats. In India, a large number of goats are reared in semi-intensive to intensive system within the close vicinity of human being. At present, there is no vaccination and control strategy for caprine brucellosis in the country. Thus, to formulate an effective control strategy, the status of etiological agent is essential. To cope up with these, the present study was conducted to isolate and identify the prevalent Brucella species in caprine brucellosis in India. The 30 samples (fetal membrane, fetal stomach content and vaginal swabs) collected throughout India from the aborted fetus of goats revealed the isolation of 05 isolates all belonging to Brucella melitensis biovars 3. All the isolates produced amplification products of 1412 and 720 bp in polymerase chain reaction with genus and species specific 16S rRNA and omp31 gene based primers, respectively. Moreover, the amplification of omp31 gene in all the isolates confirmed the presence of immuno dominant outer membrane protein (31 kDa omp) in all the field isolates of B. melitensis in aborted foetus of goats in India. These findings can support the development of omp31 based specific serodiagnostic test as well as vaccine for the control of caprine brucellosis in India. PMID:24453799

  5. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  6. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  7. Detection of Shiga toxins genes by Multiplex PCR in clinical samples

    Directory of Open Access Journals (Sweden)

    2013-09-01

    Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

  8. Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.

    Science.gov (United States)

    Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco

    2016-12-27

    In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.

  9. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  10. PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

    Directory of Open Access Journals (Sweden)

    Zohreh Ebrahimvandi

    2014-07-01

    Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.

  11. Comparison of toxicity neutralization-, ELISA- and PCR tests for typing of Clostridium perfringens and detection of the enterotoxin gene by PCR

    DEFF Research Database (Denmark)

    Møller, Kristian; Ahrens, Peter

    1996-01-01

    A polymerase chain reaction (PCR) was developed for the specific amplification of a part of each of the five Clostridium perfringens toxin genes: alpha (alpha), beta (beta), epsilon (epsilon), iota (iota), and enterotoxin (CPE). While the toxicity neutralization test (TNT) only showed limited...

  12. Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

    Science.gov (United States)

    Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

    2013-01-01

    Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

  13. Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

    Directory of Open Access Journals (Sweden)

    Daochen Zhu

    Full Text Available BACKGROUND: Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. METHODOLOGY/PRINCIPAL FINDINGS: Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. CONCLUSIONS: This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

  14. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1994-01-01

    From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  15. De novo clustering methods outperform reference-based methods for assigning 16S rRNA gene sequences to operational taxonomic units

    Directory of Open Access Journals (Sweden)

    Sarah L. Westcott

    2015-12-01

    Full Text Available Background. 16S rRNA gene sequences are routinely assigned to operational taxonomic units (OTUs that are then used to analyze complex microbial communities. A number of methods have been employed to carry out the assignment of 16S rRNA gene sequences to OTUs leading to confusion over which method is optimal. A recent study suggested that a clustering method should be selected based on its ability to generate stable OTU assignments that do not change as additional sequences are added to the dataset. In contrast, we contend that the quality of the OTU assignments, the ability of the method to properly represent the distances between the sequences, is more important.Methods. Our analysis implemented six de novo clustering algorithms including the single linkage, complete linkage, average linkage, abundance-based greedy clustering, distance-based greedy clustering, and Swarm and the open and closed-reference methods. Using two previously published datasets we used the Matthew’s Correlation Coefficient (MCC to assess the stability and quality of OTU assignments.Results. The stability of OTU assignments did not reflect the quality of the assignments. Depending on the dataset being analyzed, the average linkage and the distance and abundance-based greedy clustering methods generated OTUs that were more likely to represent the actual distances between sequences than the open and closed-reference methods. We also demonstrated that for the greedy algorithms VSEARCH produced assignments that were comparable to those produced by USEARCH making VSEARCH a viable free and open source alternative to USEARCH. Further interrogation of the reference-based methods indicated that when USEARCH or VSEARCH were used to identify the closest reference, the OTU assignments were sensitive to the order of the reference sequences because the reference sequences can be identical over the region being considered. More troubling was the observation that while both USEARCH and

  16. Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

    Science.gov (United States)

    Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

    2017-04-01

    Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

  17. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.

    Science.gov (United States)

    Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein

    2015-12-01

    Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    Science.gov (United States)

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  19. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  20. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    Directory of Open Access Journals (Sweden)

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  1. Normalizing gene expression by quantitative PCR during somatic embryogenesis in two representative conifer species: Pinus pinaster and Picea abies.

    Science.gov (United States)

    de Vega-Bartol, José J; Santos, Raquen Raissa; Simões, Marta; Miguel, Célia M

    2013-05-01

    Suitable internal control genes to normalize qPCR data from different stages of embryo development and germination were identified in two representative conifer species. Clonal propagation by somatic embryogenesis has a great application potentiality in conifers. Quantitative PCR (qPCR) is widely used for gene expression analysis during somatic embryogenesis and embryo germination. No single reference gene is universal, so a systematic characterization of endogenous genes for concrete conditions is fundamental for accuracy. We identified suitable internal control genes to normalize qPCR data obtained at different steps of somatic embryogenesis (embryonal mass proliferation, embryo maturation and germination) in two representative conifer species, Pinus pinaster and Picea abies. Candidate genes included endogenous genes commonly used in conifers, genes previously tested in model plants, and genes with a lower variation of the expression along embryo development according to genome-wide transcript profiling studies. Three different algorithms were used to evaluate expression stability. The geometric average of the expression values of elongation factor-1α, α-tubulin and histone 3 in P. pinaster, and elongation factor-1α, α-tubulin, adenosine kinase and CAC in P. abies were adequate for expression studies throughout somatic embryogenesis. However, improved accuracy was achieved when using other gene combinations in experiments with samples at a single developmental stage. The importance of studies selecting reference genes to use in different tissues or developmental stages within one or close species, and the instability of commonly used reference genes, is highlighted.

  2. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

    Science.gov (United States)

    Masud, Rizwan; Qureshi, Irfan Zia

    2011-09-01

    Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

  3. Quantitative analysis of the dystrophin gene by real-time PCR

    Directory of Open Access Journals (Sweden)

    Maksimovic Nela

    2012-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD/BMD are severe X-linked neuromuscular disorders caused by mutations in the dystrophin gene. Our aim was to optimize a quantitative real-time PCR method based on SYBR® Green I chemistry for routine diagnostics of DMD/BMD deletion carriers. Twenty female relatives of DMD/BMD patients with previously detected partial gene deletions were studied. The relative quantity of the target exons was calculated by a comparative threshold cycle method (ΔΔCt. The carrier status of all subjects was successfully determined. The gene dosage ratio for non-carriers was 1.07±0.20, and for carriers 0.56±0.11. This assay proved to be simple, rapid, reliable and cost-effective.

  4. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  5. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    Science.gov (United States)

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  6. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  7. The ITS1-5.8S rRNA gene -ITS2 sequence variability during the divergence of sweet-grass species (gen us Glyceria R. Br.

    Directory of Open Access Journals (Sweden)

    Alexander V Rodionov

    2011-12-01

    Full Text Available Comparative analysis of the sequence ITS1-5.8S rRNA gene-ITS2 of the nuclear genome of 13 species of genus Glyceria, 4 species of Melica and a species of monotypic genus Pleuropogon showed that the species of the genus Glyceria have 3 haplotypes: 1 Haplotype A was found only in species of the subgenus Glyceria section Glyceria (G. septentrionalis, G. fluitans, G. declinata, G. occidentalis, G. notata, G. borealis, G. leptostachya and in Pleuropogon sabinii; 2 Haplotype C is characteristic of the subgenus Hydropoa, section Hydropoa (G. grandis, G. х amurensis, G. triflora, G. maxima and sect. Lithuanicae (G. leptolepis; 3 Haplotype B is found in the species of the subgenus Hydropoa sections Striatae (G. elata, G. striata, G. neogaea, G. canadensis, Scolochloiformes (G. alnasteretum, G. spiculosa and G. lithuanica of sect. Lithuanicae. Species carring haplotype B are located at the base of the phylogenetic tree of the genus Glyceria and/or clustered with low bootstrap indices. On the phylogenetic trees inferred by the analysis of the sequences ITS and 5.8S rDNA both sect. Glyceria and sect. Hydropoa represented two sister monophyly branches. The species Pleuropogon sabinii belong to the branch of subgenus Glyceria as a sister monotypic branch to the branch of the sect. Glyceria.

  8. Bacterial community composition in the gut content and ambient sediment of sea cucumber Apostichopus japonicus revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Fei Gao

    Full Text Available The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments.

  9. Influence of menstruation on the microbiota of healthy women's labia minora as analyzed using a 16S rRNA gene-based clone library method.

    Science.gov (United States)

    Shiraishi, Tsukasa; Fukuda, Kazumasa; Morotomi, Nobuo; Imamura, Yuri; Mishima, Junko; Imai, Shigeo; Miyazawa, Kiyoshi; Taniguchi, Hatsumi

    2011-01-01

    The aim of this study was to determine the influence of menstruation on the bacterial population of healthy Japanese women's vulvas, especially the labia minora. Labia minora swabs were obtained from 10 premenopausal, nonpregnant Japanese women at premenstruation and on day 2 of menstruation. Vaginal swabs were also obtained from 3 out of the 10 women. No significant difference was found in the average bacterial cell count between the menstruation and premenstruation samples. Molecular analysis using a 16S rRNA gene-based clone library method detected 22 genera from the labia minora swabs (total 20), with the genus Lactobacillus being predominant at both premenstruation and during menstruation in 7 out of the 10 women. Of the other 3 women, 2 showed various kinds of bacterial species, including oral and fecal bacteria, with Atopobium vaginae and Gardnerella vaginalis predominating in the remaining woman's vulva in both conditions. In total, 6 out of 10 cases (60%) showed significantly different microbiota of the labia minora between the two conditions. These results imply that menstruation may promote a distortion of the bacterial flora around the vulva, although it causes no significant increase of the bacterial count.

  10. A novel RNA binding surface of the TAM domain of TIP5/BAZ2A mediates epigenetic regulation of rRNA genes.

    Science.gov (United States)

    Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael

    2015-05-26

    The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. IDENTIFICATION OF A LOCAL PROBIOTIC BACTERIUM USING 16S rRNA GENE SEQUENCE THAT WAS USED FOR FIELD TRIAL TO ENHANCED WHITELEG SHRIMP (Litopenaeus vannamei SURVIVAL

    Directory of Open Access Journals (Sweden)

    Tb. Haeru Rahayu

    2015-12-01

    Full Text Available The use of local probiotics in the culture of aquatic organisms is increasing with the demand for more environmental-friendly aquaculture practices. The local bacterium isolate considered as a probiotic was added into the water of whiteleg shrimp (Litopenaeus vannamei culture in a field trial. Four rectangular plastic ponds (ca. 20 m x 30 m per pond were used for 100 days experimentation for six consecutive crops in two years experiment. Survival, harvest size, feed conversion ratio (FCR and Vibrio bacterial count was compared with those of shrimp receiving and none of local isolate. Identification based on 16S rRNA gene sequence shown those isolate was Bacillus pumilus strain DURCK14 with 99% homology. Water shrimp pond added a local isolate had significantly higher survival at about 10.0% to 11.7% than shrimp without added the isolate (p<0.05, and better FCR, but no significant different in shrimp harvest size. Vibrio bacterial was undetected by total plate count. Moreover, it shown better projected yields on an annual basis (three crops per year.

  12. High protists diversity in the plankton of sulfurous lakes and lagoons examined by 18s rRNA gene sequence analyses.

    Science.gov (United States)

    Triadó-Margarit, Xavier; Casamayor, Emilio O

    2015-12-01

    Diversity of small protists was studied in sulfidic and anoxic (euxinic) stratified karstic lakes and coastal lagoons by 18S rRNA gene analyses. We hypothesized a major sulfide effect, reducing protist diversity and richness with only a few specialized populations adapted to deal with low-redox conditions and high-sulfide concentrations. However, genetic fingerprinting suggested similar ecological diversity in anoxic and sulfurous than in upper oxygen rich water compartments with specific populations inhabiting euxinic waters. Many of them agreed with genera previously identified by microscopic observations, but also new and unexpected groups were detected. Most of the sequences matched a rich assemblage of Ciliophora (i.e., Coleps, Prorodon, Plagiopyla, Strombidium, Metopus, Vorticella and Caenomorpha, among others) and algae (mainly Cryptomonadales). Unidentified Cercozoa, Fungi, Stramenopiles and Discoba were recurrently found. The lack of GenBank counterparts was higher in deep hypolimnetic waters and appeared differentially allocated in the different taxa, being higher within Discoba and lower in Cryptophyceae. A larger number of populations than expected were specifically detected in the deep sulfurous waters, with unknown ecological interactions and metabolic capabilities. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Size Matters: Assessing Optimum Soil Sample Size for Fungal and Bacterial Community Structure Analyses Using High Throughput Sequencing of rRNA Gene Amplicons

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2016-06-01

    Full Text Available We examined the effect of different soil sample sizes obtained from an agricultural field, under a single cropping system uniform in soil properties and aboveground crop responses, on bacterial and fungal community structure and microbial diversity indices. DNA extracted from soil sample sizes of 0.25, 1, 5 and 10 g using MoBIO kits and from 10 and 100 g sizes using a bead-beating method (SARDI were used as templates for high-throughput sequencing of 16S and 28S rRNA gene amplicons for bacteria and fungi, respectively, on the Illumina MiSeq and Roche 454 platforms. Sample size significantly affected overall bacterial and fungal community structure, replicate dispersion and the number of operational taxonomic units (OTUs retrieved. Richness, evenness and diversity were also significantly affected. The largest diversity estimates were always associated with the 10 g MoBIO extractions with a corresponding reduction in replicate dispersion. For the fungal data, smaller MoBIO extractions identified more unclassified Eukaryota incertae sedis and unclassified glomeromycota while the SARDI method retrieved more abundant OTUs containing unclassified Pleosporales and the fungal genera Alternaria and Cercophora. Overall, these findings indicate that a 10 g soil DNA extraction is most suitable for both soil bacterial and fungal communities for retrieving optimal diversity while still capturing rarer taxa in concert with decreasing replicate variation.

  14. Rapid molecular characterization of Acinetobacter baumannii clones with rep-PCR and evaluation of carbapenemase genes by new multiplex PCR in Hospital District of Helsinki and Uusimaa.

    Directory of Open Access Journals (Sweden)

    Tanja Pasanen

    Full Text Available Multidrug-resistant Acinetobacter baumannii (MDRAB is an increasing problem worldwide. Prevalence of carbapenem resistance in Acinetobacter spp. due to acquired carbapenemase genes is not known in Finland. The purpose of this study was to examine prevalence and clonal spread of multiresistant A. baumannii group species, and their carbapenemase genes. A total of 55 Acinetobacter isolates were evaluated with repetitive PCR (DiversiLab to analyse clonality of isolates, in conjunction with antimicrobial susceptibility profile for ampicillin/sulbactam, colistin, imipenem, meropenem, rifampicin and tigecycline. In addition, a new real-time PCR assay, detecting most clinically important carbapenemase genes just in two multiplex reactions, was developed. The assay detects genes for KPC, VIM, IMP, GES-1/-10, OXA-48, NDM, GIM-1, SPM-1, IMI/NMC-A, SME, CMY-10, SFC-1, SIM-1, OXA-23-like, OXA-24/40-like, OXA-58 and ISAbaI-OXA-51-like junction, and allows confident detection of isolates harbouring acquired carbapenemase genes. There was a time-dependent, clonal spread of multiresistant A. baumannii strongly correlating with carbapenamase gene profile, at least in this geographically restricted study material. The new carbapenemase screening assay was able to detect all the genes correctly suggesting it might be suitable for epidemiologic screening purposes in clinical laboratories.

  15. Detection of a putative virulence cadF gene of Campylobacter jejuni obtained from different sources using a microfabricated PCR chip

    DEFF Research Database (Denmark)

    Poulsen, Claus Riber; El-Ali, Jamil; Perch-Nielsen, Ivan R.

    2005-01-01

    A microfabricated polymerase chain reaction (PCR) chip made of epoxy-based photoresist (SU-8) was recently designed and developed. In this study, we tested whether the PCR chip could be used for rapid detection of a potential virulence determinant, the cadF gene of Campylobacter jejuni. PCR...... was performed using published PCR conditions and primers for the C. jejuni cadF gene. DNA isolated from a C. jejuni reference strain CCUG 11284, C. jejuni isolates obtained from different sources (chicken and human), and Campylobacter whole cells were used as templates in the PCR tests. Conventional PCR in tube...... was used as the control. After optimization of the PCR chip, PCR positives on the chip were obtained from 91.0% (10/11) of the tested chips. A fast transition time was achieved with the PCR chip, and therefore a faster cycling time and a shorter PCR program were obtained. Using the PCR chip, the cadF gene...

  16. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

    Science.gov (United States)

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  17. Development of the Multiple Gene Knockout System with One-Step PCR in Thermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    Directory of Open Access Journals (Sweden)

    Shoji Suzuki

    2017-01-01

    Full Text Available Multiple gene knockout systems developed in the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius are powerful genetic tools. However, plasmid construction typically requires several steps. Alternatively, PCR tailing for high-throughput gene disruption was also developed in S. acidocaldarius, but repeated gene knockout based on PCR tailing has been limited due to lack of a genetic marker system. In this study, we demonstrated efficient homologous recombination frequency (2.8 × 104 ± 6.9 × 103 colonies/μg DNA by optimizing the transformation conditions. This optimized protocol allowed to develop reliable gene knockout via double crossover using short homologous arms and to establish the multiple gene knockout system with one-step PCR (MONSTER. In the MONSTER, a multiple gene knockout cassette was simply and rapidly constructed by one-step PCR without plasmid construction, and the PCR product can be immediately used for target gene deletion. As an example of the applications of this strategy, we successfully made a DNA photolyase- (phr- and arginine decarboxylase- (argD- deficient strain of S. acidocaldarius. In addition, an agmatine selection system consisting of an agmatine-auxotrophic strain and argD marker was also established. The MONSTER provides an alternative strategy that enables the very simple construction of multiple gene knockout cassettes for genetic studies in S. acidocaldarius.

  18. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available The glassy-winged sharpshooter (GWSS is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony, were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas. Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the

  19. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  20. Pre-amplification in the context of high-throughput qPCR gene expression experiment

    Czech Academy of Sciences Publication Activity Database

    Korenková, Vlasta; Scott, J.; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjoback, R.

    2015-01-01

    Roč. 16, č. 5 (2015) ISSN 1471-2199 R&D Projects: GA ČR(CZ) GAP304/12/1585; GA ČR(CZ) GA15-08239S; GA ČR GA13-02154S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : High-throughput qPCR * Gene expression * Exponential pre-amplification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.500, year: 2015

  1. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  2. Molecular quantification of environmental DNA using microfluidics and digital PCR.

    Science.gov (United States)

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2012-09-01

    Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.

  3. [Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

    Science.gov (United States)

    Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

    2015-02-01

    To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

  4. Selection of reliable reference genes for quantitative real-time PCR in human T cells and neutrophils

    Directory of Open Access Journals (Sweden)

    Ledderose Carola

    2011-10-01

    Full Text Available Abstract Background The choice of reliable reference genes is a prerequisite for valid results when analyzing gene expression with real-time quantitative PCR (qPCR. This method is frequently applied to study gene expression patterns in immune cells, yet a thorough validation of potential reference genes is still lacking for most leukocyte subtypes and most models of their in vitro stimulation. In the current study, we evaluated the expression stability of common reference genes in two widely used cell culture models-anti-CD3/CD28 activated T cells and lipopolysaccharide stimulated neutrophils-as well as in unselected untreated leukocytes. Results The mRNA expression of 17 (T cells, 7 (neutrophils or 8 (unselected leukocytes potential reference genes was quantified by reverse transcription qPCR, and a ranking of the preselected candidate genes according to their expression stability was calculated using the programs NormFinder, geNorm and BestKeeper. IPO8, RPL13A, TBP and SDHA were identified as suitable reference genes in T cells. TBP, ACTB and SDHA were stably expressed in neutrophils. TBP and SDHA were also the most stable genes in untreated total blood leukocytes. The critical impact of reference gene selection on the estimated target gene expression is demonstrated for IL-2 and FIH expression in T cells. Conclusions The study provides a shortlist of suitable reference genes for normalization of gene expression data in unstimulated and stimulated T cells, unstimulated and stimulated neutrophils and in unselected leukocytes.

  5. The Mitochondrial Genome of the Prasinophyte Prasinoderma coloniale Reveals Two Trans-Spliced Group I Introns in the Large Subunit rRNA Gene

    Science.gov (United States)

    Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude

    2013-01-01

    Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications

  6. The mitochondrial genome of the prasinophyte Prasinoderma coloniale reveals two trans-spliced group I introns in the large subunit rRNA gene.

    Directory of Open Access Journals (Sweden)

    Jean-François Pombert

    Full Text Available Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI, we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V. This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI. Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the

  7. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  8. PCR detection and identification of oral streptococci in saliva samples using gtf genes.

    Science.gov (United States)

    Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

    2004-03-01

    Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

  9. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Science.gov (United States)

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  10. Analysis of Dystrophin Gene Deletions by Multiplex PCR in Moroccan Patients

    Directory of Open Access Journals (Sweden)

    Aziza Sbiti

    2002-01-01

    Full Text Available Duchenne and Becker muscular dystrophy (DMD and BMD are X-linked diseases resulting from a defect in the dystrophin gene located on Xp21. DMD is the most frequent neuromuscular disease in humans (1/3500 male newborn. Deletions in the dystrophin gene represent 65% of mutations in DMD/BMD patients. We have analyzed DNA from 72 Moroccan patients with DMD/BMD using the multiplex polymerase chain reaction (PCR to screen for exon deletions within the dystrophin gene, and to estimate the frequency of these abnormalities. We found dystrophin gene deletions in 37 cases. Therefore the frequency in Moroccan DMD/BMD patients is about 51.3%. All deletions were clustered in the two known hot-spots regions, and in 81% of cases deletions were detected in the region from exon 43 to exon 52. These findings are comparable to those reported in other studies. It is important to note that in our population, we can first search for deletions of DMD gene in the most frequently deleted exons determined by this study. This may facilitate the molecular diagnosis of DMD and BMD in our country.

  11. Expression analysis of fusarium wilt resistance gene in melon by real-time quantitative pcr

    International Nuclear Information System (INIS)

    Wang, X.; Xu, B.; Zhao, L.; Gao, P.; Luan, F.

    2014-01-01

    Melon Actin gene was used as a reference gene, to explore the gene expression profiles of the Fom-2 gene in roots, stems, and leaves of melon MR-1 under induction by Fusarium oxysporum f. sp. melonis. Monitoring using real-time quantitative PCR showed similar accumulation patterns of Fom-2 in roots, stems, and leaves over the observation period of 1 to 11 days; the expression level in stems was the highest. The expression of the Fom-2 gene was strengthened by the prolongation of induction time. In stems, the expression of Fom-2 was 5.737 times higher than in the control at three days; in roots, expression of Fom-2 was 5.617 times higher than in the control at five days. Similarly, the expression of Fom-2 in leaves obviously increased. It was 4.441 times higher than in the control at 5 days. The expression of Fom-2 was non-tissue specific, up-regulated under induction by Fusarium, and related to early resistance to Fusarium wilt. (author)

  12. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quan