WorldWideScience

Sample records for rna pathogen detection

  1. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    Science.gov (United States)

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  2. Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

    International Nuclear Information System (INIS)

    Weng, X.; Jiang, H.; Li, D.

    2012-01-01

    We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

  3. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  4. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  5. Microfluidic PCR Amplification and MiSeq Amplicon Sequencing Techniques for High-Throughput Detection and Genotyping of Human Pathogenic RNA Viruses in Human Feces, Sewage, and Oysters

    Directory of Open Access Journals (Sweden)

    Mamoru Oshiki

    2018-04-01

    Full Text Available Detection and genotyping of pathogenic RNA viruses in human and environmental samples are useful for monitoring the circulation and prevalence of these pathogens, whereas a conventional PCR assay followed by Sanger sequencing is time-consuming and laborious. The present study aimed to develop a high-throughput detection-and-genotyping tool for 11 human RNA viruses [Aichi virus; astrovirus; enterovirus; norovirus genogroup I (GI, GII, and GIV; hepatitis A virus; hepatitis E virus; rotavirus; sapovirus; and human parechovirus] using a microfluidic device and next-generation sequencer. Microfluidic nested PCR was carried out on a 48.48 Access Array chip, and the amplicons were recovered and used for MiSeq sequencing (Illumina, Tokyo, Japan; genotyping was conducted by homology searching and phylogenetic analysis of the obtained sequence reads. The detection limit of the 11 tested viruses ranged from 100 to 103 copies/μL in cDNA sample, corresponding to 101–104 copies/mL-sewage, 105–108 copies/g-human feces, and 102–105 copies/g-digestive tissues of oyster. The developed assay was successfully applied for simultaneous detection and genotyping of RNA viruses to samples of human feces, sewage, and artificially contaminated oysters. Microfluidic nested PCR followed by MiSeq sequencing enables efficient tracking of the fate of multiple RNA viruses in various environments, which is essential for a better understanding of the circulation of human pathogenic RNA viruses in the human population.

  6. 16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque

    Directory of Open Access Journals (Sweden)

    Mahendra Jaideep

    2010-01-01

    Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.

  7. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Directory of Open Access Journals (Sweden)

    Boyang Cao

    Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  8. A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

  9. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  10. PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor

    Directory of Open Access Journals (Sweden)

    Leyla Esfandiari

    2016-07-01

    Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.

  11. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    Science.gov (United States)

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  12. Biosensors for plant pathogen detection.

    Science.gov (United States)

    Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben

    2017-07-15

    Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Nodeomics: pathogen detection in vertebrate lymph nodes using meta-transcriptomics.

    Directory of Open Access Journals (Sweden)

    Nicola E Wittekindt

    Full Text Available The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.

  14. Segal’s Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project

    Directory of Open Access Journals (Sweden)

    James B. Pettengill

    2017-06-01

    Full Text Available Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella, we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria, respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb. These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species, but it was surprising how often methods differ in classifying reads—even at higher taxonomic ranks (e.g., family. This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal’s Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype.

  15. Integrating large-scale data and RNA technology to protect crops from fungal pathogens

    Directory of Open Access Journals (Sweden)

    Ian Joseph Girard

    2016-05-01

    Full Text Available With a rapidly growing human population it is expected that plant science researchers and the agricultural community will need to increase food productivity using less arable land. This challenge is complicated by fungal pathogens and diseases, many of which can severely impact crop yield. Current measures to control fungal pathogens are either ineffective or have adverse effects on the agricultural enterprise. Thus, developing new strategies through research innovation to protect plants from pathogenic fungi is necessary to overcome these hurdles. RNA sequencing technologies are increasing our understanding of the underlying genes and gene regulatory networks mediating disease outcomes. The application of invigorating next generation sequencing strategies to study plant-pathogen interactions has and will provide unprecedented insight into the complex patterns of gene activity responsible for crop protection. However, questions remain about how biological processes in both the pathogen and the host are specified in space directly at the site of infection and over the infection period. The integration of cutting edge molecular and computational tools will provide plant scientists with the arsenal required to identify genes and molecules that play a role in plant protection. Large scale RNA sequence data can then be used to protect plants by targeting genes essential for pathogen viability in the production of stably transformed lines expressing RNA interference molecules, or through foliar applications of double stranded RNA.

  16. Matrix approach to the simultaneous detection of multiple potato pathogens by real-time PCR.

    Science.gov (United States)

    Nikitin, M M; Statsyuk, N V; Frantsuzov, P A; Dzhavakhiya, V G; Golikov, A G

    2018-03-01

    Create a method for highly sensitive, selective, rapid and easy-to-use detection and identification of economically significant potato pathogens, including viruses, bacteria and oomycetes, be it single pathogen, or a range of various pathogens occurring simultaneously. Test-systems for real-time PCR, operating in the unified amplification regime, have been developed for Phytophthora infestans, Pectobacterium atrosepticum, Dickeya dianthicola, Dickeya solani, Ralstonia solanacearum, Pectobacterium carotovorum, Clavibacter michiganensis subsp. sepedonicus, potato viruses Y (ordinary and necrotic forms as well as indiscriminative test system, detecting all forms), A, X, S, M, potato leaf roll virus, potato mop top virus and potato spindle tuber viroid. The test-systems (including polymerase and revertase) were immobilized and lyophilized in miniature microreactors (1·2 μl) on silicon DNA/RNA microarrays (micromatrices) to be used with a mobile AriaDNA ® amplifier. Preloaded 30-reaction micromatrices having shelf life of 3 and 6 months (for RNA- and DNA-based pathogens, respectively) at room temperature with no special conditions were successfully tested on both reference and field samples in comparison with traditional ELISA and microbiological methods, showing perfect performance and sensitivity (1 pg). The accurate, rapid and user-friendly diagnostic system in a micromatrix format may significantly contribute to pathogen screening and phytopathological studies. © 2018 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  17. Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

    Science.gov (United States)

    Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

    2015-03-01

    Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

  18. Differential Expression Analysis by RNA-Seq Reveals Perturbations in the Platelet mRNA Transcriptome Triggered by Pathogen Reduction Systems.

    Directory of Open Access Journals (Sweden)

    Abdimajid Osman

    Full Text Available Platelet concentrates (PCs are prepared at blood banks for transfusion to patients in certain clinical conditions associated with a low platelet count. To prevent transfusion-transmitted infections via PCs, different pathogen reduction (PR systems have been developed that inactivate the nucleic acids of contaminating pathogens by chemical cross-linking, a mechanism that may also affect platelets' nucleic acids. We previously reported that treatment of stored platelets with the PR system Intercept significantly reduced the level of half of the microRNAs that were monitored, induced platelet activation and compromised the platelet response to physiological agonists. Using genome-wide differential expression (DE RNA sequencing (RNA-Seq, we now report that Intercept markedly perturbs the mRNA transcriptome of human platelets and alters the expression level of >800 mRNAs (P<0.05 compared to other PR systems and control platelets. Of these, 400 genes were deregulated with DE corresponding to fold changes (FC ≥ 2. At the p-value < 0.001, as many as 147 genes were deregulated by ≥ 2-fold in Intercept-treated platelets, compared to none in the other groups. Finally, integrated analysis combining expression data for microRNA (miRNA and mRNA, and involving prediction of miRNA-mRNA interactions, disclosed several positive and inverse correlations between miRNAs and mRNAs in stored platelets. In conclusion, this study demonstrates that Intercept markedly deregulates the platelet mRNA transcriptome, concomitant with reduced levels of mRNA-regulatory miRNAs. These findings should enlighten authorities worldwide when considering the implementation of PR systems, that target nucleic acids and are not specific to pathogens, for the management of blood products.

  19. Waterborne Pathogens: Detection Methods and Challenges

    Directory of Open Access Journals (Sweden)

    Flor Yazmín Ramírez-Castillo

    2015-05-01

    Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.

  20. Detection of mRNA by reverse-transcription PCR as an indicator of viability in Phytophthora ramorum

    Science.gov (United States)

    A. Chimento; S.O. Cacciola; M. Garbelotto

    2011-01-01

    In the last few decades, the use of molecular tools has greatly improved the efficiency of plant disease diagnosis. However, one of the major setbacks of most molecular diagnostic approaches is their inability to differentiate between dead and viable pathogens. We propose a new strategy for the detection of plant pathogens, based on the use of mRNA as a viability...

  1. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  2. A novel multiplex PCR assay for simultaneous detection of nine clinically significant bacterial pathogens associated with bovine mastitis.

    Science.gov (United States)

    Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C

    2017-06-01

    For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4  CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Molecular detection of human bacterial pathogens

    National Research Council Canada - National Science Library

    Liu, Dongyou

    2011-01-01

    .... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...

  4. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy; Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Schembri, Mark A.; Sweet, Matthew J.

    2016-01-01

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  5. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy

    2016-01-24

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  6. Rapid Detection of miRNA Using Nucleic Acids-templated AgNCs

    DEFF Research Database (Denmark)

    Shah, Pratik

    . In the case of plants, the levels of certain miRNAs can be used as biomarkers to evaluate the physiological status. Specific miRNA levels are influenced by stresses such as drought, salt, cold, heat and pathogenic infestations. In humans, the dysregulation of miRNAs have been highlighted in many diseases...... such as cancer, diabetes, cardiovascular disease and Alzheimer’s disease. MiRNAs, thus, can be useful markers for disease diagnosis, prognosis, and treatment. Because of its attractive optical properties such as brightness, tuneable emission wavelengths and photo-stability, DNA stabilized silver nano......-clusters (AgNCs) has increasingly been used to create nanoscale bio-sensing systems for selective and specific detection of bio-molecules. During the course of my Ph.D., I have focused on developing a novel diagnostic tool for miRNA detection using the fluorescent properties of DNA encapsulated AgNCs (DNA...

  7. Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens

    Directory of Open Access Journals (Sweden)

    Denis A. Kleymenov

    2017-11-01

    Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.

  8. Genomic segments RNA1 and RNA2 of Prunus necrotic ringspot virus codetermine viral pathogenicity to adapt to alternating natural Prunus hosts.

    Science.gov (United States)

    Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

    2013-05-01

    Prunus necrotic ringspot virus (PNRSV) affects Prunus fruit production worldwide. To date, numerous PNRSV isolates with diverse pathological properties have been documented. To study the pathogenicity of PNRSV, which directly or indirectly determines the economic losses of infected fruit trees, we have recently sequenced the complete genome of peach isolate Pch12 and cherry isolate Chr3, belonging to the pathogenically aggressive PV32 group and mild PV96 group, respectively. Here, we constructed the Chr3- and Pch12-derived full-length cDNA clones that were infectious in the experimental host cucumber and their respective natural Prunus hosts. Pch12-derived clones induced much more severe symptoms than Chr3 in cucumber, and the pathogenicity discrepancy between Chr3 and Pch12 was associated with virus accumulation. By reassortment of genomic segments, swapping of partial genomic segments, and site-directed mutagenesis, we identified the 3' terminal nucleotide sequence (1C region) in RNA1 and amino acid K at residue 279 in RNA2-encoded P2 as the severe virulence determinants in Pch12. Gain-of-function experiments demonstrated that both the 1C region and K279 of Pch12 were required for severe virulence and high levels of viral accumulation. Our results suggest that PNRSV RNA1 and RNA2 codetermine viral pathogenicity to adapt to alternating natural Prunus hosts, likely through mediating viral accumulation.

  9. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

    2004-01-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  10. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

    Science.gov (United States)

    Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

    2004-03-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

  11. Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-11-18

    To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.

  12. Molecular characterization of double-stranded RNA virus in Trichomonas vaginalis Egyptian isolates and its association with pathogenicity.

    Science.gov (United States)

    El-Gayar, Eman K; Mokhtar, Amira B; Hassan, Wael A

    2016-10-01

    Trichomoniasis is a common human sexually transmitted infection caused by Trichomonas vaginalis. The parasite can be infected with double-stranded RNA viruses (TVV). This viral infection may have important implications on trichomonal virulence and disease pathogenesis. This study aimed to determine the prevalence of T. vaginalis virus among isolates obtained from infected (symptomatic and asymptomatic) women in Ismailia City, Egypt, and to correlate the virus-infected isolates with the clinical manifestations of patients. In addition, the pathogenicity of TVV infected isolates on mice was also evaluated. T. vaginalis isolates were obtained from symptomatic and asymptomatic female patients followed by axenic cultivation in Diamond's TYM medium. The presence of T. vaginalis virus was determined from total extraction of nucleic acids (DNA-RNA) followed by reverse transcriptase-PCR. Representative samples were inoculated intraperitoneally in female albino/BALB mice to assess the pathogenicity of different isolates. A total of 110 women were examined; 40 (36.3 %) samples were positive for T. vaginalis infection. Of these 40 isolates, 8 (20 %) were infected by TVV. Five isolates contained TVV-2 virus species, and the remaining three isolates were infected withTVV-4 variant. A significant association was found between the presence of TVV and particular clinical manifestations of trichomoniasis. Experimental mice infection showed varying degrees of pathogenicity. This is the first report on T. vaginalis infection by TVV in Egypt. The strong association detected between TVV and particular clinical features of trichomoniasis and also the degree of pathogenicity in experimentally infected mice may indicate a possible clinical significance of TVV infection of T. vaginalis isolates.

  13. Molecular Techniques for Dicistrovirus Detection without RNA Extraction or Purification

    Directory of Open Access Journals (Sweden)

    Jailson F. B. Querido

    2013-01-01

    Full Text Available Dicistroviridae is a new family of small, nonenveloped, and +ssRNA viruses pathogenic to both beneficial arthropods and insect pests as well. Triatoma virus (TrV, a dicistrovirus, is a pathogen of Triatoma infestans (Hemiptera: Reduviidae, one of the main vectors of Chagas disease. In this work, we report a single-step method to identify TrV, a dicistrovirus, isolated from fecal samples of triatomines. The identification method proved to be quite sensitive, even without the extraction and purification of RNA virus.

  14. Direct bacterial loop-mediated isothermal amplification detection on the pathogenic features of the nosocomial pathogen - Methicillin resistant Staphylococcus aureus strains with respiratory origins.

    Science.gov (United States)

    Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi

    2017-08-01

    Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4  CFU/ml for 16S rRNA, femA, as well as orfX and 10 5  CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.

  15. Simultaneous Detection of Brown Rot- and Soft Rot-Causing Bacterial Pathogens from Potato Tubers Through Multiplex PCR.

    Science.gov (United States)

    Ranjan, R K; Singh, Dinesh; Baranwal, V K

    2016-11-01

    Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.

  16. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Directory of Open Access Journals (Sweden)

    Ratthaphol Charlermroj

    Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  17. Multiplex detection of plant pathogens using a microsphere immunoassay technology.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Oplatowska, Michalina; Gajanandana, Oraprapai; Grant, Irene R; Karoonuthaisiri, Nitsara; Elliott, Christopher T

    2013-01-01

    Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), chilli vein-banding mottle virus (CVbMV, potyvirus), watermelon silver mottle virus (WSMoV, tospovirus serogroup IV) and melon yellow spot virus (MYSV, tospovirus). An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE)-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA) when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour) was much shorter than that of ELISA (4 hours). This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.

  18. RNA detection in situ with FISH-STICs.

    Science.gov (United States)

    Sinnamon, John R; Czaplinski, Kevin

    2014-02-01

    The ability to detect RNA molecules in situ has long had important applications for molecular biological studies. Enzyme or dye-labeled antisense in vitro runoff transcripts and synthetic oligodeoxynucleotides (ODN) both have a proven track record of success, but each of these also has scientific and practical drawbacks and limitations to its use. We devised a means to use commercially synthesized oligonucleotides as RNA-FISH probes without further modification and show that such probes work well for detection of RNA in cultured cells. This approach can bind a high concentration of fluorescent ODN to a short stretch of an RNA using commercial DNA synthesis outlets available to any laboratory. We call this approach for creating in situ hybridization probes Fluorescence In Situ Hybridization with Sequential Tethered and Intertwined ODN Complexes (FISH-STICs). We demonstrate that one FISH-STIC probe can detect mRNA molecules in culture, and that probe detection can be improved by the addition of multiple probes that can be easily adapted for robust mRNA quantification. Using FISH-STICs, we demonstrate a nonoverlapping distribution for β-actin and γ-actin mRNA in cultured fibroblasts, and the detection of neuron-specific transcripts within cultured primary hippocampal neurons.

  19. Comparison of pathogenic domains of rabies and African rabies-related lyssaviruses and pathogenicity observed in mice

    Directory of Open Access Journals (Sweden)

    Joe Kgaladi

    2013-03-01

    Full Text Available Several lyssavirus species occur in Africa (Rabies virus, Lagos bat virus, Mokola virus, Duvenhage virus, Shimoni bat virus and Ikoma lyssavirus, displaying a high sequence diversity between isolates belonging to the same species. There is limited information about comparative pathogenesis of these African lyssaviruses and this precludes authoritative opinion on the potential public and veterinary health impact. In this study, an analysis of representative African lyssaviruses attempted to correlate viral genomic sequence similarities and differences with the corresponding pathogenic profiles observed in mice. The study demonstrated that the virus isolates evaluated could be lethal to mice when introduced intramuscularly and that different isolates of the same lyssavirus species differ in their virulence. Using real-time polymerase chain reaction (PCR, viral RNA was detected in brain tissue, but no viral RNA was detected in the salivary glands or blood of mice that succumbed to infection. Comparison of known pathogenic domains indicated that pathogenicity is likely to be dependent on multiple domains. Cumulatively, our results re-emphasised the realisation that the pathogenicity of a lyssavirus species cannot be deduced based on studies of only a single isolate of the species or a single pathogenic domain.

  20. A Rapid Protocol of Crude RNA/DNA Extraction for RT-qPCR Detection and Quantification of 'Candidatus Phytoplasma prunorum'.

    Science.gov (United States)

    Minguzzi, Stefano; Terlizzi, Federica; Lanzoni, Chiara; Poggi Pollini, Carlo; Ratti, Claudio

    2016-01-01

    Many efforts have been made to develop a rapid and sensitive method for phytoplasma and virus detection. Taking our cue from previous works, different rapid sample preparation methods have been tested and applied to Candidatus Phytoplasma prunorum ('Ca. P. prunorum') detection by RT-qPCR. A duplex RT-qPCR has been optimized using the crude sap as a template to simultaneously amplify a fragment of 16S rRNA of the pathogen and 18S rRNA of the host plant. The specific plant 18S rRNA internal control allows comparison and relative quantification of samples. A comparison between DNA and RNA contribution to qPCR detection is provided, showing higher contribution of the latter. The method presented here has been validated on more than a hundred samples of apricot, plum and peach trees. Since 2013, this method has been successfully applied to monitor 'Ca. P. prunorum' infections in field and nursery. A triplex RT-qPCR assay has also been optimized to simultaneously detect 'Ca. P. prunorum' and Plum pox virus (PPV) in Prunus.

  1. Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

    Science.gov (United States)

    Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

    2017-09-18

    Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B

  2. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  3. Interferon Induction by RNA Viruses and Antagonism by Viral Pathogens

    Directory of Open Access Journals (Sweden)

    Yuchen Nan

    2014-12-01

    Full Text Available Interferons are a group of small proteins that play key roles in host antiviral innate immunity. Their induction mainly relies on host pattern recognition receptors (PRR. Host PRR for RNA viruses include Toll-like receptors (TLR and retinoic acid-inducible gene I (RIG-I like receptors (RLR. Activation of both TLR and RLR pathways can eventually lead to the secretion of type I IFNs, which can modulate both innate and adaptive immune responses against viral pathogens. Because of the important roles of interferons, viruses have evolved multiple strategies to evade host TLR and RLR mediated signaling. This review focuses on the mechanisms of interferon induction and antagonism of the antiviral strategy by RNA viruses.

  4. Advances and Challenges in Viability Detection of Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Dexin Zeng

    2016-11-01

    Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound

  5. Detection of Emerging and Re-Emerging Pathogens in Surface Waters Close to an Urban Area

    Directory of Open Access Journals (Sweden)

    Stefania Marcheggiani

    2015-05-01

    Full Text Available Current knowledge about the spread of pathogens in aquatic environments is scarce probably because bacteria, viruses, algae and their toxins tend to occur at low concentrations in water, making them very difficult to measure directly. The purpose of this study was the development and validation of tools to detect pathogens in freshwater systems close to an urban area. In order to evaluate anthropogenic impacts on water microbiological quality, a phylogenetic microarray was developed in the context of the EU project µAQUA to detect simultaneously numerous pathogens and applied to samples from two different locations close to an urban area located upstream and downstream of Rome in the Tiber River. Furthermore, human enteric viruses were also detected. Fifty liters of water were collected and concentrated using a hollow-fiber ultrafiltration approach. The resultant concentrate was further size-fractionated through a series of decreasing pore size filters. RNA was extracted from pooled filters and hybridized to the newly designed microarray to detect pathogenic bacteria, protozoa and toxic cyanobacteria. Diatoms as indicators of the water quality status, were also included in the microarray to evaluate water quality. The microarray results gave positive signals for bacteria, diatoms, cyanobacteria and protozoa. Cross validation of the microarray was performed using standard microbiological methods for the bacteria. The presence of oral-fecal transmitted human enteric-viruses were detected using q-PCR. Significant concentrations of Salmonella, Clostridium, Campylobacter and Staphylococcus as well as Hepatitis E Virus (HEV, noroviruses GI (NoGGI and GII (NoGII and human adenovirus 41 (ADV 41 were found in the Mezzocammino site, whereas lower concentrations of other bacteria and only the ADV41 virus was recovered at the Castel Giubileo site. This study revealed that the pollution level in the Tiber River was considerably higher downstream rather than

  6. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  7. Electrochemical Methodologies for the Detection of Pathogens.

    Science.gov (United States)

    Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine

    2018-05-25

    Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current

  8. Genetic characterization of human-pathogenic Cyclospora cayetanensis parasites from three endemic regions at the 18S ribosomal RNA locus.

    Science.gov (United States)

    Sulaiman, Irshad M; Ortega, Ynes; Simpson, Steven; Kerdahi, Khalil

    2014-03-01

    Cyclospora cayetanensis is an apicocomplexan parasite that infects the gastrointestinal tract and causes acute diarrheal disease in humans. In recent years, this human-pathogenic parasite has led to several foodborne outbreaks in the United States and Canada, mostly associated with imported produce. Understanding the biology and epidemiology of C. cayetanensis is difficult because little is known about its origin, possible zoonotic reservoirs, and genetic relationships with other coccidian parasites. Recently, we developed a 70kDa heat shock protein (HSP70) gene based nested PCR protocol for detection of C. cayetanensis parasite and sequenced the PCR products of 16 human isolates from Nepal, Mexico, and Peru. In this study, we have characterized the regions of 18S ribosomal RNA (rRNA) gene of 17 human C. cayetanensis isolates for molecular detection, and also to ascertain the genetic diversity of this parasite. The 18S rRNA primer sets were further tested by PCR amplification followed by nucleotide sequencing of the PCR amplified products of previously characterized C. cayetanensis isolates from three endemic regions at HSP70 locus. Although no genetic polymorphism was observed at the regions of HSP70 locus characterized in our previous study, the data analysis of this study revealed a minor genetic diversity at the 18S rRNA locus among the C. cayetanensis isolates. The 18S rRNA gene-based nested PCR protocol provides a useful genetic marker for the detection of C. cayetanensis parasite and confirms it as a genetically distinct species in genus Cyclospora. The results also supported lack of geographic segregation and existence of genetically homogeneous population for the C. cayetanensis parasites both at the HSP70 as well as at the18S rRNA loci. Published by Elsevier B.V.

  9. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.

    Science.gov (United States)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders

    2018-03-10

    Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.

  10. Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France.

    Science.gov (United States)

    Scoizec, Axelle; Niqueux, Eric; Thomas, Rodolphe; Daniel, Patrick; Schmitz, Audrey; Le Bouquin, Sophie

    2018-01-01

    In southwestern France, during the winter of 2016-2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50-110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log 10 RNA copies per m 3 , and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.

  11. Airborne Detection of H5N8 Highly Pathogenic Avian Influenza Virus Genome in Poultry Farms, France

    Directory of Open Access Journals (Sweden)

    Axelle Scoizec

    2018-02-01

    Full Text Available In southwestern France, during the winter of 2016–2017, the rapid spread of highly pathogenic avian influenza H5N8 outbreaks despite the implementation of routine control measures, raised the question about the potential role of airborne transmission in viral spread. As a first step to investigate the plausibility of that transmission, air samples were collected inside, outside and downwind from infected duck and chicken facilities. H5 avian influenza virus RNA was detected in all samples collected inside poultry houses, at external exhaust fans and at 5 m distance from poultry houses. For three of the five flocks studied, in the sample collected at 50–110 m distance, viral genomic RNA was detected. The measured viral air concentrations ranged between 4.3 and 6.4 log10 RNA copies per m3, and their geometric mean decreased from external exhaust fans to the downwind measurement point. These findings are in accordance with the possibility of airborne transmission and question the procedures for outbreak depopulation.

  12. Rapid identification and detection of pathogenic Fungi by padlock probes

    NARCIS (Netherlands)

    Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.

    2013-01-01

    Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen

  13. Clinical significance of LUNX mRNA, CK19 mRNA, CEA mRNA expression in detecting micrometastasis from lung cancer

    International Nuclear Information System (INIS)

    Zhu Guangying; Liu Delin; Chen Jie

    2003-01-01

    Objective: To evaluate the sensitivity, specificity and clinical significance of CK19 mRNA, CEA mRNA and LUNX mRNA for detecting micrometastasis by sampling the peripheral blood and regional lymph nodes of lung cancer patients. Methods: Reverse transcriptase chain reaction (RT-PCR) was used to detect LUNX mRNA, CK19 mRNA, CEA mRNA for micrometastasis by sampling the peripheral blood of 48 lung cancer patients and 44 regional lymph nodes of such patients treated by curative resection. Peripheral blood of 30 patients with pulmonary benign lesions and 10 normal healthy volunteers and lymph nodes of 6 patients with benign pulmonary diseases served as control. Results: 1) LUNX mRNA, CK19 mRNA, CEA mRNA were expressed in all (35/35) lung cancer tissues. 2) In the peripheral blood from 48 lung cancer patients, 30 (62.5%) were positive for LUNX mRNA, 24 (50.0%) positive for CK19 mRNA and 32(66.7%) positive for CEA mRNA. The positive detection rates of micrometastasis in 44 lymph nodes from lung cancer patients were 36.4% (16 out of 44) for LUNX mRNA, 27.3% (12 out of 44) for CK19 mRNA and 40.9% (18 out of 44) for CEA mRNA. 3) In the 30 blood samples from patients with pulmonary benign diseases, 2 (6.7%) expressed CK19 mRNA, but none expressed LUNX mRNA or CEA mRNA. All the 3 molecular markers were negative in the 10 blood samples from healthy volunteers. In 11 lymph nodes from patients with pulmonary benign lesions, none was positive for any of the three markers. 4) In 44 regional lymph nodes from lung cancer patients, 6 (13.6%) were positive for metastasis by histopathological examination, with a positive rate significantly lower than that of the RT-PCR (P<0.05). 5) The micrometastatic positive rate in the peripheral blood of 40 non-small cell lung cancer (NSCLC) patients was significantly related to TNM stage (P=0.01). Conclusions: LUNX mRNA, CK19 MRNA, CEA mRNA are all appropriate target genes for the detection of micrometastasis from lung cancer. LUNX mRNA and CEA mRNA

  14. Pathogen detection and gut bacteria identification in Apis cerana ...

    African Journals Online (AJOL)

    acer

    other lactic acid bacteria, were isolated from larvae and adult workers, but gave conflicting preliminary identities based on their biochemistry-morphology versus sequence analysis of a partial fragment (1.4 kb) of their 16S rRNA. Key words: Apis cerana indica, bee pathogens, gut bacteria, multiplex polymerase chain ...

  15. RNA Detection Based on Graphene Field-Effect Transistor Biosensor

    Directory of Open Access Journals (Sweden)

    Meng Tian

    2018-01-01

    Full Text Available Graphene has attracted much attention in biosensing applications due to its unique properties. In this paper, the monolayer graphene was grown by chemical vapor deposition (CVD method. Using the graphene as the electric channel, we have fabricated a graphene field-effect transistor (G-FET biosensor that can be used for label-free detection of RNA. Compared with conventional method, the G-FET RNA biosensor can be run in low cost, be time-saving, and be miniaturized for RNA measurement. The sensors show high performance and achieve the RNA detection sensitivity as low as 0.1 fM, which is two orders of magnitude lower than the previously reports. Moreover, the G-FET biosensor can readily distinguish target RNA from noncomplementary RNA, showing high selectivity for RNA detection. The developed G-FET RNA biosensor with high sensitivity, fast analysis speed, and simple operation may provide a new feasible direction for RNA research and biosensing.

  16. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  17. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus

    Science.gov (United States)

    Qiu, Xiu-Wen; Wu, Xiao-Qin; Huang, Lin; Ye, Jian-Ren

    2016-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi) is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1). The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA) after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1). The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p < 0.001) after treatment with dsRNAi compared with that using a control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD. PMID:26797602

  18. Detection and treatment of chemical weapons and/or biological pathogens

    Science.gov (United States)

    Mariella Jr., Raymond P.

    2004-09-07

    A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.

  19. Quantitative multiplex detection of pathogen biomarkers

    Energy Technology Data Exchange (ETDEWEB)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

    2016-02-09

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  20. Quantitative multiplex detection of pathogen biomarkers

    Science.gov (United States)

    Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

    2014-10-14

    The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

  1. Rapid detection, characterization, and enumeration of foodborne pathogens.

    Science.gov (United States)

    Hoorfar, J

    2011-11-01

    As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible

  2. Characterization of an Hfq dependent antisense sRNA in the Gram-positive human pathogen Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Lei Kristensen, Lisbeth; Hanghøj Chrisitansen, Mie

    between sRNA and target mRNA rely on the RNA chaperone Hfq. Hfq is a ubiquitous protein found in almost all genres of bacterial life. However, so far its role as an RNA chaperone has only been described in Gram-negative species such as Escherichia coli and Salmonella (Vogel, J. 2009). We previously...... identified several Hfq-binding sRNAs in the Gram-positive human pathogen L. monocytogenes (Christiansen et al 2006). Through bioinformatics, we have identified a number of candidate targets for one of these sRNAs (LhrA). Here, we present the characterization of one of these targets. Our results suggest...

  3. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    disease that has become an important public health problem. Traditional serological methods are the gold standard for the detection of pathogenic strains of Leptospira. However, serological procedures are cumbersome, require more complex experimental techniques, and are based on a large number of international and domestic reference strains. Additionally, these experiments involve the immunization of animals with antigens from different serotypes to produce immune serum, and improper techniques may result in a rapid decrease in antibody titer, which would affect the final results. It is difficult to perform cumbersome detection procedures in a basic laboratory. Therefore, the use of conventional serological methods is limited, which significantly impacts daily leptospirosis epidemic surveillance, prevention, and control. Molecular biology methods, such as 16S rRNA and PCR-based methods, can be used to identify the pathogenic Leptospira. However, DNA extraction and gene sequencing methods are laborious and time consuming. Therefore, more rapid and reliable high-throughput identification methods are urgently needed for the clinical diagnosis of leptospirosis to improve epidemic control. Here, molecular fingerprinting technique was use to identify the pathogenicity. We constructed the reference spectra database and the super reference spectra of pathogenic and non-pathogenic Leptospira, which can rapidly identified Leptospira at the species level and the pathogenicity of these isolates can be simultaneously confirmed. Furthermore, the protein components of Leptospira pathogenicity were revealed. These findings thus provide a new way for Leptospira pathogenicity identification. Copyright © 2014. Published by Elsevier B.V.

  4. Spectroelectrochemical detection of microRNA-155 based on functional RNA immobilization onto ITO/GNP nanopattern.

    Science.gov (United States)

    Mohammadniaei, Mohsen; Yoon, Jinho; Lee, Taek; Choi, Jeong-Woo

    2018-05-20

    We fabricated a microRNA biosensor using the combination of surface enhanced Raman spectroscopy (SERS) and electrochemical (EC) techniques. For the first time, the weaknesses of each techniques for microRNA detection was compensated by the other ones to give rise to the specific and wide-range detection of miR-155. A single stranded 3' methylene blue (MB) and 5' thiol-modified RNA (MB-ssRNA-SH) was designed to detect the target miR-155 and immobilized onto the gold nanoparticle-modified ITO (ITO/GNP). Upon the invasion of target strand, the double-stranded RNA transformed rapidly to an upright structure resulting in a notable decrease in SERS and redox signals of the MB. For the first time, by combination of SERS and EC techniques in a single platform we extended the dynamic range of both techniques from 10 pM to 450 nM (SERS: 10 pM-5 nM and EC: 5 nM-450 nM). As well, the SERS technique improved the detection limit of the EC method from 100 pM to 100 fM, while the EC method covered single-mismatch detection which was the SERS deficiency. The fabricated single-step biosensor possessing a good capability of miRNA detection in human serum, could be employed throughout the broad ranges of biomedical and bioelectronics applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection

    OpenAIRE

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R.; Deforce, Dieter; Smagghe, Guy; Swevers, Luc

    2015-01-01

    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by...

  6. An automated procedure for covariation-based detection of RNA structure

    International Nuclear Information System (INIS)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs

  7. An automated procedure for covariation-based detection of RNA structure

    Energy Technology Data Exchange (ETDEWEB)

    Winker, S.; Overbeek, R.; Woese, C.R.; Olsen, G.J.; Pfluger, N.

    1989-12-01

    This paper summarizes our investigations into the computational detection of secondary and tertiary structure of ribosomal RNA. We have developed a new automated procedure that not only identifies potential bondings of secondary and tertiary structure, but also provides the covariation evidence that supports the proposed bondings, and any counter-evidence that can be detected in the known sequences. A small number of previously unknown bondings have been detected in individual RNA molecules (16S rRNA and 7S RNA) through the use of our automated procedure. Currently, we are systematically studying mitochondrial rRNA. Our goal is to detect tertiary structure within 16S rRNA and quaternary structure between 16S and 23S rRNA. Our ultimate hope is that automated covariation analysis will contribute significantly to a refined picture of ribosome structure. Our colleagues in biology have begun experiments to test certain hypotheses suggested by an examination of our program's output. These experiments involve sequencing key portions of the 23S ribosomal RNA for species in which the known 16S ribosomal RNA exhibits variation (from the dominant pattern) at the site of a proposed bonding. The hope is that the 23S ribosomal RNA of these species will exhibit corresponding complementary variation or generalized covariation. 24 refs.

  8. Dual RNA-seq of the plant pathogen phytophthora ramorum and its tanoak host

    Science.gov (United States)

    Katherine J. Hayden; Matteo Garbelotto; Brian J. Knaus; Richard C. Cronn; Hardeep Rai; Jessica W. Wright

    2014-01-01

    Emergent diseases are an ever-increasing threat to forests and forest ecosystems and necessitate the development of research tools for species that often may have few preexisting resources. We sequenced the mRNA expressed by the sudden oak death pathogen Phytophthora ramorum and its most susceptible forest host, tanoak, within the same tissue at two time points after...

  9. Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica.

    Science.gov (United States)

    Campos-Calderón, Liliana; Ábrego-Sánchez, Leyda; Solórzano-Morales, Antony; Alberti, Alberto; Tore, Gessica; Zobba, Rosanna; Jiménez-Rocha, Ana E; Dolz, Gaby

    2016-10-01

    Although vector-borne diseases are globally widespread with considerable impact on animal production and on public health, few reports document their presence in Central America. This study focuses on the detection and molecular identification of species belonging to selected bacterial genera (Ehrlichia, Anaplasma and Rickettsia) in ticks sampled from dogs in Costa Rica by targeting several genes: 16S rRNA/dsb genes for Ehrlichia; 16S rRNA/groEL genes for Anaplasma, and ompA/gltA/groEL genes for Rickettsia. PCR and sequence analyses provides evidences of Ehrlichia canis, Anaplasma platys, and Anaplasma phagocytophilum infection in Rhipicephalus sanguineus s.l ticks, and allow establishing the presence of Rickettsia monacensis in Ixodes boliviensis. Furthermore, the presence of recently discovered Mediterranean A. platys-like strains is reported for the first time in Central America. Results provide new background on geographical distribution of selected tick-transmitted bacterial pathogens in Costa Rica and on their molecular epidemiology, and are pivotal to the development of effective and reliable diagnostic tools in Central America. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins

    Directory of Open Access Journals (Sweden)

    Jaewoo eBai

    2016-04-01

    Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.

  11. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection.

    Science.gov (United States)

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R; Deforce, Dieter; Smagghe, Guy; Swevers, Luc

    2015-11-01

    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by a segmented double-stranded RNA (dsRNA) genome. Further, we show that Dicer-2 predominantly targets viral dsRNA and produces 20-nucleotide (nt) vsRNAs, whereas an additional pathway is responsive to viral mRNA derived from segment 10. Importantly, vsRNA distributions, which define specific hot and cold spot profiles for each viral segment, to a considerable degree overlap between Dicer-2-related (19 to 21 nt) and Dicer-2-unrelated vsRNAs, suggesting a common origin for these profiles. We found a degenerate motif significantly enriched at the cut sites of vsRNAs of various lengths which link an unknown RNase to the origins of vsRNAs biogenesis and distribution. Accordingly, the indicated RNase activity may be an important early factor for the host's antiviral defense in Lepidoptera. This work contributes to the elucidation of the lepidopteran antiviral response against infection of segmented double-stranded RNA (dsRNA) virus (CPV; Reoviridae) and highlights the importance of viral small-RNA (vsRNA) analysis for getting insights into host-pathogen interactions. Three vsRNA pathways are implicated in antiviral defense. For dsRNA, two pathways are proposed, either based on Dicer-2 cleavage to generate 20-nucleotide vsRNAs or based on the activity of an uncharacterized endo-RNase that cleaves the viral RNA substrate at a degenerate motif. The analysis also indicates the existence of a degradation pathway that targets the positive strand of segment 10. Copyright © 2015, American

  12. [Investigation of RNA viral genome amplification by multiple displacement amplification technique].

    Science.gov (United States)

    Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin

    2013-06-01

    In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.

  13. DETECTION OF BACTERIAL SMALL TRANSCRIPTS FROM RNA-SEQ DATA: A COMPARATIVE ASSESSMENT.

    Science.gov (United States)

    Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S

    2016-01-01

    Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.

  14. Microfluidic devices for sample preparation and rapid detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy

    2018-01-01

    and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...

  15. TEST KIT FOR THE DETECTION AND GENOTYPING OF HIGHLY PATHOGENIC INFLUENZA VIRUS A H5N1 BY REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    S. V. Stepaniuk

    2014-06-01

    Full Text Available Results of the annual monitoring of epizooties indicate that highly pathogenic HPAI/H5N1 avian influenza widely circulated in Eurasian region. Over a period of 2010–2013 years more than 165 cases of outbreaks in 14 countries were found out. Ukraine became one of the first countries in Europe where in Autonomous Republic of Crimea in October 2005 outbreak of avian epizootic with HPAI/H5N1 was documented and until February 2008 more than 236,000 poultry were killed. Since then the question of monitoring of infected both migrating birds and poultry in places of cross contact in Ukraine remains of high priority. The test system is developed for identification and genotyping A H5N1 on three genes (M, H5 and N1 HPAI/H5N1 in real-time mode for polymerase chain reaction. Test kit capacity to detect HPAI/h5n1avian influenza virus and differentiate it from the other viral infection agents of birds and animals were studied by testing of HPAI/H5N1 virus isolated during mass infection outbreak in Crimea in 2005 and cultural specimens of other viral pathogens. It was established that the «DIA Real Avian Influenza» test kit was capable to detect RNA influenza A virus of high pathogenic H5N1 strains having high sensitivity (100% while RNA of the Crimean HPAI/H5N1 isolate studying and specificity (100% while RNA viruses of Newcastle birds disease, fowl powershift, syndrome of drop in egg production and horse influenza studying.

  16. Sensing of RNA viruses

    DEFF Research Database (Denmark)

    Jensen, Søren; Thomsen, Allan Randrup

    2012-01-01

    pathogen-associated molecular patterns have emerged in great detail. This review presents an overview of our current knowledge regarding the receptors used to detect RNA virus invasion, the molecular structures these receptors sense, and the involved downstream signaling pathways.......Our knowledge regarding the contribution of the innate immune system in recognizing and subsequently initiating a host response to an invasion of RNA virus has been rapidly growing over the last decade. Descriptions of the receptors involved and the molecular mechanisms they employ to sense viral...

  17. UGGT1 enhances enterovirus 71 pathogenicity by promoting viral RNA synthesis and viral replication.

    Directory of Open Access Journals (Sweden)

    Peng-Nien Huang

    2017-05-01

    Full Text Available Positive-strand RNA virus infections can induce the stress-related unfolded protein response (UPR in host cells. This study found that enterovirus A71 (EVA71 utilizes host UDP-glucose glycoprotein glucosyltransferase 1 (UGGT1, a key endoplasmic reticulum protein (ER involved in UPR, to enhance viral replication and virulence. EVA71 forms replication complexes (RCs on cellular membranes that contain a mix of host and viral proteins to facilitate viral replication, but the components and processes involved in the assembly and function of RCs are not fully understood. Using EVA71 as a model, this study found that host UGGT1 and viral 3D polymerase co-precipitate along with other factors on membranous replication complexes to enhance viral replication. Increased UGGT1 levels elevated viral growth rates, while viral pathogenicity was observed to be lower in heterozygous knockout mice (Uggt1 +/- mice. These findings provide important insight on the role of UPR and host UGGT1 in regulating RNA virus replication and pathogenicity.

  18. Lack of the RNA chaperone Hfq attenuates pathogenicity of several Escherichia coli pathotypes towards Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Bojer, Martin Saxtorph; Jakobsen, Henrik; Struve, Carsten

    2012-01-01

    as a model for virulence characterization and screening for novel antimicrobial entities. Several E. coli human pathotypes are also pathogenic towards C. elegans, and we show here that lack of the RNA chaperone Hfq significantly reduces pathogenicity of VTEC, EAEC, and UPEC in the nematode model. Thus, Hfq...... is intrinsically essential to pathogenic E. coli for survival and virulence exerted in the C. elegans host.......Escherichia coli is an important agent of Gram-negative bacterial infections worldwide, being one of the leading causes of diarrhoea and urinary tract infections. Strategies to understand pathogenesis and develop therapeutic compounds include the use of the nematode Caenorhabditis elegans...

  19. Biosensor-based microRNA detection: techniques, design, performance, and challenges.

    Science.gov (United States)

    Johnson, Blake N; Mutharasan, Raj

    2014-04-07

    The current state of biosensor-based techniques for amplification-free microRNA (miRNA) detection is critically reviewed. Comparison with non-sensor and amplification-based molecular techniques (MTs), such as polymerase-based methods, is made in terms of transduction mechanism, associated protocol, and sensitivity. Challenges associated with miRNA hybridization thermodynamics which affect assay selectivity and amplification bias are briefly discussed. Electrochemical, electromechanical, and optical classes of miRNA biosensors are reviewed in terms of transduction mechanism, limit of detection (LOD), time-to-results (TTR), multiplexing potential, and measurement robustness. Current trends suggest that biosensor-based techniques (BTs) for miRNA assay will complement MTs due to the advantages of amplification-free detection, LOD being femtomolar (fM)-attomolar (aM), short TTR, multiplexing capability, and minimal sample preparation requirement. Areas of future importance in miRNA BT development are presented which include focus on achieving high measurement confidence and multiplexing capabilities.

  20. RADIA: RNA and DNA integrated analysis for somatic mutation detection.

    Directory of Open Access Journals (Sweden)

    Amie J Radenbaugh

    Full Text Available The detection of somatic single nucleotide variants is a crucial component to the characterization of the cancer genome. Mutation calling algorithms thus far have focused on comparing the normal and tumor genomes from the same individual. In recent years, it has become routine for projects like The Cancer Genome Atlas (TCGA to also sequence the tumor RNA. Here we present RADIA (RNA and DNA Integrated Analysis, a novel computational method combining the patient-matched normal and tumor DNA with the tumor RNA to detect somatic mutations. The inclusion of the RNA increases the power to detect somatic mutations, especially at low DNA allelic frequencies. By integrating an individual's DNA and RNA, we are able to detect mutations that would otherwise be missed by traditional algorithms that examine only the DNA. We demonstrate high sensitivity (84% and very high precision (98% and 99% for RADIA in patient data from endometrial carcinoma and lung adenocarcinoma from TCGA. Mutations with both high DNA and RNA read support have the highest validation rate of over 99%. We also introduce a simulation package that spikes in artificial mutations to patient data, rather than simulating sequencing data from a reference genome. We evaluate sensitivity on the simulation data and demonstrate our ability to rescue back mutations at low DNA allelic frequencies by including the RNA. Finally, we highlight mutations in important cancer genes that were rescued due to the incorporation of the RNA.

  1. Flow cytometric analysis of RNA synthesis by detection of bromouridine incorporation

    DEFF Research Database (Denmark)

    Larsen, J K; Jensen, Peter Østrup; Larsen, J

    2001-01-01

    RNA synthesis has traditionally been investigated by a laborious and time-consuming radiographic method involving incorporation of tritiated uridine. Now a faster non-radioactive alternative has emerged, based on immunocytochemical detection. This method utilizes the brominated RNA precursor...... bromouridine, which is taken into a cell, phosphorylated, and incorporated into nascent RNA. The BrU-substituted RNA is detected by permeabilizing the cells and staining with certain anti-BrdU antibodies. This dynamic approach yields information complementing that provided by cellular RNA content analysis...

  2. 9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...

  3. Quantification of pathogenic Leptospira in the soils of a Brazilian urban slum.

    Directory of Open Access Journals (Sweden)

    Andrew G Schneider

    2018-04-01

    Full Text Available Leptospirosis is an important zoonotic disease that causes considerable morbidity and mortality globally, primarily in residents of urban slums. While contact with contaminated water plays a critical role in the transmission of leptospirosis, little is known about the distribution and abundance of pathogenic Leptospira spp. in soil and the potential contribution of this source to human infection.We collected soil samples (n = 70 from three sites within an urban slum community endemic for leptospirosis in Salvador, Brazil. Using qPCR of Leptospira genes lipl32 and 16S rRNA, we quantified the pathogenic Leptospira load in each soil sample. lipl32 qPCR detected pathogenic Leptospira in 22 (31% of 70 samples, though the median concentration among positive samples was low (median = 6 GEq/g; range: 4-4.31×102 GEq/g. We also observed heterogeneity in the distribution of pathogenic Leptospira at the fine spatial scale. However, when using 16S rRNA qPCR, we detected a higher proportion of Leptospira-positive samples (86% and higher bacterial concentrations (median: 4.16×102 GEq/g; range: 4-2.58×104 GEq/g. Sequencing of the qPCR amplicons and qPCR analysis with all type Leptospira species revealed that the 16S rRNA qPCR detected not only pathogenic Leptospira but also intermediate species, although both methods excluded saprophytic Leptospira. No significant associations were identified between the presence of pathogenic Leptospira DNA and environmental characteristics (vegetation, rat activity, distance to an open sewer or a house, or soil clay content, though samples with higher soil moisture content showed higher prevalences.This is the first study to successfully quantify the burden of pathogenic Leptospira in soil from an endemic region. Our results support the hypothesis that soil may be an under-recognized environmental reservoir contributing to transmission of pathogenic Leptospira in urban slums. Consequently, the role of soil should be

  4. Detection and characterization of foodborne pathogenic bacteria with hyperspectral microscope imaging

    Science.gov (United States)

    Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...

  5. Sensitive and label-free detection of miRNA-145 by triplex formation.

    Science.gov (United States)

    Aviñó, Anna; Huertas, César S; Lechuga, Laura M; Eritja, Ramon

    2016-01-01

    The development of new strategies for detecting microRNAs (miRNAs) has become a crucial step in the diagnostic field. miRNA profiles depend greatly on the sample and the analytical platform employed, leading sometimes to contradictory results. In this work, we study the use of modified parallel tail-clamps to detect a miRNA sequence involved in tumor suppression by triplex formation. Thermal denaturing curves and circular dichroism (CD) measurements have been performed to confirm that parallel clamps carrying 8-aminoguanine form the most stable triplex structures with their target miRNA. The modified tail-clamps have been tested as bioreceptors in a surface plasmon resonance (SPR) biosensor for the detection of miRNA-145. The detection limit was improved 2.4 times demonstrating that a stable triplex structure is formed between target miRNA and 8-aminoguanine tail-clamp bioreceptor. This new approach is an essential step toward the label-free and reliable detection of miRNA signatures for diagnostic purposes.

  6. Isothermal Amplification for MicroRNA Detection: From the Test Tube to the Cell.

    Science.gov (United States)

    Deng, Ruijie; Zhang, Kaixiang; Li, Jinghong

    2017-04-18

    MicroRNAs (miRNAs) are a class of small noncoding RNAs that act as pivotal post-transcriptional regulators of gene expression, thus involving in many fundamental cellular processes such as cell proliferation, migration, and canceration. The detection of miRNAs has attracted significant interest, as abnormal miRNA expression is identified to contribute to serious human diseases such as cancers. Particularly, miRNAs in peripheral blood have recently been recognized as important biomarkers potential for liquid biopsy. Furthermore, as miRNAs are expressed heterogeneously in different cells, investigations into single-cell miRNA expression will be of great value for resolving miRNA-mediated regulatory circuits and the complexity and heterogeneity of miRNA-related diseases. Thus, the development of miRNA detection methods, especially for complex clinic samples and single cells is in great demand. In this Account, we will present recent progress in the design and application of isothermal amplification enabling miRNA detection transition from the test tube to the clinical sample and single cell, which will significantly advance our knowledge of miRNA functions and disease associations, as well as its translation in clinical diagnostics. miRNAs present a huge challenge in detection because of their extremely short length (∼22 nucleotides) and sequence homology (even with only single-nucleotide variation). The conventional golden method for nucleic acid detection, quantitative PCR (qPCR), is not amenable to directly detecting short RNAs and hardly enables distinguishing between miRNA family members with very similar sequences. Alternatively, isothermal amplification has emerged as a powerful method for quantification of nucleic acids and attracts broad interest for utilization in developing miRNA assays. Compared to PCR, isothermal amplification can be performed without precise control of temperature cycling and is well fit for detecting short RNA or DNA. We and other

  7. Simultaneous Detection of CDC Category "A" DNA and RNA Bioterrorism Agents by Use of Multiplex PCR & RT-PCR Enzyme Hybridization Assays

    Directory of Open Access Journals (Sweden)

    Kelly J. Henrickson

    2009-10-01

    Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The

  8. Multiplex real-time PCR (TaqMan) assay for the simultaneous detection and discrimination of potato powdery and common scab diseases and pathogens.

    Science.gov (United States)

    Qu, X S; Wanner, L A; Christ, B J

    2011-03-01

    To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  9. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  10. [EXPERIENCE OF STUDY AND POSSIBLE WAYS OF ELIMINATION OF FALSE POSITIVE AND FALSE NEGATIVE RESULTS DURING EXECUTION OF POLYMERASE CHAIN REACTION ON AN EXAMPLE OF JUNIN VIRUS RNA DETECTION].

    Science.gov (United States)

    Sizikova, T E; Lebedev, V N; Pantyukhov, V B; Borisevich, S V; Merkulov, V A

    2015-01-01

    Experience of study and possible ways of elimination of false positive and false negative results during execution of polymerase chain reaction on an example of Junin virus RNA detection. MATERIALSS AND METHODS: Junin virus--causative agent of Argentine hemorrhagic fever (AHF) strain XJpR37/5787 was obtained from the State collection of pathogenicity group I causative agents of the 48th Central Research Institute. Reagent kit for detection of Junin virus RNA by RT-PCR was developed in the Institute and consists of 4 sets: for isolation of RNA, execution of reverse-transcription reaction, execution of PCR and electrophoretic detection of PCR products. RT-PCR was carried out by a standard technique. Continuous cell cultures of African green monkey Vero B, GMK-AH-1(D) were obtained from the museum of cell culture department of the Centre. An experimental study of the effect of various factors of impact on the sample under investigation ("thawing-freezing", presence of formaldehyde, heparin) on the obtaining of false negative results during Junin virus RNA detection by using RT-PCR was studied. Addition of 0.01% heparin to the samples was shown to completely inhibit PCR. Addition of 0.05% formaldehyde significantly reduces sensitivity of the method. A possibility of reduction of analysis timeframe from 15 to 5 days was shown during detection of the causative agent in samples with low concentration of the latter by growing the samples and subsequent analysis of the material obtained by using RT-PCR. During detection of causative agent by using RT-PCR false negative results could appear in the presence of formaldehyde and heparin in the sample. A possibility of elimination of false negative PCR results due to concentration of the causative agent in the sample under investigation at a level below sensitivity threshold was shown on the example of Junin virus RNA detection by using growing of the pathogen in appropriate accumulation system with subsequent analysis of the

  11. Detection of small interfering RNA (siRNA) by mass spectrometry procedures in doping controls.

    Science.gov (United States)

    Thomas, Andreas; Walpurgis, Katja; Delahaut, Philippe; Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

    2013-01-01

    Uncovering manipulation of athletic performance via small interfering (si)RNA is an emerging field in sports drug testing. Due to the potential to principally knock down every target gene in the organism by means of the RNA interference pathway, this facet of gene doping has become a realistic scenario. In the present study, two distinct model siRNAs comprising 21 nucleotides were designed as double strands which were perfect counterparts to a sequence of the respective messenger RNA coding the muscle regulator myostatin of Rattus norvegicus. Several modified nucleotides were introduced in both the sense and the antisense strand comprising phosphothioates, 2'-O-methylation, 2'-fluoro-nucleotides, locked nucleic acids and a cholesterol tag at the 3'-end. The model siRNAs were applied to rats at 1 mg/kg (i.v.) and blood as well as urine samples were collected. After isolation of the RNA by means of a RNA purification kit, the target analytes were detected by liquid chromatography - high resolution/high accuracy mass spectrometry (LC-HRMS). Analytes were detected as modified nucleotides after alkaline hydrolysis, as intact oligonucleotide strands (top-down) and by means of denaturing SDS-PAGE analysis. The gel-separated siRNA was further subjected to in-gel hydrolysis with different RNases and subsequent identification of the fragments by untargeted LC-HRMS analysis (bottom-up, 'experimental RNomics'). Combining the results of all approaches, the identification of several 3'-truncated urinary metabolites was accomplished and target analytes were detected up to 24 h after a single administration. Simultaneously collected blood samples yielded no promising results. The methods were validated and found fit-for-purpose for doping controls. Copyright © 2013 John Wiley & Sons, Ltd.

  12. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Science.gov (United States)

    Martins, Patrícia; Cleary, Daniel F R; Pires, Ana C C; Rodrigues, Ana Maria; Quintino, Victor; Calado, Ricardo; Gomes, Newton C M

    2013-01-01

    The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS) with a shallow raceway system (SRS) for turbot (Scophthalmus maximus) and sole (Solea senegalensis). Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup), fish production tanks (Pro), sedimentation filter (Sed), biofilter tank (Bio), and protein skimmer (Ozo; also used as an ozone reaction chamber) of twin RAS operating in parallel (one for each fish species). Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments), Tenacibaculum discolor in turbot and sole (all compartments), Tenacibaculum soleae in turbot (all compartments) and sole (Pro, Sed and Bio), and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo) and sole (only Sed) RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  13. Molecular analysis of bacterial communities and detection of potential pathogens in a recirculating aquaculture system for Scophthalmus maximus and Solea senegalensis.

    Directory of Open Access Journals (Sweden)

    Patrícia Martins

    Full Text Available The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS with a shallow raceway system (SRS for turbot (Scophthalmus maximus and sole (Solea senegalensis. Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup, fish production tanks (Pro, sedimentation filter (Sed, biofilter tank (Bio, and protein skimmer (Ozo; also used as an ozone reaction chamber of twin RAS operating in parallel (one for each fish species. Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments, Tenacibaculum discolor in turbot and sole (all compartments, Tenacibaculum soleae in turbot (all compartments and sole (Pro, Sed and Bio, and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo and sole (only Sed RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.

  14. Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.

    Science.gov (United States)

    Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine

    2015-09-01

    In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.

  15. Label and label-free based surface-enhanced Raman scattering for pathogen bacteria detection: A review.

    Science.gov (United States)

    Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun

    2017-08-15

    Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Identification of vector-borne pathogens in dogs and cats from Southern Brazil.

    Science.gov (United States)

    Malheiros, J; Costa, M M; do Amaral, R B; de Sousa, K C M; André, M R; Machado, R Z; Vieira, M I B

    2016-07-01

    Dogs and cats are often infected with vector-borne pathogens and play a crucial role as reservoirs and hosts in their life cycles. The aim of the present study was to investigate the occurrence of vector-borne pathogens among dogs and cats in the northwestern region of Rio Grande do Sul (RS) State, Brazil. One hundred and ten blood samples were collected from dogs (n=80) and cats (n=30). Laboratory analysis were carried out through stained blood smears, indirect enzyme-linked immunosorbent assay (ELISA) for Babesia vogeli and Ehrlichia canis (only for dogs) and polymerase chain reaction (PCR) aiming the detection of pathogens. The following pathogens were screened by PCR among dogs and cats: Babesia spp. and Hepatozoon spp. (18S rRNA gene), Anaplasma spp. (16S rRNA gene), and Ehrlichia spp. (dsb gene for dogs and 16S rRNA gene for cats) and Bartonella spp. (nuoG gene only for cats). Using blood smears structures morphologically compatible with piroplasms were found in 5.45% (6/110) of the samples. Anti-B. vogeli and anti-E. canis antibodies were detected in 91% (73/80) and 9% (7/80) of the dogs, respectively. All the seropositive dogs to E. canis were also to B. vogeli. Nineteen (17.3%) animals were positive to hemoparasites by PCR. After sequencing Rangelia vitalii 6/80 (7.5%), B. vogeli 3/80 (4%), Hepatozoon spp. 1/80 (1%), and Anaplasma spp. 1/80 (1%) were found in the dogs, and B. vogeli 2/30 (7%) and Bartonella spp. 6/30 (20%) were detected in the screened cats. No sample was positive for genes dsb and 16S rRNA of Ehrlichia spp. Only those animals which were positive for R. vitalii showed findings compatible with rangeliosis, such as anemia (100%), thrombocytopenia (67%), jaundice (50%), external bleeding (50%), and anorexia (50%). This is the first time that B. vogeli detected among cats in Southern Brazil. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. Bacteriophages for detection of bacterial pathogens

    International Nuclear Information System (INIS)

    Kutateladze, M.

    2009-01-01

    The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary

  18. In Situ Detection of MicroRNA Expression with RNAscope Probes.

    Science.gov (United States)

    Yin, Viravuth P

    2018-01-01

    Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.

  19. 9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...

  20. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  1. Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria

    Science.gov (United States)

    Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon

    2013-01-01

    Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591

  2. Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.

    Directory of Open Access Journals (Sweden)

    Joshua Kamani

    Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.

  3. RNA FISH for detecting expanded repeats in human diseases.

    Science.gov (United States)

    Urbanek, Martyna O; Krzyzosiak, Wlodzimierz J

    2016-04-01

    RNA fluorescence in situ hybridization (FISH) is a widely used technique for detecting transcripts in fixed cells and tissues. Many variants of RNA FISH have been proposed to increase signal strength, resolution and target specificity. The current variants of this technique facilitate the detection of the subcellular localization of transcripts at a single molecule level. Among the applications of RNA FISH are studies on nuclear RNA foci in diseases resulting from the expansion of tri-, tetra-, penta- and hexanucleotide repeats present in different single genes. The partial or complete retention of mutant transcripts forming RNA aggregates within the nucleoplasm has been shown in multiple cellular disease models and in the tissues of patients affected with these atypical mutations. Relevant diseases include, among others, myotonic dystrophy type 1 (DM1) with CUG repeats, Huntington's disease (HD) and spinocerebellar ataxia type 3 (SCA3) with CAG repeats, fragile X-associated tremor/ataxia syndrome (FXTAS) with CGG repeats, myotonic dystrophy type 2 (DM2) with CCUG repeats, amyotrophic lateral sclerosis/frontotemporal dementia (ALS/FTD) with GGGGCC repeats and spinocerebellar ataxia type 32 (SCA32) with GGCCUG. In this article, we summarize the results obtained with FISH to examine RNA nuclear inclusions. We provide a detailed protocol for detecting RNAs containing expanded CAG and CUG repeats in different cellular models, including fibroblasts, lymphoblasts, induced pluripotent stem cells and murine and human neuronal progenitors. We also present the results of the first single-molecule FISH application in a cellular model of polyglutamine disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Multi-gene detection and identification of mosquito-borne RNA viruses using an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Nathan D Grubaugh

    Full Text Available BACKGROUND: Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae, Alphavirus (Togaviridae, Orthobunyavirus (Bunyaviridae, and Phlebovirus (Bunyaviridae. METHODOLOGY/PRINCIPAL FINDINGS: The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. CONCLUSIONS/SIGNIFICANCE: We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish

  5. Detection of pathogens from periodontal lesions

    Directory of Open Access Journals (Sweden)

    Malheiros Veruska de João

    2004-01-01

    Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.

  6. Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems

    Directory of Open Access Journals (Sweden)

    Carl A. Batt

    2009-05-01

    Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.

  7. Colonization by non-pathogenic bacteria alters mRNA expression of cytochromes P450 in originally germ-free mice.

    Science.gov (United States)

    Jourová, L; Anzenbacher, P; Lišková, B; Matušková, Z; Hermanová, P; Hudcovic, T; Kozáková, H; Hrnčířová, L; Anzenbacherová, E

    2017-11-01

    Gut microbiota provides a wide range of beneficial function for the host and has an immense effect on the host's health state. It has also been shown that gut microbiome is often involved in the biotransformation of xenobiotics; however, the molecular mechanisms of the interaction between the gut bacteria and the metabolism of drugs by the host are still unclear. To investigate the effect of microbial colonization on messenger RNA (mRNA) expression of liver cytochromes P450 (CYPs), the main drug-metabolizing enzymes, we used germ-free (GF) mice, lacking the intestinal flora and mice monocolonized by non-pathogenic bacteria Lactobacillus plantarum NIZO2877 or probiotic bacteria Escherichia coli Nissle 1917 compared to specific pathogen-free (SPF) mice. Our results show that the mRNA expression of Cyp1a2 and Cyp2e1 was significantly increased, while the expression of Cyp3a11 mRNA was decreased under GF conditions compared to the SPF mice. The both bacteria L. plantarum NIZO2877 and E. coli Nissle 1917 given to the GF mice decreased the level of Cyp1a2 mRNA and normalized it to the control level. On the other hand, the colonization by these bacteria had no effect on the expression of Cyp3a11 mRNA in the liver of the GF mice (which remained decreased). Surprisingly, monocolonization with chosen bacterial strains has shown a different effect on the expression of Cyp2e1 mRNA in GF mice. Increased level of Cyp2e1 expression observed in the GF mice was found also in mice colonized by L. plantarum NIZO2877 ; however, the colonization with probiotic E. coli Nissle 1917 caused a decrease in Cyp2e1 expression and partially restored the SPF mice conditions.

  8. An Approach to Detect and Study DNA Double-Strand Break Repair by Transcript RNA Using a Spliced-Antisense RNA Template.

    Science.gov (United States)

    Keskin, Havva; Storici, Francesca

    2018-01-01

    A double-strand break (DSB) is one of the most dangerous DNA lesion, and its repair is crucial for genome stability. Homologous recombination is considered the safest way to repair a DNA DSB and requires an identical or nearly identical DNA template, such as a sister chromatid or a homologous chromosome for accurate repair. Can transcript RNA serve as donor template for DSB repair? Here, we describe an approach that we developed to detect and study DNA repair by transcript RNA. Key features of the method are: (i) use of antisense (noncoding) RNA as template for DSB repair by RNA, (ii) use of intron splicing to distinguish the sequence of the RNA template from that of the DNA that generates the RNA template, and (iii) use of a trans and cis system to study how RNA repairs a DSB in homologous but distant DNA or in its own DNA, respectively. This chapter provides details on how to use a spliced-antisense RNA template to detect and study DSB repair by RNA in trans or cis in yeast cells. Our approach for detection of DSB repair by RNA in cells can be applied to cell types other than yeast, such as bacteria, mammalian cells, or other eukaryotic cells. © 2018 Elsevier Inc. All rights reserved.

  9. Rapid detection, characterization, and enumeration of foodborne pathogens

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey

    2011-01-01

    . The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...

  10. Convergent evolution of argonaute-2 slicer antagonism in two distinct insect RNA viruses.

    NARCIS (Netherlands)

    Mierlo, J.T. van; Bronkhorst, A.W.; Overheul, G.J.; Sadanandan, S.A.; Ekstrom, J.O.; Heestermans, M.; Hultmark, D.; Antoniewski, C.; Rij, R.P. van

    2012-01-01

    RNA interference (RNAi) is a major antiviral pathway that shapes evolution of RNA viruses. We show here that Nora virus, a natural Drosophila pathogen, is both a target and suppressor of RNAi. We detected viral small RNAs with a signature of Dicer-2 dependent small interfering RNAs in Nora virus

  11. Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.

    Science.gov (United States)

    Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G

    2016-05-01

    The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.

  12. Task 1.5 Genomic Shift and Drift Trends of Emerging Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Borucki, M

    2010-01-05

    The Lawrence Livermore National Laboratory (LLNL) Bioinformatics group has recently taken on a role in DTRA's Transformation Medical Technologies Initiative (TMTI). The high-level goal of TMTI is to accelerate the development of broad-spectrum countermeasures. To achieve those goals, TMTI has a near term need to conduct analyses of genomic shift and drift trends of emerging pathogens, with a focused eye on select agent pathogens, as well as antibiotic and virulence markers. Most emerging human pathogens are zoonotic viruses with a genome composed of RNA. The high mutation rate of the replication enzymes of RNA viruses contributes to sequence drift and provides one mechanism for these viruses to adapt to diverse hosts (interspecies transmission events) and cause new human and zoonotic diseases. Additionally, new viral pathogens frequently emerge due to genetic shift (recombination and segment reassortment) which allows for dramatic genotypic and phenotypic changes to occur rapidly. Bacterial pathogens also evolve via genetic drift and shift, although sequence drift generally occurs at a much slower rate for bacteria as compared to RNA viruses. However, genetic shift such as lateral gene transfer and inter- and intragenomic recombination enables bacteria to rapidly acquire new mechanisms of survival and antibiotic resistance. New technologies such as rapid whole genome sequencing of bacterial genomes, ultra-deep sequencing of RNA virus populations, metagenomic studies of environments rich in antibiotic resistance genes, and the use of microarrays for the detection and characterization of emerging pathogens provide mechanisms to address the challenges posed by the rapid emergence of pathogens. Bioinformatic algorithms that enable efficient analysis of the massive amounts of data generated by these technologies as well computational modeling of protein structures and evolutionary processes need to be developed to allow the technology to fulfill its potential.

  13. Advanced biosensors for detection of pathogens related to livestock and poultry.

    Science.gov (United States)

    Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole

    2017-02-21

    Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.

  14. Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis

    Science.gov (United States)

    Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.

    2002-02-01

    Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.

  15. A conformation-induced fluorescence method for microRNA detection

    DEFF Research Database (Denmark)

    Aw, Sherry S; Tang, Melissa Xm; Teo, Yin Nah

    2016-01-01

    and quantify microRNAs may aid research into novel aspects of microRNA biology and contribute to the development of diagnostics. By introducing an additional stem loop into the fluorescent RNA Spinach and altering its 3' and 5' ends, we have generated a new RNA, Pandan, that functions as the basis for a micro......MicroRNAs play important roles in a large variety of biological systems and processes through their regulation of target mRNA expression, and show promise as clinical biomarkers. However, their small size presents challenges for tagging or direct detection. Innovation in techniques to sense......RNA sensor. Pandan contains two sequence-variable stem loops that encode complementary sequence for a target microRNA of interest. In its sensor form, it requires the binding of a target microRNA in order to reconstitute the RNA scaffold for fluorophore binding and fluorescence. Binding of the target micro...

  16. Methods for detecting pathogens in the beef food chain: detecting particular pathogens

    Science.gov (United States)

    The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...

  17. Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens

    International Nuclear Information System (INIS)

    Kim, G; Om, A S; Mun, J H

    2007-01-01

    Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency

  18. SERS based point-of-care detection of food-borne pathogens

    International Nuclear Information System (INIS)

    Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh

    2016-01-01

    The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)

  19. Luciferase-Zinc-Finger System for the Rapid Detection of Pathogenic Bacteria.

    Science.gov (United States)

    Shi, Chu; Xu, Qing; Ge, Yue; Jiang, Ling; Huang, He

    2017-08-09

    Rapid and reliable detection of pathogenic bacteria is crucial for food safety control. Here, we present a novel luciferase-zinc finger system for the detection of pathogens that offers rapid and specific profiling. The system, which uses a zinc-finger protein domain to probe zinc finger recognition sites, was designed to bind the amplified conserved regions of 16S rDNA, and the obtained products were detected using a modified luciferase. The luciferase-zinc finger system not only maintained luciferase activity but also allowed the specific detection of different bacterial species, with a sensitivity as low as 10 copies and a linear range from 10 to 10 4 copies per microliter of the specific PCR product. Moreover, the system is robust and rapid, enabling the simultaneous detection of 6 species of bacteria in artificially contaminated samples with excellent accuracy. Thus, we envision that our luciferase-zinc finger system will have far-reaching applications.

  20. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  1. Dual RNA-sequencing of Eucalyptus nitens during Phytophthora cinnamomi challenge reveals pathogen and host factors influencing compatibility

    Directory of Open Access Journals (Sweden)

    Febe Elizabeth Meyer

    2016-03-01

    Full Text Available Damage caused by Phytophthora cinnamomi Rands remains an important concern on forest tree species. The pathogen causes root and collar rot, stem cankers and dieback of various economically important Eucalyptus spp. In South Africa, susceptible cold tolerant Eucalyptus plantations have been affected by various Phytophthora spp. with P. cinnamomi considered one of the most virulent. The molecular basis of this compatible interaction is poorly understood. In this study, susceptible Eucalyptus nitens plants were stem inoculated with P. cinnamomi and tissue was harvested five days post inoculation. Dual RNA-sequencing, a technique which allows the concurrent detection of both pathogen and host transcripts during infection, was performed. Approximately 1% of the reads mapped to the draft genome of P. cinnamomi while 78% of the reads mapped to the Eucalyptus grandis genome. The highest expressed P. cinnamomi gene in planta was a putative crinkler effector (CRN1. Phylogenetic analysis indicated the high similarity of this P. cinnamomi CRN1 to that of Phytophthora infestans. Some CRN effectors are known to target host nuclei to suppress defense. In the host, over 1400 genes were significantly differentially expressed in comparison to mock inoculated trees, including suites of pathogenesis related (PR genes. In particular, a PR-9 peroxidase gene with a high similarity to a Carica papaya PR-9 ortholog previously shown to be suppressed upon infection by Phytophthora palmivora was down-regulated two-fold. This PR-9 gene may represent a cross-species effector target during P. cinnamomi infection. This study identified pathogenicity factors, potential manipulation targets and attempted host defense mechanisms activated by E. nitens that contributed to the susceptible outcome of the interaction.

  2. Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria

    NARCIS (Netherlands)

    Chitarra, L.G.

    2001-01-01

    Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on

  3. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  4. Detection of melatonin receptor mRNA in human muscle

    International Nuclear Information System (INIS)

    Li Lei

    2004-01-01

    To verify the expression of melatonin receptor mRNA in human, muscle, muscle beside vertebrae was collected to obtain total RNA and the mRNA of melatonin receptor was detected by RT-PCR method. The electrophoretic results of RT-PCR products by mt 1 and MT 2 primer were all positive and the sequence is corresponding with human melatonin receptor cDNA. It suggests that melatonin may act on the muscle beside vertebrae directly and regulate its growth and development. (authors)

  5. Detection of hepatitis A virus by hybridization with single-stranded RNA probes

    International Nuclear Information System (INIS)

    Xi, J.; Estes, M.K.; Metcalf, T.G.

    1987-01-01

    An improved method of dot-blot hybridization to detect hepatitis A virus (HAV) was developed with single-stranded RNA (ssRNA) probes. Radioactive and nonradioactive ssRNA probes were generated by in vitro transcription of HAV templates inserted into the plasmid pGEM-1. 32 P-labeled ssRNA probes were at least eightfold more sensitive than the 32 P-labeled double-stranded cDNA counterparts, whereas biotin-labeled ssRNA probes showed a sensitivity comparable with that of the 32 P-labeled double-stranded cDNA counterparts. Hybridization of HAV with the ssRNA probes at high stringency revealed specific reactions with a high signal-to-noise ratio. The differential hybridization reactions seen with probes of positive and negative sense (compared with HAV genomic RNA) were used to detect HAV in clinical and field samples. A positive/negative ratio was introduced as an indicator that permitted an semiquantitative expression of a positive HAV reaction. Good agreement of this indicator was observed with normal stool samples and with HAV-seeded samples. By using this system, HAV was detected in estuarine and freshwater samples collected from a sewage-polluted bayou in Houston and a saltwater tributary of Galveston Bay

  6. Henipavirus RNA in African bats.

    Directory of Open Access Journals (Sweden)

    Jan Felix Drexler

    Full Text Available BACKGROUND: Henipaviruses (Hendra and Nipah virus are highly pathogenic members of the family Paramyxoviridae. Fruit-eating bats of the Pteropus genus have been suggested as their natural reservoir. Human Henipavirus infections have been reported in a region extending from Australia via Malaysia into Bangladesh, compatible with the geographic range of Pteropus. These bats do not occur in continental Africa, but a whole range of other fruit bats is encountered. One of the most abundant is Eidolon helvum, the African Straw-coloured fruit bat. METHODOLOGY/PRINCIPAL FINDINGS: Feces from E. helvum roosting in an urban setting in Kumasi/Ghana were tested for Henipavirus RNA. Sequences of three novel viruses in phylogenetic relationship to known Henipaviruses were detected. Virus RNA concentrations in feces were low. CONCLUSIONS/SIGNIFICANCE: The finding of novel putative Henipaviruses outside Australia and Asia contributes a significant extension of the region of potential endemicity of one of the most pathogenic virus genera known in humans.

  7. Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

    Science.gov (United States)

    Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

    2015-01-01

    The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

  8. Detection of foodborne pathogens by qPCR: A practical approach for food industry applications

    Directory of Open Access Journals (Sweden)

    María-José Chapela

    2015-12-01

    Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.

  9. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  10. Intracellular Detection of Viral Transcription and Replication Using RNA FISH

    Science.gov (United States)

    2016-05-26

    Chapter 14. Intracellular detection of viral transcription and replication using RNA FISH i. Summary/Abstract Many hemorrhagic fever viruses...only allow entirely new investigations into the replication of these viruses, but also how this method can be applied to any virus with a known...localization, TurboFISH, hemorrhagic fever virus replication 1. Introduction RNA FISH was developed as a method to visualize cellular RNA by binding a

  11. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  12. Progress in rapid detection and identification of unknown human and agricultural pathogens

    International Nuclear Information System (INIS)

    Barnes, T; Holzrichter, J F; Milanovich, F P

    1999-01-01

    The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content

  13. Imperfect pathogen detection from non-invasive skin swabs biases disease inference

    Science.gov (United States)

    DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen

    2018-01-01

    1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.

  14. Detection of Zika virus RNA in semen of asymptomatic blood donors.

    Science.gov (United States)

    Musso, D; Richard, V; Teissier, A; Stone, M; Lanteri, M C; Latoni, G; Alsina, J; Reik, R; Busch, M P

    2017-12-01

    Zika virus (ZIKV) transmission through semen donation has never been reported but the risk is supported by the detection of ZIKV in semen and the demonstration of ZIKV sexual transmission. The potential impact of ZIKV on assisted reproductive procedures should be evaluated. We tested longitudinally collected semen samples provided by asymptomatic blood donors who tested positive for ZIKV RNA in plasma during ZIKV outbreaks in Puerto Rico and Florida in 2016. Five of the 14 (35.7%) asymptomatic blood donors provided semen samples that tested positive for ZIKV RNA, with ZIKV RNA loads ranging from 8.03 × 10 3 to 2.55 × 10 6 copies/mL. Plasma collected at the same time as the semen tested negative for ZIKV RNA for most ZIKV RNA-positive semen collections; all corresponding plasma samples tested positive or equivocal for anti-ZIKV IgG antibodies and all except one tested positive for ZIKV IgM antibodies. The rate of detection of ZIKV RNA in semen in asymptomatic donors is not significantly different from the rate previously reported for symptomatic patients. Our results that show a high percentage of detection of ZIKV RNA in the semen of asymptomatic men confirm that ZIKV is a new threat for reproductive medicine and should have important implications for assisted reproductive technology. We recommend that semen donations from men at risk for ZIKV infection should be tested for ZIKV RNA, regardless of symptoms of ZIKV infection. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    Daniel Spira

    Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

  16. A whole-mount in situ hybridization method for microRNA detection in Caenorhabditis elegans.

    Science.gov (United States)

    Andachi, Yoshiki; Kohara, Yuji

    2016-07-01

    Whole-mount in situ hybridization (WISH) is an outstanding method to decipher the spatiotemporal expression patterns of microRNAs (miRNAs) and provides important clues for elucidating their functions. The first WISH method for miRNA detection was developed in zebrafish. Although this method was quickly adapted for other vertebrates and fruit flies, WISH analysis has not been successfully used to detect miRNAs in Caenorhabditis elegans Here, we show a novel WISH method for miRNA detection in C. elegans Using this method, mir-1 miRNA was detected in the body-wall muscle where the expression and roles of mir-1 miRNA have been previously elucidated. Application of the method to let-7 family miRNAs, let-7, mir-48, mir-84, and mir-241, revealed their distinct but partially overlapping expression patterns, indicating that miRNAs sharing a short common sequence were distinguishably detected. In pash-1 mutants that were depleted of mature miRNAs, signals of mir-48 miRNA were greatly reduced, suggesting that mature miRNAs were detected by the method. These results demonstrate the validity of WISH to detect mature miRNAs in C. elegans. © 2016 Andachi and Kohara; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  18. Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.

    Science.gov (United States)

    Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching

    2014-06-15

    The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Science.gov (United States)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  20. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    International Nuclear Information System (INIS)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  1. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)

    2017-01-15

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.

  2. Towards On-site Pathogen Detection Using Antibody-based Sensors

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer

    2008-01-01

    In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...

  3. Single walled carbon nanotube-based electrical biosensor for the label-free detection of pathogenic bacteria

    DEFF Research Database (Denmark)

    Yoo, S. M.; Baek, Y. K.; Shin, S.

    2016-01-01

    We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...... different pathogenic bacteria was analyzed, and conditions were optimized with different probe concentrations. Using this system, the reference strains and clinical isolates of Staphylococcus aureus and Escherichia coli were successfully detected; in both cases, the sensor showed a detection limit of 10 CFU....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....

  4. REDItools: high-throughput RNA editing detection made easy.

    Science.gov (United States)

    Picardi, Ernesto; Pesole, Graziano

    2013-07-15

    The reliable detection of RNA editing sites from massive sequencing data remains challenging and, although several methodologies have been proposed, no computational tools have been released to date. Here, we introduce REDItools a suite of python scripts to perform high-throughput investigation of RNA editing using next-generation sequencing data. REDItools are in python programming language and freely available at http://code.google.com/p/reditools/. ernesto.picardi@uniba.it or graziano.pesole@uniba.it Supplementary data are available at Bioinformatics online.

  5. Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Anurag eSharma

    2015-05-01

    Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.

  6. Detection of mastitis pathogens by analysis of volatile bacterial metabolites

    NARCIS (Netherlands)

    Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.

    2008-01-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In

  7. Design of Genomic Signatures of Pathogen Identification & Characterization

    Energy Technology Data Exchange (ETDEWEB)

    Slezak, T; Gardner, S; Allen, J; Vitalis, E; Jaing, C

    2010-02-09

    This chapter will address some of the many issues associated with the identification of signatures based on genomic DNA/RNA, which can be used to identify and characterize pathogens for biodefense and microbial forensic goals. For the purposes of this chapter, we define a signature as one or more strings of contiguous genomic DNA or RNA bases that are sufficient to identify a pathogenic target of interest at the desired resolution and which could be instantiated with particular detection chemistry on a particular platform. The target may be a whole organism, an individual functional mechanism (e.g., a toxin gene), or simply a nucleic acid indicative of the organism. The desired resolution will vary with each program's goals but could easily range from family to genus to species to strain to isolate. The resolution may not be taxonomically based but rather pan-mechanistic in nature: detecting virulence or antibiotic-resistance genes shared by multiple microbes. Entire industries exist around different detection chemistries and instrument platforms for identification of pathogens, and we will only briefly mention a few of the techniques that we have used at Lawrence Livermore National Laboratory (LLNL) to support our biosecurity-related work since 2000. Most nucleic acid based detection chemistries involve the ability to isolate and amplify the signature target region(s), combined with a technique to detect the amplification. Genomic signature based identification techniques have the advantage of being precise, highly sensitive and relatively fast in comparison to biochemical typing methods and protein signatures. Classical biochemical typing methods were developed long before knowledge of DNA and resulted in dozens of tests (Gram's stain, differential growth characteristics media, etc.) that could be used to roughly characterize the major known pathogens (of course some are uncultivable). These tests could take many days to complete and precise resolution

  8. Fluorescence In Situ Hybridization for MicroRNA Detection in Archived Oral Cancer Tissues

    Directory of Open Access Journals (Sweden)

    Zonggao Shi

    2012-01-01

    Full Text Available The noncoding RNA designated as microRNA (miRNA is a large group of small single-stranded regulatory RNA and has generated wide-spread interest in human disease studies. To facilitate delineating the role of microRNAs in cancer pathology, we sought to explore the feasibility of detecting microRNA expression in formalin-fixed paraffin-embedded (FFPE tissues. Using FFPE materials, we have compared fluorescent in situ hybridization (FISH procedures to detect miR-146a with (a different synthetic probes: regular custom DNA oligonucleotides versus locked nucleic acid (LNA incorporated DNA oligonucleotides; (b different reporters for the probes: biotin versus digoxigenin (DIG; (c different visualization: traditional versus tyramide signal amplification (TSA system; (d different blocking reagents for endogenous peroxidase. Finally, we performed miR-146a FISH on a commercially available oral cancer tissue microarray, which contains 40 cases of oral squamous cell carcinoma (OSCC and 10 cases of normal epithelia from the human oral cavity. A sample FISH protocol for detecting miR-146a is provided. In summary, we have established reliable in situ hybridization procedures for detecting the expression of microRNA in FFPE oral cancer tissues. This method is an important tool for studies on the involvement of microRNA in oral cancer pathology and may have potential prognostic or diagnostic value.

  9. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    Directory of Open Access Journals (Sweden)

    Jones Sophie

    2012-08-01

    Full Text Available Abstract Background Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Methods Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA and reverse-transcriptase PCR (RT-PCR. Results Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (p  Conclusions This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.

  10. Prevalence of pathogenic bacteria in Ixodes ricinus ticks in Central Bohemia.

    Science.gov (United States)

    Klubal, Radek; Kopecky, Jan; Nesvorna, Marta; Sparagano, Olivier A E; Thomayerova, Jana; Hubert, Jan

    2016-01-01

    Bacteria associated with the tick Ixodes ricinus were assessed in specimens unattached or attached to the skin of cats, dogs and humans, collected in the Czech Republic. The bacteria were detected by PCR in 97 of 142 pooled samples including 204 ticks, i.e. 1-7 ticks per sample, collected at the same time from one host. A fragment of the bacterial 16S rRNA gene was amplified, cloned and sequenced from 32 randomly selected samples. The most frequent sequences were those related to Candidatus Midichloria midichlori (71% of cloned sequences), followed by Diplorickettsia (13%), Spiroplasma (3%), Rickettsia (3%), Pasteurella (3%), Morganella (3%), Pseudomonas (2%), Bacillus (1%), Methylobacterium (1%) and Phyllobacterium (1%). The phylogenetic analysis of Spiroplasma 16S rRNA gene sequences showed two groups related to Spiroplasma eriocheiris and Spiroplasma melliferum, respectively. Using group-specific primers, the following potentially pathogenic bacteria were detected: Borellia (in 20% of the 142 samples), Rickettsia (12%), Spiroplasma (5%), Diplorickettsia (5%) and Anaplasma (2%). In total, 68% of I. ricinus samples (97/142) contained detectable bacteria and 13% contained two or more putative pathogenic groups. The prevalence of tick-borne bacteria was similar to the observations in other European countries.

  11. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes.

    Science.gov (United States)

    Jones, Sophie; Sutherland, Colin J; Hermsen, Cornelus; Arens, Theo; Teelen, Karina; Hallett, Rachel; Corran, Patrick; van der Vegte-Bolmer, Marga; Sauerwein, Robert; Drakeley, Chris J; Bousema, Teun

    2012-08-08

    Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL were spotted onto Whatman™ 903 Protein Saver Cards, FTA Classic Cards and 3MM filter papers that were stored under frozen, cold chain or tropical conditions for up to 13 weeks . RNA was extracted, then detected by quantitative nucleic acid sequence-based amplification (QT-NASBA) and reverse-transcriptase PCR (RT-PCR). Successful gametocyte detection was more frequently observed from the Whatman 903 Protein Saver Card compared to the Whatman FTA Classic Card, by both techniques (pFTA Classic Card but not the 903 Protein Saver Card or Whatman 3MM filter paper. The sensitivity of gametocyte detection was decreased when papers were stored at high humidity. This study indicates the Whatman 903 Protein Saver Card is better for Pfs25 mRNA sampling compared to the Whatman FTA Classic Card, and that the Whatman 3MM filter paper may prove to be a satisfactory cheaper option for Pfs25 mRNA sampling. When appropriately dried, filter papers provide a useful approach to Pfs25 mRNA sampling, especially in settings where storage in RNA-protecting buffer is not possible.

  12. Antibody array in a multiwell plate format for the sensitive and multiplexed detection of important plant pathogens.

    Science.gov (United States)

    Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara

    2014-07-15

    The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.

  13. Skin lesion-associated pathogens from Octopus vulgaris: first detection of Photobacterium swingsii, Lactococcus garvieae and betanodavirus.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Perrucci, S; Vanni, A; Cersini, A; Lenzi, C; De Wolf, T; Fronte, B; Guarducci, M; Susini, F

    2015-07-23

    The common octopus Octopus vulgaris Cuvier, 1798 is extremely important in fisheries and is a useful protein source in most Mediterranean countries. Here we investigated pathogens associated with skin lesions in 9 naturally deceased specimens that included both cultured and wild common octopus. Within 30 min after death, each octopus was stored at 4°C and microbiologically examined within 24 h. Bacterial colonies, cultured from swabs taken from the lesions, were examined using taxonomical and biochemical analyses. Vibrio alginolyticus and V. parahaemolyticus were only isolated from cultured animals. A conventional PCR targeting the 16S ribosomal RNA (rRNA) gene and sequencing were performed on 2 bacterial isolates that remained unidentified after taxonomical and biochemical analysis. The sequence results indicated that the bacteria had a 99% identity with Lactococcus garvieae and Photobacterium swingsii. L. garvieae was confirmed using a specific PCR based on the 16S-23S rRNA internal transcribed spacer region, while P. swingsii was confirmed by phylogenetic analyses. Although all animals examined were found to be infected by the protozoan species Aggregata octopiana localised in the intestines, it was also present in skin lesions of 2 of the animals. Betanodavirus was detected in both cultured and wild individuals by cell culture, PCR and electron microscopy. These findings are the first report of L. garvieae and betanodavirus from skin lesions of common octopus and the first identification of P. swingsii both in octopus skin lesions and in marine invertebrates in Italy.

  14. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  15. Molecular detection of pathogens in water--the pros and cons of molecular techniques.

    Science.gov (United States)

    Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia

    2010-08-01

    Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.

  16. Screening of Modified RNA duplexes

    DEFF Research Database (Denmark)

    Schyth, Brian Dall; Bramsen, Jesper Bertram; Kjems, Jørgen

    protection against a fish pathogenic virus. This protection corresponded with an interferon response in the fish. Here we use this fish model to screen siRNAs containing various chemical modifications of the RNA backbone for their antiviral activity, the overall aim being identification of an siRNA form......Because of sequence specific gene targeting activity siRNAs are regarded as promising active compounds in gene medicine. But one serious problem with delivering siRNAs as treatment is the now well-established non-specific activities of some RNA duplexes. Cellular reactions towards double stranded...... RNAs include the 2´-5´ oligoadenylate synthetase system, the protein kinase R, RIG-I and Toll-like receptor activated pathways all resulting in antiviral defence mechanism. We have previously shown that antiviral innate immune reactions against double stranded RNAs could be detected in vivo as partial...

  17. Subgenomic reporter RNA system for detection of alphavirus infection in mosquitoes.

    Directory of Open Access Journals (Sweden)

    J Jordan Steel

    Full Text Available Current methods for detecting real-time alphavirus (Family Togaviridae infection in mosquitoes require the use of recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which produces a translatable RNA species only when infectious virus is present and providing viral replication proteins. This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The detection system is relatively species specific and only detects closely related viruses, but can detect low levels of alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus infection in mosquito cell culture and in live transgenic mosquitoes.

  18. The fish pathogen Yersinia ruckeri produces holomycin and uses an RNA methyltransferase for self-resistance.

    Science.gov (United States)

    Qin, Zhiwei; Baker, Alexander Thomas; Raab, Andrea; Huang, Sheng; Wang, Tiehui; Yu, Yi; Jaspars, Marcel; Secombes, Christopher J; Deng, Hai

    2013-05-24

    Holomycin and its derivatives belong to a class of broad-spectrum antibacterial natural products containing a rare dithiolopyrrolone heterobicyclic scaffold. The antibacterial mechanism of dithiolopyrrolone compounds has been attributed to the inhibition of bacterial RNA polymerase activities, although the exact mode of action has not been established in vitro. Some dithiopyrrolone derivatives display potent anticancer activities. Recently the biosynthetic gene cluster of holomycin has been identified and characterized in Streptomyces clavuligerus. Here we report that the fish pathogen Yersinia ruckeri is a holomycin producer, as evidenced through genome mining, chemical isolation, and structural elucidation as well as genetic manipulation. We also identified a unique regulatory gene hom15 at one end of the gene cluster encoding a cold-shock-like protein that likely regulates the production of holomycin in low cultivation temperatures. Inactivation of hom15 resulted in a significant loss of holomycin production. Finally, gene disruption of an RNA methyltransferase gene hom12 resulted in the sensitivity of the mutant toward holomycin. A complementation experiment of hom12 restored the resistance against holomycin. Although the wild-type Escherichia coli BL21(DE3) Gold is susceptible to holomycin, the mutant harboring hom12 showed tolerance toward holomycin. High resolution liquid chromatography (LC)-ESI/MS analysis of digested RNA fragments demonstrated that the wild-type Y. ruckeri and E. coli harboring hom12 contain a methylated RNA fragment, whereas the mutated Y. ruckeri and the wild-type E. coli only contain normal non-methylated RNA fragments. Taken together, our results strongly suggest that this putative RNA methyltransferase Hom12 is the self-resistance protein that methylates the RNA of Y. ruckeri to reduce the cytotoxic effect of holomycin during holomycin production.

  19. Maximizing the chances of detecting pathogenic leptospires in mammals

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Graham, G C; Dohnt, M F

    2011-01-01

    . In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...

  20. A Viral RNA Structural Element Alters Host Recognition of Nonself RNA

    Energy Technology Data Exchange (ETDEWEB)

    Hyde, J. L.; Gardner, C. L.; Kimura, T.; White, J. P.; Liu, G.; Trobaugh, D. W.; Huang, C.; Tonelli, M.; Paessler, S.; Takeda, K.; Klimstra, W. B.; Amarasinghe, G. K.; Diamond, M. S.

    2014-01-30

    Although interferon (IFN) signaling induces genes that limit viral infection, many pathogenic viruses overcome this host response. As an example, 2'-O methylation of the 5' cap of viral RNA subverts mammalian antiviral responses by evading restriction of Ifit1, an IFN-stimulated gene that regulates protein synthesis. However, alphaviruses replicate efficiently in cells expressing Ifit1 even though their genomic RNA has a 5' cap lacking 2'-O methylation. We show that pathogenic alphaviruses use secondary structural motifs within the 5' untranslated region (UTR) of their RNA to alter Ifit1 binding and function. Mutations within the 5'-UTR affecting RNA structural elements enabled restriction by or antagonism of Ifit1 in vitro and in vivo. These results identify an evasion mechanism by which viruses use RNA structural motifs to avoid immune restriction.

  1. Detection of Leishmania RNA virus in Leishmania parasites.

    Directory of Open Access Journals (Sweden)

    Haroun Zangger

    Full Text Available Patients suffering from cutaneous leishmaniasis (CL caused by New World Leishmania (Viannia species are at high risk of developing mucosal (ML or disseminated cutaneous leishmaniasis (DCL. After the formation of a primary skin lesion at the site of the bite by a Leishmania-infected sand fly, the infection can disseminate to form secondary lesions. This metastatic phenotype causes significant morbidity and is often associated with a hyper-inflammatory immune response leading to the destruction of nasopharyngeal tissues in ML, and appearance of nodules or numerous ulcerated skin lesions in DCL. Recently, we connected this aggressive phenotype to the presence of Leishmania RNA virus (LRV in strains of L. guyanensis, showing that LRV is responsible for elevated parasitaemia, destructive hyper-inflammation and an overall exacerbation of the disease. Further studies of this relationship and the distribution of LRVs in other Leishmania strains and species would benefit from improved methods of viral detection and quantitation, especially ones not dependent on prior knowledge of the viral sequence as LRVs show significant evolutionary divergence.This study reports various techniques, among which, the use of an anti-dsRNA monoclonal antibody (J2 stands out for its specific and quantitative recognition of dsRNA in a sequence-independent fashion. Applications of J2 include immunofluorescence, ELISA and dot blot: techniques complementing an arsenal of other detection tools, such as nucleic acid purification and quantitative real-time-PCR. We evaluate each method as well as demonstrate a successful LRV detection by the J2 antibody in several parasite strains, a freshly isolated patient sample and lesion biopsies of infected mice.We propose that refinements of these methods could be transferred to the field for use as a diagnostic tool in detecting the presence of LRV, and potentially assessing the LRV-related risk of complications in cutaneous leishmaniasis.

  2. Concurrent Detection of Human Norovirus and Bacterial Pathogens in Water Samples from an Agricultural Region in Central California Coast

    Directory of Open Access Journals (Sweden)

    Peng Tian

    2017-08-01

    Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E

  3. Myeloperoxidase mRNA detection for lineage determination of leukemic blasts: retrospective analysis.

    Science.gov (United States)

    Crisan, D; Anstett, M J

    1995-07-01

    Myeloperoxidase (MPO) mRNA is an early myeloid marker; its detection in the morphologically and immunophenotypically primitive blasts of acute undifferentiated leukemia (AUL) establishes myeloid lineage and allows reclassification as acute myelogenous leukemia with minimal differentiation (AML-MO). We have previously reported a procedure for MPO mRNA detection by RT-PCR (reverse transcription-polymerase chain reaction) and an adaptation for use of routine hematology smears. This variant procedure allows retrospective analysis of mRNA and is used in the present study to evaluate the lineage of leukemic blasts in seven cases with morphology and cytochemistry consistent with AUL. All hematology smears used in this study were air-dried, unstained or Wright-stained and stored at room temperature for periods varying between 3 days and 2 years. MPO mRNA was detected in six cases, establishing the myeloid lineage of the blasts and the diagnosis of AML-MO. In the remaining case, the blasts were MPO mRNA negative, confirming the diagnosis of AUL. The RT-PCR procedure for retrospective mRNA analysis is useful in the clinical setting, due to its high specificity and sensitivity, speed (less than 24 h), safety (no radioactivity) and convenient use of routine hematology smears; it is particularly attractive in clinical situations when fresh or frozen specimens are no longer available at the time when the need for molecular diagnostics becomes apparent.

  4. Classifications within molecular subtypes enables identification of BRCA1/BRCA2 mutation carriers by RNA tumor profiling

    DEFF Research Database (Denmark)

    Larsen, Martin J; Kruse, Torben A; Tan, Qihua

    2013-01-01

    Pathogenic germline mutations in BRCA1 or BRCA2 are detected in less than one third of families with a strong history of breast cancer. It is therefore expected that mutations still remain undetected by currently used screening methods. In addition, a growing number of BRCA1/2 sequence variants...... of unclear pathogen significance are found in the families, constituting an increasing clinical challenge. New methods are therefore needed to improve the detection rate and aid the interpretation of the clinically uncertain variants. In this study we analyzed a series of 33 BRCA1, 22 BRCA2, and 128 sporadic...... tumors by RNA profiling to investigate the classification potential of RNA profiles to predict BRCA1/2 mutation status. We found that breast tumors from BRCA1 and BRCA2 mutation carriers display characteristic RNA expression patterns, allowing them to be distinguished from sporadic tumors. The majority...

  5. Detection of H5N1 high-pathogenicity avian influenza virus in meat and tracheal samples from experimentally infected chickens.

    Science.gov (United States)

    Das, Amaresh; Spackman, Erica; Thomas, Colleen; Swayne, David E; Suarez, David L

    2008-03-01

    The Asian H5N1 highly pathogenic avian influenza (HPAI) virus causes a systemic disease with high mortality of poultry and is potentially zoonotic. In both chickens and ducks, the virus has been demonstrated to replicate in both cardiac and skeletal muscle cells. Experimentally, H5N1 HPAI virus has been transmitted to chickens through the consumption of raw infected meat. In this study, we investigated virus replication in cardiac and skeletal muscle and in the trachea of chickens after experimental intranasal inoculation with the H5N1 HPAI virus. The virus was detected in tissues by real-time reverse transcription-polymerase chain reaction (RRT-PCR) and virus isolation, and in the trachea by RRT-PCR and a commercial avian influenza (AI) viral antigen detection test. A modified RNA extraction protocol was developed for rapid detection of the virus in tissues by RRT-PCR. The H5N1 HPAI virus was sporadically detected in meat and the tracheas of infected birds without any clinical sign of disease as early as 6 hr postinfection (PI), and was detected in all samples tested at 24 hr PI and later. No differences in sensitivity were seen between virus isolation and RRT-PCR in meat samples. The AI viral antigen detection test on tracheal swabs was a useful method for identifying infected chickens when they were sick or dead, but was less sensitive in detecting infected birds when they were preclinical. This study provides data indicating that preslaughter tracheal swab testing can identify birds infected with HPAI among the daily mortality and prevent infected flocks from being sent to processing plants. In addition, the modified RNA extraction and RRT-PCR test on meat samples provide a rapid and sensitive method of identifying HPAI virus in illegal contraband or domestic meat samples.

  6. Detection of mastitis pathogens by analysis of volatile bacterial metabolites.

    Science.gov (United States)

    Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M

    2008-10-01

    The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.

  7. Pathogen inactivation of Dengue virus in red blood cells using amustaline and glutathione.

    Science.gov (United States)

    Aubry, Maite; Laughhunn, Andrew; Santa Maria, Felicia; Lanteri, Marion C; Stassinopoulos, Adonis; Musso, Didier

    2017-12-01

    Dengue virus (DENV) is an arbovirus primarily transmitted through mosquito bite; however, DENV transfusion-transmitted infections (TTIs) have been reported and asymptomatic DENV RNA-positive blood donors have been identified in endemic countries. DENV is considered a high-risk pathogen for blood safety. One of the mitigation strategies to prevent arbovirus TTIs is pathogen inactivation. In this study we demonstrate that the amustaline and glutathione (S-303/GSH) treatment previously found effective against Zika virus in red blood cells (RBCs) is also effective in inactivating DENV. Red blood cells were spiked with high levels of DENV. Viral RNA loads and infectious titers were measured in the untreated control and before and after pathogen inactivation treatment of RBC samples. DENV infectivity was also assessed over five successive cell culture passages to detect any potential residual replicative virus. The mean ± SD DENV titer in RBCs before inactivation was 6.61 ± 0.19 log 50% tissue culture infectious dose (TCID 50 )/mL and the mean viral RNA load was 8.42 log genome equivalents/mL. No replicative DENV was detected either immediately after completion of treatment using S-303/GSH or after cell culture passages. Treatment using S-303/GSH inactivated high levels of DENV in RBCs to the limit of detection. In combination with previous studies showing the effective inactivation of DENV in plasma and platelets using the licensed amotosalen/UVA system, this study demonstrates that high levels of DENV can be inactivated in all blood components. © 2017 The Authors Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  8. Detection of tmRNA molecules on microarrays at low temperatures using helper oligonucleotides

    Directory of Open Access Journals (Sweden)

    Palta Priit

    2010-04-01

    Full Text Available Abstract Background The hybridization of synthetic Streptococcus pneumoniae tmRNA on a detection microarray is slow at 34°C resulting in low signal intensities. Results We demonstrate that adding specific DNA helper oligonucleotides (chaperones to the hybridization buffer increases the signal strength at a given temperature and thus makes the specific detection of Streptococcus pneumoniae tmRNA more sensitive. No loss of specificity was observed at low temperatures compared to hybridization at 46°C. The effect of the chaperones can be explained by disruption of the strong secondary and tertiary structure of the target RNA by the selective hybridization of helper molecules. The amplification of the hybridization signal strength by chaperones is not necessarily local; we observed increased signal intensities in both local and distant regions of the target molecule. Conclusions The sensitivity of the detection of tmRNA at low temperature can be increased by chaperone oligonucleotides. Due to the complexity of RNA secondary and tertiary structures the effect of any individual chaperone is currently not predictable.

  9. Rank-Based miRNA Signatures for Early Cancer Detection

    Directory of Open Access Journals (Sweden)

    Mario Lauria

    2014-01-01

    Full Text Available We describe a new signature definition and analysis method to be used as biomarker for early cancer detection. Our new approach is based on the construction of a reference map of transcriptional signatures of both healthy and cancer affected individuals using circulating miRNA from a large number of subjects. Once such a map is available, the diagnosis for a new patient can be performed by observing the relative position on the map of his/her transcriptional signature. To demonstrate its efficacy for this specific application we report the results of the application of our method to published datasets of circulating miRNA, and we quantify its performance compared to current state-of-the-art methods. A number of additional features make this method an ideal candidate for large-scale use, for example, as a mass screening tool for early cancer detection or for at-home diagnostics. Specifically, our method is minimally invasive (because it works well with circulating miRNA, it is robust with respect to lab-to-lab protocol variability and batch effects (it requires that only the relative ranking of expression value of miRNA in a profile be accurate not their absolute values, and it is scalable to a large number of subjects. Finally we discuss the need for HPC capability in a widespread application of our or similar methods.

  10. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  11. Detection of siRNA Mediated Target mRNA Cleavage Activities in Human Cells by a Novel Stem-Loop Array RT-PCR Analysis

    Science.gov (United States)

    2016-09-07

    sequences of the target mRNA, and a double stranded stem at the 5′ end that forms a stem -loop to function as a forceps to stabilize the secondary...E-mjournal homepage: www.elsevier.com/locate/bbrepDetection of siRNA-mediated target mRNA cleavage activities in human cells by a novel stem -loop...challenges for the accurate and efficient detection and verification of cleavage sites on target mRNAs. Here we used a sensitive stem -loop array reverse

  12. Ratiometric FRET-based detection of DNA and micro-RNA in solution

    International Nuclear Information System (INIS)

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy

    2009-01-01

    A ratiometric method for detecting DNA oligomers in bulk solution based on Foerster resonance energy transfer (FRET) is described. The two fluorescence signals (green and red), originating from Cy3 (donor, green) and Cy5 (acceptor, red) labels, are simultaneously detected from the pre-hybridized Cy3oligomerY:Cy5oligomerX system. The ratio of red to green intensities is sensitive to the presence of the single-stranded complimentary oligomer, which replaces single-stranded Cy3oligomerY in the donor:acceptor complex and perturbs the FRET. The detection scheme is generally applicable to the detection of DNA and RNA, and particularly micro-RNA. The proposed method is applicable to various double-stranded various lengths targets (manipulation of the sample preparation conditions, such as temperature, incubation time, denaturizing agent, may be needed).

  13. Plant Responses to Pathogen Attack: Small RNAs in Focus.

    Science.gov (United States)

    Islam, Waqar; Noman, Ali; Qasim, Muhammad; Wang, Liande

    2018-02-08

    Small RNAs (sRNA) are a significant group of gene expression regulators for multiple biological processes in eukaryotes. In plants, many sRNA silencing pathways produce extensive array of sRNAs with specialized roles. The evidence on record advocates for the functions of sRNAs during plant microbe interactions. Host sRNAs are reckoned as mandatory elements of plant defense. sRNAs involved in plant defense processes via different pathways include both short interfering RNA (siRNA) and microRNA (miRNA) that actively regulate immunity in response to pathogenic attack via tackling pathogen-associated molecular patterns (PAMPs) and other effectors. In response to pathogen attack, plants protect themselves with the help of sRNA-dependent immune systems. That sRNA-mediated plant defense responses play a role during infections is an established fact. However, the regulations of several sRNAs still need extensive research. In this review, we discussed the topical advancements and findings relevant to pathogen attack and plant defense mediated by sRNAs. We attempted to point out diverse sRNAs as key defenders in plant systems. It is hoped that sRNAs would be exploited as a mainstream player to achieve food security by tackling different plant diseases.

  14. Human pathogens in plant biofilms: Formation, physiology, and detection.

    Science.gov (United States)

    Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael

    2017-07-01

    Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Immuno-Northern Blotting: Detection of RNA Modifications by Using Antibodies against Modified Nucleosides.

    Directory of Open Access Journals (Sweden)

    Eikan Mishima

    Full Text Available The biological roles of RNA modifications are still largely not understood. Thus, developing a method for detecting RNA modifications is important for further clarification. We developed a method for detecting RNA modifications called immuno-northern blotting (INB analysis and herein introduce its various capabilities. This method involves the separation of RNAs using either polyacrylamide or agarose gel electrophoresis, followed by transfer onto a nylon membrane and subsequent immunoblotting using antibodies against modified nucleosides for the detection of specific modifications. We confirmed that INB with the antibodies for 1-methyladenosine (m1A, N6-methyladenosine (m6A, pseudouridine, and 5-methylcytidine (m5C showed different modifications in a variety of RNAs from various species and organelles. INB with the anti-m5C antibody revealed that the antibody cross-reacted with another modification on DNA, suggesting the application of this method for characterization of the antibody for modified nucleosides. Additionally, using INB with the antibody for m1A, which is a highly specific modification in eukaryotic tRNA, we detected tRNA-derived fragments known as tiRNAs under the cellular stress response, suggesting the application for tracking target RNA containing specific modifications. INB with the anti-m6A antibody confirmed the demethylation of m6A by the specific demethylases fat mass and obesity-associated protein (FTO and ALKBH5, suggesting its application for quantifying target modifications in separated RNAs. Furthermore, INB demonstrated that the knockdown of FTO and ALKBH5 increased the m6A modification in small RNAs as well as in mRNA. The INB method has high specificity, sensitivity, and quantitative capability, and it can be employed with conventional experimental apparatus. Therefore, this method would be useful for research on RNA modifications and metabolism.

  16. Immuno-Northern Blotting: Detection of RNA Modifications by Using Antibodies against Modified Nucleosides.

    Science.gov (United States)

    Mishima, Eikan; Jinno, Daisuke; Akiyama, Yasutoshi; Itoh, Kunihiko; Nankumo, Shinnosuke; Shima, Hisato; Kikuchi, Koichi; Takeuchi, Yoichi; Elkordy, Alaa; Suzuki, Takehiro; Niizuma, Kuniyasu; Ito, Sadayoshi; Tomioka, Yoshihisa; Abe, Takaaki

    2015-01-01

    The biological roles of RNA modifications are still largely not understood. Thus, developing a method for detecting RNA modifications is important for further clarification. We developed a method for detecting RNA modifications called immuno-northern blotting (INB) analysis and herein introduce its various capabilities. This method involves the separation of RNAs using either polyacrylamide or agarose gel electrophoresis, followed by transfer onto a nylon membrane and subsequent immunoblotting using antibodies against modified nucleosides for the detection of specific modifications. We confirmed that INB with the antibodies for 1-methyladenosine (m1A), N6-methyladenosine (m6A), pseudouridine, and 5-methylcytidine (m5C) showed different modifications in a variety of RNAs from various species and organelles. INB with the anti-m5C antibody revealed that the antibody cross-reacted with another modification on DNA, suggesting the application of this method for characterization of the antibody for modified nucleosides. Additionally, using INB with the antibody for m1A, which is a highly specific modification in eukaryotic tRNA, we detected tRNA-derived fragments known as tiRNAs under the cellular stress response, suggesting the application for tracking target RNA containing specific modifications. INB with the anti-m6A antibody confirmed the demethylation of m6A by the specific demethylases fat mass and obesity-associated protein (FTO) and ALKBH5, suggesting its application for quantifying target modifications in separated RNAs. Furthermore, INB demonstrated that the knockdown of FTO and ALKBH5 increased the m6A modification in small RNAs as well as in mRNA. The INB method has high specificity, sensitivity, and quantitative capability, and it can be employed with conventional experimental apparatus. Therefore, this method would be useful for research on RNA modifications and metabolism.

  17. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    Science.gov (United States)

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  18. Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation

    Directory of Open Access Journals (Sweden)

    Caroline K. Glidden

    2018-01-01

    Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was

  19. A deep learning method for lincRNA detection using auto-encoder algorithm.

    Science.gov (United States)

    Yu, Ning; Yu, Zeng; Pan, Yi

    2017-12-06

    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

  20. Comparison of various methods of detection of different forms of dengue virus type 2 RNA in cultured cells

    International Nuclear Information System (INIS)

    Liu, H.S.; Lin, Y.L.; Chen, C.C.

    1997-01-01

    In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)

  1. RNA interference for performance enhancement and detection in doping control.

    Science.gov (United States)

    Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

    2011-10-01

    RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

  2. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Directory of Open Access Journals (Sweden)

    Yong Huang

    Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  3. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    Science.gov (United States)

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  4. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Science.gov (United States)

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  5. Detection of the emerging amphibian pathogens Batrachochytrium dendrobatidis and ranavirus in Russia

    Science.gov (United States)

    Reshetnikov, Andrey N.; Chestnut, Tara E.; Brunner, Jesse L.; Charles, Kaylene M.; Nebergall, Emily E.; Olson, Deanna H.

    2014-01-01

    In a population of the European common toad Bufo bufo from a rural pond in the region of Lake Glubokoe Regional Reserve in Moscow province, Russia, unexplained mass mortality events involving larvae and metamorphs have been observed over a monitoring period of >20 yr. We tested toads from this and a nearby site for the emerging amphibian pathogens Batrachochytrium dendrobatidis (Bd) and ranavirus (Rv). Both pathogens were detected, and at the rural pond site, with the above-noted losses and decline in toad breeding success, 40% of B. bufo metamorphs were Bd positive, 46% were Rv positive and 20% were co-infected with both pathogens. Toad metamorphs from a neighbouring water body were also Bd and Rv positive (25 and 55%, respectively). This is the first confirmation of these pathogens in Russia. Questions remain as to the origins of these pathogens in Russia and their roles in documented mass mortality events.

  6. Pathogenicity of Highly Pathogenic Avian Influenza Virus H5N1 in Naturally Infected Poultry in Egypt.

    Directory of Open Access Journals (Sweden)

    Ibrahim Thabet Hagag

    Full Text Available Highly pathogenic avian influenza virus (HPAIV H5N1 has been endemic in Egypt since 2006, and there is increasing concern for its potential to become highly transmissible among humans. Infection by HPAIV H5N1 has been described in experimentally challenged birds. However, the pathogenicity of the H5N1 isolated in Egypt has never been reported in naturally infected chickens and ducks. Here we report a 2013 outbreak of HPAIV H5N1 in commercial poultry farms and backyards in Sharkia Province, Egypt. The main symptoms were ecchymosis on the shanks and feet, cyanosis of the comb and wattles, subcutaneous edema of the head and neck for chickens, and nervous signs (torticollis for ducks. Within 48-72 hrs of the onset of illness, the average mortality rates were 22.8-30% and 28.5-40% in vaccinated chickens and non-vaccinated ducks, respectively. Tissue samples of chickens and ducks were collected for analyses with cross-section immunohistochemistry and real-time RT-PCR for specific viral RNA transcripts. While viral RNA was detected in nearly all tissues and sera collected, viral nucleoprotein was detected almost ubiquitously in all tissues, including testis. Interestingly, viral antigen was also observed in endothelial cells of most organs in chickens, and clearly detected in the trachea and brain in particular. Viral nucleoprotein was also detected in mononuclear cells of various organs, especially pulmonary tissue. We performed phylogenetic analyses and compared the genomic sequences of the hemagglutinin (HA and nonstructural proteins (NS among the isolated viruses, the HPAIV circulated in Egypt in the past and currently, and some available vaccine strains. Further analysis of deduced amino acids of both HA and NS1 revealed that our isolates carried molecular determinants of HPAIV, including the multibasic amino acids (PQGERRRK/KR*GLF in the cleavage site in HA and glutamate at position 92 (D92E in NS1. This is the first report of the pathogenicity

  7. Detection of bacteriophage phi 6 minus-strand RNA and novel mRNA isoconformers synthesized in vivo and in vitro, by strand-separating agarose gels

    International Nuclear Information System (INIS)

    Pagratis, N.; Revel, H.R.

    1990-01-01

    Two urea-free agarose gel protocols that resolve the six individual strands of bacteriophage phi 6 dsRNA were developed and used to analyze phage RNA synthesis in vivo and in vitro. Citrate gels separate strands of the large and medium chromosomes while Tris-borate-EDTA (TBE) gels resolve the medium and small dsRNA segments. Minus strands migrate faster than plus strands on citrate gels but are retarded on TBE gels. A study of electrophoretic conditions showed that pH affects strand resolution on citrate gels, and that voltage gradient, agarose concentration, and ethidium bromide significantly alter strand migration on TBE gels. Analysis of native phi 6 RNA synthesized in vivo and in vitro showed that the large and medium message RNAs comigrate with the corresponding plus strands of denatured virion dsRNA. The small messenger RNA is exceptional. Native small mRNA was detected as three isoconformers in vivo and in vitro. The isoconformers were converted by heat denaturation to a single RNA species that comigrates with the virion s+ strand. Minus strands labeled in vivo were detected only after heat denaturation. Minus strand synthesis was detected also in heat-denatured samples from in vitro phi 6 nucleocapsid RNA polymerase reactions at pH values suboptimal for transcription

  8. Genes under positive selection in a model plant pathogenic fungus, Botrytis.

    Science.gov (United States)

    Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

    2012-07-01

    The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Ultrasensitive and Facile Detection of MicroRNA via a Portable Pressure Meter.

    Science.gov (United States)

    Shi, Lu; Lei, Jing; Zhang, Bei; Li, Baoxin; Yang, Chaoyong James; Jin, Yan

    2018-04-18

    The upregulation of microRNA (miRNA) is highly related with some kinds of tumor, such as breast, prostate, lung, and pancreatic cancers. Therefore, for an important tumor biomarker, the point-of-care testing (POCT) of miRNA is of significant importance and is in great demand for disease diagnosis and clinical prognoses. Herein, a POCT assay for miRNA detection was developed via a portable pressure meter. Two hairpin DNA probes, H1 and H2, were ingeniously designed and functionalized with magnetic beads (MBs) and platinum nanoparticles (PtNPs), respectively, to form MBs-H1 and PtNPs-H2 complexes. In the presence of target microRNA 21 (miR-21), the cyclic strand displacement reaction (SDR) between MBs-H1 and PtNPs-H2 was triggered to continuously form the MBs-H1/PtNPs-H2 duplex. Owing to the amplification of cyclic SDR, numerous PtNPs were enriched onto the surface of MBs to catalytically decompose H 2 O 2 for the generation of much O 2 . The gas pressure value has a linear relationship with the logarithmic value of miR-21 concentration in the range of 10 fM to 10 pM. The limit of detection is 7.6 fM, which is more sensitive than that in a number of previous reports. Hairpin DNA probes and magnetic separation highly ensured the specificity and reliability. Single-base mutation was easily discriminated, and the detection of miR-21 in the serum sample achieved satisfactory result. Therefore, it offers a reliable POCT strategy for the detection of miRNA, which is of great theoretical and practical importance for POCT clinical diagnostics.

  10. Simultaneous detection of mRNA and protein stem cell markers in live cells

    Directory of Open Access Journals (Sweden)

    Bao Gang

    2009-04-01

    Full Text Available Abstract Background Biological studies and medical application of stem cells often require the isolation of stem cells from a mixed cell population, including the detection of cancer stem cells in tumor tissue, and isolation of induced pluripotent stem cells after eliciting the expression of specific genes in adult cells. Here we report the detection of Oct-4 mRNA and SSEA-1 protein in live carcinoma stem cells using respectively molecular beacon and dye-labeled antibody, aiming to establish a new method for stem cells detection and isolation. Results Quantification of Oct-4 mRNA and protein in P19 mouse carcinoma stem cells using respectively RT-PCR and immunocytochemistry confirmed that their levels drastically decreased after differentiation. To visualize Oct-4 mRNA in live stem cells, molecular beacons were designed, synthesized and validated, and the detection specificity was confirmed using control studies. We found that the fluorescence signal from Oct-4-targeting molecular beacons provides a clear discrimination between undifferentiated and retinoic acid-induced differentiated cells. Using deconvolution fluorescence microscopy, Oct-4 mRNAs were found to reside on one side of the cytosol. We demonstrated that, using a combination of Oct-4 mRNA-targeting molecular beacon with SSEA-1 antibody in flow cytometric analysis, undifferentiated stem cells can be clearly distinguished from differentiated cells. We revealed that Oct-4 targeting molecular beacons do not seem to affect stem cell biology. Conclusion Molecular beacons have the potential to provide a powerful tool for highly specific detection and isolation of stem cells, including cancer stem cells and induced pluripotent stem (iPS cells without disturbing cell physiology. It is advantageous to perform simultaneous detection of intracellular (mRNA and cell-surface (protein stem cell markers in flow cytometric analysis, which may lead to high detection sensitivity and efficiency.

  11. New Trends in Impedimetric Biosensors for the Detection of Foodborne Pathogenic Bacteria

    Science.gov (United States)

    Wang, Yixian; Ye, Zunzhong; Ying, Yibin

    2012-01-01

    The development of a rapid, sensitive, specific method for the foodborne pathogenic bacteria detection is of great importance to ensure food safety and security. In recent years impedimetric biosensors which integrate biological recognition technology and impedance have gained widespread application in the field of bacteria detection. This paper presents an overview on the progress and application of impedimetric biosensors for detection of foodborne pathogenic bacteria, particularly the new trends in the past few years, including the new specific bio-recognition elements such as bacteriophage and lectin, the use of nanomaterials and microfluidics techniques. The applications of these new materials or techniques have provided unprecedented opportunities for the development of high-performance impedance bacteria biosensors. The significant developments of impedimetric biosensors for bacteria detection in the last five years have been reviewed according to the classification of with or without specific bio-recognition element. In addition, some microfluidics systems, which were used in the construction of impedimetric biosensors to improve analytical performance, are introduced in this review. PMID:22737018

  12. A non-canonical RNA degradation pathway suppresses RNAi-dependent epimutations in the human fungal pathogen Mucor circinelloides.

    Science.gov (United States)

    Calo, Silvia; Nicolás, Francisco E; Lee, Soo Chan; Vila, Ana; Cervantes, Maria; Torres-Martinez, Santiago; Ruiz-Vazquez, Rosa M; Cardenas, Maria E; Heitman, Joseph

    2017-03-01

    Mucorales are a group of basal fungi that includes the casual agents of the human emerging disease mucormycosis. Recent studies revealed that these pathogens activate an RNAi-based pathway to rapidly generate drug-resistant epimutant strains when exposed to stressful compounds such as the antifungal drug FK506. To elucidate the molecular mechanism of this epimutation pathway, we performed a genetic analysis in Mucor circinelloides that revealed an inhibitory role for the non-canonical RdRP-dependent Dicer-independent silencing pathway, which is an RNAi-based mechanism involved in mRNA degradation that was recently identified. Thus, mutations that specifically block the mRNA degradation pathway, such as those in the genes r3b2 and rdrp3, enhance the production of drug resistant epimutants, similar to the phenotype previously described for mutation of the gene rdrp1. Our genetic analysis also revealed two new specific components of the epimutation pathway related to the quelling induced protein (qip) and a Sad-3-like helicase (rnhA), as mutations in these genes prevented formation of drug-resistant epimutants. Remarkably, drug-resistant epimutant production was notably increased in M. circinelloides f. circinelloides isolates from humans or other animal hosts. The host-pathogen interaction could be a stressful environment in which the phenotypic plasticity provided by the epimutant pathway might provide an advantage for these strains. These results evoke a model whereby balanced regulation of two different RNAi pathways is determined by the activation of the RNAi-dependent epimutant pathway under stress conditions, or its repression when the regular maintenance of the mRNA degradation pathway operates under non-stress conditions.

  13. A non-canonical RNA degradation pathway suppresses RNAi-dependent epimutations in the human fungal pathogen Mucor circinelloides.

    Directory of Open Access Journals (Sweden)

    Silvia Calo

    2017-03-01

    Full Text Available Mucorales are a group of basal fungi that includes the casual agents of the human emerging disease mucormycosis. Recent studies revealed that these pathogens activate an RNAi-based pathway to rapidly generate drug-resistant epimutant strains when exposed to stressful compounds such as the antifungal drug FK506. To elucidate the molecular mechanism of this epimutation pathway, we performed a genetic analysis in Mucor circinelloides that revealed an inhibitory role for the non-canonical RdRP-dependent Dicer-independent silencing pathway, which is an RNAi-based mechanism involved in mRNA degradation that was recently identified. Thus, mutations that specifically block the mRNA degradation pathway, such as those in the genes r3b2 and rdrp3, enhance the production of drug resistant epimutants, similar to the phenotype previously described for mutation of the gene rdrp1. Our genetic analysis also revealed two new specific components of the epimutation pathway related to the quelling induced protein (qip and a Sad-3-like helicase (rnhA, as mutations in these genes prevented formation of drug-resistant epimutants. Remarkably, drug-resistant epimutant production was notably increased in M. circinelloides f. circinelloides isolates from humans or other animal hosts. The host-pathogen interaction could be a stressful environment in which the phenotypic plasticity provided by the epimutant pathway might provide an advantage for these strains. These results evoke a model whereby balanced regulation of two different RNAi pathways is determined by the activation of the RNAi-dependent epimutant pathway under stress conditions, or its repression when the regular maintenance of the mRNA degradation pathway operates under non-stress conditions.

  14. Concentration of circulating miRNA-containing particles in serum enhances miRNA detection and reflects CRC tissue-related deregulations.

    Science.gov (United States)

    ElSharawy, Abdou; Röder, Christian; Becker, Thomas; Habermann, Jens K; Schreiber, Stefan; Rosenstiel, Philip; Kalthoff, Holger

    2016-11-15

    The emerging potential of miRNAs as biomarkers for cancer detection demands parallel evaluation of strategies for reliable identification of disease-related signatures from easily accessible and pertinent body compartments. Here, we addressed whether efficient concentration of circulating miRNA-carrying particles is a rationale for miRNA biomarker discovery. We systematically compared miRNA signatures in 93 RNA preparations from three serum entities (whole serum, particle-concentrated, and particle-depleted fractions) and corresponding tissue samples from patients with colorectal cancer (CRC) as a model disease. Significant differences between whole sera and particle-concentrated serum fractions of CRC patients emerged for 45 of 742 tested miRNAs. Twenty-eight of these 45 miRNAs were differentially expressed between particle-concentrated serum fractions of metastatic CRC- and healthy individuals. Over half of these candidates (15 of 28) showed deregulations only in concentrated serum fractions, but not in whole sera, compared to the respective controls.Our results also provided evidence of a consistent downregulation of miR-486 and miR-92a, and further showed a possible "strand-specific" deregulation of extracellular miRNAs in CRC. More importantly, most of the identified miRNAs in the enriched sera reflected the patterns of the corresponding tumor tissues and showed links to cancer-related inflammation. Further investigation of seven serum pools revealed a subset of potential extracellular miRNA candidates to be implicated in both neoplastic and inflammatory bowel disease.Our findings demonstrate that enrichment and sensitive detection of miRNA carriers is a promising approach to detect CRC-related pathological changes in liquid biopsies, and has potential for clinical diagnostics.

  15. Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens

    Science.gov (United States)

    2017-04-28

    pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...life to boost their capability for rapid determination of clean water sources during field deployment. Despite the promising results of these studies

  16. An improved specimens handling procedure for pathogen detection of the cerebrospinal fluid by microscope

    Directory of Open Access Journals (Sweden)

    WANG Hua-cheng

    2013-02-01

    Full Text Available Background The diagnosis of encephalitis depends on the finding of pathogens in the brain parenchyma or cerebrospinal fluid (CSF. But the success rates of finding pathogens by microscope are low by the traditional specimens handling procedure in which pathogens are detected by direct centrifugation of CSF getting from lumbar puncture. The process of pathogen collection from the CSF such as centrifugation and washing would cause the destruction and loss of pathogens, resulting in a lower rate of pathogen discovery. Therefore, in order to increase the detection rate of pathogenic microorganisms in CSF, these traditional steps need to be improved. Methods CSF samples of 23 patients with suspected viral encephalitis and 10 control patients with fracture were prepared by two methods: traditional specimens handling procedure (TSHP and improved specimens handling procedure (ISHP. In the ISHP, a final concentration of 2.5% glutaraldehyde was added to CSF in a glass tube, mixed and kept not moving in 4 ℃ for 2 to 4 h or in 37 ℃for 1 h. Then a smear was made from the sediment formed in the tube to check pathogens by microscope. As for the TSHP, pathogens were collected by direct centrifugation of CSF which had not been treated after lumbar puncture, and checked through Gimenze staining. Results There was no statistically significant difference between the two dealing procedures in the control group ( P = 1.000. As for the case group, there were 10 cases showing positive in Pandy test after TSHP, and visible sediments were seen in all the 23 cases after ISHP. There was statistically significant difference between two kinds of CSF treatment for the finding of pathogens (P = 0.000. Seven cases presented pathogen growth in CSF and were diagosed as rickettsial infections by Gimenze staining, immunofluorescence assay (IFA and polymerase chain reaction (PCR. Conclusion Improved specimens handling procedures of CSF contribute to the seperation of cells

  17. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  18. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens.

    Directory of Open Access Journals (Sweden)

    Manas K Akmatov

    Full Text Available BACKGROUND: The need for the timely collection of diagnostic biosamples during symptomatic episodes represents a major obstacle to large-scale studies on acute respiratory infection (ARI epidemiology. This may be circumvented by having the participants collect their own nasal swabs. We compared self- and staff-collected swabs in terms of swabbing quality and detection of viral respiratory pathogens. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a prospective study among employees of our institution during the ARI season 2010/2011 (December-March. Weekly emails were sent to the participants (n = 84, reminding them to come to the study center in case of new symptoms. The participants self-collected an anterior nasal swab from one nostril, and trained study personnel collected one from the other nostril. The participants self-collected another two swabs (one from each nostril on a subsequent day. Human β-actin DNA concentration was determined in the swabs as a quality control. Viral respiratory pathogens were detected by multiplex RT-PCR (Seeplex RV15 kit, Seegene, Eschborn, Germany. Of 84 participants, 56 (67% reported at least one ARI episode, 18 participants two, and one participant three. Self-swabbing was highly accepted by the participants. The amount of β-actin DNA per swab was higher in the self- than in the staff-collected swabs (p = 0.008. β-actin concentration was lower in the self-swabs collected on day 1 than in those collected on a subsequent day (p<0.0001. A respiratory viral pathogen was detected in 31% (23/75 of staff- and in 35% (26/75 of self-collected swabs (p = 0.36. With both approaches, the most frequently identified pathogens were human rhinoviruses A/B/C (12/75 swabs, 16% and human coronavirus OC43 (4/75 swabs, 5%. There was almost perfect agreement between self- and staff-collected swabs in terms of pathogen detection (agreement = 93%, kappa = 0.85, p<0.0001. CONCLUSIONS/SIGNIFICANCE: Nasal self

  19. High throughput screening strategies and technology platforms for detection of pathogens: An Introduction

    Science.gov (United States)

    Globally, foodborne pathogens are a major public health concern. In this chapter, we provide a broad description of the problem of food-borne diseases and current and future detection technologies for food safety assurance and prevention of foodborne illnesses. Current detection approaches include s...

  20. Monoclonal antibody-based Surface Plasmon Resonance sensors for pathogen detection

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand

    2007-01-01

    essentially transforms molecular interactions into a digital signal, thereby making detection of analytes label-free. Biosensors are used for detection of analytes ranging from small drug molecules to food- and waterborne microorganisms as well as biowarfare pathogens. In future farming, plant production......A biosensor is an analytical device, which incorporates a biological sensing element integrated within a physicochemical transducer. The aim of a biosensor is to produce an electronic signal, which is proportional to the interaction of analytes with the sensing element. This means that the sensor...

  1. Synthetic mRNA devices that detect endogenous proteins and distinguish mammalian cells.

    Science.gov (United States)

    Kawasaki, Shunsuke; Fujita, Yoshihiko; Nagaike, Takashi; Tomita, Kozo; Saito, Hirohide

    2017-07-07

    Synthetic biology has great potential for future therapeutic applications including autonomous cell programming through the detection of protein signals and the production of desired outputs. Synthetic RNA devices are promising for this purpose. However, the number of available devices is limited due to the difficulty in the detection of endogenous proteins within a cell. Here, we show a strategy to construct synthetic mRNA devices that detect endogenous proteins in living cells, control translation and distinguish cell types. We engineered protein-binding aptamers that have increased stability in the secondary structures of their active conformation. The designed devices can efficiently respond to target proteins including human LIN28A and U1A proteins, while the original aptamers failed to do so. Moreover, mRNA delivery of an LIN28A-responsive device into human induced pluripotent stem cells (hiPSCs) revealed that we can distinguish living hiPSCs and differentiated cells by quantifying endogenous LIN28A protein expression level. Thus, our endogenous protein-driven RNA devices determine live-cell states and program mammalian cells based on intracellular protein information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. A statistical method for the detection of alternative splicing using RNA-seq.

    Directory of Open Access Journals (Sweden)

    Liguo Wang

    2010-01-01

    Full Text Available Deep sequencing of transcriptome (RNA-seq provides unprecedented opportunity to interrogate plausible mRNA splicing patterns by mapping RNA-seq reads to exon junctions (thereafter junction reads. In most previous studies, exon junctions were detected by using the quantitative information of junction reads. The quantitative criterion (e.g. minimum of two junction reads, although is straightforward and widely used, usually results in high false positive and false negative rates, owning to the complexity of transcriptome. Here, we introduced a new metric, namely Minimal Match on Either Side of exon junction (MMES, to measure the quality of each junction read, and subsequently implemented an empirical statistical model to detect exon junctions. When applied to a large dataset (>200M reads consisting of mouse brain, liver and muscle mRNA sequences, and using independent transcripts databases as positive control, our method was proved to be considerably more accurate than previous ones, especially for detecting junctions originated from low-abundance transcripts. Our results were also confirmed by real time RT-PCR assay. The MMES metric can be used either in this empirical statistical model or in other more sophisticated classifiers, such as logistic regression.

  3. Rapid multiplex detection of 10 foodborne pathogens with an up-converting phosphor technology-based 10-channel lateral flow assay

    Science.gov (United States)

    Zhao, Yong; Wang, Haoran; Zhang, Pingping; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Yang, Ruifu; Wang, Chengbin; Zhou, Lei

    2016-01-01

    The rapid high-throughput detection of foodborne pathogens is essential in controlling food safety. In this study, a 10-channel up-converting phosphor technology-based lateral flow (TC-UPT-LF) assay was established for the rapid and simultaneous detection of 10 epidemic foodborne pathogens. Ten different single-target UPT-LF strips were developed and integrated into one TC-UPT-LF disc with optimization. Without enrichment the TC-UPT-LF assay had a detection sensitivity of 104 CFU mL−1 or 105 CFU mL−1 for each pathogen, and after sample enrichment it was 10 CFU/0.6 mg. The assay also showed good linearity, allowing quantitative detection, with a linear fitting coefficient of determination (R2) of 0.916–0.998. The 10 detection channels did not cross-react, so multiple targets could be specifically detected. When 279 real food samples were tested, the assay was highly consistent (100%) with culture-based methods. The results for 110 food samples artificially contaminated with single or multiple targets showed a high detection rate (≥80%) for most target bacteria. Overall, the TC-UPT-LF assay allows the rapid, quantitative, and simultaneous detection of 10 kinds of foodborne pathogens within 20 min, and is especially suitable for the rapid detection and surveillance of foodborne pathogens in food and water. PMID:26884128

  4. Direct RNA-based detection and differentiation of CTX-M-type extended-spectrum β-lactamases (ESBL.

    Directory of Open Access Journals (Sweden)

    Claudia Stein

    Full Text Available The current global spread of multi-resistant Gram-negatives, particularly extended spectrum β-lactamases expressing bacteria, increases the likelihood of inappropriate empiric treatment of critically ill patients with subsequently increased mortality. From a clinical perspective, fast detection of resistant pathogens would allow a pre-emptive correction of an initially inappropriate treatment. Here we present diagnostic amplification-sequencing approach as proof of principal based on the fast molecular detection and correct discrimination of CTX-M-β-lactamases, the most frequent ESBL family. The workflow consists of the isolation of total mRNA and CTX-M-specific reverse transcription (RT, amplification and pyrosequencing. Due to the high variability of the CTX-M-β-lactamase-genes, degenerated primers for RT, qRT as well as for pyrosequencing, were used and the suitability and discriminatory performance of two conserved positions within the CTX-M genes were analyzed, using one protocol for all isolates and positions, respectively. Using this approach, no information regarding the expected CTX-M variant is needed since all sequences are covered by these degenerated primers. The presented workflow can be conducted within eight hours and has the potential to be expanded to other β-lactamase families.

  5. Multiplex detection of plant pathogens through the luminex magplex bead system

    NARCIS (Netherlands)

    Vlugt, van der R.A.A.; Raaij, van H.M.G.; Weerdt, de M.; Bergervoet, J.H.W.

    2015-01-01

    Here we describe a versatile multiplex method for both the serological and molecular detection of plant pathogens. The Luminex MagPlex bead system uses small paramagnetic microspheres (“beads”), either coated with specific antibodies or oligonucleotides, which capture respectively viruses and/or

  6. A validated pipeline for detection of SNVs and short InDels from RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Nitin Mandloi

    2017-12-01

    In this study, we have developed a pipeline to detect germline variants from RNA-seq data. The pipeline steps include: pre-processing, alignment, GATK best practices for RNA-seq and variant filtering. The pre-processing step includes base and adapter trimming and removal of contamination reads from rRNA, tRNA, mitochondrial DNA and repeat regions. The read alignment of the pre-processed reads is performed using STAR/HiSAT. After this we used GATK best practices for the RNA-seq dataset to call germline variants. We benchmarked our pipeline on NA12878 RNA-seq data downloaded from SRA (SRR1258218. After variant calling, the quality passed variants were compared against the gold standard variants provided by GIAB consortium. Of the total ~3.6 million high quality variants reported as gold standard variants for this sample (considering whole genome, our pipeline identified ~58,104 variants to be expressed in RNA-seq. Our pipeline achieved more than 99% of sensitivity in detection of germline variants.

  7. Simultaneous Detection of Five Pathogens from Cerebrospinal Fluid Specimens Using Luminex Technology

    Directory of Open Access Journals (Sweden)

    Linfu Zhou

    2016-02-01

    Full Text Available Early diagnosis and treatment are crucial for the outcome of central nervous system (CNS infections. In this study, we developed a multiplex PCR-Luminex assay for the simultaneous detection of five major pathogens, including Mycobacterium tuberculosis, Cryptococcus neoformans, Streptococcus pneumoniae, and herpes simplex virus types 1 and 2, which frequently cause CNS infections. Through the hybridization reaction between multiplex PCR-amplified targets and oligonucleotide “anti-TAG” sequences, we found that the PCR-Luminex assay could detect as low as 101–102 copies of synthetic pathogen DNAs. Furthermore, 163 cerebrospinal fluid (CSF specimens from patients with suspected CNS infections were used to evaluate the efficiency of this multiplex PCR-Luminex method. Compared with Ziehl-Neelsen stain, this assay showed a high diagnostic accuracy for tuberculosis meningitis (sensitivity, 90.7% and specificity, 99.1%. For cryptococcal meningitis, the sensitivity and specificity were 92% and 97.1%, respectively, compared with the May Grunwald Giemsa (MGG stain. For herpes simplex virus types 1 and 2 encephalitis, the sensitivities were 80.8% and 100%, and the specificities were 94.2% and 99%, respectively, compared with Enzyme Linked Immunosorbent Assay (ELISA assays. Taken together, this multiplex PCR-Luminex assay showed potential efficiency for the simultaneous detection of five pathogens and may be a promising supplement to conventional methods for diagnosing CNS infections.

  8. Fluorescent Silica Nanoparticles in the Detection and Control of the Growth of Pathogen

    International Nuclear Information System (INIS)

    Chitra, K.; Annadurai, G.

    2013-01-01

    In this present study the bio conjugated fluorescent silica nanoparticles give an efficient fluorescent-based immunoassay for the detection of pathogen. The synthesized silica nanoparticles were poly dispersed and the size of the silica nanoparticles was in the range of 114-164 nm. The energy dispersive X-ray spectrophotometer showed the presence of silica at 1.8 keV and the selected area diffractometer showed amorphous nature of silica nanoparticles. The FTIR spectrum confirmed the attachment of dye and carboxyl group onto the silica nanoparticles surface. The fluorescent silica nanoparticles showed highly efficient fluorescence and the fluorescent emission of silica nanoparticles occurred at 536 nm. The SEM image showed the aggregation of nanoparticles and bacteria. The growth of the pathogenic E. coli was controlled using silica nanoparticles; therefore silica nanoparticles could be used in food packaging material, biomedical material, and so forth. This work provides a rapid, simple, and accurate method for the detection of pathogen using fluorescent-based immunoassay.

  9. Sensing miRNA: Signal Amplification by Cognate RISC for Intracellular Detection of miRNA in Live Cells.

    Science.gov (United States)

    Kavishwar, Amol; Medarova, Zdravka

    2016-01-01

    The ability to detect miRNA expression in live cells would leave these cells available for further manipulation or culture. Here, we describe the design of a miRNA sensor oligonucleotide whose sequence mimics the target mRNA. The sensor has a fluorescent label on one end of the oligo and a quencher on the other. When inside the cell, the sensor is recognized by its cognate miRNA-RISC and gets cleaved, setting the fluorophore free from its quencher. This results in fluorescence "turn on." Since cleavage by the RISC complex is an enzymatic process, the described approach has a very high level of sensitivity (nM). The rate of nonspecific cleavage of the sensor is very slow permitting the collection of meaningful signal over a long period of time.

  10. The cellular receptors of exogenous RNA

    Directory of Open Access Journals (Sweden)

    Patryk Reniewicz

    2016-04-01

    Full Text Available One of the key determinants of survival for organisms is proper recognition of exogenous and endogenous nucleic acids. Therefore, high eukaryotes developed a number of receptors that allow for discrimination between friend or foe DNA and RNA. Appearance of exogenous RNA in cytoplasm provides a signal of danger and triggers cellular responses that facilitate eradication of a pathogen. Recognition of exogenous RNA is additionally complicated by fact that large amount of endogenous RNA is present in cytoplasm Thus, number of different receptors, found in eukaryotic cells, is able to recognize that nucleic acid. First group of those receptors consist endosomal Toll like receptors, namely TLR3, TLR7, TLR8 and TLR13. Those receptors recognize RNA released from pathogens that enter the cell by endocytosis. The second group includes cytoplasmic sensors like PKR and the family of RLRs comprised of RIG-I, MDA5 and LGP2. Cytoplasmic receptors recognize RNA from pathogens invading the cell by non-endocytic pathway. In both cases binding of RNA by its receptors results in activation of the signalling cascades that lead to the production of interferon and other cytokines.

  11. Carbon nanotube-polyamidoamine dendrimer hybrid-modified electrodes for highly sensitive electrochemical detection of microRNA24.

    Science.gov (United States)

    Li, Fengye; Peng, Jing; Zheng, Qiong; Guo, Xiang; Tang, Hao; Yao, Shouzhuo

    2015-01-01

    A simple and ultrasensitive microRNA (miRNA) electrochemical biosensor employing multiwalled carbon nanotube (MWCNT)-polyamidoamine (PAMAM) dendrimer and methylene blue (MB) redox indicator is reported in this work. The assay utilizes a glass carbon (GC) electrode modified with MWCNT-PAMAM, on which the oligonucleotide capture probes are immobilized. The electrochemical detection of miRNAs is completed by measuring the reduction signal change of MB before and after the probe hybridization with target miRNA (miRNA24 is used as a model case). The MWCNT-PAMAM/GC electrode shows greatly enhanced signal to MB reduction in contrast to bare GC electrode. The functionalization of MWCNT with PAMAM maintains the electrochemical property of MWCNT to MB reduction but minimizes the undesired adsorption of MB on the MWCNT surface. The effect of experimental variables on the miRNA detection is investigated and optimized. A detection limit of 0.5 fM and a linear peak current density-concentration relationship up to 100 nM are obtained following 60 min hybridization. The proposed assay is successfully used to detect miRNA24 in total RNA sample extracted from HeLa cells.

  12. Detection of GBV-C/HGV RNA in cervico-vaginal smears from healthy individuals

    Directory of Open Access Journals (Sweden)

    Maria Angelica Ehara Watanabe

    2008-10-01

    Full Text Available The purpose of the present study was to evaluate the sexual transmission of GBV-C/HGV, through RNA detection in cervicovaginal smears. Therefore the GBV-C/HGV RNA in cervicovaginal smears from apparently healthy women was investigated using routine proceedings for prophylactic screening to cervical cancer. GBV-C/HGV RNA was detected by reverse transcriptase and polymerase chain reaction (RT-PCR. Only one woman presented co-infection with human papilloma virus (HPV. The GBV-C/HGV RNA was detected in 13/73 (17.57% healthy women and it's prevalence in participating women between 28-43 years old was 53.85%. No association was found with GBV-C/HGV for the age of first sexual intercourse and number of pregnancies. In GBV-C/HGV RNA positive women, 69.23% were married. In conclusion, the present findings show that cervical and vaginal specimens could contain the GBV-C/HGV RNA.O objetivo do presente estudo foi avaliar a transmissão sexual de GBV-C/HBV, através da detecção do RNA viral em raspados cérvico-vaginais. Portanto, a presença do RNA GBV-C/HGV foi investigada em raspados cérvico-vaginais em mulheres aparentemente saudáveis que realizaram exames preventivos para câncer cervical. GBV-C/HGV RNA foi detectado por reação de transcriptase reversa e reação em cadeia da polimerase (RT-PCR. Apenas uma mulher apresentou a co-infecção com o papiloma vírus humano (HPV. O RNA GBV-C/HGV foi detectado em 13/73 (17,57% mulheres saudáveis e sua prevalência entre participantes da idade de 28-43 anos foi de 53,85%. Não foi observada relação entre a presença do RNA GBV-C/HGV com a idade de primeira relação sexual, nem com o número de gestações. Entre as mulheres que apresentavam o RNA viral, 69,23% eram casadas. O presente estudo demonstrou que secreções cérvico-vaginais podem conter o RNA viral GBV-C/HBV.

  13. Rescue of foot-and-mouth disease viruses that are pathogenic for cattle from preserved viral RNA samples.

    Directory of Open Access Journals (Sweden)

    Graham J Belsham

    Full Text Available BACKGROUND: Foot and mouth disease is an economically important disease of cloven-hoofed animals including cattle, sheep and pigs. It is caused by a picornavirus, foot-and-mouth disease virus (FMDV, which has a positive sense RNA genome which, when introduced into cells, can initiate virus replication. PRINCIPAL FINDINGS: A system has been developed to rescue infectious FMDV from RNA preparations generated from clinical samples obtained under experimental conditions and then applied to samples collected in the "field". Clinical samples from suspect cases of foot-and-mouth disease (FMD were obtained from within Pakistan and Afghanistan. The samples were treated to preserve the RNA and then transported to National Veterinary Institute, Lindholm, Denmark. Following RNA extraction, FMDV RNA was quantified by real-time RT-PCR and samples containing significant levels of FMDV RNA were introduced into susceptible cells using electroporation. Progeny viruses were amplified in primary bovine thyroid cells and characterized using antigen ELISA and also by RT-PCR plus sequencing. FMD viruses of three different serotypes and multiple lineages have been successfully rescued from the RNA samples. Two of the rescued viruses (of serotype O and Asia 1 were inoculated into bull calves under high containment conditions. Acute clinical disease was observed in each case which spread rapidly from the inoculated calves to in-contact animals. Thus the rescued viruses were highly pathogenic. The availability of the rescued viruses enabled serotyping by antigen ELISA and facilitated genome sequencing. CONCLUSIONS: The procedure described here should improve the characterization of FMDVs circulating in countries where the disease is endemic and thus enhance disease control globally.

  14. Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens.

    Science.gov (United States)

    Gritzfeld, Jenna F; Roberts, Paul; Roche, Lorna; El Batrawy, Sherouk; Gordon, Stephen B

    2011-04-13

    Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS) and a nasal wash (NW) in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test.Nasal washing was more comfortable for volunteers than swabbing (n = 24). In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p < 0.00001). Overall, there was a low carriage rate of pathogens in this sample; no significant difference was seen in the detection of bacteria between culture and PCR methods. Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

  15. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  16. An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

    Science.gov (United States)

    Wang, Yejun; MacKenzie, Keith D; White, Aaron P

    2015-05-07

    As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for

  17. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  18. Direct 13C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    International Nuclear Information System (INIS)

    Fürtig, Boris; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina; Kovacs, Helena; Schwalbe, Harald

    2016-01-01

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond 1 H detection. Here, we develop 13 C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for 13 C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed 13 C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  19. Canine Detection of the Volatilome: A Review of Implications for Pathogen and Disease Detection.

    Science.gov (United States)

    Angle, Craig; Waggoner, Lowell Paul; Ferrando, Arny; Haney, Pamela; Passler, Thomas

    2016-01-01

    The volatilome is the entire set of volatile organic compounds (VOC) produced by an organism. The accumulation of VOC inside and outside of the body reflects the unique metabolic state of an organism. Scientists are developing technologies to non-invasively detect VOC for the purposes of medical diagnosis, therapeutic monitoring, disease outbreak containment, and disease prevention. Detection dogs are proven to be a valuable real-time mobile detection technology for the detection of VOC related to explosives, narcotics, humans, and many other targets of interests. Little is known about what dogs are detecting when searching for biological targets. It is important to understand where biological VOC originates and how dogs might be able to detect biological targets. This review paper discusses the recent scientific literature involving VOC analysis and postulates potential biological targets for canine detection. Dogs have shown their ability to detect pathogen and disease-specific VOC. Future research will determine if dogs can be employed operationally in hospitals, on borders, in underserved areas, on farms, and in other operational environments to give real-time feedback on the presence of a biological target.

  20. Vascular Streak Dieback of cacao in Southeast Asia and Melanesia: in planta detection of the pathogen and a new taxonomy.

    Science.gov (United States)

    Samuels, Gary J; Ismaiel, Adnan; Rosmana, Ade; Junaid, Muhammad; Guest, David; McMahon, Peter; Keane, Philip; Purwantara, Agus; Lambert, Smilja; Rodriguez-Carres, Marianela; Cubeta, Marc A

    2012-01-01

    Vascular Streak Dieback (VSD) disease of cacao (Theobroma cacao) in Southeast Asia and Melanesia is caused by a basidiomycete (Ceratobasidiales) fungus Oncobasidium theobromae (syn. =Thanatephorus theobromae). The most characteristic symptoms of the disease are green-spotted leaf chlorosis or, commonly since about 2004, necrotic blotches, followed by senescence of leaves beginning on the second or third flush behind the shoot apex, and blackening of infected xylem in the vascular traces at the leaf scars resulting from the abscission of infected leaves. Eventually the shoot apex is killed and infected branches die. In susceptible cacao the fungus may grow through the xylem down into the main stem and kill a mature cacao tree. Infections in the stem of young plants prior to the formation of the first 3-4 lateral branches usually kill the plant. Basidiospores released from corticioid basidiomata developed on leaf scars or along cracks in the main vein of infected leaves infect young leaves. The pathogen commonly infects cacao but there are rare reports from avocado. As both crops are introduced to the region, the pathogen is suspected to occur asymptomatically in native vegetation. The pathogen is readily isolated but cultures cannot be maintained. In this study, DNA was extracted from pure cultures of O. theobromae obtained from infected cacao plants sampled from Indonesia. The internal transcribed spacer region (ITS), consisting of ITS1, 5.8S ribosomal RNA and ITS2, and a portion of nuclear large subunit (LSU) were sequenced. Phylogenetic analysis of ITS sequences placed O. theobromae sister to Ceratobasidium anastomosis groups AG-A, AG-Bo, and AG-K with high posterior probability. Therefore the new combination Ceratobasidium theobromae is proposed. A PCR-based protocol was developed to detect and identify C. theobromae in plant tissue of cacao enabling early detection of the pathogen in plants. A second species of Ceratobasidium, Ceratobasidium ramicola

  1. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    Directory of Open Access Journals (Sweden)

    Hironobu Yanagisawa

    2016-03-01

    Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

  2. Molecular techniques for detection and identification of pathogens in food: advantages and limitations

    OpenAIRE

    Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

  3. Alternative Pre-mRNA Splicing in Mammals and Teleost Fish: A Effective Strategy for the Regulation of Immune Responses Against Pathogen Infection.

    Science.gov (United States)

    Chang, Ming Xian; Zhang, Jie

    2017-07-15

    Pre-mRNA splicing is the process by which introns are removed and the protein coding elements assembled into mature mRNAs. Alternative pre-mRNA splicing provides an important source of transcriptome and proteome complexity through selectively joining different coding elements to form mRNAs, which encode proteins with similar or distinct functions. In mammals, previous studies have shown the role of alternative splicing in regulating the function of the immune system, especially in the regulation of T-cell activation and function. As lower vertebrates, teleost fish mainly rely on a large family of pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) from various invading pathogens. In this review, we summarize recent advances in our understanding of alternative splicing of piscine PRRs including peptidoglycan recognition proteins (PGRPs), nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs), retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) and their downstream signaling molecules, compared to splicing in mammals. We also discuss what is known and unknown about the function of splicing isoforms in the innate immune responses against pathogens infection in mammals and teleost fish. Finally, we highlight the consequences of alternative splicing in the innate immune system and give our view of important directions for future studies.

  4. Fluorescence detection of natural RNA using rationally designed "clickable" oligonucleotide probes

    DEFF Research Database (Denmark)

    Okholm, Anders; Kjems, Jørgen; Astakhova, Kira

    2014-01-01

    Herein a reliable approach to the design of effective fluorescent probes for RNA detection is described. The fluorescence signalling of hybridization by internally positioned polyaromatic hydrocarbons and rhodamine dyes was achieved with a low fluorescence background signal, high fluorescence qua...... quantum yields at ambient and elevated temperature, high selectivity and signal specificity of the probes when binding to miR-7 and circRNA targets....

  5. On the performance of pre-microRNA detection algorithms

    DEFF Research Database (Denmark)

    Saçar Demirci, Müşerref Duygu; Baumbach, Jan; Allmer, Jens

    2017-01-01

    assess 13 ab initio pre-miRNA detection approaches using all relevant, published, and novel data sets while judging algorithm performance based on ten intrinsic performance measures. We present an extensible framework, izMiR, which allows for the unbiased comparison of existing algorithms, adding new...

  6. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  7. Transmutation of Personal Glucose Meters into Portable and Highly Sensitive Microbial Pathogen Detection Platform.

    Science.gov (United States)

    Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang

    2015-10-07

    Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

    Science.gov (United States)

    Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

    2014-01-01

    Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

  9. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    OpenAIRE

    Jones, Sophie; Sutherland, Colin J.; Hermsen, Cornelus; Arens, Theo; Teelen, Karina; Hallett, Rachel; Corran, Patrick; van der Vegte-Bolmer, Marga; Sauerwein, Robert; Drakeley, Chris J.; Bousema, Teun

    2012-01-01

    Abstract Background Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be used for collecting RNA samples, but rigorous testing of their capacity to withstand adverse storage conditions has not been fully explored. Methods Three gametocyte dilutions: 10/μL, 1.0/μL and 0.1/μL ...

  10. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  11. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  12. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  13. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain

    OpenAIRE

    Yang, Xiang; Noyes, Noelle R.; Doster, Enrique; Martin, Jennifer N.; Linke, Lyndsey M.; Magnuson, Roberta J.; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R.; Jones, Kenneth L.; Ruiz, Jaime; Boucher, Christina; Morley, Paul S.; Belk, Keith E.

    2016-01-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bact...

  14. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  15. Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes

    Directory of Open Access Journals (Sweden)

    Toome Kadri

    2011-02-01

    Full Text Available Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.

  16. Detection of NASBA amplified bacterial tmRNA molecules on SLICSel designed microarray probes

    LENUS (Irish Health Repository)

    Scheler, Ott

    2011-02-28

    Abstract Background We present a comprehensive technological solution for bacterial diagnostics using tmRNA as a marker molecule. A robust probe design algorithm for microbial detection microarray is implemented. The probes were evaluated for specificity and, combined with NASBA (Nucleic Acid Sequence Based Amplification) amplification, for sensitivity. Results We developed a new web-based program SLICSel for the design of hybridization probes, based on nearest-neighbor thermodynamic modeling. A SLICSel minimum binding energy difference criterion of 4 kcal\\/mol was sufficient to design of Streptococcus pneumoniae tmRNA specific microarray probes. With lower binding energy difference criteria, additional hybridization specificity tests on the microarray were needed to eliminate non-specific probes. Using SLICSel designed microarray probes and NASBA we were able to detect S. pneumoniae tmRNA from a series of total RNA dilutions equivalent to the RNA content of 0.1-10 CFU. Conclusions The described technological solution and both its separate components SLICSel and NASBA-microarray technology independently are applicative for many different areas of microbial diagnostics.

  17. The effects of environmental chemical carcinogens on the microRNA machinery.

    Science.gov (United States)

    Izzotti, A; Pulliero, A

    2014-07-01

    The first evidence that microRNA expression is early altered by exposure to environmental chemical carcinogens in still healthy organisms was obtained for cigarette smoke. To date, the cumulative experimental data indicate that similar effects are caused by a variety of environmental carcinogens, including polycyclic aromatic hydrocarbons, nitropyrenes, endocrine disruptors, airborne mixtures, carcinogens in food and water, and carcinogenic drugs. Accordingly, the alteration of miRNA expression is a general mechanism that plays an important pathogenic role in linking exposure to environmental toxic agents with their pathological consequences, mainly including cancer development. This review summarizes the existing experimental evidence concerning the effects of chemical carcinogens on the microRNA machinery. For each carcinogen, the specific microRNA alteration signature, as detected in experimental studies, is reported. These data are useful for applying microRNA alterations as early biomarkers of biological effects in healthy organisms exposed to environmental carcinogens. However, microRNA alteration results in carcinogenesis only if accompanied by other molecular damages. As an example, microRNAs altered by chemical carcinogens often inhibits the expression of mutated oncogenes. The long-term exposure to chemical carcinogens causes irreversible suppression of microRNA expression thus allowing the transduction into proteins of mutated oncogenes. This review also analyzes the existing knowledge regarding the mechanisms by which environmental carcinogens alter microRNA expression. The underlying molecular mechanism involves p53-microRNA interconnection, microRNA adduct formation, and alterations of Dicer function. On the whole, reported findings provide evidence that microRNA analysis is a molecular toxicology tool that can elucidate the pathogenic mechanisms activated by environmental carcinogens. Copyright © 2014 Elsevier GmbH. All rights reserved.

  18. High-throughput DNA microarray detection of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley, Nepal.

    Science.gov (United States)

    Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari

    2015-01-01

    Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.

  19. The analysis of novel microRNA mimic sequences in cancer cells reveals lack of specificity in stem-loop RT-qPCR-based microRNA detection.

    Science.gov (United States)

    Winata, Patrick; Williams, Marissa; McGowan, Eileen; Nassif, Najah; van Zandwijk, Nico; Reid, Glen

    2017-11-17

    MicroRNAs are frequently downregulated in cancer, and restoring expression has tumour suppressive activity in tumour cells. Our recent phase I clinical trial investigated microRNA-based therapy in patients with malignant pleural mesothelioma. Treatment with TargomiRs, microRNA mimics with novel sequence packaged in EGFR antibody-targeted bacterial minicells, revealed clear signs of clinical activity. In order to detect delivery of microRNA mimics to tumour cells in future clinical trials, we tested hydrolysis probe-based assays specific for the sequence of the novel mimics in transfected mesothelioma cell lines using RT-qPCR. The custom assays efficiently and specifically amplified the consensus mimics. However, we found that these assays gave a signal when total RNA from untransfected and control mimic-transfected cells were used as templates. Further investigation revealed that the reverse transcription step using stem-loop primers appeared to introduce substantial non-specific amplification with either total RNA or synthetic RNA templates. This suggests that reverse transcription using stem-loop primers suffers from an intrinsic lack of specificity for the detection of highly similar microRNAs in the same family, especially when analysing total RNA. These results suggest that RT-qPCR is unlikely to be an effective means to detect delivery of microRNA mimic-based drugs to tumour cells in patients.

  20. The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.

    Science.gov (United States)

    Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng

    2017-05-01

    Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection.

    Science.gov (United States)

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce

    2013-10-07

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.

  2. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Il-Hoon Cho

    2017-09-01

    Full Text Available The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods. Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  3. Current Technical Approaches for the Early Detection of Foodborne Pathogens: Challenges and Opportunities.

    Science.gov (United States)

    Cho, Il-Hoon; Ku, Seockmo

    2017-09-30

    The development of novel and high-tech solutions for rapid, accurate, and non-laborious microbial detection methods is imperative to improve the global food supply. Such solutions have begun to address the need for microbial detection that is faster and more sensitive than existing methodologies (e.g., classic culture enrichment methods). Multiple reviews report the technical functions and structures of conventional microbial detection tools. These tools, used to detect pathogens in food and food homogenates, were designed via qualitative analysis methods. The inherent disadvantage of these analytical methods is the necessity for specimen preparation, which is a time-consuming process. While some literature describes the challenges and opportunities to overcome the technical issues related to food industry legal guidelines, there is a lack of reviews of the current trials to overcome technological limitations related to sample preparation and microbial detection via nano and micro technologies. In this review, we primarily explore current analytical technologies, including metallic and magnetic nanomaterials, optics, electrochemistry, and spectroscopy. These techniques rely on the early detection of pathogens via enhanced analytical sensitivity and specificity. In order to introduce the potential combination and comparative analysis of various advanced methods, we also reference a novel sample preparation protocol that uses microbial concentration and recovery technologies. This technology has the potential to expedite the pre-enrichment step that precedes the detection process.

  4. Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.

    Science.gov (United States)

    Escobedo-Hinojosa, Wendy; Pardo-López, Liliana

    2017-07-31

    Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Integrated Detection of Pathogens and Host Biomarkers for Wounds

    Energy Technology Data Exchange (ETDEWEB)

    Jaing, C

    2012-03-19

    The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.

  6. Bacterial community structure in experimental methanogenic bioreactors and search for pathogenic clostridia as community members.

    Science.gov (United States)

    Dohrmann, Anja B; Baumert, Susann; Klingebiel, Lars; Weiland, Peter; Tebbe, Christoph C

    2011-03-01

    Microbial conversion of organic waste or harvested plant material into biogas has become an attractive technology for energy production. Biogas is produced in reactors under anaerobic conditions by a consortium of microorganisms which commonly include bacteria of the genus Clostridium. Since the genus Clostridium also harbors some highly pathogenic members in its phylogenetic cluster I, there has been some concern that an unintended growth of such pathogens might occur during the fermentation process. Therefore this study aimed to follow how process parameters affect the diversity of Bacteria in general, and the diversity of Clostridium cluster I members in particular. The development of both communities was followed in model biogas reactors from start-up during stable methanogenic conditions. The biogas reactors were run with either cattle or pig manures as substrates, and both were operated at mesophilic and thermophilic conditions. The structural diversity was analyzed independent of cultivation using a PCR-based detection of 16S rRNA genes and genetic profiling by single-strand conformation polymorphism (SSCP). Genetic profiles indicated that both bacterial and clostridial communities evolved in parallel, and the community structures were highly influenced by both substrate and temperature. Sequence analysis of 16S rRNA genes recovered from prominent bands from SSCP profiles representing Clostridia detected no pathogenic species. Thus, this study gave no indication that pathogenic clostridia would be enriched as dominant community members in biogas reactors fed with manure.

  7. Influence of Rack Design and Disease Prevalence on Detection of Rodent Pathogens in Exhaust Debris Samples from Individually Ventilated Caging Systems.

    Science.gov (United States)

    Bauer, Beth A; Besch-Williford, Cynthia; Livingston, Robert S; Crim, Marcus J; Riley, Lela K; Myles, Matthew H

    2016-11-01

    Sampling of bedding debris within the exhaust systems of ventilated racks may be a mechanism for detecting murine pathogens in colony animals. This study examined the effectiveness of detecting pathogens by PCR analysis of exhaust debris samples collected from ventilated racks of 2 different rack designs, one with unfiltered air flow from within the cage to the air-exhaust pathway, and the other had a filter between the cage and the air-exhaust pathway. For 12 wk, racks were populated with either 1 or 5 cages of mice (3 mice per cage) infected with one of the following pathogens: mouse norovirus (MNV), mouse parvovirus (MPV), mouse hepatitis virus (MHV), Helicobacter spp., Pasteurella pneumotropica, pinworms, Entamoeba muris, Tritrichomonas muris, and fur mites. Pathogen shedding by infected mice was monitored throughout the study. In the filter-containing rack, PCR testing of exhaust plenums yielded negative results for all pathogens at all time points of the study. In the rack with open air flow, pathogens detected by PCR analysis of exhaust debris included MHV, Helicobacter spp., P. pneumotropica, pinworms, enteric protozoa, and fur mites; these pathogens were detected in racks housing either 1 or 5 cages of infected mice. Neither MPV nor MNV was detected in exhaust debris, even though prolonged viral shedding was confirmed. These results demonstrate that testing rack exhaust debris from racks with unfiltered air flow detected MHV, enteric bacteria and parasites, and fur mites. However, this method failed to reliably detect MNV or MPV infection of colony animals.

  8. Surveillance of vector-borne pathogens under imperfect detection: lessons from Chagas disease risk (mis)measurement.

    Science.gov (United States)

    Minuzzi-Souza, Thaís Tâmara Castro; Nitz, Nadjar; Cuba, César Augusto Cuba; Hagström, Luciana; Hecht, Mariana Machado; Santana, Camila; Ribeiro, Marcelle; Vital, Tamires Emanuele; Santalucia, Marcelo; Knox, Monique; Obara, Marcos Takashi; Abad-Franch, Fernando; Gurgel-Gonçalves, Rodrigo

    2018-01-09

    Vector-borne pathogens threaten human health worldwide. Despite their critical role in disease prevention, routine surveillance systems often rely on low-complexity pathogen detection tests of uncertain accuracy. In Chagas disease surveillance, optical microscopy (OM) is routinely used for detecting Trypanosoma cruzi in its vectors. Here, we use replicate T. cruzi detection data and hierarchical site-occupancy models to assess the reliability of OM-based T. cruzi surveillance while explicitly accounting for false-negative and false-positive results. We investigated 841 triatomines with OM slides (1194 fresh, 1192 Giemsa-stained) plus conventional (cPCR, 841 assays) and quantitative PCR (qPCR, 1682 assays). Detections were considered unambiguous only when parasitologists unmistakably identified T. cruzi in Giemsa-stained slides. qPCR was >99% sensitive and specific, whereas cPCR was ~100% specific but only ~55% sensitive. In routine surveillance, examination of a single OM slide per vector missed ~50-75% of infections and wrongly scored as infected ~7% of the bugs. qPCR-based and model-based infection frequency estimates were nearly three times higher, on average, than OM-based indices. We conclude that the risk of vector-borne Chagas disease may be substantially higher than routine surveillance data suggest. The hierarchical modelling approach we illustrate can help enhance vector-borne disease surveillance systems when pathogen detection is imperfect.

  9. Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

    Science.gov (United States)

    Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

    2017-08-01

    Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  10. Direct metagenomic detection of viral pathogens in nasal and fecal specimens using an unbiased high-throughput sequencing approach.

    Directory of Open Access Journals (Sweden)

    Shota Nakamura

    Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.

  11. Rapid fluorescence detection of pathogenic bacteria using magnetic enrichment technique combined with magnetophoretic chromatography.

    Science.gov (United States)

    Che, Yulan; Xu, Yi; Wang, Renjie; Chen, Li

    2017-08-01

    A rapid and sensitive analytical method was developed to detect pathogenic bacteria which combined magnetic enrichment, fluorescence labeling with polyethylene glycol (PEG) magnetophoretic chromatography. As pathogenic bacteria usually exist in complex matrixes at low concentration, an efficient enrichment is essential for diagnosis. In order to capture series types of pathogenic bacteria in samples, amino-modified magnetic nanoparticles (Fe 3 O 4 @SiO 2 -NH 2 ) were prepared for efficient enrichment by the electrostatic interaction with pathogenic bacteria. It was shown that the capture efficiency reached up to 95.4% for Escherichia coli (E. coli). Furthermore, quantitative analysis of the bacteria was achieved by using acridine orange (AO) as a fluorescence probe for the captured E. coli due to its ability of staining series types of bacteria and rapid labeling. In order to remove the free magnetic nanoparticles and redundant fluorescent reagent, the labeled suspension was poured into a PEG separation column and was separated by applying an external magnetic field. The presence of 100 cfu mL -1 E. coli could be detected for semi-quantitative analysis by observing the separation column with the naked eye, and the concentration could be further evaluated by fluorescence detection. All the above processes were finished within 80 min. It was demonstrated that a good linear relationship existed between the fluorescence intensity and the concentration of E. coli ranging from 10 2 to 10 6  cfu mL -1 , with a detection limit of 100 cfu mL -1 when E. coli acted as target bacteria. The recovery rate of E. coli was 93.6∼102.0% in tap water and cooked meat samples, and the RSD was lower than 7% (n = 6); the result coincided with the conventional plate count method. Graphical abstract ᅟ.

  12. Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

    Science.gov (United States)

    Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

    2010-10-01

    Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

  13. Direct {sup 13}C-detected NMR experiments for mapping and characterization of hydrogen bonds in RNA

    Energy Technology Data Exchange (ETDEWEB)

    Fürtig, Boris, E-mail: fuertig@nmr.uni-frankfurt.de; Schnieders, Robbin; Richter, Christian; Zetzsche, Heidi; Keyhani, Sara; Helmling, Christina [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany); Kovacs, Helena [Bruker BioSpin (Switzerland); Schwalbe, Harald, E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe Universität Frankfurt, Center for Biomolecular Magnetic Resonance (BMRZ), Institute of Organic Chemistry and Chemical Biology (Germany)

    2016-03-15

    In RNA secondary structure determination, it is essential to determine whether a nucleotide is base-paired and not. Base-pairing of nucleotides is mediated by hydrogen bonds. The NMR characterization of hydrogen bonds relies on experiments correlating the NMR resonances of exchangeable protons and can be best performed for structured parts of the RNA, where labile hydrogen atoms are protected from solvent exchange. Functionally important regions in RNA, however, frequently reveal increased dynamic disorder which often leads to NMR signals of exchangeable protons that are broadened beyond {sup 1}H detection. Here, we develop {sup 13}C direct detected experiments to observe all nucleotides in RNA irrespective of whether they are involved in hydrogen bonds or not. Exploiting the self-decoupling of scalar couplings due to the exchange process, the hydrogen bonding behavior of the hydrogen bond donor of each individual nucleotide can be determined. Furthermore, the adaption of HNN-COSY experiments for {sup 13}C direct detection allows correlations of donor–acceptor pairs and the localization of hydrogen-bond acceptor nucleotides. The proposed {sup 13}C direct detected experiments therefore provide information about molecular sites not amenable by conventional proton-detected methods. Such information makes the RNA secondary structure determination by NMR more accurate and helps to validate secondary structure predictions based on bioinformatics.

  14. Meta-analysis diagnostic accuracy of SNP-based pathogenicity detection tools: a case of UTG1A1 gene mutations.

    Science.gov (United States)

    Galehdari, Hamid; Saki, Najmaldin; Mohammadi-Asl, Javad; Rahim, Fakher

    2013-01-01

    Crigler-Najjar syndrome (CNS) type I and type II are usually inherited as autosomal recessive conditions that result from mutations in the UGT1A1 gene. The main objective of the present review is to summarize results of all available evidence on the accuracy of SNP-based pathogenicity detection tools compared to published clinical result for the prediction of in nsSNPs that leads to disease using prediction performance method. A comprehensive search was performed to find all mutations related to CNS. Database searches included dbSNP, SNPdbe, HGMD, Swissvar, ensemble, and OMIM. All the mutation related to CNS was extracted. The pathogenicity prediction was done using SNP-based pathogenicity detection tools include SIFT, PHD-SNP, PolyPhen2, fathmm, Provean, and Mutpred. Overall, 59 different SNPs related to missense mutations in the UGT1A1 gene, were reviewed. Comparing the diagnostic OR, PolyPhen2 and Mutpred have the highest detection 4.983 (95% CI: 1.24 - 20.02) in both, following by SIFT (diagnostic OR: 3.25, 95% CI: 1.07 - 9.83). The highest MCC of SNP-based pathogenicity detection tools, was belong to SIFT (34.19%) followed by Provean, PolyPhen2, and Mutpred (29.99%, 29.89%, and 29.89%, respectively). Hence the highest SNP-based pathogenicity detection tools ACC, was fit to SIFT (62.71%) followed by PolyPhen2, and Mutpred (61.02%, in both). Our results suggest that some of the well-established SNP-based pathogenicity detection tools can appropriately reflect the role of a disease-associated SNP in both local and global structures.

  15. Microbial Quality, Safety, and Pathogen Detection by Using Quantitative PCR of Raw Salad Vegetables Sold in Dhanbad City, India.

    Science.gov (United States)

    Mritunjay, Sujeet K; Kumar, Vipin

    2017-01-01

    Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.

  16. Bacterial RNA induces myocyte cellular dysfunction through the activation of PKR

    Science.gov (United States)

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V.; Tai, TC; Saleh, Mazen; Parrillo, Joseph E.; Kumar, Anand

    2012-01-01

    Severe sepsis and the ensuing septic shock are serious life threatening conditions. These diseases are triggered by the host's over exuberant systemic response to the infecting pathogen. Several surveillance mechanisms have evolved to discriminate self from foreign RNA and accordingly trigger effective cellular responses to target the pathogenic threats. The RNA-dependent protein kinase (PKR) is a key component of the cytoplasmic RNA sensors involved in the recognition of viral double-stranded RNA (dsRNA). Here, we identify bacterial RNA as a distinct pathogenic pattern recognized by PKR. Our results indicate that natural RNA derived from bacteria directly binds to and activates PKR. We further show that bacterial RNA induces human cardiac myocyte apoptosis and identify the requirement for PKR in mediating this response. In addition to bacterial immunity, the results presented here may also have implications in cardiac pathophysiology. PMID:22833816

  17. In vitro selection of RNA aptamer specific to Salmonella typhimurium.

    Science.gov (United States)

    Han, Seung Ryul; Lee, Seong-Wook

    2013-06-28

    Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.

  18. Polymorphic DNA sequences of the fungal honey bee pathogen Ascosphaera apis

    DEFF Research Database (Denmark)

    Jensen, Annette B; Welker, Dennis L; Kryger, Per

    2012-01-01

    The pathogenic fungus Ascosphaera apis is ubiquitous in honey bee populations. We used the draft genome assembly of this pathogen to search for polymorphic intergenic loci that could be used to differentiate haplotypes. Primers were developed for five such loci, and the species specificities were...... verified using DNA from nine closely related species. The sequence variation was compared among 12 A. apis isolates at each of these loci, and two additional loci, the internal transcribed spacer of the ribosomal RNA (ITS) and a variable part of the elongation factor 1α (Ef1α). The degree of variation...... was then compared among the different loci, and three were found to have the greatest detection power for identifying A. apis haplotypes. The described loci can help to resolve strain differences and population genetic structures, to elucidate host–pathogen interaction and to test evolutionary hypotheses...

  19. Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

    Directory of Open Access Journals (Sweden)

    Stefan Czemmel

    Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

  20. Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.

    Science.gov (United States)

    Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G

    2016-03-15

    During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Recent Advances in Molecular Technologies and Their Application in Pathogen Detection in Foods with Particular Reference to Yersinia

    Directory of Open Access Journals (Sweden)

    Jin Gui

    2011-01-01

    Full Text Available Yersinia enterocolitica is an important zoonotic pathogen that can cause yersiniosis in humans and animals. Food has been suggested to be the main source of yersiniosis. It is critical for the researchers to be able to detect Yersinia or any other foodborne pathogen with increased sensitivity and specificity, as well as in real-time, in the case of a foodborne disease outbreak. Conventional detection methods are known to be labor intensive, time consuming, or expensive. On the other hand, more sensitive molecular-based detection methods like next generation sequencing, microarray, and many others are capable of providing faster results. DNA testing is now possible on a single molecule, and high-throughput analysis allows multiple detection reactions to be performed at once, thus allowing a range of characteristics to be rapidly and simultaneously determined. Despite better detection efficiencies, results derived using molecular biology methods can be affected by the various food matrixes. With the improvements in sample preparation, data analysis, and testing procedures, molecular detection techniques will likely continue to simplify and increase the speed of detection while simultaneously improving the sensitivity and specificity for tracking pathogens in food matrices.

  2. Understanding the Pathogenicity of Burkholderia contaminans, an Emerging Pathogen in Cystic Fibrosis.

    Science.gov (United States)

    Nunvar, Jaroslav; Kalferstova, Lucie; Bloodworth, Ruhi A M; Kolar, Michal; Degrossi, Jose; Lubovich, Silvina; Cardona, Silvia T; Drevinek, Pavel

    2016-01-01

    Several bacterial species from the Burkholderia cepacia complex (Bcc) are feared opportunistic pathogens that lead to debilitating lung infections with a high risk of developing fatal septicemia in cystic fibrosis (CF) patients. However, the pathogenic potential of other Bcc species is yet unknown. To elucidate clinical relevance of Burkholderia contaminans, a species frequently isolated from CF respiratory samples in Ibero-American countries, we aimed to identify its key virulence factors possibly linked with an unfavorable clinical outcome. We performed a genome-wide comparative analysis of two isolates of B. contaminans ST872 from sputum and blood culture of a female CF patient in Argentina. RNA-seq data showed significant changes in expression for quorum sensing-regulated virulence factors and motility and chemotaxis. Furthermore, we detected expression changes in a recently described low-oxygen-activated (lxa) locus which encodes stress-related proteins, and for two clusters responsible for the biosynthesis of antifungal and hemolytic compounds pyrrolnitrin and occidiofungin. Based on phenotypic assays that confirmed changes in motility and in proteolytic, hemolytic and antifungal activities, we were able to distinguish two phenotypes of B. contaminans that coexisted in the host and entered her bloodstream. Whole genome sequencing revealed that the sputum and bloodstream isolates (each representing a distinct phenotype) differed by over 1,400 mutations as a result of a mismatch repair-deficient hypermutable state of the sputum isolate. The inferred lack of purifying selection against nonsynonymous mutations and the high rate of pseudogenization in the derived isolate indicated limited evolutionary pressure during evolution in the nutrient-rich, stable CF sputum environment. The present study is the first to examine the genomic and transcriptomic differences between longitudinal isolates of B. contaminans. Detected activity of a number of putative virulence

  3. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

    Science.gov (United States)

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-08-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

  4. MicroRNA Expression during Viral Infection or PolyI:C Stimulation in a Fish Model

    DEFF Research Database (Denmark)

    Kristensen, Lasse Bøgelund Juel; Schyth, Brian Dall; Lorenzen, Niels

    Fish are important as small vertebrate models for studying various aspects of development and disease. MicroRNA regulation in fish has so far received attention especially in studies of their expression and function during embryonic development. In the studies carried out at the National Veterinary...... Institute in Århus we aim at using fish models for studying microRNA regulation during viral infection. In the studies presented here we make use of a qPCR method to detect miRNAs in fish cells. We present results regarding the expression of the immunologically relevant microRNAs, miR-155, miR-146a and mi......R-146b in fish cells during infection with the fish pathogenic virus viral hemorrhagic septicemia virus (VHSV) and during immune stimulation with double stranded RNA (polyI:C). We highlight the need of finding stable normalization genes for microRNA detection....

  5. Detection of pneumonia associated pathogens using a prototype multiplexed pneumonia test in hospitalized patients with severe pneumonia.

    Directory of Open Access Journals (Sweden)

    Berit Schulte

    Full Text Available Severe pneumonia remains an important cause of morbidity and mortality. Polymerase chain reaction (PCR has been shown to be more sensitive than current standard microbiological methods--particularly in patients with prior antibiotic treatment--and therefore, may improve the accuracy of microbiological diagnosis for hospitalized patients with pneumonia. Conventional detection techniques and multiplex PCR for 14 typical bacterial pneumonia-associated pathogens were performed on respiratory samples collected from adult hospitalized patients enrolled in a prospective multi-center study. Patients were enrolled from March until September 2012. A total of 739 fresh, native samples were eligible for analysis, of which 75 were sputa, 421 aspirates, and 234 bronchial lavages. 276 pathogens were detected by microbiology for which a valid PCR result was generated (positive or negative detection result by Curetis prototype system. Among these, 120 were identified by the prototype assay, 50 pathogens were not detected. Overall performance of the prototype for pathogen identification was 70.6% sensitivity (95% confidence interval (CI lower bound: 63.3%, upper bound: 76.9% and 95.2% specificity (95% CI lower bound: 94.6%, upper bound: 95.7%. Based on the study results, device cut-off settings were adjusted for future series production. The overall performance with the settings of the CE series production devices was 78.7% sensitivity (95% CI lower bound: 72.1% and 96.6% specificity (95% CI lower bound: 96.1%. Time to result was 5.2 hours (median for the prototype test and 43.5 h for standard-of-care. The Pneumonia Application provides a rapid and moderately sensitive assay for the detection of pneumonia-causing pathogens with minimal hands-on time.Deutsches Register Klinischer Studien (DRKS DRKS00005684.

  6. Multiplexed lateral flow microarray assay for detection of citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis pv citri

    Energy Technology Data Exchange (ETDEWEB)

    Cary,; Bruce, R [Santa Fe, NM; Stubben, Christopher J [Los Alamos, NM

    2011-03-22

    The invention provides highly sensitive and specific assays for the major citrus pathogens Xylella fastidiosa and Xanthomonas axonopodis, including a field deployable multiplexed assay capable of rapidly assaying for both pathogens simultaneously. The assays are directed at particular gene targets derived from pathogenic strains that specifically cause the major citrus diseases of citrus variegated chlorosis (Xylella fastidiosa 9a5c) and citrus canker (Xanthomonas axonopodis pv citri). The citrus pathogen assays of the invention offer femtomole sensitivity, excellent linear dynamic range, and rapid and specific detection.

  7. Optimization of Quantitative PCR Methods for Enteropathogen Detection

    Science.gov (United States)

    Liu, Jie; Gratz, Jean; Amour, Caroline; Nshama, Rosemary; Walongo, Thomas; Maro, Athanasia; Mduma, Esto; Platts-Mills, James; Boisen, Nadia; Nataro, James; Haverstick, Doris M.; Kabir, Furqan; Lertsethtakarn, Paphavee; Silapong, Sasikorn; Jeamwattanalert, Pimmada; Bodhidatta, Ladaporn; Mason, Carl; Begum, Sharmin; Haque, Rashidul; Praharaj, Ira; Kang, Gagandeep; Houpt, Eric R.

    2016-01-01

    Detection and quantification of enteropathogens in stool specimens is useful for diagnosing the cause of diarrhea but is technically challenging. Here we evaluate several important determinants of quantification: specimen collection, nucleic acid extraction, and extraction and amplification efficiency. First, we evaluate the molecular detection and quantification of pathogens in rectal swabs versus stool, using paired flocked rectal swabs and whole stool collected from 129 children hospitalized with diarrhea in Tanzania. Swabs generally yielded a higher quantification cycle (Cq) (average 29.7, standard deviation 3.5 vs. 25.3 ± 2.9 from stool, P<0.001) but were still able to detect 80% of pathogens with a Cq < 30 in stool. Second, a simplified total nucleic acid (TNA) extraction procedure was compared to separate DNA and RNA extractions and showed 92% (318/344) sensitivity and 98% (951/968) specificity, with no difference in Cq value for the positive results (ΔCq(DNA+RNA-TNA) = -0.01 ± 1.17, P = 0.972, N = 318). Third, we devised a quantification scheme that adjusts pathogen quantity to the specimen’s extraction and amplification efficiency, and show that this better estimates the quantity of spiked specimens than the raw target Cq. In sum, these methods for enteropathogen quantification, stool sample collection, and nucleic acid extraction will be useful for laboratories studying enteric disease. PMID:27336160

  8. A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection

    OpenAIRE

    Zuo, Peng; Li, XiuJun; Dominguez, Delfina C.; Ye, Bang-Ce

    2013-01-01

    Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated ...

  9. Filter paper collection of Plasmodium falciparum mRNA for detecting low-density gametocytes

    NARCIS (Netherlands)

    Jones, S.; Sutherland, C.J.; Hermsen, C.C.; Arens, T.; Teelen, K.A.E.M.; Hallett, R.; Corran, P.; van der Vegte-Bolmer, M.; Sauerwein, R.; Drakeley, C.; Bousema, J.T.

    2012-01-01

    ABSTRACT: BACKGROUND: Accurate sampling of sub-microscopic gametocytes is necessary for epidemiological studies to identify the infectious reservoir of Plasmodium falciparum. Detection of gametocyte mRNA achieves sensitive detection, but requires careful handling of samples. Filter papers can be

  10. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams

    Science.gov (United States)

    Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.

    2016-01-01

    Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.

  11. Comparison between nasopharyngeal swab and nasal wash, using culture and PCR, in the detection of potential respiratory pathogens

    Directory of Open Access Journals (Sweden)

    El Batrawy Sherouk

    2011-04-01

    Full Text Available Abstract Background Nasopharyngeal carriage of potential pathogens is important as it is both the major source of transmission and the prerequisite of invasive disease. New methods for detecting carriage could improve comfort, accuracy and laboratory utility. The aims of this study were to compare the sensitivities of a nasopharyngeal swab (NPS and a nasal wash (NW in detecting potential respiratory pathogens in healthy adults using microbiological culture and PCR. Results Healthy volunteers attended for nasal washing and brushing of the posterior nasopharynx. Conventional and real-time PCR were used to detect pneumococcus and meningococcus. Statistical differences between the two nasal sampling methods were determined using a nonparametric Mann-Whitney U test; differences between culture and PCR methods were determined using the McNemar test. Nasal washing was more comfortable for volunteers than swabbing (n = 24. In detection by culture, the NW was significantly more likely to detect pathogens than the NPS (p Conclusions Nasal washing and PCR may provide effective alternatives to nasopharyngeal swabbing and classical microbiology, respectively.

  12. FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?

    Science.gov (United States)

    Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha

    2015-04-01

    Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. RNA CoMPASS: a dual approach for pathogen and host transcriptome analysis of RNA-seq datasets.

    Directory of Open Access Journals (Sweden)

    Guorong Xu

    Full Text Available High-throughput RNA sequencing (RNA-seq has become an instrumental assay for the analysis of multiple aspects of an organism's transcriptome. Further, the analysis of a biological specimen's associated microbiome can also be performed using RNA-seq data and this application is gaining interest in the scientific community. There are many existing bioinformatics tools designed for analysis and visualization of transcriptome data. Despite the availability of an array of next generation sequencing (NGS analysis tools, the analysis of RNA-seq data sets poses a challenge for many biomedical researchers who are not familiar with command-line tools. Here we present RNA CoMPASS, a comprehensive RNA-seq analysis pipeline for the simultaneous analysis of transcriptomes and metatranscriptomes from diverse biological specimens. RNA CoMPASS leverages existing tools and parallel computing technology to facilitate the analysis of even very large datasets. RNA CoMPASS has a web-based graphical user interface with intrinsic queuing to control a distributed computational pipeline. RNA CoMPASS was evaluated by analyzing RNA-seq data sets from 45 B-cell samples. Twenty-two of these samples were derived from lymphoblastoid cell lines (LCLs generated by the infection of naïve B-cells with the Epstein Barr virus (EBV, while another 23 samples were derived from Burkitt's lymphomas (BL, some of which arose in part through infection with EBV. Appropriately, RNA CoMPASS identified EBV in all LCLs and in a fraction of the BLs. Cluster analysis of the human transcriptome component of the RNA CoMPASS output clearly separated the BLs (which have a germinal center-like phenotype from the LCLs (which have a blast-like phenotype with evidence of activated MYC signaling and lower interferon and NF-kB signaling in the BLs. Together, this analysis illustrates the utility of RNA CoMPASS in the simultaneous analysis of transcriptome and metatranscriptome data. RNA CoMPASS is freely

  14. MicroRNA Detection by Whole-Mount In Situ Hybridization in C. elegans.

    Science.gov (United States)

    Andachi, Yoshiki; Kohara, Yuji

    2018-01-01

    MicroRNAs (miRNAs) loaded on argonaute proteins guide RNA-induced silencing complexes to target mRNAs. An excellent method to decipher the spatiotemporal expression patterns of miRNAs is whole-mount in situ hybridization (WISH), which has been successfully used in vertebrate embryos but still remains unavailable for many animal species. Here, we describe a WISH method for miRNA detection in Caenorhabditis elegans at both embryonic and post-embryonic stages. Strategies devised for detection include fixation of animals with carbodiimide at a high temperature and subsequent partial digestion of the fixed animals with an extremely high concentration of proteinase. WISH signals are visualized by staining with a chromogenic substrate or a fluorescent dye.

  15. Oligo-DNA custom macroarray for monitoring major pathogenic and non-pathogenic fungi and bacteria in the phyllosphere of apple trees.

    Science.gov (United States)

    He, Ying-Hong; Isono, Sayaka; Shibuya, Makoto; Tsuji, Masaharu; Adkar Purushothama, Charith-Raj; Tanaka, Kazuaki; Sano, Teruo

    2012-01-01

    To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3) CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in the phyllosphere of apple trees and identify key species

  16. Oligo-DNA custom macroarray for monitoring major pathogenic and non-pathogenic fungi and bacteria in the phyllosphere of apple trees.

    Directory of Open Access Journals (Sweden)

    Ying-Hong He

    Full Text Available BACKGROUND: To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. METHODS AND FINDINGS: First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3 CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. CONCLUSIONS: The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in

  17. A quantum-dot-based fluoroassay for detection of food-borne pathogens.

    Science.gov (United States)

    Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass

    2017-09-01

    Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Validation of Metagenomic Next-Generation Sequencing Tests for Universal Pathogen Detection.

    Science.gov (United States)

    Schlaberg, Robert; Chiu, Charles Y; Miller, Steve; Procop, Gary W; Weinstock, George

    2017-06-01

    - Metagenomic sequencing can be used for detection of any pathogens using unbiased, shotgun next-generation sequencing (NGS), without the need for sequence-specific amplification. Proof-of-concept has been demonstrated in infectious disease outbreaks of unknown causes and in patients with suspected infections but negative results for conventional tests. Metagenomic NGS tests hold great promise to improve infectious disease diagnostics, especially in immunocompromised and critically ill patients. - To discuss challenges and provide example solutions for validating metagenomic pathogen detection tests in clinical laboratories. A summary of current regulatory requirements, largely based on prior guidance for NGS testing in constitutional genetics and oncology, is provided. - Examples from 2 separate validation studies are provided for steps from assay design, and validation of wet bench and bioinformatics protocols, to quality control and assurance. - Although laboratory and data analysis workflows are still complex, metagenomic NGS tests for infectious diseases are increasingly being validated in clinical laboratories. Many parallels exist to NGS tests in other fields. Nevertheless, specimen preparation, rapidly evolving data analysis algorithms, and incomplete reference sequence databases are idiosyncratic to the field of microbiology and often overlooked.

  19. Ratiometric FRET-based detection of DNA and micro-RNA on the surface using TIRF detection

    International Nuclear Information System (INIS)

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy

    2010-01-01

    A new FRET-based method for the ratiometric detection of DNA oligomers on a surface using TIRF detection mode is reported. The dual-labeled system consisting of two hybridized oligomers, Cy3oligoY:Cy5oligoX was immobilized on the surface, and the total internal reflection fluorescence (TIRF) was used to detect emission signals from the surface. Two signals, green and red, which originated from the green donor Cy3 and the red acceptor Cy5, have been simultaneously detected. When the target single-stranded complimentary oligomer was present in the solution, this oligomer replaced the Cy3oligoY in the donor:acceptor complex on the surface and the ratio of red-to-green signal was dramatically changed. This detection scheme is generally applicable to the detection of DNA or RNA on a surface.

  20. An integrated lab-on-chip for rapid identification and simultaneous differentiation of tropical pathogens.

    Directory of Open Access Journals (Sweden)

    Jeslin J L Tan

    Full Text Available Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens.

  1. The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

    NARCIS (Netherlands)

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M

    2015-01-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy.

  2. Consequences of organ choice in describing bacterial pathogen assemblages in a rodent population.

    Science.gov (United States)

    Villette, P; Afonso, E; Couval, G; Levret, A; Galan, M; Tatard, C; Cosson, J F; Giraudoux, P

    2017-10-01

    High-throughput sequencing technologies now allow for rapid cost-effective surveys of multiple pathogens in many host species including rodents, but it is currently unclear if the organ chosen for screening influences the number and identity of bacteria detected. We used 16S rRNA amplicon sequencing to identify bacterial pathogens in the heart, liver, lungs, kidneys and spleen of 13 water voles (Arvicola terrestris) collected in Franche-Comté, France. We asked if bacterial pathogen assemblages within organs are similar and if all five organs are necessary to detect all of the bacteria present in an individual animal. We identified 24 bacteria representing 17 genera; average bacterial richness for each organ ranged from 1·5 ± 0·4 (mean ± standard error) to 2·5 ± 0·4 bacteria/organ and did not differ significantly between organs. The average bacterial richness when organ assemblages were pooled within animals was 4·7 ± 0·6 bacteria/animal; Operational Taxonomic Unit accumulation analysis indicates that all five organs are required to obtain this. Organ type influences bacterial assemblage composition in a systematic way (PERMANOVA, 999 permutations, pseudo-F 4,51 = 1·37, P = 0·001). Our results demonstrate that the number of organs sampled influences the ability to detect bacterial pathogens, which can inform sampling decisions in public health and wildlife ecology.

  3. RNA-protein interactions in plant disease: hackers at the dinner table.

    Science.gov (United States)

    Spanu, Pietro D

    2015-09-01

    Plants are the source of most of our food, whether directly or as feed for the animals we eat. Our dinner table is a trophic level we share with the microbes that also feed on the primary photosynthetic producers. Microbes that enter into close interactions with plants need to evade or suppress detection and host immunity to access nutrients. They do this by deploying molecular tools - effectors - which target host processes. The mode of action of effector proteins in these events is varied and complex. Recent data from diverse systems indicate that RNA-interacting proteins and RNA itself are delivered by eukaryotic microbes, such as fungi and oomycetes, to host plants and contribute to the establishment of successful interactions. This is evidence that pathogenic microbes can interfere with the host software. We are beginning to see that pathogenic microbes are capable of hacking into the plants' immunity programs. © 2015 The Author. New Phytologist © 2015 New Phytologist Trust.

  4. Autonomous system for pathogen detection and identification

    International Nuclear Information System (INIS)

    Belgrader, P.; Benett, W.; Langlois, R.; Long, G.; Mariella, R.; Milanovich, F.; Miles, R.; Nelson, W.; Venkateswaran, K.

    1998-01-01

    This purpose of this project is to build a prototype instrument that will, running unattended, detect, identify, and quantify BW agents. In order to accomplish this, we have chosen to start with the world s leading, proven, assays for pathogens: surface-molecular recognition assays, such as antibody-based assays, implemented on a high-performance, identification (ID)-capable flow cytometer, and the polymerase chain reaction (PCR) for nucleic-acid based assays. With these assays, we must integrate the capability to: l collect samples from aerosols, water, or surfaces; l perform sample preparation prior to the assays; l incubate the prepared samples, if necessary, for a period of time; l transport the prepared, incubated samples to the assays; l perform the assays; l interpret and report the results of the assays. Issues such as reliability, sensitivity and accuracy, quantity of consumables, maintenance schedule, etc. must be addressed satisfactorily to the end user. The highest possible sensitivity and specificity of the assay must be combined with no false alarms. Today, we have assays that can, in under 30 minutes, detect and identify stimulants for BW agents at concentrations of a few hundred colony-forming units per ml of solution. If the bio-aerosol sampler of this system collects 1000 Ymin and concentrates the respirable particles into 1 ml of solution with 70% processing efficiency over a period of 5 minutes, then this translates to a detection/ID capability of under 0.1 agent-containing particle/liter of air

  5. HIV RNA and proviral HIV DNA can be detected in semen after 6 months of antiretroviral therapy although HIV RNA is undetectable in blood.

    Science.gov (United States)

    Du, Peiwei; Liu, An; Jiao, Yanmei; Liu, Cuie; Jiang, Taiyi; Zhu, Weijun; Zhu, Yunxia; Wu, Hao; Sun, Lijun

    2016-03-01

    The risk of sexual transmission of HIV is strongly correlated with amounts of genital HIV RNA. Few studies have reported amounts of HIV RNA and HIV DNA in semen in HIV-infected Chinese patients undergoing antiviral treatment (ART). In this observational study, the amounts of HIV RNA and HIV DNA in semen were assessed after six months of ART in HIV-infected Chinese individuals, when HIV RNA was undetectable in blood . This study included 19 HIV-infected Chinese men undergoing ART for six months. Amounts of HIV in paired semen and blood samples were assessed using real-time PCR. The C2-V5 region of the HIV envelope (env) genes was cloned and sequenced and genotype and co-receptor usage predicted based on the sequence. It was found that HIV RNA was undetectable in the plasma of most patients (17/19), whereas HIV RNA could be detected in the semen of most patients (16/19). HIV DNA could be detected in both semen and blood. Genetic diversity of HIV between the seminal and blood compartments was identified. Thus, amounts of HIV RNA and HIV DNA remain high in semen of HIV-infected Chinese patients after six months of ART treatment, even when HIV RNA was undetectable in blood. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

  6. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  7. A Rapid and Simple Real-Time PCR Assay for Detecting Foodborne Pathogenic Bacteria in Human Feces.

    Science.gov (United States)

    Hanabara, Yutaro; Ueda, Yutaka

    2016-11-22

    A rapid, simple method for detecting foodborne pathogenic bacteria in human feces is greatly needed. Here, we examined the efficacy of a method that employs a combination of a commercial PCR master mix, which is insensitive to PCR inhibitors, and a DNA extraction method which used sodium dodecyl benzene sulfonate (SDBS), and Tween 20 to counteract the inhibitory effects of SDBS on the PCR assay. This method could detect the target genes (stx1 and stx2 of enterohemorrhagic Escherichia coli, invA of Salmonella Enteritidis, tdh of Vibrio parahaemolyticus, gyrA of Campylobacter jejuni, ceuE of Campylobacter coli, SEA of Staphylococcus aureus, ces of Bacillus cereus, and cpe of Clostridium perfringens) in a fecal suspension containing 1.0 × 10 1 to 1.0 × 10 3 CFU/ml. Furthermore, the assay was neither inhibited nor influenced by individual differences among the fecal samples of 10 subjects or fecal concentration (40-160 mg/ml in the fecal suspension). When we attempted to detect the genes of pathogenic bacteria in 4 actual clinical cases, we found that this method was more sensitive than standard culture method. These results showed that this assay is a rapid, simple detection method for foodborne pathogenic bacteria in human feces.

  8. Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Rahman, Salma [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the

  9. Distribution of Plasmids in Distinct Leptospira Pathogenic Species.

    Science.gov (United States)

    Wang, Yanzhuo; Zhuang, Xuran; Zhong, Yi; Zhang, Cuicai; Zhang, Yan; Zeng, Lingbing; Zhu, Yongzhang; He, Ping; Dong, Ke; Pal, Utpal; Guo, Xiaokui; Qin, Jinhong

    2015-11-01

    Leptospirosis, caused by pathogenic Leptospira, is a worldwide zoonotic infection. The genus Leptospira includes at least 21 species clustered into three groups--pathogens, non-pathogens, and intermediates--based on 16S rRNA phylogeny. Research on Leptospira is difficult due to slow growth and poor transformability of the pathogens. Recent identification of extrachromosomal elements besides the two chromosomes in L. interrogans has provided new insight into genome complexity of the genus Leptospira. The large size, low copy number, and high similarity of the sequence of these extrachromosomal elements with the chromosomes present challenges in isolating and detecting them without careful genome assembly. In this study, two extrachromosomal elements were identified in L. borgpetersenii serovar Ballum strain 56604 through whole genome assembly combined with S1 nuclease digestion following pulsed-field gel electrophoresis (S1-PFGE) analysis. Further, extrachromosomal elements in additional 15 Chinese epidemic strains of Leptospira, comprising L. borgpetersenii, L. weilii, and L. interrogans, were successfully separated and identified, independent of genome sequence data. Southern blot hybridization with extrachromosomal element-specific probes, designated as lcp1, lcp2 and lcp3-rep, further confirmed their occurrences as extrachromosomal elements. In total, 24 plasmids were detected in 13 out of 15 tested strains, among which 11 can hybridize with the lcp1-rep probe and 11 with the lcp2-rep probe, whereas two can hybridize with the lcp3-rep probe. None of them are likely to be species-specific. Blastp search of the lcp1, lcp2, and lcp3-rep genes with a nonredundant protein database of Leptospira species genomes showed that their homologous sequences are widely distributed among clades of pathogens but not non-pathogens or intermediates. These results suggest that the plasmids are widely distributed in Leptospira species, and further elucidation of their biological

  10. A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.

    Science.gov (United States)

    Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G

    2015-05-21

    Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  12. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  13. Graphene-interfaced electrical biosensor for label-free and sensitive detection of foodborne pathogenic E. coli O157:H7.

    Science.gov (United States)

    Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum

    2017-05-15

    E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Inventory and update on argasid ticks and associated pathogens in Algeria.

    Science.gov (United States)

    Lafri, I; Benredjem, W; Neffah-Baaziz, F; Lalout, R; Abdelouahed, K; Gassen, B; Bakhouch, S; Chergui, M; Karakellah, M; Adjmi-Hamoudi, H; Bitam, I

    2018-05-01

    Argasid ticks include vectors of relapsing fevers caused by Borrelia spp. in humans, and they can transmit arboviruses and other bacterial pathogens. Knowledge about soft ticks ( Ixodida: Argasidae ) in Algeria is incomplete, and distribution data need to be updated. Here we report a series of entomologic investigations that we conducted in five different areas in Algeria between 2012 and 2015. Ticks were identified by entomologic keys and molecular tools (16S rRNA gene). Six distinct species belonging to two genera were identified, including Ornithodoros capensis s.s., Ornithodoros rupestris, Ornithodoros occidentalis, Ornithodoros erraticus, Ornithodoros sonrai and Argas persicus. The present study highlights the distribution of soft ticks, the establishment of an update inventory with nine species and associated pathogens detected in argasid ticks in Algeria.

  15. Antagonism pattern detection between microRNA and target expression in Ewing's sarcoma.

    Directory of Open Access Journals (Sweden)

    Loredana Martignetti

    Full Text Available MicroRNAs (miRNAs have emerged as fundamental regulators that silence gene expression at the post-transcriptional and translational levels. The identification of their targets is a major challenge to elucidate the regulated biological processes. The overall effect of miRNA is reflected on target mRNA expression, suggesting the design of new investigative methods based on high-throughput experimental data such as miRNA and transcriptome profiles. We propose a novel statistical measure of non-linear dependence between miRNA and mRNA expression, in order to infer miRNA-target interactions. This approach, which we name antagonism pattern detection, is based on the statistical recognition of a triangular-shaped pattern in miRNA-target expression profiles. This pattern is observed in miRNA-target expression measurements since their simultaneously elevated expression is statistically under-represented in the case of miRNA silencing effect. The proposed method enables miRNA target prediction to strongly rely on cellular context and physiological conditions reflected by expression data. The procedure has been assessed on synthetic datasets and tested on a set of real positive controls. Then it has been applied to analyze expression data from Ewing's sarcoma patients. The antagonism relationship is evaluated as a good indicator of real miRNA-target biological interaction. The predicted targets are consistently enriched for miRNA binding site motifs in their 3'UTR. Moreover, we reveal sets of predicted targets for each miRNA sharing important biological function. The procedure allows us to infer crucial miRNA regulators and their potential targets in Ewing's sarcoma disease. It can be considered as a valid statistical approach to discover new insights in the miRNA regulatory mechanisms.

  16. Humic substances interfere with detection of pathogenic prion protein

    Science.gov (United States)

    Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.

    2014-01-01

    Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.

  17. Universal, colorimetric microRNA detection strategy based on target-catalyzed toehold-mediated strand displacement reaction

    Science.gov (United States)

    Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu

    2018-02-01

    In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.

  18. A Broad RNA Virus Survey Reveals Both miRNA Dependence and Functional Sequestration

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Luna, Joseph M; Liniger, Matthias

    2016-01-01

    , critically depended on the interaction of cellular miR-17 and let-7 with the viral 3' UTR. Unlike canonical miRNA interactions, miR-17 and let-7 binding enhanced pestivirus translation and RNA stability. miR-17 sequestration by pestiviruses conferred reduced AGO binding and functional de...... immunoprecipitation (CLIP) of the Argonaute (AGO) proteins to characterize strengths and specificities of miRNA interactions in the context of 15 different RNA virus infections, including several clinically relevant pathogens. Notably, replication of pestiviruses, a major threat to milk and meat industries...

  19. Label-Free Platform for MicroRNA Detection Based on the Fluorescence Quenching of Positively Charged Gold Nanoparticles to Silver Nanoclusters.

    Science.gov (United States)

    Miao, Xiangmin; Cheng, Zhiyuan; Ma, Haiyan; Li, Zongbing; Xue, Ning; Wang, Po

    2018-01-16

    A novel strategy was developed for microRNA-155 (miRNA-155) detection based on the fluorescence quenching of positively charged gold nanoparticles [(+)AuNPs] to Ag nanoclusters (AgNCs). In the designed system, DNA-stabilized Ag nanoclusters (DNA/AgNCs) were introduced as fluorescent probes, and DNA-RNA heteroduplexes were formed upon the addition of target miRNA-155. Meanwhile, the (+)AuNPs could be electrostatically adsorbed on the negatively charged single-stranded DNA (ssDNA) or DNA-RNA heteroduplexes to quench the fluorescence signal. In the presence of duplex-specific nuclease (DSN), DNA-RNA heteroduplexes became a substrate for the enzymatic hydrolysis of the DNA strand to yield a fluorescence signal due to the diffusion of AgNCs away from (+)AuNPs. Under the optimal conditions, (+)AuNPs displayed very high quenching efficiency to AgNCs, which paved the way for ultrasensitive detection with a low detection limit of 33.4 fM. In particular, the present strategy demonstrated excellent specificity and selectivity toward the detection of target miRNA against control miRNAs, including mutated miRNA-155, miRNA-21, miRNA-141, let-7a, and miRNA-182. Moreover, the practical application value of the system was confirmed by the evaluation of the expression levels of miRNA-155 in clinical serum samples with satisfactory results, suggesting that the proposed sensing platform is promising for applications in disease diagnosis as well as the fundamental research of biochemistry.

  20. SERS-based inverse molecular sentinel (iMS) nanoprobes for multiplexed detection of microRNA cancer biomarkers in biological samples

    Science.gov (United States)

    Crawford, Bridget M.; Wang, Hsin-Neng; Fales, Andrew M.; Bowie, Michelle L.; Seewaldt, Victoria L.; Vo-Dinh, Tuan

    2017-02-01

    The development of sensitive and selective biosensing techniques is of great interest for clinical diagnostics. Here, we describe the development and application of a surface enhanced Raman scattering (SERS) sensing technology, referred to as "inverse Molecular Sentinel (iMS)" nanoprobes, for the detection of nucleic acid biomarkers in biological samples. This iMS nanoprobe involves the use of plasmonic-active nanostars as the sensing platform for a homogenous assay for multiplexed detection of nucleic acid biomarkers, including DNA, RNA and microRNA (miRNA). The "OFF-to-ON" signal switch is based on a non-enzymatic strand-displacement process and the conformational change of stem-loop (hairpin) oligonucleotide probes upon target binding. Here, we demonstrate the development of iMS nanoprobes for the detection of DNA sequences as well as a modified design of the nanoprobe for the detection of short (22-nt) microRNA sequences. The application of iMS nanoprobes to detect miRNAs in real biological samples was performed with total small RNA extracted from breast cancer cell lines. The multiplex capability of the iMS technique was demonstrated using a mixture of the two differently labeled nanoprobes to detect miR-21 and miR-34a miRNA biomarkers for breast cancer. The results of this study demonstrate the feasibility of applying the iMS technique for multiplexed detection of nucleic acid biomarkers, including short miRNAs molecules.

  1. Avian metapneumovirus excretion in vaccinated and non-vaccinated specified pathogen free laying chickens.

    Science.gov (United States)

    Hess, M; Huggins, M B; Mudzamiri, R; Heincz, U

    2004-02-01

    Vaccinated and non-vaccinated specified pathogen-free White Leghorn laying chickens were challenged at peak of lay by the intravenous or oculonasal route with a virulent avian metapneumovirus (aMPV) subtype B chicken strain. Severe clinical signs and a drop in egg production were induced in the non-vaccinated intravenously challenged birds whereas the vaccinates were not affected. Live virus excretion was demonstrated in the faeces and respiratory tract of non-vaccinated hens for up to 7 days post intravenous challenge. After oculonasal challenge, virus excretion could only be demonstrated in the respiratory tract for up to 5 days. No live virus excretion was found in either the faeces or the respiratory tract of vaccinated birds. Concurrent with live virus isolation, the presence of viral RNA was demonstrated by single reverse transcription-polymerase chain reaction (RT-PCR). Nested RT-PCR was more sensitive and viral RNA could be detected in non-vaccinated birds up to 28 days post either intravenous or oculonasal challenge, at which time the experiment was terminated. Viral RNA was detected for up to 12 days in vaccinated birds. This is the first study investigating excretion of aMPV and viral RNA in vaccinated and non-vaccinated laying hens challenged under experimental conditions. The results are of importance with regard to the persistence of aMPV and the appropriate diagnostic detection method in laying birds.

  2. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  3. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  4. Detection of human bacterial pathogens in ticks collected from Louisiana black bears (Ursus americanus luteolus).

    Science.gov (United States)

    Leydet, Brian F; Liang, Fang-Ting

    2013-04-01

    There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.

    Science.gov (United States)

    Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad

    2018-03-15

    The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Non-coding RNA detection methods combined to improve usability, reproducibility and precision

    Directory of Open Access Journals (Sweden)

    Kreikemeyer Bernd

    2010-09-01

    Full Text Available Abstract Background Non-coding RNAs gain more attention as their diverse roles in many cellular processes are discovered. At the same time, the need for efficient computational prediction of ncRNAs increases with the pace of sequencing technology. Existing tools are based on various approaches and techniques, but none of them provides a reliable ncRNA detector yet. Consequently, a natural approach is to combine existing tools. Due to a lack of standard input and output formats combination and comparison of existing tools is difficult. Also, for genomic scans they often need to be incorporated in detection workflows using custom scripts, which decreases transparency and reproducibility. Results We developed a Java-based framework to integrate existing tools and methods for ncRNA detection. This framework enables users to construct transparent detection workflows and to combine and compare different methods efficiently. We demonstrate the effectiveness of combining detection methods in case studies with the small genomes of Escherichia coli, Listeria monocytogenes and Streptococcus pyogenes. With the combined method, we gained 10% to 20% precision for sensitivities from 30% to 80%. Further, we investigated Streptococcus pyogenes for novel ncRNAs. Using multiple methods--integrated by our framework--we determined four highly probable candidates. We verified all four candidates experimentally using RT-PCR. Conclusions We have created an extensible framework for practical, transparent and reproducible combination and comparison of ncRNA detection methods. We have proven the effectiveness of this approach in tests and by guiding experiments to find new ncRNAs. The software is freely available under the GNU General Public License (GPL, version 3 at http://www.sbi.uni-rostock.de/moses along with source code, screen shots, examples and tutorial material.

  7. rMATS: robust and flexible detection of differential alternative splicing from replicate RNA-Seq data.

    Science.gov (United States)

    Shen, Shihao; Park, Juw Won; Lu, Zhi-xiang; Lin, Lan; Henry, Michael D; Wu, Ying Nian; Zhou, Qing; Xing, Yi

    2014-12-23

    Ultra-deep RNA sequencing (RNA-Seq) has become a powerful approach for genome-wide analysis of pre-mRNA alternative splicing. We previously developed multivariate analysis of transcript splicing (MATS), a statistical method for detecting differential alternative splicing between two RNA-Seq samples. Here we describe a new statistical model and computer program, replicate MATS (rMATS), designed for detection of differential alternative splicing from replicate RNA-Seq data. rMATS uses a hierarchical model to simultaneously account for sampling uncertainty in individual replicates and variability among replicates. In addition to the analysis of unpaired replicates, rMATS also includes a model specifically designed for paired replicates between sample groups. The hypothesis-testing framework of rMATS is flexible and can assess the statistical significance over any user-defined magnitude of splicing change. The performance of rMATS is evaluated by the analysis of simulated and real RNA-Seq data. rMATS outperformed two existing methods for replicate RNA-Seq data in all simulation settings, and RT-PCR yielded a high validation rate (94%) in an RNA-Seq dataset of prostate cancer cell lines. Our data also provide guiding principles for designing RNA-Seq studies of alternative splicing. We demonstrate that it is essential to incorporate biological replicates in the study design. Of note, pooling RNAs or merging RNA-Seq data from multiple replicates is not an effective approach to account for variability, and the result is particularly sensitive to outliers. The rMATS source code is freely available at rnaseq-mats.sourceforge.net/. As the popularity of RNA-Seq continues to grow, we expect rMATS will be useful for studies of alternative splicing in diverse RNA-Seq projects.

  8. Construction of an infectious cDNA clone of avian hepatitis E virus (avian HEV) recovered from a clinically healthy chicken in the United States and characterization of its pathogenicity in specific-pathogen-free chickens.

    Science.gov (United States)

    Kwon, Hyuk Moo; LeRoith, Tanya; Pudupakam, R S; Pierson, F William; Huang, Yao-Wei; Dryman, Barbara A; Meng, Xiang-Jin

    2011-01-27

    A genetically distinct strain of avian hepatitis E virus (avian HEV-VA strain) was isolated from a healthy chicken in Virginia, and thus it is important to characterize and compare its pathogenicity with the prototype strain (avian HEV-prototype) isolated from a diseased chicken. Here we first constructed an infectious clone of the avian HEV-VA strain. Capped RNA transcripts from the avian HEV-VA clone were replication-competent after transfection of LMH chicken liver cells. Chickens inoculated intrahepatically with RNA transcripts of avian HEV-VA clone developed active infection as evidenced by fecal virus shedding, viremia, and seroconversion. To characterize the pathogenicity, RNA transcripts of both avian HEV-VA and avian HEV-prototype clones were intrahepatically inoculated into the livers of chickens. Avian HEV RNA was detected in feces, serum and bile samples from 10/10 avian HEV-VA-inoculated and 9/9 avian HEV-prototype-inoculated chickens although seroconversion occurred only in some chickens during the experimental period. The histopathological lesion scores were lower for avian HEV-VA group than avian HEV-prototype group in the liver at 3 and 5 weeks post-inoculation (wpi) and in the spleen at 3 wpi, although the differences were not statistically significant. The liver/body weight ratio, indicative of liver enlargement, of both avian HEV-VA and avian HEV-prototype groups were significantly higher than that of the control group at 5 wpi. Overall, the avian HEV-VA strain still induces histological liver lesions even though it was isolated from a healthy chicken. The results also showed that intrahepatic inoculation of chickens with RNA transcripts of avian HEV infectious clone may serve as an alternative for live virus in animal pathogenicity studies. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. The defense-responsive genes showing enhanced and repressed expression after pathogen infection in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)

    2002-01-01

    Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.

  10. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  11. [Detection of biofilm formation by selected pathogens relevant to the food industry].

    Science.gov (United States)

    Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J

    2015-09-01

    Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.

  12. Multifunctional Nanotechnology-Enabled Sensors for Rapid Capture and Detection of Pathogens.

    Science.gov (United States)

    Mustafa, Fatima; Hassan, Rabeay Y A; Andreescu, Silvana

    2017-09-15

    Nanomaterial-based sensing approaches that incorporate different types of nanoparticles (NPs) and nanostructures in conjunction with natural or synthetic receptors as molecular recognition elements provide opportunities for the design of sensitive and selective assays for rapid detection of contaminants. This review summarizes recent advancements over the past ten years in the development of nanotechnology-enabled sensors and systems for capture and detection of pathogens. The most common types of nanostructures and NPs, their modification with receptor molecules and integration to produce viable sensing systems with biorecognition, amplification and signal readout are discussed. Examples of all-in-one systems that combine multifunctional properties for capture, separation, inactivation and detection are also provided. Current trends in the development of low-cost instrumentation for rapid assessment of food contamination are discussed as well as challenges for practical implementation and directions for future research.

  13. Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

    2016-01-19

    MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.

  14. Demonstration of a very inexpensive, turbidimetric, real-time, RT-LAMP detection platform using shrimp Laem-Singh virus (LSNV as a model.

    Directory of Open Access Journals (Sweden)

    Narong Arunrut

    Full Text Available Rapid and accurate detection of pathogens under field laboratory conditions is necessary for effective control of veterinary pathogens. Here we describe a prototype, portable, pathogen detection device developed for single tube, real-time, reverse transcription, loop-mediated isothermal amplification (RT-LAMP using Laem-Singh virus (LSNV as a model. LSNV is an RNA virus and a component cause of growth retardation in black tiger shrimp. We chose its RNA-dependent RNA polymerase (RdRp gene as the target for our tests. The basis for detection was measurement of turbidity arising from formation of a white, insoluble magnesium pyrophosphate precipitate byproduct upon amplification of the RdRp target sequence from 100 ng template RNA extracted from shrimp. The measurement device consisted of a heating block to maintain constant temperature in the RT-LAMP reaction for 8 Eppindorf sample tubes, a light-emitting diode (LED light source providing red light emission at 650 nm wavelength to pass through sample tubes, a light dependent resistance (LDR photo-detector and a software program to report turbidity events and could potentially be marketed for under US$3000. The device was connected to a computer to display real-time results in a variety of formats. The optimized protocol for LSNV detection consisted of incubation of the sample tubes at 65 °C for 1 h during which turbidity was continuously measured, and quantitative results could be obtained by reaction time measurement. The sensitivity of detection was comparable to that of conventional nested RT-PCR and there was no cross reaction with other common shrimp viruses. The device was used for quantitative measurement of relative copy numbers of LSNV RdRp in 8 shrimp tissues and they were found to be highest in the gills followed in order by the lymphoid organ and hemolymph (p ≤ 0.05. This platform can be easily adapted for detection of other pathogens under field laboratory settings.

  15. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  16. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  17. Inventory and update on argasid ticks and associated pathogens in Algeria

    Directory of Open Access Journals (Sweden)

    I. Lafri

    2018-05-01

    Full Text Available Argasid ticks include vectors of relapsing fevers caused by Borrelia spp. in humans, and they can transmit arboviruses and other bacterial pathogens. Knowledge about soft ticks (Ixodida: Argasidae in Algeria is incomplete, and distribution data need to be updated. Here we report a series of entomologic investigations that we conducted in five different areas in Algeria between 2012 and 2015. Ticks were identified by entomologic keys and molecular tools (16S rRNA gene. Six distinct species belonging to two genera were identified, including Ornithodoros capensis s.s., Ornithodoros rupestris, Ornithodoros occidentalis, Ornithodoros erraticus, Ornithodoros sonrai and Argas persicus. The present study highlights the distribution of soft ticks, the establishment of an update inventory with nine species and associated pathogens detected in argasid ticks in Algeria. Keywords: Argasid, Borrelia, Ornithodoros, Rickettsia

  18. Clinical validation of integrated nucleic acid and protein detection on an electrochemical biosensor array for urinary tract infection diagnosis.

    Directory of Open Access Journals (Sweden)

    Ruchika Mohan

    Full Text Available BACKGROUND: Urinary tract infection (UTI is a common infection that poses a substantial healthcare burden, yet its definitive diagnosis can be challenging. There is a need for a rapid, sensitive and reliable analytical method that could allow early detection of UTI and reduce unnecessary antibiotics. Pathogen identification along with quantitative detection of lactoferrin, a measure of pyuria, may provide useful information towards the overall diagnosis of UTI. Here, we report an integrated biosensor platform capable of simultaneous pathogen identification and detection of urinary biomarker that could aid the effectiveness of the treatment and clinical management. METHODOLOGY/PRINCIPAL FINDINGS: The integrated pathogen 16S rRNA and host lactoferrin detection using the biosensor array was performed on 113 clinical urine samples collected from patients at risk for complicated UTI. For pathogen detection, the biosensor used sandwich hybridization of capture and detector oligonucleotides to the target analyte, bacterial 16S rRNA. For detection of the protein biomarker, the biosensor used an analogous electrochemical sandwich assay based on capture and detector antibodies. For this assay, a set of oligonucleotide probes optimized for hybridization at 37°C to facilitate integration with the immunoassay was developed. This probe set targeted common uropathogens including E. coli, P. mirabilis, P. aeruginosa and Enterococcus spp. as well as less common uropathogens including Serratia, Providencia, Morganella and Staphylococcus spp. The biosensor assay for pathogen detection had a specificity of 97% and a sensitivity of 89%. A significant correlation was found between LTF concentration measured by the biosensor and WBC and leukocyte esterase (p<0.001 for both. CONCLUSION/SIGNIFICANCE: We successfully demonstrate simultaneous detection of nucleic acid and host immune marker on a single biosensor array in clinical samples. This platform can be used for

  19. New diagnostics for melanoma detection: from artificial intelligence to RNA microarrays.

    Science.gov (United States)

    Ahlgrimm-Siess, Verena; Laimer, Martin; Arzberger, Edith; Hofmann-Wellenhof, Rainer

    2012-07-01

    Early detection of melanoma remains crucial to ensuring a favorable prognosis. Dermoscopy and total body photography are well-established noninvasive aids that increase the diagnostic accuracy of dermatologists in their daily routine, beyond that of a naked-eye examination. New noninvasive diagnostic techniques, such as reflectance confocal microscopy, multispectral digital imaging and RNA microarrays, are currently being investigated to determine their utility for melanoma detection. This review presents emerging technologies for noninvasive melanoma diagnosis, and discusses their advantages and limitations.

  20. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  1. Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

    2007-11-01

    Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

  2. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m

  3. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Science.gov (United States)

    Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

    2012-01-01

    In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

  4. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  5. An Annotation Agnostic Algorithm for Detecting Nascent RNA Transcripts in GRO-Seq.

    Science.gov (United States)

    Azofeifa, Joseph G; Allen, Mary A; Lladser, Manuel E; Dowell, Robin D

    2017-01-01

    We present a fast and simple algorithm to detect nascent RNA transcription in global nuclear run-on sequencing (GRO-seq). GRO-seq is a relatively new protocol that captures nascent transcripts from actively engaged polymerase, providing a direct read-out on bona fide transcription. Most traditional assays, such as RNA-seq, measure steady state RNA levels which are affected by transcription, post-transcriptional processing, and RNA stability. GRO-seq data, however, presents unique analysis challenges that are only beginning to be addressed. Here, we describe a new algorithm, Fast Read Stitcher (FStitch), that takes advantage of two popular machine-learning techniques, hidden Markov models and logistic regression, to classify which regions of the genome are transcribed. Given a small user-defined training set, our algorithm is accurate, robust to varying read depth, annotation agnostic, and fast. Analysis of GRO-seq data without a priori need for annotation uncovers surprising new insights into several aspects of the transcription process.

  6. Deep RNA-Seq profile reveals biodiversity, plant-microbe interactions and a large family of NBS-LRR resistance genes in walnut (Juglans regia) tissues.

    Science.gov (United States)

    Chakraborty, Sandeep; Britton, Monica; Martínez-García, P J; Dandekar, Abhaya M

    2016-03-01

    Deep RNA-Seq profiling, a revolutionary method used for quantifying transcriptional levels, often includes non-specific transcripts from other co-existing organisms in spite of stringent protocols. Using the recently published walnut genome sequence as a filter, we present a broad analysis of the RNA-Seq derived transcriptome profiles obtained from twenty different tissues to extract the biodiversity and possible plant-microbe interactions in the walnut ecosystem in California. Since the residual nature of the transcripts being analyzed does not provide sufficient information to identify the exact strain, inferences made are constrained to the genus level. The presence of the pathogenic oomycete Phytophthora was detected in the root through the presence of a glyceraldehyde-3-phosphate dehydrogenase. Cryptococcus, the causal agent of cryptococcosis, was found in the catkins and vegetative buds, corroborating previous work indicating that the plant surface supported the sexual cycle of this human pathogen. The RNA-Seq profile revealed several species of the endophytic nitrogen fixing Actinobacteria. Another bacterial species implicated in aerobic biodegradation of methyl tert-butyl ether (Methylibium petroleiphilum) is also found in the root. RNA encoding proteins from the pea aphid were found in the leaves and vegetative buds, while a serine protease from mosquito with significant homology to a female reproductive tract protease from Drosophila mojavensis in the vegetative bud suggests egg-laying activities. The comprehensive analysis of RNA-seq data present also unraveled detailed, tissue-specific information of ~400 transcripts encoded by the largest family of resistance (R) genes (NBS-LRR), which possibly rationalizes the resistance of the specific walnut plant to the pathogens detected. Thus, we elucidate the biodiversity and possible plant-microbe interactions in several walnut (Juglans regia) tissues in California using deep RNA-Seq profiling.

  7. Bacterial RNA induces myocyte cellular dysfunction through the activation of PKR

    OpenAIRE

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V.; Tai, TC; Saleh, Mazen; Parrillo, Joseph E.; Kumar, Anand; Kumar, Aseem

    2012-01-01

    Severe sepsis and the ensuing septic shock are serious life threatening conditions. These diseases are triggered by the host's over exuberant systemic response to the infecting pathogen. Several surveillance mechanisms have evolved to discriminate self from foreign RNA and accordingly trigger effective cellular responses to target the pathogenic threats. The RNA-dependent protein kinase (PKR) is a key component of the cytoplasmic RNA sensors involved in the recognition of viral double-strande...

  8. Non-Specific dsRNA-Mediated Antiviral Response in the Honey Bee

    Science.gov (United States)

    Flenniken, Michelle L.; Andino, Raul

    2013-01-01

    Honey bees are essential pollinators of numerous agricultural crops. Since 2006, honey bee populations have suffered considerable annual losses that are partially attributed to Colony Collapse Disorder (CCD). CCD is an unexplained phenomenon that correlates with elevated incidence of pathogens, including RNA viruses. Honey bees are eusocial insects that live in colonies of genetically related individuals that work in concert to gather and store nutrients. Their social organization provides numerous benefits, but also facilitates pathogen transmission between individuals. To investigate honey bee antiviral defense mechanisms, we developed an RNA virus infection model and discovered that administration of dsRNA, regardless of sequence, reduced virus infection. Our results suggest that dsRNA, a viral pathogen associated molecular pattern (PAMP), triggers an antiviral response that controls virus infection in honey bees. PMID:24130869

  9. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    International Nuclear Information System (INIS)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-01-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  10. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Science.gov (United States)

    Giubileo, Gianfranco; Lai, Antonella; Piccinelli, Delinda; Puiu, Adriana

    2010-11-01

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges ( Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  11. Laser diagnostic technology for early detection of pathogen infestation in orange fruits

    Energy Technology Data Exchange (ETDEWEB)

    Giubileo, Gianfranco, E-mail: gianfranco.giubileo@frascati.enea.i [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Lai, Antonella; Piccinelli, Delinda [ENEA Frascati, Via E. Fermi 45, 00044 (Italy); Puiu, Adriana [Tor Vergata University of Rome, Faculty of Engineering, Via del Politecnico 1, 00133 Rome (Italy)

    2010-11-11

    Due to an increased expectation of food products that respect high quality and safety standards, there is a need for the growth of accurate, fast, objective and non-destructive technologies for quality determination of food and agricultural products. For this purpose, a diagnostic system based on laser photoacoustic spectroscopy (LPAS) was developed at ENEA Frascati Molecular Spectroscopy Laboratory (Italy). In the design of the photoacoustic detector, particular emphasis was placed in attaining a high sensitivity in detecting ethylene (ET) down to sub-parts per billion level (minimum detectable concentration 0.2 ppb). This was required due to the necessity to monitor and follow up ET production at a single fruit scale. ET is normally synthesised in very low amounts by healthy citrus fruits; however stress conditions such as pathogen attack may induce a substantial increase in the synthesised ET. In the present paper, the comparison between the ET emitted by healthy oranges (Citrus sinensis L. Osbeck) cv Navel and by Phytophthora citrophthora infested Navel orange fruits are reported. The obtained results show a well evident increase in ET emission from the infested fruit with respect to the healthy one, even 24 h after the inoculation with the pathogen; at that time the tissue necrosis was not yet visible, and the fruit was also not yet damaged. The possibility to perform a real time non-destructive detection of ET traces makes the LPAS a powerful tool for monitoring the healthy state of the citrus fruits.

  12. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  13. Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos Shown with 16S rRNA Gene-Based Microbial Community Analysis

    Directory of Open Access Journals (Sweden)

    Isamu Maeda

    2013-01-01

    Full Text Available Jungle Crows (Corvus macrorhynchos prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

  14. Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo

    2015-06-16

    A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.

  15. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    DEFF Research Database (Denmark)

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per

    2015-01-01

    the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  16. Pathogenic bacteria in sewage treatment plants as revealed by 454 pyrosequencing.

    Science.gov (United States)

    Ye, Lin; Zhang, Tong

    2011-09-01

    This study applied 454 high-throughput pyrosequencing to analyze potentially pathogenic bacteria in activated sludge from 14 municipal wastewater treatment plants (WWTPs) across four countries (China, U.S., Canada, and Singapore), plus the influent and effluent of one of the 14 WWTPs. A total of 370,870 16S rRNA gene sequences with average length of 207 bps were obtained and all of them were assigned to corresponding taxonomic ranks by using RDP classifier and MEGAN. It was found that the most abundant potentially pathogenic bacteria in the WWTPs were affiliated with the genera of Aeromonas and Clostridium. Aeromonas veronii, Aeromonas hydrophila, and Clostridium perfringens were species most similar to the potentially pathogenic bacteria found in this study. Some sequences highly similar (>99%) to Corynebacterium diphtheriae were found in the influent and activated sludge samples from a saline WWTP. Overall, the percentage of the sequences closely related (>99%) to known pathogenic bacteria sequences was about 0.16% of the total sequences. Additionally, a platform-independent Java application (BAND) was developed for graphical visualization of the data of microbial abundance generated by high-throughput pyrosequencing. The approach demonstrated in this study could examine most of the potentially pathogenic bacteria simultaneously instead of one-by-one detection by other methods.

  17. Integration of the Pokeweed miRNA and mRNA Transcriptomes Reveals Targeting of Jasmonic Acid-Responsive Genes

    Directory of Open Access Journals (Sweden)

    Kira C. M. Neller

    2018-05-01

    Full Text Available The American pokeweed plant, Phytolacca americana, displays broad-spectrum resistance to plant viruses and is a heavy metal hyperaccumulator. However, little is known about the regulation of biotic and abiotic stress responses in this non-model plant. To investigate the control of miRNAs in gene expression, we sequenced the small RNA transcriptome of pokeweed treated with jasmonic acid (JA, a hormone that mediates pathogen defense and stress tolerance. We predicted 145 miRNAs responsive to JA, most of which were unique to pokeweed. These miRNAs were low in abundance and condition-specific, with discrete expression change. Integration of paired mRNA-Seq expression data enabled us to identify correlated, novel JA-responsive targets that mediate hormone biosynthesis, signal transduction, and pathogen defense. The expression of approximately half the pairs was positively correlated, an uncommon finding that we functionally validated by mRNA cleavage. Importantly, we report that a pokeweed-specific miRNA targets the transcript of OPR3, novel evidence that a miRNA regulates a JA biosynthesis enzyme. This first large-scale small RNA study of a Phytolaccaceae family member shows that miRNA-mediated control is a significant component of the JA response, associated with widespread changes in expression of genes required for stress adaptation.

  18. Label-free fluorescence strategy for sensitive microRNA detection based on isothermal exponential amplification and graphene oxide.

    Science.gov (United States)

    Li, Wei; Hou, Ting; Wu, Min; Li, Feng

    2016-01-01

    MicroRNAs (miRNAs) play an important role in many biological processes, and have been regarded as potential targets and biomarkers in cancer diagnosis and therapy. Also, to meet the big challenge imposed by the characteristics of miRNAs, such as small size and vulnerability to enzymatic digestion, it is of great importance to develop accurate, sensitive and simple miRNA assays. Herein, we developed a label-free fluorescence strategy for sensitive miRNA detection by combining isothermal exponential amplification and the unique features of SYBR Green I (SG) and graphene oxide (GO), in which SG gives significantly enhanced fluorescence upon intercalation into double-stranded DNAs (dsDNAs), and GO selectively adsorbs miRNA, single-stranded DNA and SG, to protect miRNA from enzymatic digestion, and to quench the fluorescence of the adsorbed SG. In the presence of the target miRNA, the ingeniously designed hairpin probe (HP) is unfolded and the subsequent polymerization and strand displacement reaction takes place to initiate the target recycling process. The newly formed dsDNAs are then recognized and cleaved by the nicking enzyme, generating new DNA triggers with the same sequence as the target miRNA, which hybridize with intact HPs to initiate new extension reactions. As a result, the circular exponential amplification for target miRNA is achieved and large amount of dsDNAs are formed to generate significantly enhanced fluorescence upon the intercalation of SG. Thus sensitive and selective fluorescence miRNA detection is realized, and the detection limit of 3 fM is obtained. Besides, this method exhibits additional advantages of simplicity and low cost, since expensive and tedious labeling process is avoided. Therefore, the as-proposed label-free fluorescence strategy has great potential in the applications in miRNA-related clinical practices and biochemical researches. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Sensitive voltammetric detection of yeast RNA based on its interaction with Victoria Blue B

    Directory of Open Access Journals (Sweden)

    WEI SUN

    2009-12-01

    Full Text Available Voltammetric studies of the interaction of yeast RNA (y-RNA with Victoria Blue B (VBB are described in this paper. Furthermore, a linear sweep voltammetric method for the detection of y-RNA was established. The reaction conditions, such as acidity and amount of buffer solution, the concentration of VBB, the reaction time and temperature, etc., were carefully investigated by second order derivative linear sweep voltammetry. Under the optimal conditions, the reduction peak current of VBB at –0.75 V decreased greatly after the addition of y-RNA to the solution without any shift of the reduction peak potential. Based on the decrease of the peak current, a new quantitative method for the determination of y-RNA was developed. The effects of co-existing substances on the determination were carefully investigated and three synthetic samples were determined with satisfactory results. The stoichiometry of the VBB–y-RNA complex was calculated by linear sweep voltammetry and the interaction mechanism is discussed.

  20. Non-coding RNA regulation in pathogenic bacteria located inside eukaryotic cells

    NARCIS (Netherlands)

    Ortega, Alvaro D.; Quereda, Juan J; Pucciarelli, M Graciela; García-del Portillo, Francisco

    2014-01-01

    Intracellular bacterial pathogens have evolved distinct lifestyles inside eukaryotic cells. Some pathogens coexist with the infected cell in an obligate intracellular state, whereas others transit between the extracellular and intracellular environment. Adaptation to these intracellular lifestyles

  1. On-Particle Rolling Circle Amplification-Based Core-Satellite Magnetic Superstructures for MicroRNA Detection

    DEFF Research Database (Denmark)

    Tian, Bo; Qiu, Zhen; Ma, Jing

    2018-01-01

    -specific nuclease in the presence of target microRNA, resulting in a release of MNPs that can be quantified in an optomagnetic sensor. The proposed biosensor has a simple mix-separate-measure strategy. For let-7b detection, the proposed biosensor offers a wide linear detection range of approximately 5 orders...

  2. SOAPsplice: genome-wide ab initio detection of splice junctions from RNA-Seq data

    Directory of Open Access Journals (Sweden)

    Songbo eHuang

    2011-07-01

    Full Text Available RNA-Seq, a method using next generation sequencing technologies to sequence the transcriptome, facilitates genome-wide analysis of splice junction sites. In this paper, we introduce SOAPsplice, a robust tool to detect splice junctions using RNA-Seq data without using any information of known splice junctions. SOAPsplice uses a novel two-step approach consisting of first identifying as many reasonable splice junction candidates as possible, and then, filtering the false positives with two effective filtering strategies. In both simulated and real datasets, SOAPsplice is able to detect many reliable splice junctions with low false positive rate. The improvement gained by SOAPsplice, when compared to other existing tools, becomes more obvious when the depth of sequencing is low. SOAPsplice is freely available at http://soap.genomics.org.cn/soapsplice.html.

  3. System for rapid detection of antibiotic resistance of airborne pathogens

    Science.gov (United States)

    Fortin, M.; Noiseux, I.; Mouslinkina, L.; Vernon, M. L.; Laflamme, C.; Filion, G.; Duchaine, C.; Ho, J.

    2009-05-01

    This project uses function-based detection via a fundamental understanding of the genetic markers of AR to distinguish harmful organisms from innocuous ones. This approach circumvents complex analyses to unravel the taxonomic details of 1399 pathogen species, enormously simplifying detection requirements. Laval Hospital's fast permeabilization strategy enables AR revelation in <1hr. Packaging the AR protocols in liquid-processing cartridges and coupling these to our in-house miniature fiber optic flow cell (FOFC) provides first responders with timely information on-site. INO's FOFC platform consists of a specialty optical fiber through which a hole is transversally bored by laser micromachining. The analyte solution is injected into the hole of the fiber and the particles are detected and counted. The advantage with respect to classic free space FC is that alignment occurs in the fabrication process only and complex excitation and collection optics are replaced by optical fibers. Moreover, we use a sheathless configuration which has the advantage of increase the portability of the system, to reduce excess biohazard material and the need for weekly maintenance. In this paper we present the principle of our FOFC along with a, demonstration of the basic capability of the platform for detection of bacillus cereus spores using permeabilized staining.

  4. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  5. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  6. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff.

    Science.gov (United States)

    Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A

    2010-01-01

    Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.

  7. A Role for Nonsense-Mediated mRNA Decay in Plants: Pathogen Responses Are Induced in Arabidopsis thaliana NMD Mutants

    Science.gov (United States)

    Rayson, Samantha; Arciga-Reyes, Luis; Wootton, Lucie; De Torres Zabala, Marta; Truman, William; Graham, Neil; Grant, Murray; Davies, Brendan

    2012-01-01

    Nonsense-mediated mRNA decay (NMD) is a conserved mechanism that targets aberrant mRNAs for destruction. NMD has also been found to regulate the expression of large numbers of genes in diverse organisms, although the biological role for this is unclear and few evolutionarily conserved targets have been identified. Expression analyses of three Arabidopsis thaliana lines deficient in NMD reveal that the vast majority of NMD-targeted transcripts are associated with response to pathogens. Congruently, NMD mutants, in which these transcripts are elevated, confer partial resistance to Pseudomonas syringae. These findings suggest a biological rationale for the regulation of gene expression by NMD in plants and suggest that manipulation of NMD could offer a new approach for crop protection. Amongst the few non-pathogen responsive NMD-targeted genes, one potential NMD targeted signal, the evolutionarily conserved upstream open reading frame (CuORF), was found to be hugely over-represented, raising the possibility that this feature could be used to target specific physiological mRNAs for control by NMD. PMID:22384098

  8. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  9. Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone

    Science.gov (United States)

    Xia, Hongjie; Wang, Peipei; Wang, Guang-Chuan; Yang, Jie; Sun, Xianlin; Wu, Wenzhe; Qiu, Yang; Shu, Ting; Zhao, Xiaolu; Yin, Lei; Qin, Cheng-Feng; Hu, Yuanyang; Zhou, Xi

    2015-01-01

    RNA helicases and chaperones are the two major classes of RNA remodeling proteins, which function to remodel RNA structures and/or RNA-protein interactions, and are required for all aspects of RNA metabolism. Although some virus-encoded RNA helicases/chaperones have been predicted or identified, their RNA remodeling activities in vitro and functions in the viral life cycle remain largely elusive. Enteroviruses are a large group of positive-stranded RNA viruses in the Picornaviridae family, which includes numerous important human pathogens. Herein, we report that the nonstructural protein 2CATPase of enterovirus 71 (EV71), which is the major causative pathogen of hand-foot-and-mouth disease and has been regarded as the most important neurotropic enterovirus after poliovirus eradication, functions not only as an RNA helicase that 3′-to-5′ unwinds RNA helices in an adenosine triphosphate (ATP)-dependent manner, but also as an RNA chaperone that destabilizes helices bidirectionally and facilitates strand annealing and complex RNA structure formation independently of ATP. We also determined that the helicase activity is based on the EV71 2CATPase middle domain, whereas the C-terminus is indispensable for its RNA chaperoning activity. By promoting RNA template recycling, 2CATPase facilitated EV71 RNA synthesis in vitro; when 2CATPase helicase activity was impaired, EV71 RNA replication and virion production were mostly abolished in cells, indicating that 2CATPase-mediated RNA remodeling plays a critical role in the enteroviral life cycle. Furthermore, the RNA helicase and chaperoning activities of 2CATPase are also conserved in coxsackie A virus 16 (CAV16), another important enterovirus. Altogether, our findings are the first to demonstrate the RNA helicase and chaperoning activities associated with enterovirus 2CATPase, and our study provides both in vitro and cellular evidence for their potential roles during viral RNA replication. These findings increase our

  10. High throughput, multiplexed pathogen detection authenticates plague waves in medieval Venice, Italy.

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-03-10

    Historical records suggest that multiple burial sites from the 14th-16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century.

  11. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  12. Signal-on electrochemiluminescence biosensor for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction.

    Science.gov (United States)

    Wang, Minghui; Zhou, Yunlei; Yin, Huanshun; Jiang, Wenjing; Wang, Haiyan; Ai, Shiyun

    2018-06-01

    MicroRNAs play crucial role in regulating gene expression in organism, thus it is very necessary to exploit an efficient method for the sensitive and specific detection of microRNA. Herein, a signal-on electrochemiluminescence biosensor was fabricated for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction (ISDPR). In the presence of target microRNA, amounts of trigger DNA could be generated by the first ISDPR. Then, the trigger DNA and the primer hybridized simultaneously with the hairpin probe to open the stem of the probe, and then the ECL signal will be emitted. In the presence of phi29 DNA polymerase and dNTPs, the trigger DNA could be displaced to initiate a new cycle which was the second ISDPR. Due to the two-stage amplification, this method presented excellent detection sensitivity with a low detection limit of 0.14 fM. Moreover, the applicability of the developed method was demonstrated by detecting the change of microRNA-319a content in the leaves of rice seedlings after the rice seeds were incubated with chemical mutagen of ethyl methanesulfonate. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Fluorescence-Free Biosensor Methods in Detection of Food Pathogens with a Special Focus on Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Rajeswaran Radhakrishnan

    2017-12-01

    Full Text Available Food pathogens contaminate food products that allow their growth on the shelf and also under refrigerated conditions. Therefore, it is of utmost importance to lower the limit of detection (LOD of the method used and to obtain the results within hours to few days. Biosensor methods exploit the available technologies to individuate and provide an approximate quantification of the bacteria present in a sample. The main bottleneck of these methods depends on the aspecific binding to the surfaces and on a change in sensitivity when bacteria are in a complex food matrix with respect to bacteria in a liquid food sample. In this review, we introduce surface plasmon resonance (SPR, new advancements in SPR techniques, and electrochemical impedance spectroscopy (EIS, as fluorescence-free biosensing technologies for detection of L. monocytogenes in foods. The application of the two methods has facilitated L. monocytogenes detection with LOD of 1 log CFU/mL. Further advancements are envisaged through the combination of biosensor methods with immunoseparation of bacteria from larger volumes, application of lab-on-chip technologies, and EIS sensing methods for multiplex pathogen detection. Validation efforts are being conducted to demonstrate the robustness of detection, reproducibility and variability in multi-site installations.

  14. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

    Science.gov (United States)

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

    2016-07-01

    Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies

  15. Development of RNA-FISH Assay for Detection of Oncogenic FGFR3-TACC3 Fusion Genes in FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Masahiro Kurobe

    Full Text Available Oncogenic FGFR3-TACC3 fusions and FGFR3 mutations are target candidates for small molecule inhibitors in bladder cancer (BC. Because FGFR3 and TACC3 genes are located very closely on chromosome 4p16.3, detection of the fusion by DNA-FISH (fluorescent in situ hybridization is not a feasible option. In this study, we developed a novel RNA-FISH assay using branched DNA probe to detect FGFR3-TACC3 fusions in formaldehyde-fixed paraffin-embedded (FFPE human BC samples.The RNA-FISH assay was developed and validated using a mouse xenograft model with human BC cell lines. Next, we assessed the consistency of the RNA-FISH assay using 104 human BC samples. In this study, primary BC tissues were stored as frozen and FFPE tissues. FGFR3-TACC3 fusions were independently detected in FFPE sections by the RNA-FISH assay and in frozen tissues by RT-PCR. We also analyzed the presence of FGFR3 mutations by targeted sequencing of genomic DNA extracted from deparaffinized FFPE sections.FGFR3-TACC3 fusion transcripts were identified by RNA-FISH and RT-PCR in mouse xenograft FFPE tissues using the human BC cell lines RT112 and RT4. These cell lines have been reported to be fusion-positive. Signals for FGFR3-TACC3 fusions by RNA-FISH were positive in 2/60 (3% of non-muscle-invasive BC (NMIBC and 2/44 (5% muscle-invasive BC (MIBC patients. The results of RT-PCR of all 104 patients were identical to those of RNA-FISH. FGFR3 mutations were detected in 27/60 (45% NMIBC and 8/44 (18% MIBC patients. Except for one NMIBC patient, FGFR3 mutation and FGFR3-TACC3 fusion were mutually exclusive.We developed an RNA-FISH assay for detection of the FGFR3-TACC3 fusion in FFPE samples of human BC tissues. Screening for not only FGFR3 mutations, but also for FGFR3-TACC3 fusion transcripts has the potential to identify additional patients that can be treated with FGFR inhibitors.

  16. Detection and molecular identification of leishmania RNA virus (LRV) in Iranian Leishmania species.

    Science.gov (United States)

    Hajjaran, Homa; Mahdi, Maryam; Mohebali, Mehdi; Samimi-Rad, Katayoun; Ataei-Pirkooh, Angila; Kazemi-Rad, Elham; Naddaf, Saied Reza; Raoofian, Reza

    2016-12-01

    Leishmania RNA virus (LRV) was first detected in members of the subgenus Leishmania (Viannia), and later, the virulence and metastasis of the New World species were attributed to this virus. The data on the presence of LRV in Old World species are confined to Leishmania major and a few Leishmania aethiopica isolates. The aim of this study was to survey the presence of LRV in various Iranian Leishmania species originating from patients and animal reservoir hosts. Genomic nucleic acids were extracted from 50 cultured isolates belonging to the species Leishmania major, Leishmania tropica, and Leishmania infantum. A partial sequence of the viral RNA-dependent RNA polymerase (RdRp) gene was amplified, sequenced and compared with appropriate sequences from the GenBank database. We detected the virus in two parasite specimens: an isolate of L. infantum derived from a visceral leishmaniasis (VL) patient who was unresponsive to meglumine antimoniate treatment, and an L. major isolate originating from a great gerbil, Rhombomys opimus. The Iranian LRV sequences showed the highest similarities to an Old World L. major LRV2 and were genetically distant from LRV1 isolates detected in New World Leishmania parasites. We could not attribute treatment failure in VL patient to the presence of LRV due to the limited number of specimens analyzed. Further studies with inclusion of more clinical samples are required to elucidate the potential role of LRVs in pathogenesis or treatment failure of Old World leishmaniasis.

  17. Systematic detection of positive selection in the human-pathogen interactome and lasting effects on infectious disease susceptibility.

    Directory of Open Access Journals (Sweden)

    Erik Corona

    Full Text Available Infectious disease has shaped the natural genetic diversity of humans throughout the world. A new approach to capture positive selection driven by pathogens would provide information regarding pathogen exposure in distinct human populations and the constantly evolving arms race between host and disease-causing agents. We created a human pathogen interaction database and used the integrated haplotype score (iHS to detect recent positive selection in genes that interact with proteins from 26 different pathogens. We used the Human Genome Diversity Panel to identify specific populations harboring pathogen-interacting genes that have undergone positive selection. We found that human genes that interact with 9 pathogen species show evidence of recent positive selection. These pathogens are Yersenia pestis, human immunodeficiency virus (HIV 1, Zaire ebolavirus, Francisella tularensis, dengue virus, human respiratory syncytial virus, measles virus, Rubella virus, and Bacillus anthracis. For HIV-1, GWAS demonstrate that some naturally selected variants in the host-pathogen protein interaction networks continue to have functional consequences for susceptibility to these pathogens. We show that selected human genes were enriched for HIV susceptibility variants (identified through GWAS, providing further support for the hypothesis that ancient humans were exposed to lentivirus pandemics. Human genes in the Italian, Miao, and Biaka Pygmy populations that interact with Y. pestis show significant signs of selection. These results reveal some of the genetic footprints created by pathogens in the human genome that may have left lasting marks on susceptibility to infectious disease.

  18. Development of a reverse transcription loop-mediated isothermal amplification method for the rapid detection of avian influenza virus subtype H7.

    Science.gov (United States)

    Bao, Hongmei; Wang, Xiurong; Zhao, Yuhui; Sun, Xiaodong; Li, Yanbing; Xiong, Yongzhong; Chen, Hualan

    2012-01-01

    A rapid and sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for the detection of the H7 avian influenza virus (H7 AIV) isotype was developed. The minimum detection limit of the RT-LAMP assay was 0.1-0.01 PFU per reaction for H7 AIV RNA, making this assay 100-fold more sensitive than the conventional RT-PCR method. This RT-LAMP assay also has the capacity to detect both high- and low-pathogenic H7 AIV strains. Using a pool of RNAs extracted from influenza viruses corresponding to all 15 HA subtypes (in addition to other avian pathogenic viruses), the RT-LAMP system was confirmed to amplify only H7 AIV RNA. Furthermore, specific pathogen free (SPF) chickens were infected artificially with H7 AIV, throat and cloacal swabs were collected, and viral shedding was examined using viral isolation, RT-PCR and RT-LAMP. Shedding was detected following viral isolation and RT-LAMP one day after infection, whereas viral detection using RT-PCR was effective only on day 3 post-infection. These results indicate that the RT-LAMP method could facilitate epidemiological surveillance and the rapid diagnosis of the avian influenza subtype H7. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. A nucleic acid strand displacement system for the multiplexed detection of tuberculosis-specific mRNA using quantum dots

    Science.gov (United States)

    Gliddon, H. D.; Howes, P. D.; Kaforou, M.; Levin, M.; Stevens, M. M.

    2016-05-01

    The development of rapid, robust and high performance point-of-care diagnostics relies on the advancement and combination of various areas of research. We have developed an assay for the detection of multiple mRNA molecules that combines DNA nanotechnology with fluorescent nanomaterials. The core switching mechanism is toehold-mediated strand displacement. We have used fluorescent quantum dots (QDs) as signal transducers in this assay, as they bring many benefits including bright fluorescence and multiplexing abilities. The resulting assay is capable of multiplexed detection of long RNA targets against a high concentration of background non-target RNA, with high sensitivity and specificity and limits of detection in the nanomolar range using only a standard laboratory plate reader. We demonstrate the utility of our QD-based system for the detection of two genes selected from a microarray-derived tuberculosis-specific gene expression signature. Levels of up- and downregulated gene transcripts comprising this signature can be combined to give a disease risk score, making the signature more amenable for use as a diagnostic marker. Our QD-based approach to detect these transcripts could pave the way for novel diagnostic assays for tuberculosis.The development of rapid, robust and high performance point-of-care diagnostics relies on the advancement and combination of various areas of research. We have developed an assay for the detection of multiple mRNA molecules that combines DNA nanotechnology with fluorescent nanomaterials. The core switching mechanism is toehold-mediated strand displacement. We have used fluorescent quantum dots (QDs) as signal transducers in this assay, as they bring many benefits including bright fluorescence and multiplexing abilities. The resulting assay is capable of multiplexed detection of long RNA targets against a high concentration of background non-target RNA, with high sensitivity and specificity and limits of detection in the nanomolar

  20. Electrocatalytic miRNA Detection Using Cobalt Porphyrin-Modified Reduced Graphene Oxide

    Directory of Open Access Journals (Sweden)

    Camille De Souza

    2014-06-01

    Full Text Available Metalated porphyrins have been described to bind nucleic acids. Additionally, cobalt porphyrins present catalytic properties towards oxygen reduction. In this work, a carboxylic acid-functionalized cobalt porphyrin was physisorbed on reduced graphene oxide, then immobilized on glassy carbon electrodes. The carboxylic groups were used to covalently graft amino-terminated oligonucleotide probes which are complementary to a short microRNA target. It was shown that the catalytic oxygen electroreduction on cobalt porphyrin increases upon hybridization of miRNA strand (“signal-on” response. Current changes are amplified compared to non-catalytic amperometric system. Apart from oxygen, no added reagent is necessary. A limit of detection in the sub-nanomolar range was reached. This approach has never been described in the literature.

  1. A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.

    Science.gov (United States)

    Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao

    2010-06-17

    Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    Science.gov (United States)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  3. MicroRNA and piRNA profiles in normal human testis detected by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Qingling Yang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are the class of small endogenous RNAs that play an important regulatory role in cells by negatively affecting gene expression at transcriptional and post-transcriptional levels. There have been extensive studies aiming to discover miRNAs and to analyze their functions in the cells from a variety of species. However, there are no published studies of miRNA profiles in human testis using next generation sequencing (NGS technology. RESULTS: We employed Solexa sequencing technology to profile miRNAs in normal human testis. Total 770 known and 5 novel human miRNAs, and 20121 piRNAs were detected, indicating that the human testis has a complex population of small RNAs. The expression of 15 known and 5 novel detected miRNAs was validated by qRT-PCR. We have also predicted the potential target genes of the abundant known and novel miRNAs, and subjected them to GO and pathway analysis, revealing the involvement of miRNAs in many important biological phenomenon including meiosis and p53-related pathways that are implicated in the regulation of spermatogenesis. CONCLUSIONS: This study reports the first genome-wide miRNA profiles in human testis using a NGS approach. The presence of large number of miRNAs and the nature of their target genes suggested that miRNAs play important roles in spermatogenesis. Here we provide a useful resource for further elucidation of the regulatory role of miRNAs and piRNAs in the spermatogenesis. It may also facilitate the development of prophylactic strategies for male infertility.

  4. Detection of bat hepatitis E virus RNA in microbats in Japan.

    Science.gov (United States)

    Kobayashi, Tomoya; Murakami, Shin; Yamamoto, Terumasa; Mineshita, Ko; Sakuyama, Muneki; Sasaki, Reiko; Maeda, Ken; Horimoto, Taisuke

    2018-05-29

    Several recent studies have reported that various bat species harbor bat hepatitis E viruses (BatHEV) belonging to the family Hepeviridae, which also contains human hepatitis E virus (HEV). The distribution and ecology of BatHEV are not well known. Here, we collected and screened 81 bat fecal samples from nine bat species in Japan to detect BatHEV RNA by RT-PCR using HEV-specific primers, and detected three positive samples. Sequence and phylogenetic analyses indicated that these three viruses were BatHEVs belonging to genus Orthohepevirus D like other BatHEV strains reported earlier in various countries. These data support the first detection of BatHEVs in Japanese microbats, indicating their wide geographical distribution among multiple bat species.

  5. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR

    Science.gov (United States)

    Stokdyk, Joel P.; Firnstahl, Aaron; Spencer, Susan K.; Burch, Tucker R; Borchardt, Mark A.

    2016-01-01

    The limit of detection (LOD) for qPCR-based analyses is not consistently defined or determined in studies on waterborne pathogens. Moreover, the LODs reported often reflect the qPCR assay alone rather than the entire sample process. Our objective was to develop an approach to determine the 95% LOD (lowest concentration at which 95% of positive samples are detected) for the entire process of waterborne pathogen detection. We began by spiking the lowest concentration that was consistently positive at the qPCR step (based on its standard curve) into each procedural step working backwards (i.e., extraction, secondary concentration, primary concentration), which established a concentration that was detectable following losses of the pathogen from processing. Using the fraction of positive replicates (n = 10) at this concentration, we selected and analyzed a second, and then third, concentration. If the fraction of positive replicates equaled 1 or 0 for two concentrations, we selected another. We calculated the LOD using probit analysis. To demonstrate our approach we determined the 95% LOD for Salmonella enterica serovar Typhimurium, adenovirus 41, and vaccine-derived poliovirus Sabin 3, which were 11, 12, and 6 genomic copies (gc) per reaction (rxn), respectively (equivalent to 1.3, 1.5, and 4.0 gc L−1 assuming the 1500 L tap-water sample volume prescribed in EPA Method 1615). This approach limited the number of analyses required and was amenable to testing multiple genetic targets simultaneously (i.e., spiking a single sample with multiple microorganisms). An LOD determined this way can facilitate study design, guide the number of required technical replicates, aid method evaluation, and inform data interpretation.

  6. Enteric bacterial pathogen detection in southern sea otters (Enhydra lutris nereis) is associated with coastal urbanization and freshwater runoff

    Science.gov (United States)

    Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.

    2009-01-01

    Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009

  7. Exposing the Three-Dimensional Biogeography and Metabolic States of Pathogens in Cystic Fibrosis Sputum via Hydrogel Embedding, Clearing, and rRNA Labeling

    Directory of Open Access Journals (Sweden)

    William H. DePas

    2016-09-01

    Full Text Available Physiological resistance to antibiotics confounds the treatment of many chronic bacterial infections, motivating researchers to identify novel therapeutic approaches. To do this effectively, an understanding of how microbes survive in vivo is needed. Though much can be inferred from bulk approaches to characterizing complex environments, essential information can be lost if spatial organization is not preserved. Here, we introduce a tissue-clearing technique, termed MiPACT, designed to retain and visualize bacteria with associated proteins and nucleic acids in situ on various spatial scales. By coupling MiPACT with hybridization chain reaction (HCR to detect rRNA in sputum samples from cystic fibrosis (CF patients, we demonstrate its ability to survey thousands of bacteria (or bacterial aggregates over millimeter scales and quantify aggregation of individual species in polymicrobial communities. By analyzing aggregation patterns of four prominent CF pathogens, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus sp., and Achromobacter xylosoxidans, we demonstrate a spectrum of aggregation states: from mostly single cells (A. xylosoxidans, to medium-sized clusters (S. aureus, to a mixture of single cells and large aggregates (P. aeruginosa and Streptococcus sp.. Furthermore, MiPACT-HCR revealed an intimate interaction between Streptococcus sp. and specific host cells. Lastly, by comparing standard rRNA fluorescence in situ hybridization signals to those from HCR, we found that different populations of S. aureus and A. xylosoxidans grow slowly overall yet exhibit growth rate heterogeneity over hundreds of microns. These results demonstrate the utility of MiPACT-HCR to directly capture the spatial organization and metabolic activity of bacteria in complex systems, such as human sputum.

  8. Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels.

    Science.gov (United States)

    Wu, Shijia; Duan, Nuo; Shi, Zhao; Fang, Congcong; Wang, Zhouping

    2014-03-18

    A highly sensitive and specific multiplex method for the simultaneous detection of three pathogenic bacteria was fabricated using multicolor upconversion nanoparticles (UCNPs) as luminescence labels coupled with aptamers as the molecular recognition elements. Multicolor UCNPs were synthesized via doping with various rare-earth ions to obtain well-separated emission peaks. The aptamer sequences were selected using the systematic evolution of ligands by exponential enrichment (SELEX) strategy for Staphylococcus aureus, Vibrio parahemolyticus, and Salmonella typhimurium. When applied in this method, aptamers can be used for the specific recognition of the bacteria from complex mixtures, including those found in real food matrixes. Aptamers and multicolor UCNPs were employed to selectively capture and simultaneously quantify the three target bacteria on the basis of the independent peaks. Under optimal conditions, the correlation between the concentration of three bacteria and the luminescence signal was found to be linear from 50-10(6) cfu mL(-1). Improved by the magnetic separation and concentration effect of Fe3O4 magnetic nanoparticles, the limits of detection of the developed method were found to be 25, 10, and 15 cfu mL(-1) for S. aureus, V. parahemolyticus, and S. typhimurium, respectively. The capability of the bioassay in real food samples was also investigated, and the results were consistent with experimental results obtained from plate-counting methods. This proposed method for the detection of various pathogenic bacteria based on multicolor UCNPs has great potential in the application of food safety and multiplex nanosensors.

  9. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood

    OpenAIRE

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos

    2016-01-01

    Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...

  10. Mechanisms of innate immune evasion in re-emerging RNA viruses.

    Science.gov (United States)

    Ma, Daphne Y; Suthar, Mehul S

    2015-06-01

    Recent outbreaks of Ebola, West Nile, Chikungunya, Middle Eastern Respiratory and other emerging/re-emerging RNA viruses continue to highlight the need to further understand the virus-host interactions that govern disease severity and infection outcome. As part of the early host antiviral defense, the innate immune system mediates pathogen recognition and initiation of potent antiviral programs that serve to limit virus replication, limit virus spread and activate adaptive immune responses. Concordantly, viral pathogens have evolved several strategies to counteract pathogen recognition and cell-intrinsic antiviral responses. In this review, we highlight the major mechanisms of innate immune evasion by emerging and re-emerging RNA viruses, focusing on pathogens that pose significant risk to public health. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. High Throughput, Multiplexed Pathogen Detection Authenticates Plague Waves in Medieval Venice, Italy

    Science.gov (United States)

    Tran, Thi-Nguyen-Ny; Signoli, Michel; Fozzati, Luigi; Aboudharam, Gérard; Raoult, Didier; Drancourt, Michel

    2011-01-01

    Background Historical records suggest that multiple burial sites from the 14th–16th centuries in Venice, Italy, were used during the Black Death and subsequent plague epidemics. Methodology/Principal Findings High throughput, multiplexed real-time PCR detected DNA of seven highly transmissible pathogens in 173 dental pulp specimens collected from 46 graves. Bartonella quintana DNA was identified in five (2.9%) samples, including three from the 16th century and two from the 15th century, and Yersinia pestis DNA was detected in three (1.7%) samples, including two from the 14th century and one from the 16th century. Partial glpD gene sequencing indicated that the detected Y. pestis was the Orientalis biotype. Conclusions These data document for the first time successive plague epidemics in the medieval European city where quarantine was first instituted in the 14th century. PMID:21423736

  12. Isothermal amplification detection of miRNA based on the catalysis of nucleases and voltammetric characteristics of silver nanoparticles.

    Science.gov (United States)

    Xu, Jianhua; Han, Kun; Liu, Dongdong; Lin, Li; Miao, Peng

    2016-11-15

    MiRNAs are a fascinating kind of biomolecule due to their vital functions in gene regulation and potential value as biomarkers for serious diseases including cancers. Exploiting convenient and sensitive methods for miRNA expression assays is imperative. In this study, we employ an exonuclease (RecJ f ) and a nicking endonuclease (Nt.BbvCI) to catalyse isothermal reactions for the amplified detection of miRNA. The degree of cyclical enzymatic amplification depends on the initial target miRNA level, which can determine the density of DNA probes bound on the electrode surface. Since DNA probes with an amino group at the 3' end are able to locate silver nanoparticles on the electrode, which provide intense stripping responses, the sensitive quantification of miRNA can be achieved. The proposed method has a limit of detection as low as 35 aM, with remarkable specificity, which offers a new approach for investigating miRNA networks and for clinical diagnosis applications.

  13. Design and Elementary Evaluation of a Highly-Automated Fluorescence-Based Instrument System for On-Site Detection of Food-Borne Pathogens

    Directory of Open Access Journals (Sweden)

    Zhan Lu

    2017-02-01

    Full Text Available A simple, highly-automated instrument system used for on-site detection of foodborne pathogens based on fluorescence was designed, fabricated, and preliminarily tested in this paper. A corresponding method has been proved effective in our previous studies. This system utilizes a light-emitting diode (LED to excite fluorescent labels and a spectrometer to record the fluorescence signal from samples. A rotation stage for positioning and switching samples was innovatively designed for high-throughput detection, ten at most in one single run. We also developed software based on LabVIEW for data receiving, processing, and the control of the whole system. In the test of using a pure quantum dot (QD solution as a standard sample, detection results from this home-made system were highly-relevant with that from a well-commercialized product and even slightly better reproducibility was found. And in the test of three typical kinds of food-borne pathogens, fluorescence signals recorded by this system are highly proportional to the variation of the sample concentration, with a satisfied limit of detection (LOD (nearly 102–103 CFU·mL−1 in food samples. Additionally, this instrument system is low-cost and easy-to-use, showing a promising potential for on-site rapid detection of food-borne pathogens.

  14. Detection of Zika virus using reverse-transcription LAMP coupled with reverse dot blot analysis in saliva.

    Directory of Open Access Journals (Sweden)

    Maite Sabalza

    Full Text Available In recent years, there have been increasing numbers of infectious disease outbreaks that spread rapidly to population centers resulting from global travel, population vulnerabilities, environmental factors, and ecological disasters such as floods and earthquakes. Some examples of the recent outbreaks are the Ebola epidemic in West Africa, Middle East respiratory syndrome coronavirus (MERS-Co in the Middle East, and the Zika outbreak through the Americas. We have created a generic protocol for detection of pathogen RNA and/or DNA using loop-mediated isothermal amplification (LAMP and reverse dot-blot for detection (RDB and processed automatically in a microfluidic device. In particular, we describe how a microfluidic assay to detect HIV viral RNA was converted to detect Zika virus (ZIKV RNA. We first optimized the RT-LAMP assay to detect ZIKV RNA using a benchtop isothermal amplification device. Then we implemented the assay in a microfluidic device that will allow analyzing 24 samples simultaneously and automatically from sample introduction to detection by RDB technique. Preliminary data using saliva samples spiked with ZIKV showed that our diagnostic system detects ZIKV RNA in saliva. These results will be validated in further experiments with well-characterized ZIKV human specimens of saliva. The described strategy and methodology to convert the HIV diagnostic assay and platform to a ZIKV RNA detection assay provides a model that can be readily utilized for detection of the next emerging or re-emerging infectious disease.

  15. Detection of Antibodies to Seven Priority Pathogens in Backyard Poultry in Trinidad, West Indies

    Directory of Open Access Journals (Sweden)

    Arianne Brown Jordan

    2018-01-01

    Full Text Available Backyard poultry farms in Trinidad and Tobago (T&T play a vital role in providing food and income for rural communities. There is currently no information on the presence and circulation of pathogens in backyard poultry farms in T&T, and little is known in relation to the potential risks of spread of these pathogens to the commercial poultry sector. In order to address this, serum samples were collected from 41 chickens on five backyard farms taken from selected locations in Trinidad. Samples were tested for antibodies to seven priority pathogens of poultry by enzyme-linked immunosorbent assay (ELISA. Antibodies were detected in 65% (CI 95%: 50–78% of the sampled birds for Infectious bronchitis virus (IBV, 67.5% (CI 95%: 52–80% for Infectious bursal disease virus (IBDV, 10% (CI 95%: 4–23% for Newcastle disease virus (NDV, 0% (CI 95%: 0–0% for Avian influenza virus (AIV, 0% (CI 95%: 0–0% for West Nile virus (WNV, 31.7% (CI 95%: 20–47% for Mycoplasm gallisepticum/synoviae and 0% (CI 95%: 0–0% for Salmonella enterica serotype Enteritidis. These results reveal the presence and circulation of important pathogens of poultry in selected backyard farms in Trinidad. The results provide important information which should be taken into consideration when assessing the risks of pathogen transmission between commercial and backyard poultry farms, as well as between poultry and wild birds.

  16. Approaches for Reverse Line Blot-Based Detection of Microbial Pathogens in Ixodes ricinus Ticks Collected in Austria and Impact of the Chosen Method.

    Science.gov (United States)

    Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold

    2017-07-01

    Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The

  17. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium.

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1-4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  18. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Science.gov (United States)

    Villamizar-Rodríguez, Germán; Fernández, Javier; Marín, Laura; Muñiz, Juan; González, Isabel; Lombó, Felipe

    2015-01-01

    Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to ensure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for the simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (38 species, 27 genera), Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, 13 strains). Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for each pathogen type. The detection limits have been 1 Genome Equivalent (GE), with the exception of the Fam. Enterobacteriaceae (5 GEs). We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type), showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h), followed by a mPCR (2 h) and a capillary electrophoresis (30 min); avoiding the tedious and long lasting growing on solid media required in traditional analysis (1–4 days, depending on the specific pathogen and verification procedure). An external testing of this method was conducted in order to compare classical and mPCR methods. This evaluation was

  19. Cascaded strand displacement for non-enzymatic target recycling amplification and label-free electronic detection of microRNA from tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Kai; Dou, Baoting; Yang, Jianmei; Yuan, Ruo; Xiang, Yun, E-mail: yunatswu@swu.edu.cn

    2016-04-15

    The monitoring of microRNA (miRNA) expression levels is of great importance in cancer diagnosis. In the present work, based on two cascaded toehold-mediated strand displacement reactions (TSDRs), we have developed a label- and enzyme-free target recycling signal amplification approach for sensitive electronic detection of miRNA-21 from human breast cancer cells. The junction probes containing the locked G-quadruplex forming sequences are self-assembled on the senor surface. The presence of the target miRNA-21 initiates the first TSDR and results in the disassembly of the junction probes and the release of the active G-quadruplex forming sequences. Subsequently, the DNA fuel strand triggers the second TSDR and leads to cyclic reuse of the target miRNA-21. The cascaded TSDRs thus generate many active G-quadruplex forming sequences on the sensor surface, which associate with hemin to produce significantly amplified current response for sensitive detection of miRNA-21 at 1.15 fM. The sensor is also selective and can be employed to monitor miRNA-21 from human breast cancer cells. - Highlights: • Amplified and sensitive detection of microRNA from tumor cells is achieved. • Signal amplification is realized by two cascaded strand displacement reactions. • The developed sensor is selective and label-free without involving any enzymes.

  20. Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11

    DEFF Research Database (Denmark)

    Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe

    2016-01-01

    Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...

  1. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  2. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  3. DETECTION AND IDENTIFICATION OF PATHOGENIC CANDIDA SPECIES IN WATER USING FLOW CYTOMETRY COUPLED WITH TAQMAN PCR

    Science.gov (United States)

    As the incidence of human fungal infection increases, the ability to detect and identify pathogenic fungi in potential environmental reservoirs becomes increasingly important for disease control. PCR based assays are widely used for diagnostic purposes, but may be inadequate for...

  4. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    International Nuclear Information System (INIS)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-01

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

  5. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  6. Detection and comparison of microRNA expression in the serum of Doberman Pinschers with dilated cardiomyopathy and healthy controls.

    Science.gov (United States)

    Steudemann, Carola; Bauersachs, Stefan; Weber, Karin; Wess, Gerhard

    2013-01-17

    Dilated cardiomyopathy (DCM) is the most common heart disease in Doberman Pinschers. MicroRNAs (miRNAs) are short non-coding RNAs playing important roles in gene regulation. Different miRNA expression patterns have been described for DCM in humans and might represent potential diagnostic markers. There are no studies investigating miRNA expression profiles in canine DCM. The aims of this study were to screen the miRNA expression profile of canine serum using miRNA microarray and to compare expression patterns of a group of Doberman Pinschers with DCM and healthy controls. Eight Doberman Pinschers were examined by echocardiography and 24-hour-ECG and classified as healthy (n=4) or suffering from DCM (n=4). Total RNA was extracted from serum and hybridized on a custom-designed 8x60k miRNA microarray (Agilent) containing probes for 1368 individual miRNAs. Although total RNA concentrations were very low in serum samples, 404 different miRNAs were detectable with sufficient signal intensity on miRNA microarray. 22 miRNAs were differentially expressed in the two groups (p1.5), but did not reach statistical significance after multiple testing correction (false discovery rate adjusted p>0.05). Five miRNAs were selected for further analysis using quantitative Real-Time RT-PCR (qPCR) assays. No significant differences were found using specific miRNA qPCR assays (p>0.05). Numerous miRNAs can be detected in canine serum. Between healthy and DCM dogs, miRNA expression changes could be detected, but the results did not reach statistical significance most probably due to the small group size. miRNAs are potential new circulating biomarkers in veterinary medicine and should be investigated in larger patient groups and additional canine diseases.

  7. Viral evasion of intracellular DNA and RNA sensing

    Science.gov (United States)

    Chan, Ying Kai; Gack, Michaela U.

    2016-01-01

    The co-evolution of viruses with their hosts has led to the emergence of viral pathogens that are adept at evading or actively suppressing host immunity. Pattern recognition receptors (PRRs) are key components of antiviral immunity that detect conserved molecular features of viral pathogens and initiate signalling that results in the expression of antiviral genes. In this Review, we discuss the strategies that viruses use to escape immune surveillance by key intracellular sensors of viral RNA or DNA, with a focus on RIG-I-like receptors (RLRs), cyclic GMP–AMP synthase (cGAS) and interferon-γ (IFNγ)-inducible protein 16 (IFI16). Such viral strategies include the sequestration or modification of viral nucleic acids, interference with specific post-translational modifications of PRRs or their adaptor proteins, the degradation or cleavage of PRRs or their adaptors, and the sequestration or relocalization of PRRs. An understanding of viral immune-evasion mechanisms at the molecular level may guide the development of vaccines and antivirals. PMID:27174148

  8. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno; De Palma, Armando M.; Neyts, Johan; Egloff, Marie-Pierre; Grisel, Sacha; Dalle, Karen; Campanacci, Valerie; Spinelli, Silvia; Cambillau, Christian; Canard, Bruno; Gruez, Arnaud, E-mail: arnaud.gruez@maem.uhp-nancy.fr [Centre National de la Recherche Scientifique and Universités d’Aix-Marseille I et II, UMR 6098, Architecture et Fonction des Macromolécules Biologiques, Ecole Supérieure d’Ingénieurs de Luminy-Case 925, 163 Avenue de Luminy, 13288 Marseille CEDEX 9 (France)

    2007-06-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited to X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination.

  9. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    International Nuclear Information System (INIS)

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno; De Palma, Armando M.; Neyts, Johan; Egloff, Marie-Pierre; Grisel, Sacha; Dalle, Karen; Campanacci, Valerie; Spinelli, Silvia; Cambillau, Christian; Canard, Bruno; Gruez, Arnaud

    2007-01-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited to X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination

  10. Detection of bacteriocins produced by plant pathogenic bacteria from the general Erwinia, Pseudomonas and Xanthomonas

    International Nuclear Information System (INIS)

    Biagi, C.M.R. de

    1992-01-01

    Detection of bacteriocin production was studied under distinct conditions using strains of plant pathogenic bacteria from the genera Erwinia, Pseudomonas and Xanthomonas. 58.06%, 79.31% and 40.00% of producing strains were found respectively in the three groups of bacteria using the 523 medium which was the best for the detection of bacteriocin production. Increasing agar concentrations added to the medium up to 1,5% improved the detection. The amount of medium added to the Petri dishes did not affect bacteriocin production. The longest incubation time (72 h.) improved the detection of haloes production. Ultra-violet irradiation in low dosages seems to improve the visualization of haloes production but this is dependent on the tested strains. (author)

  11. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  12. Nonradioactive RNA mobility shift with chemiluminescent detection ...

    African Journals Online (AJOL)

    hesham

    RNA mobility shift is one among many procedures used to study RNA-protein interaction. Yet, there are some limitations for the radioactive RNA mobility shift including; 1) the risk of using radiolabeled nucleotides, 2) the long time to get the results; this could range from days to weeks, and 3) its high cost as compared to ...

  13. Optimization of chemiluminescent detection of mitochondrial RNA ...

    African Journals Online (AJOL)

    RNA mobility shift is one among many procedures used to study RNA-protein interaction. Yet, there are some limitations for the radioactive RNA mobility shift including; 1) the risk of using radiolabeled nucleotides, 2) the long time to get the results; this could range from days to weeks, and 3) its high cost as compared to ...

  14. Highly selective and sensitive detection of miRNA based on toehold-mediated strand displacement reaction and DNA tetrahedron substrate.

    Science.gov (United States)

    Li, Wei; Jiang, Wei; Ding, Yongshun; Wang, Lei

    2015-09-15

    MicroRNAs (miRNAs) play important roles in a variety of biological processes and have been regarded as tumor biomarkers in cancer diagnosis and prognosis. In this work, a single-molecule counting method for miRNA analysis was proposed based on toehold-mediated strand displacement reaction (SDR) and DNA tetrahedron substrate. Firstly, a specially designed DNA tetrahedron was assembled with a hairpin at one of the vertex, which has an overhanging toehold domain. Then, the DNA tetrahedron was immobilized on the epoxy-functional glass slide by epoxy-amine reaction, forming a DNA tetrahedron substrate. Next, the target miRNA perhybridized with the toehold domain and initiated a strand displacement reaction along with the unfolding of the hairpin, realizing the selective recognization of miRNA. Finally, a biotin labeled detection DNA was hybridized with the new emerging single strand and the streptavidin coated QDs were used as fluorescent probes. Fluorescent images were acquired via epi-fluorescence microscopy, the numbers of fluorescence dots were counted one by one for quantification. The detection limit is 5 fM, which displayed an excellent sensitivity. Moreover, the proposed method which can accurately be identified the target miRNA among its family members, demonstrated an admirable selectivity. Furthermore, miRNA analysis in total RNA samples from human lung tissues was performed, suggesting the feasibility of this method for quantitative detection of miRNA in biomedical research and early clinical diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    Science.gov (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  16. Detection of pathogenic micro-organisms on children's hands and toys during play.

    Science.gov (United States)

    Martínez-Bastidas, T; Castro-del Campo, N; Mena, K D; Castro-del Campo, N; León-Félix, J; Gerba, C P; Chaidez, C

    2014-06-01

    This study aimed to determine if the children's leisure activities impact the presence of pathogens on their hands and toys. To assess the microbiological hazard in playground areas, a pilot study that included 12 children was conducted. We then conducted an intervention study; children's hands and toys were washed before playing. Faecal coliforms, pathogenic bacteria and Giardia lamblia were quantified by membrane filtration, selective media and flotation techniques, respectively; rotavirus, hepatitis A and rhinovirus by RT-PCR. Pilot study results revealed faecal contamination on children's hands and toys after playing on sidewalks and in public parks. Pathogenic bacteria, hepatitis A and G. lamblia on children's hands were also found. In the intervention study, Staphylococcus aureus and Klebsiella pneumoniae were found on children's hands at concentrations up to 2·5 × 10(4) and 1 × 10(4) CFU hands(-1), respectively. E. coli and Kl. pneumoniae were detected on toys (2·4 × 10(3) and 2·7 × 10(4) CFU toy(-1), respectively). Salmonella spp, Serratia spp and G. lamblia cysts were also present on toys. Children's play activities influence microbial presence on hands and toys; the transfer seems to occur in both ways. Control strategy needs to be implemented to protect children from infectious diseases. © 2014 The Society for Applied Microbiology.

  17. Detection of Pathogenic Viruses in Sewage Provided Early Warnings of Hepatitis A Virus and Norovirus Outbreaks

    Science.gov (United States)

    Hellmér, Maria; Paxéus, Nicklas; Magnius, Lars; Enache, Lucica; Arnholm, Birgitta; Johansson, Annette; Bergström, Tomas

    2014-01-01

    Most persons infected with enterically transmitted viruses shed large amounts of virus in feces for days or weeks, both before and after onset of symptoms. Therefore, viruses causing gastroenteritis may be detected in wastewater, even if only a few persons are infected. In this study, the presence of eight pathogenic viruses (norovirus, astrovirus, rotavirus, adenovirus, Aichi virus, parechovirus, hepatitis A virus [HAV], and hepatitis E virus) was investigated in sewage to explore whether their identification could be used as an early warning of outbreaks. Samples of the untreated sewage were collected in proportion to flow at Ryaverket, Gothenburg, Sweden. Daily samples collected during every second week between January and May 2013 were pooled and analyzed for detection of viruses by concentration through adsorption to milk proteins and PCR. The largest amount of noroviruses was detected in sewage 2 to 3 weeks before most patients were diagnosed with this infection in Gothenburg. The other viruses were detected at lower levels. HAV was detected between weeks 5 and 13, and partial sequencing of the structural VP1protein identified three different strains. Two strains were involved in an ongoing outbreak in Scandinavia and were also identified in samples from patients with acute hepatitis A in Gothenburg during spring of 2013. The third strain was unique and was not detected in any patient sample. The method used may thus be a tool to detect incipient outbreaks of these viruses and provide early warning before the causative pathogens have been recognized in health care. PMID:25172863

  18. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  19. Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae) Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts.

    Science.gov (United States)

    Overholt, Will A; Diaz, Rodrigo; Rosskopf, Erin; Green, Stefan J; Overholt, William A

    2015-01-01

    Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae) are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia), in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU) ribosomal RNA (rRNA) gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97%) detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10)). As far as we are aware, our study is the first to characterize the microbiome of a candidate

  20. Deep Characterization of the Microbiomes of Calophya spp. (Hemiptera: Calophyidae Gall-Inducing Psyllids Reveals the Absence of Plant Pathogenic Bacteria and Three Dominant Endosymbionts.

    Directory of Open Access Journals (Sweden)

    Will A Overholt

    Full Text Available Bacteria associated with sap-feeding insect herbivores include not only symbionts that may increase their hosts' fitness but also harmful plant pathogens. Calophya spp. gall-inducing psyllids (Hemiptera: Calophyidae are being investigated for their potential as biological control agents of the noxious weed, Brazilian peppertree (Schinus terebinthifolia, in Florida. Although there are no examples of plant pathogen transmission by members of the family Calophyidae, several insects in the superfamily Psylloidea are known to transmit pathogenic bacteria in the genera Candidatus Liberibacter and Candidatus Phytoplasma. To determine whether Calophya spp. harbor potentially harmful plant pathogenic bacteria, we sequenced small subunit (SSU ribosomal RNA (rRNA gene amplicons generated from individuals from four Calophya spp. populations: All microbial SSU gene sequences fell into the bacterial domain, with 98-99% belonging to the Proteobacteria. The Calophya microbiomes contained a relatively simple community, with 49-79 operational taxonomic units (OTUs; 97% detected, and only 5-8 OTUs with greater than 1% abundance. Candidatus Carsonella showed the highest relative abundance, with OTUs from this candidate genus representing between 51-65% of all recovered sequences. The next most abundant clade observed was an unclassified Enterobacteriacae group closely related to bacteria from the genera Buchnera and Blochmannia that ranged from 20-31% in relative abundance. Wolbachia populations were the third most abundant group and represented 7-27% of the diversity in microbial OTUs. No SSU rRNA gene sequences from putative pathogenic bacteria from the genera Ca. Liberibacter or Ca. Phytoplasma were detected in the microbiomes of the four Calophya populations. The probability that infected psyllids were present in our colonies, but were not sampled, was extremley low (1.39 x 10(-10. As far as we are aware, our study is the first to characterize the microbiome of

  1. Detection and quantification of serum or plasma HCV RNA: mini review of commercially available assays.

    Science.gov (United States)

    Le Guillou-Guillemette, Helene; Lunel-Fabiani, Francoise

    2009-01-01

    The treatment schedule (combination of compounds, doses, and duration) and the virological follow-up for management of antiviral treatment in patients chronically infected by HCV is now well standardized, but to ensure good monitoring of the treated patients, physicians need rapid, reproducible, and sensitive molecular virological tools with a wide range of detection and quantification of HCV RNA in blood samples. Several assays for detection and/or quantification of HCV RNA are currently commercially available. Here, all these assays are detailed, and a brief description of each step of the assay is provided. They are divided into two categories by method: those based on signal amplification and those based on target amplification. These two categories are then divided into qualitative, quantitative, and quantitative detection assays. The real-time reverse-transcription polymerase chain reaction (RT-PCR)-based assays are the most promising strategy in the HCV virological area.

  2. Salivary detection of periodontopathic bacteria and periodontal health status in dental students.

    Science.gov (United States)

    Leblebicioglu, Binnaz; Kulekci, Guven; Ciftci, Sevgi; Keskin, Fahriye; Badur, Selim

    2009-06-01

    Saliva may become a potential source of contamination through vertical and horizontal transmissions as well as cross-infections. This study aims to use saliva as a screening tool to detect putative periodontal pathogens in a young population with fairly good oral hygiene. Stimulated saliva samples were obtained from 134 dental students (20.5+/-1 years, range 18-22 years). Among those, 77 subjects also completed a periodontal examination including attachment loss, modified dental, gingival and plaque indices (AL, mDI, GI and PI). The test bacteria were identified using a 16S rRNA-based PCR detection method. One or more of the test bacteria was found in 67% of the subjects. Prevotella nigrescens was detected as single bacterium in 16% of the subjects followed by Treponema denticola (4%), Porphyromonas gingivalis (2%), Aggregatibacter (formerly Actinobacillus) actinomycetemcomitans (1%) and Tannerella forsythia (1%). Two or more pathogens were detected in 42% of the subjects. Clinical examination revealed health with no attachment loss (AL) in 84% of the students. In no AL group, 38% of the students were pathogen free while this was 25% for students in localized AL group (p>0.05). There was a statistically significant association between the detection of salivary periodontal pathogen in general and higher PI (p=0.018) and GI (p=0.043). Within the limits of this study, it is possible to detect all six periodontal pathogens in the saliva of dental students. Although a correlation can be observed between the presence of salivary periodontal pathogen and clinical signs of inflammation such as plaque accumulation and gingival bleeding, detection of specific bacteria in saliva is not related to the presence of localized AL based on the presented study population.

  3. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  4. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    Science.gov (United States)

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  5. Molecular-based detection of the gastrointestinal pathogen Campylobacter ureolyticus in unpasteurized milk samples from two cattle farms in Ireland

    Directory of Open Access Journals (Sweden)

    Koziel Monika

    2012-11-01

    Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.

  6. Molecular Biosensors for Electrochemical Detection of Infectious Pathogens in Liquid Biopsies: Current Trends and Challenges.

    Science.gov (United States)

    Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel

    2017-11-03

    Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.

  7. RNA Interference in Insect Vectors for Plant Viruses

    OpenAIRE

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests...

  8. Direct immobilization of antibodies on Zn-doped Fe_3O_4 nanoclusters for detection of pathogenic bacteria

    International Nuclear Information System (INIS)

    Pal, Monalisa; Lee, Sanghee; Kwon, Donghoon; Hwang, Jeongin; Lee, Hyeonjeong; Hwang, Seokyung; Jeon, Sangmin

    2017-01-01

    Zinc-doped magnetic nanoclusters (Zn-MNCs) were synthesized and used to detect pathogenic bacteria in milk. Hydrothermally synthesized Zn-MNCs exhibited stronger magnetic properties than pure MNCs, which facilitated the magnetic separation from the sample using a permanent magnet. The presence of accessible Zn sites allows the direct immobilization of half-fragmented antibodies over Zn-MNCs through strong Zn−S bonds and prevents the tedious multiple steps of molecular functionalization or coating with costly noble metals prior to conjugation with an antibody. After the capture and magnetic separation of Salmonella in milk using the antibody-functionalized Zn-MNCs, the concentration of bacteria was determined with a portable ATP luminometer and the detection limit was found to be 10 CFU/mL. - Highlights: • Zn-doped Fe_3O_4 nanoclusters (Zn-MNCs) were synthesized by hydrothermal method. • Antibodies were directly immobilized over Zn-MNCs through strong Zn–S_t_h_i_o_l bonds. • Higher magnetization of Zn-MNCs than pure MNCs facilitates the magnetic separation. • Detection limit of pathogenic bacteria in milk was found to be 10 cfu/mL. • Cost effective, sensitive and selective detection of bacteria.

  9. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Science.gov (United States)

    Li, Yongjin

    2016-01-01

    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

  10. Studying RNA-protein interactions in vivo by RNA immunoprecipitation

    DEFF Research Database (Denmark)

    Selth, Luke A; Close, Pierre; Svejstrup, Jesper Q

    2011-01-01

    and have significant effects on gene expression. RNA immunoprecipitation (RIP) is a powerful technique used to detect direct and indirect interactions between individual proteins and specific RNA molecules in vivo. Here, we describe RIP methods for both yeast and mammalian cells.......The crucial roles played by RNA-binding proteins in all aspects of RNA metabolism, particularly in the regulation of transcription, have become increasingly evident. Moreover, other factors that do not directly interact with RNA molecules can nevertheless function proximally to RNA polymerases...

  11. Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia.

    Directory of Open Access Journals (Sweden)

    Zerihun Hailemariam

    Full Text Available Tick-borne diseases (TBDs cause significant losses among livestock and impact the livelihoods of resource-poor farming communities worldwide. In Ethiopia, detailed studies on the epidemiology of tick-borne pathogens (TBPs in cattle using sensitive molecular detection methods are scarce. The objective of this study was to determine the prevalence and species composition of bovine TBPs of veterinary significance in local cattle populations. A comprehensive cross-sectional epidemiological study was conducted in cattle populations of Illubabor zone in Southwestern Ethiopia from June to August 2013. For this purpose, blood samples were collected from 392 cattle. A combination of polymerase chain reaction (PCR and a Reverse Line Blot (RLB hybridization assay was employed for the detection of TBPs in these samples. The PCR/RLB results of the 392 blood samples indicated a high overall prevalence of 96.9% for TBPs, including Theileria mutans (66.1%, Theileria orientalis (51.8%, Anaplasma sp. Omatjenne (25.5%, Anaplasma marginale (14.5%, Babesia bigemina (14.0% and Theileria velifera (13.0% and minor occurrences of Ehrlichia ruminantium (0.5% and Ehrlichia minasensis (0.26%. Moreover, three novel Anaplasma genotypes were detected in bovine blood samples. A phylogenetic analysis revealed that they most likely represent three, but at least two, new species. The prevalence of the three novel Anaplasma species, preliminary designated as Anaplasma sp. Hadesa, Anaplasma sp. Saso and Anaplasma sp. Dedessa, was 12.5%, 14.3% and 5.6%, respectively. Overall, a total of 227 cattle (57.9% were found to be co-infected with two or more TBPs simultaneously and 86 different species combinations were observed. The findings show a very high burden of infection of cattle with TBPs in Ethiopia. The high frequency of co-infections suggests that clinical manifestations might be complex. Further research is required to determine the pathogenicity, host cell types and vector of

  12. Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1-Seropositive Kenyan Men.

    Science.gov (United States)

    Korhonen, Christine J; Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L; Sanders, Eduard J; Peshu, Norbert M; Krieger, John N; Muller, Charles H; Coombs, Robert W; Fredricks, David N; Graham, Susan M

    2017-03-01

    HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. We analyzed semen samples from 42 HIV-1-seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: -0.77, 95% CI: -1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Most of these HIV-1-infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission.

  13. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. DeAnnIso: a tool for online detection and annotation of isomiRs from small RNA sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Zang, Qiguang; Zhang, Huan; Ban, Rongjun; Yang, Yifan; Iqbal, Furhan; Li, Ao; Shi, Qinghua

    2016-07-08

    Small RNA (sRNA) Sequencing technology has revealed that microRNAs (miRNAs) are capable of exhibiting frequent variations from their canonical sequences, generating multiple variants: the isoforms of miRNAs (isomiRs). However, integrated tool to precisely detect and systematically annotate isomiRs from sRNA sequencing data is still in great demand. Here, we present an online tool, DeAnnIso (Detection and Annotation of IsomiRs from sRNA sequencing data). DeAnnIso can detect all the isomiRs in an uploaded sample, and can extract the differentially expressing isomiRs from paired or multiple samples. Once the isomiRs detection is accomplished, detailed annotation information, including isomiRs expression, isomiRs classification, SNPs in miRNAs and tissue specific isomiR expression are provided to users. Furthermore, DeAnnIso provides a comprehensive module of target analysis and enrichment analysis for the selected isomiRs. Taken together, DeAnnIso is convenient for users to screen for isomiRs of their interest and useful for further functional studies. The server is implemented in PHP + Perl + R and available to all users for free at: http://mcg.ustc.edu.cn/bsc/deanniso/ and http://mcg2.ustc.edu.cn/bsc/deanniso/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Quantitative Molecular Detection of Putative Periodontal Pathogens in Clinically Healthy and Periodontally Diseased Subjects

    Science.gov (United States)

    Göhler, André; Hetzer, Adrian; Holtfreter, Birte; Geisel, Marie Henrike; Schmidt, Carsten Oliver; Steinmetz, Ivo; Kocher, Thomas

    2014-01-01

    Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined. PMID:25029268

  16. MicroRNA from tuberculosis RNA: A bioinformatics study

    OpenAIRE

    Wiwanitkit, Somsri; Wiwanitkit, Viroj

    2012-01-01

    The role of microRNA in the pathogenesis of pulmonary tuberculosis is the interesting topic in chest medicine at present. Recently, it was proposed that the microRNA can be a useful biomarker for monitoring of pulmonary tuberculosis and might be the important part in pathogenesis of disease. Here, the authors perform a bioinformatics study to assess the microRNA within known tuberculosis RNA. The microRNA part can be detected and this can be important key information in further study of the p...

  17. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

  18. Detection of foot-and-mouth disease virus rna by reverse transcription loop-mediated isothermal amplification

    Directory of Open Access Journals (Sweden)

    Chen Hao-tai

    2011-11-01

    Full Text Available Abstract A reverse transcription loop-mediated isothermal amplification (RT-LAMP assay was developed for foot-and-mouth disease virus (FMDV RNA. The amplification was able to finish in 45 min under isothermal condition at 64°C by employing a set of four primers targeting FMDV 2B. The assay showed higher sensitivity than RT-PCR. No cross reactivity was observed from other RNA viruses including classical swine fever virus, swine vesicular disease, porcine reproductive and respiratory syndrome virus, Japanese encephalitis virus. Furthermore, the assay correctly detected 84 FMDV positive samples but not 65 FMDV negative specimens. The result indicated the potential usefulness of the technique as a simple and rapid procedure for the detection of FMDV infection.

  19. Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle

    OpenAIRE

    Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

    2014-01-01

    Background The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is reg...

  20. Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen

    Directory of Open Access Journals (Sweden)

    Deng D

    2015-04-01

    Full Text Available Dawei Deng,* Yang Li,* Jianpeng Xue, Jie Wang, Guanhua Ai, Xin Li, Yueqing GuDepartment of Biomedical Engineering, China Pharmaceutical University, Nanjing, People’s Republic of China*These authors contributed equally to this workAbstract: Messenger RNA (mRNA, a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP beacon containing a bare gold nanoparticle (AuNP as fluorescence quencher and thiol-terminated fluorescently labeled stem–loop–stem oligonucleotide sequences attached by Au–S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.Keywords: molecular beacon, bioinformatics, gold nanoparticle, STAT5b mRNA, visual detection

  1. Nanomaterial-based sensors for detection of foodborne bacterial pathogens and toxins as well as pork adulteration in meat products

    Directory of Open Access Journals (Sweden)

    B. Stephen Inbaraj

    2016-01-01

    Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.

  2. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  3. Comparative study of CXC chemokines modulation in brown trout (Salmo trutta) following infection with a bacterial or viral pathogen.

    Science.gov (United States)

    Gorgoglione, Bartolomeo; Zahran, Eman; Taylor, Nick G H; Feist, Stephen W; Zou, Jun; Secombes, Christopher J

    2016-03-01

    Chemokine modulation in response to pathogens still needs to be fully characterised in fish, in view of the recently described novel chemokines present. This paper reports the first comparative study of CXC chemokine genes transcription in salmonids (brown trout), with a particular focus on the fish specific CXC chemokines (CXCL_F). Adopting new primer sets, optimised to specifically target mRNA, a RT-qPCR gene screening was carried out. Constitutive gene expression was assessed first in six tissues from SPF brown trout. Transcription modulation was next investigated in kidney and spleen during septicaemic infection induced by a RNA virus (Viral Haemorrhagic Septicaemia virus, genotype Ia) or by a Gram negative bacterium (Yersinia ruckeri, ser. O1/biot. 2). From each target organ specific pathogen burden, measured detecting VHSV-glycoprotein or Y. ruckeri 16S rRNA, and IFN-γ gene expression were analysed for their correlation to chemokine transcription. Both pathogens modulated CXC chemokine gene transcript levels, with marked up-regulation seen in some cases, and with both temporal and tissue specific effects apparent. For example, Y. ruckeri strongly induced chemokine transcription in spleen within 24h, whilst VHS generally induced the largest increases at 3d.p.i. in both tissues. This study gives clues to the role of the novel CXC chemokines, in comparison to the other known CXC chemokines in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Label-free and ultrasensitive electrochemiluminescence detection of microRNA based on long-range self-assembled DNA nanostructures

    International Nuclear Information System (INIS)

    Liu, Ting; Chen, Xian; Hong, Cheng-Yi; Xu, Xiao-Ping; Yang, Huang-Hao

    2014-01-01

    Electrochemiluminescence (ECL) integrates the advantages of electrochemical detection and chemiluminescent techniques. The method has received particular attention because it is highly sensitive and selective, has a wide linear range but low reagent costs. The use of nanomaterials with their unique physical and chemical properties has led to new kinds of biosensors that exhibit high sensitivity and stability. Compared to other nanomaterials, DNA nanostructures are more biocompatible, more hydrophilic, and thus less prone to nonspecific adsorption onto the electrode surface. We describe here a label-free and ultrasensitive ECL biosensor for detecting a cancer-associated microRNA at a femtomolar level. We have designed two auxiliary probes that cause the formation of a long-range self-assembly in the form of a μm-long 1-dimensional DNA concatamer. These can be used as carriers for signal amplification. The intercalation of the ECL probe Ru(phen) 3 2+ into the grooves of the concatamers leads to a substantial increase in ECL intensity. This amplified sensor shows high selectivity for discriminating complementary target and other mismatched RNAs. The biosensor enables the quantification of the expression of microRNA-21 in MCF-7 cells. It also displays very low limits of detection and provides an alternative approach for the detection of RNA or DNA detection in diagnostics and gene analysis. (author)

  5. Improving vector-borne pathogen surveillance: A laboratory-based study exploring the potential to detect dengue virus and malaria parasites in mosquito saliva.

    Science.gov (United States)

    Melanson, Vanessa R; Jochim, Ryan; Yarnell, Michael; Ferlez, Karen Bingham; Shashikumar, Soumya; Richardson, Jason H

    2017-01-01

    Vector-borne pathogen surveillance programmes typically rely on the collection of large numbers of potential vectors followed by screening protocols focused on detecting pathogens in the arthropods. These processes are laborious, time consuming, expensive, and require screening of large numbers of samples. To streamline the surveillance process, increase sample throughput, and improve cost-effectiveness, a method to detect dengue virus and malaria parasites (Plasmodium falciparum) by leveraging the sugar-feeding behaviour of mosquitoes and their habit of expectorating infectious agents in their saliva during feeding was investigated in this study. Dengue virus 2 (DENV-2) infected female Aedes aegypti mosquitoes and P. falciparum infected female Anopheles stephensi mosquitoes were allowed to feed on honey coated Flinders Technical Associates -FTA® cards dyed with blue food colouring. The feeding resulted in deposition of saliva containing either DENV-2 particles or P. falciparum sporozoites onto the FTA card. Nucleic acid was extracted from each card and the appropriate real-time PCR (qPCR) assay was run to detect the pathogen of interest. As little as one plaque forming unit (PFU) of DENV-2 and as few as 60 P. falciparum parasites deposited on FTA cards from infected mosquitoes were detected via qPCR. Hence, their use to collect mosquito saliva for pathogen detection is a relevant technique for vector surveillance. This study provides laboratory confirmation that FTA cards can be used to capture and stabilize expectorated DENV-2 particles and P. falciparum sporozoites from infectious, sugar-feeding mosquitoes in very low numbers. Thus, the FTA card-based mosquito saliva capture method offers promise to overcome current limitations and revolutionize traditional mosquito-based pathogen surveillance programmes. Field testing and further method development are required to optimize this strategy.

  6. The ViennaRNA web services.

    Science.gov (United States)

    Gruber, Andreas R; Bernhart, Stephan H; Lorenz, Ronny

    2015-01-01

    The ViennaRNA package is a widely used collection of programs for thermodynamic RNA secondary structure prediction. Over the years, many additional tools have been developed building on the core programs of the package to also address issues related to noncoding RNA detection, RNA folding kinetics, or efficient sequence design considering RNA-RNA hybridizations. The ViennaRNA web services provide easy and user-friendly web access to these tools. This chapter describes how to use this online platform to perform tasks such as prediction of minimum free energy structures, prediction of RNA-RNA hybrids, or noncoding RNA detection. The ViennaRNA web services can be used free of charge and can be accessed via http://rna.tbi.univie.ac.at.

  7. Genomic Insights and Its Comparative Analysis with Yersinia enterocolitica Reveals the Potential Virulence Determinants and Further Pathogenicity for Foodborne Outbreaks.

    Science.gov (United States)

    Gnanasekaran, Gopalsamy; Na, Eun Jung; Chung, Han Young; Kim, Suyeon; Kim, You-Tae; Kwak, Woori; Kim, Heebal; Ryu, Sangryeol; Choi, Sang Ho; Lee, Ju-Hoon

    2017-02-28

    Yersinia enterocolitica is a well-known foodborne pathogen causing gastrointestinal infections worldwide. The strain Y. enterocolitica FORC_002 was isolated from the gill of flatfish (plaice) and its genome was sequenced. The genomic DNA consists of 4,837,317 bp with a GC content of 47.1%, and is predicted to contain 4,221 open reading frames, 81 tRNA genes, and 26 rRNA genes. Interestingly, genomic analysis revealed pathogenesis and host immune evasion-associated genes encoding guanylate cyclase (Yst), invasin (Ail and Inv), outer membrane protein (Yops), autotransporter adhesin A (YadA), RTX-like toxins, and a type III secretion system. In particular, guanylate cyclase is a heat-stable enterotoxin causing Yersinia -associated diarrhea, and RTX-like toxins are responsible for attachment to integrin on the target cell for cytotoxic action. This genome can be used to identify virulence factors that can be applied for the development of novel biomarkers for the rapid detection of this pathogen in foods.

  8. Hyperspectral imaging using a color camera and its application for pathogen detection

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary

    2015-02-01

    This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image

  9. RNA ‘Information Warfare’ in Pathogenic and Mutualistic Interactions

    NARCIS (Netherlands)

    Chaloner, Thomas; Kan, van Jan A.L.; Grant-Downton, Robert T.

    2016-01-01

    Regulatory non-coding RNAs are emerging as key players in host–pathogen interactions. Small RNAs such as microRNAs are implicated in regulating plant transcripts involved in immunity and defence. Surprisingly, RNAs with silencing properties can be translocated from plant hosts to various invading

  10. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  11. Detection of pathogenic Leptospira from selected environment in Kelantan and Terengganu, Malaysia.

    Science.gov (United States)

    Ridzlan, F R; Bahaman, A R; Khairani-Bejo, S; Mutalib, A R

    2010-12-01

    Leptospirosis is recognized as one of the important zoonotic diseases in the world including Malaysia. A total of 145 soil and water samples were collected from selected National Service Training Centres (NSTC) in Kelantan and Terengganu. The samples were inoculated into modified semisolid Ellinghausen McCullough Johnson Harris (EMJH) medium, incubated at room temperature for 1 month and examined under the dark-field microscope. Positive growth of the leptospiral isolates were then confirmed with 8-Azaguanine Test, Polymerase Chain Reaction (PCR) assay and Microscopic Agglutination Test (MAT). Fifteen cultures (10.34%) exhibited positive growths which were seen under dark field microscope whilst only 20% (3/15) were confirmed as pathogenic species. based on 8-Azaguanine Test and PCR. Serological identification of the isolates with MAT showed that hebdomadis was the dominant serovar in Terengganu. Pathogenic leptospires can be detected in Malaysian environment and this has the potential to cause an outbreak. Therefore, precautionary steps against leptospirosis should be taken by camp authorities to ensure the safety of trainees.

  12. Molecular and serological detection of tick-borne pathogens in donkeys (Equus asinus) in Italy.

    Science.gov (United States)

    Veronesi, Fabrizia; Morganti, Giulia; Ravagnan, Silvia; Laus, Fulvio; Spaterna, Andrea; Diaferia, Manuela; Moretti, Annabella; Fioretti, Daniela Piergili; Capelli, Gioia

    2014-10-10

    Donkeys, owing to the frequent outdoor activity, are exposed to a high risk of infection with tick-borne pathogens. This work aimed to detect exposure to Theileria equi, Babesia caballi, Anaplasma phagocytophilum and Borrelia burgdorferi s.l. of donkeys reared in Central Italy. For this purpose 122 adult donkeys were selected within 11 herds and submitted to blood collection. IgG antibodies to T. equi, B. caballi, A. phagocytophilum and B. burgdorferi s.l. were detected by IFAT. Conventional PCRs targeting the genes MSP2 and the flagellin were used for the detection of A. phagocytophilum and B. burgdorferi s.l. respectively and a Real Time PCR Sybr Green was used to detect Babesia/Theileria spp…. The species identity was determined by amplicons sequencing. Forty eight (39.3%) and 58 (47.5%) animals tested positive for T. equi and B. caballi antibodies, respectively; nine animals (7.4%) were found positive for antibodies against A. phagocytophilum whereas negative results were obtained for B. burgdorferi s.l. Twenty-six (21.3%) animals showed antibodies for both T. equi and B. caballi. Twenty-three (18.8%) donkeys were positive to Babesia/Theileria spp. PCR assay. Out of 21 sequenced amplicons, 20 were identified as T. equi, belonging to three main groups designated A, B and D and one as B. caballi group A. Neither A. phagocytophilum nor B. burgdorferi PCR results were positive. The study showed a high exposure of donkeys to tick-borne pathogens and provides information on the genetic identity of the T. equi strains circulating in Central Italy. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A high-throughput method to detect RNA profiling by integration of RT-MLPA with next generation sequencing technology.

    Science.gov (United States)

    Wang, Jing; Yang, Xue; Chen, Haofeng; Wang, Xuewei; Wang, Xiangyu; Fang, Yi; Jia, Zhenyu; Gao, Jidong

    2017-07-11

    RNA in formalin-fixed and paraffin-embedded (FFPE) tissues provides large amount of information indicating disease stages, histological tumor types and grades, as well as clinical outcomes. However, Detection of RNA expression levels in formalin-fixed and paraffin-embedded samples is extremely difficult due to poor RNA quality. Here we developed a high-throughput method, Reverse Transcription-Multiple Ligation-dependent Probe Sequencing (RT-MLPSeq), to determine expression levels of multiple transcripts in FFPE samples. By combining Reverse Transcription-Multiple Ligation-dependent Amplification method and next generation sequencing technology, RT-MLPSeq overcomes the limit of probe length in multiplex ligation-dependent probe amplification assay and thus could detect expression levels of transcripts without quantitative limitations. We proved that different RT-MLPSeq probes targeting on the same transcripts have highly consistent results and the starting RNA/cDNA input could be as little as 1 ng. RT-MLPSeq also presented consistent relative RNA levels of selected 13 genes with reverse transcription quantitative PCR. Finally, we demonstrated the application of the new RT-MLPSeq method by measuring the mRNA expression levels of 21 genes which can be used for accurate calculation of the breast cancer recurrence score - an index that has been widely used for managing breast cancer patients.

  14. RNA-Binding Proteins in Plant Immunity

    Directory of Open Access Journals (Sweden)

    Virginia Woloshen

    2011-01-01

    Full Text Available Plant defence responses against pathogen infection are crucial to plant survival. The high degree of regulation of plant immunity occurs both transcriptionally and posttranscriptionally. Once transcribed, target gene RNA must be processed prior to translation. This includes polyadenylation, 5′capping, editing, splicing, and mRNA export. RNA-binding proteins (RBPs have been implicated at each level of RNA processing. Previous research has primarily focused on structural RNA-binding proteins of yeast and mammals; however, more recent work has characterized a number of plant RBPs and revealed their roles in plant immune responses. This paper provides an update on the known functions of RBPs in plant immune response regulation. Future in-depth analysis of RBPs and other related players will unveil the sophisticated regulatory mechanisms of RNA processing during plant immune responses.

  15. Evaluation of automated RNA-extraction technology and a qualitative HCV assay for sensitivity and detection of HCV RNA in pool-screening systems

    NARCIS (Netherlands)

    Beld, M.; Habibuw, M. R.; Rebers, S. P.; Boom, R.; Reesink, H. W.

    2000-01-01

    BACKGROUND: The objective of this study was the evaluation of NAT technology for the detection of HCV RNA in plasma pools according to the recommendations of the Paul Ehrlich Institute (5000 IU/mL/donation) and the Committee for Proprietary Medical Products (100 IU/mL/manufacturing pool). STUDY

  16. microRNA expression profiling on individual breast cancer patients identifies novel panel of circulating microRNA for early detection

    DEFF Research Database (Denmark)

    Hamam, Rimi; Ali, Arwa M.; Alsaleh, Khalid A.

    2016-01-01

    Breast cancer (BC) is the most common cancer type and the second cause of cancer-related death among women. Therefore, better understanding of breast cancer tumor biology and the identification of novel biomarkers is essential for the early diagnosis and for better disease stratification and mana......Breast cancer (BC) is the most common cancer type and the second cause of cancer-related death among women. Therefore, better understanding of breast cancer tumor biology and the identification of novel biomarkers is essential for the early diagnosis and for better disease stratification...... and management choices. Herein we developed a novel approach which relies on the isolation of circulating microRNAs through an enrichment step using speed-vacuum concentration which resulted in 5-fold increase in microRNA abundance. Global miRNA microarray expression profiling performed on individual samples...... of 46 BC and 14 controls. The expression of those microRNAs was overall higher in patients with stage I, II, and III, compared to stage IV, with potential utilization for early detection. The expression of this microRNA panel was slightly higher in the HER2 and TN compared to patients with luminal...

  17. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples.

    Science.gov (United States)

    Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal

    2015-03-01

    PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  18. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Comparative proteomic analysis of pathogenic and non-pathogenic strains from the swine pathogen Mycoplasma hyopneumoniae

    Directory of Open Access Journals (Sweden)

    Klein Cátia S

    2009-12-01

    Full Text Available Abstract Background Mycoplasma hyopneumoniae is a highly infectious swine pathogen and is the causative agent of enzootic pneumonia (EP. Following the previous report of a proteomic survey of the pathogenic 7448 strain of swine pathogen, Mycoplasma hyopneumoniae, we performed comparative protein profiling of three M. hyopneumoniae strains, namely the non-pathogenic J strain and the two pathogenic strains 7448 and 7422. Results In 2DE comparisons, we were able to identify differences in expression levels for 67 proteins, including the overexpression of some cytoadherence-related proteins only in the pathogenic strains. 2DE immunoblot analyses allowed the identification of differential proteolytic cleavage patterns of the P97 adhesin in the three strains. For more comprehensive protein profiling, an LC-MS/MS strategy was used. Overall, 35% of the M. hyopneumoniae genome coding capacity was covered. Partially overlapping profiles of identified proteins were observed in the strains with 81 proteins identified only in one strain and 54 proteins identified in two strains. Abundance analysis of proteins detected in more than one strain demonstrates the relative overexpression of 64 proteins, including the P97 adhesin in the pathogenic strains. Conclusions Our results indicate the physiological differences between the non-pathogenic strain, with its non-infective proliferate lifestyle, and the pathogenic strains, with its constitutive expression of adhesins, which would render the bacterium competent for adhesion and infection prior to host contact.

  20. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  1. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  2. Direct RNA-based detection of CTX-M β-lactamases in human blood samples.

    Science.gov (United States)

    Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Pletz, Mathias W

    2015-05-01

    Bloodstream infections with ESBL-producers are associated with increased mortality, which is due to delayed appropriate treatment resulting in clinical failure. Current routine diagnostics for detection of bloodstream infections consists of blood culture followed by species identification and susceptibility testing. In attempts to improve and accelerate diagnostic procedures, PCR-based methods have been developed. These methods focus on species identification covering only a limited number of ESBL coding genes. Therefore, they fail to cover the steadily further evolving genetic diversity of clinically relevant β-lactamases. We have recently designed a fast and novel RNA targeting method to detect and specify CTX-M alleles from bacterial cultures, based on an amplification-pyrosequencing approach. We further developed this assay towards a diagnostic tool for clinical use and evaluated its sensitivity and specificity when applied directly to human blood samples. An optimized protocol for mRNA isolation allows detection of specific CTX-M groups from as little as 100 CFU/mL blood via reverse transcription, amplification, and pyrosequencing directly from human EDTA blood samples as well as from pre-incubated human blood cultures with a turnaround time for test results of <7 h. Copyright © 2015 Elsevier GmbH. All rights reserved.

  3. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    Science.gov (United States)

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Noncoding Subgenomic Flavivirus RNA: Multiple Functions in West Nile Virus Pathogenesis and Modulation of Host Responses

    Directory of Open Access Journals (Sweden)

    Justin A. Roby

    2014-01-01

    Full Text Available Flaviviruses are a large group of positive strand RNA viruses transmitted by arthropods that include many human pathogens such as West Nile virus (WNV, Japanese encephalitis virus (JEV, yellow fever virus, dengue virus, and tick-borne encephalitis virus. All members in this genus tested so far are shown to produce a unique subgenomic flavivirus RNA (sfRNA derived from the 3' untranslated region (UTR. sfRNA is a product of incomplete degradation of genomic RNA by the cell 5'–3' exoribonuclease XRN1 which stalls at highly ordered secondary RNA structures at the beginning of the 3'UTR. Generation of sfRNA results in inhibition of XRN1 activity leading to an increase in stability of many cellular mRNAs. Mutant WNV deficient in sfRNA generation was highly attenuated displaying a marked decrease in cytopathicity in cells and pathogenicity in mice. sfRNA has also been shown to inhibit the antiviral activity of IFN-α/β by yet unknown mechanism and of the RNAi pathway by likely serving as a decoy substrate for Dicer. Thus, sfRNA is involved in modulating multiple cellular pathways to facilitate viral pathogenicity; however the overlying mechanism linking all these multiple functions of sfRNA remains to be elucidated.

  5. Multiplex detection of nine food-borne pathogens by mPCR and capillary electrophoresis after using a universal pre-enrichment medium

    Directory of Open Access Journals (Sweden)

    Germán eVillamizar-Rodríguez

    2015-11-01

    Full Text Available Routine microbiological quality analyses in food samples require, in some cases, an initial incubation in pre-enrichment medium. This is necessary in order to assure that small amounts of pathogenic strains are going to be detected. In this work, a universal pre-enrichment medium has been developed for simultaneous growth of Bacillus cereus, Campylobacter jejuni, Clostridium perfringens, Cronobacter sakazakii, Escherichia coli, Enterobacteriaceae family (thirty eight species, twenty seven genera, Listeria monocytogenes, Staphylococcus aureus, Salmonella spp. (two species, thirteen strains. Growth confirmation for all these species was achieved in all cases, with excellent enrichments. This was confirmed by plating on the corresponding selective agar media for each bacterium. This GVUM universal pre-enrichment medium could be useful in food microbiological analyses, where different pathogenic bacteria must be detected after a pre-enrichment step. Following, a mPCR reaction for detection of all these pathogens was developed, after designing a set of nine oligonucleotide pairs from specific genetic targets on gDNA from each of these bacteria, covering all available strains already sequenced in GenBank for them. The detection limits have been 1 Genome Equivalent, with the exception of Fam. Enterobacteriaceae (5 GEs. We obtained amplification for all targets (from 70 to 251 bp, depending on the bacteria type, showing the capability of this method to detect the most important industrial and sanitary food-borne pathogens from a universal pre-enrichment medium. This method includes an initial pre-enrichment step (18 h, followed by a mPCR (2 h and a capillary electrophoresis (30 min; avoiding the tedious and long lasting growing on solid media required in traditional analysis (1 to 4 days, depending on the specific pathogen and verification procedure. An external testing of this method was conducted in order to compare classical and mPCR methods. This

  6. Non-invasive aneuploidy detection using free fetal DNA and RNA in maternal plasma: recent progress and future possibilities.

    NARCIS (Netherlands)

    Go, A.T.; Vugt, J.M.G. van; Oudejans, C.B.

    2011-01-01

    BACKGROUND: Cell-free fetal DNA (cff DNA) and RNA can be detected in maternal plasma and used for non-invasive prenatal diagnostics. Recent technical advances have led to a drastic change in the clinical applicability and potential uses of free fetal DNA and RNA. This review summarizes the latest

  7. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

    Science.gov (United States)

    Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

    2016-09-26

    Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

  8. Research resources: comparative microRNA profiles in human corona radiata cells and cumulus oophorus cells detected by next-generation small RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Xian-Hong Tong

    Full Text Available During folliculogenesis, cumulus cells surrounding the oocyte differentiate into corona radiata cells (CRCs and cumulus oophorus cells (COCs, which are involved in gonadal steroidogenesis and the development of germ cells. Several studies suggested that microRNAs (miRNAs play an important regulatory role at the post-transcriptional level in cumulus cells. However, comparative miRNA profiles and associated processes in human CRCs and COCs have not been reported before. In this study, miRNA profiles were obtained from CRCs and COCs using next generation sequencing in women undergoing controlled ovarian stimulation for IVF. A total of 785 and 799 annotated miRNAs were identified in CRCs and COCs, while high expression levels of six novel miRNAs were detected both in CRCs and in COCs. In addition, different expression patterns in CRCs and COCs were detected in 72 annotated miRNAs. To confirm the miRNA profile in COCs and CRCs, quantitative real-time PCR was used to validate the expression of annotated miRNAs, differentially expressed miRNAs, and novel miRNAs. The miRNAs in the let-7 family were found to be involved in the regulation of a broad range of biological processes in both cumulus cell populations, which was accompanied by a large amount of miRNA editing. Bioinformatics analysis showed that amino acid and energy metabolism were targeted significantly by miRNAs that were differentially expressed between CRCs and COCs. Our work extends the current knowledge of the regulatory role of miRNAs and their targeted pathways in folliculogenesis, and provides novel candidates for molecular biomarkers in the research of female infertility.

  9. Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1–Seropositive Kenyan Men

    Science.gov (United States)

    Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L.; Sanders, Eduard J.; Peshu, Norbert M.; Krieger, John N.; Muller, Charles H.; Coombs, Robert W.; Fredricks, David N.; Graham, Susan M.

    2017-01-01

    Introduction: HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. Methods: We analyzed semen samples from 42 HIV-1–seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Results: Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: −0.77, 95% CI: −1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Conclusion: Most of these HIV-1–infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission. PMID:27861240

  10. Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen.

    Science.gov (United States)

    Deng, Dawei; Li, Yang; Xue, Jianpeng; Wang, Jie; Ai, Guanhua; Li, Xin; Gu, Yueqing

    2015-01-01

    Messenger RNA (mRNA), a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP) beacon containing a bare gold nanoparticle (AuNP) as fluorescence quencher and thiol-terminated fluorescently labeled stem-loop-stem oligonucleotide sequences attached by Au-S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b) mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.

  11. A Phenotype-Driven Approach to Generate Mouse Models with Pathogenic mtDNA Mutations Causing Mitochondrial Disease

    Directory of Open Access Journals (Sweden)

    Johanna H.K. Kauppila

    2016-09-01

    Full Text Available Mutations of mtDNA are an important cause of human disease, but few animal models exist. Because mammalian mitochondria cannot be transfected, the development of mice with pathogenic mtDNA mutations has been challenging, and the main strategy has therefore been to introduce mutations found in cell lines into mouse embryos. Here, we describe a phenotype-driven strategy that is based on detecting clonal expansion of pathogenic mtDNA mutations in colonic crypts of founder mice derived from heterozygous mtDNA mutator mice. As proof of concept, we report the generation of a mouse line transmitting a heteroplasmic pathogenic mutation in the alanine tRNA gene of mtDNA displaying typical characteristics of classic mitochondrial disease. In summary, we describe a straightforward and technically simple strategy based on mouse breeding and histology to generate animal models of mtDNA-mutation disease, which will be of great importance for studies of disease pathophysiology and preclinical treatment trials.

  12. Complete genome sequence of Bacillus velezensis S3-1, a potential biological pesticide with plant pathogen inhibiting and plant promoting capabilities.

    Science.gov (United States)

    Jin, Qing; Jiang, Qiuyue; Zhao, Lei; Su, Cuizhu; Li, Songshuo; Si, Fangyi; Li, Shanshan; Zhou, Chenhao; Mu, Yonglin; Xiao, Ming

    2017-10-10

    Antagonistic soil microorganisms, which are non-toxic, harmless non-pollutants, can effectively reduce the density of pathogenic species by some ways. Bacillus velezensis strain S3-1 was isolated from the rhizosphere soil of cucumber, and was shown to inhibit plant pathogens, promote plant growth and efficiently colonize rhizosphere soils. The strain produced 13 kinds of lipopeptide antibiotics, belonging to the surfactin, iturin and fengycin families. Here, we presented the complete genome sequence of S3-1. The genome consists of one chromosome without plasmids and also contains the biosynthetic gene cluster that encodes difficidin, macrolactin, surfactin and fengycin. The genome contains 86 tRNA genes, 27 rRNA genes and 57 antibiotic-related genes. The complete genome sequence of B. velezensis S3-1 provides useful information to further detect the molecular mechanisms behind antifungal actions, and will facilitate its potential as a biological pesticide in the agricultural industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    Science.gov (United States)

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Widespread detection of highly pathogenic H5 influenza viruses in wild birds from the Pacific Flyway of the United States.

    Science.gov (United States)

    Bevins, S N; Dusek, R J; White, C L; Gidlewski, T; Bodenstein, B; Mansfield, K G; DeBruyn, P; Kraege, D; Rowan, E; Gillin, C; Thomas, B; Chandler, S; Baroch, J; Schmit, B; Grady, M J; Miller, R S; Drew, M L; Stopak, S; Zscheile, B; Bennett, J; Sengl, J; Brady, Caroline; Ip, H S; Spackman, E; Killian, M L; Torchetti, M K; Sleeman, J M; Deliberto, T J

    2016-07-06

    A novel highly pathogenic avian influenza virus belonging to the H5 clade 2.3.4.4 variant viruses was detected in North America in late 2014. Motivated by the identification of these viruses in domestic poultry in Canada, an intensive study was initiated to conduct highly pathogenic avian influenza surveillance in wild birds in the Pacific Flyway of the United States. A total of 4,729 hunter-harvested wild birds were sampled and highly pathogenic avian influenza virus was detected in 1.3% (n = 63). Three H5 clade 2.3.4.4 subtypes were isolated from wild birds, H5N2, H5N8, and H5N1, representing the wholly Eurasian lineage H5N8 and two novel reassortant viruses. Testing of 150 additional wild birds during avian morbidity and mortality investigations in Washington yielded 10 (6.7%) additional highly pathogenic avian influenza isolates (H5N8 = 3 and H5N2 = 7). The geographically widespread detection of these viruses in apparently healthy wild waterfowl suggest that the H5 clade 2.3.4.4 variant viruses may behave similarly in this taxonomic group whereby many waterfowl species are susceptible to infection but do not demonstrate obvious clinical disease. Despite these findings in wild waterfowl, mortality has been documented for some wild bird species and losses in US domestic poultry during the first half of 2015 were unprecedented.

  15. Low levels of HIV-1 RNA detected in the cerebrospinal fluid after up to 10 years of suppressive therapy are associated with local immune activation.

    Science.gov (United States)

    Dahl, Viktor; Peterson, Julia; Fuchs, Dietmar; Gisslen, Magnus; Palmer, Sarah; Price, Richard W

    2014-09-24

    Though combination antiretroviral therapy reduces the concentration of HIV-1 RNA in both plasma and cerebrospinal fluid (CSF) below the detection limit of clinical assays, low levels of HIV-1 RNA are frequently detectable in plasma using more sensitive assays. We examined the frequency and magnitude of persistent low-level HIV-1 RNA in CSF and its relation to the central nervous system (CNS) immune activation. CSF and plasma HIV-1 RNA were measured using the single-copy assay with a detection limit of 0.3 copies/ml in 70 CSF and 68 plasma samples from 45 treated HIV-1-infected patients with less than 40 copies/ml of HIV-1 RNA in both fluids by standard clinical assays. We also measured CSF neopterin to assess intrathecal immune activation. Theoretical drug exposure was estimated using the CNS penetration-efficacy score of treatment regimens. CSF HIV-1 RNA was detected in 12 of the 70 CSF samples (17%) taken after up to 10 years of suppressive therapy, compared to 39 of the 68 plasma samples (57%) with a median concentration of less than 0.3 copies/ml in CSF compared to 0.3 copies/ml in plasma (P < 0.0001). CSF samples with detectable HIV-1 RNA had higher CSF neopterin levels (mean 8.2 compared to 5.7 nmol/l; P = 0.0085). Patients with detectable HIV-1 RNA in CSF did not differ in pretreatment plasma HIV-1 RNA levels, nadir CD4 cell count or CNS penetration-efficacy score. Low-level CSF HIV-1 RNA and its association with elevated CSF neopterin highlight the potential for the CNS to serve as a viral reservoir and for persistent infection to cause subclinical CNS injury.

  16. Dual RNA regulatory control of a Staphylococcus aureus virulence factor.

    Science.gov (United States)

    Chabelskaya, Svetlana; Bordeau, Valérie; Felden, Brice

    2014-04-01

    In pathogens, the accurate programming of virulence gene expression is essential for infection. It is achieved by sophisticated arrays of regulatory proteins and ribonucleic acids (sRNAs), but in many cases their contributions and connections are not yet known. Based on genetic, biochemical and structural evidence, we report that the expression pattern of a Staphylococcus aureus host immune evasion protein is enabled by the collaborative actions of RNAIII and small pathogenicity island RNA D (SprD). Their combined expression profiles during bacterial growth permit early and transient synthesis of Sbi to avoid host immune responses. Together, these two sRNAs use antisense mechanisms to monitor Sbi expression at the translational level. Deletion analysis combined with structural analysis of RNAIII in complex with its novel messenger RNA (mRNA) target indicate that three distant RNAIII domains interact with distinct sites of the sbi mRNA and that two locations are deep in the sbi coding region. Through distinct domains, RNAIII lowers production of two proteins required for avoiding innate host immunity, staphylococcal protein A and Sbi. Toeprints and in vivo mutational analysis reveal a novel regulatory module within RNAIII essential for attenuation of Sbi translation. The sophisticated translational control of mRNA by two differentially expressed sRNAs ensures supervision of host immune escape by a major pathogen.

  17. Multiplexed microRNA detection using lanthanide-labeled DNA probes and laser ablation inductively coupled plasma mass spectrometry

    DEFF Research Database (Denmark)

    de Bang, Thomas Christian; Shah, Pratik; Cho, Seok Keun

    2014-01-01

    coupled plasma mass spectrometry (LA-ICPMS). Three miRNAs from Arabidopsis thaliana were analyzed simultaneously with high specificity, and the sensitivity of the method was comparable to radioactive detection (low femtomol range). The perspective of the developed method is highly multiplexed......In the past decade, microRNAs (miRNAs) have drawn increasing attention due to their role in regulation of gene expression. Especially, their potential as biomarkers in disease diagnostics has motivated miRNA research, including the development of simple, accurate, and sensitive detection methods....... The narrow size range of miRNAs (20-24 nucleotides) combined with the chemical properties of conventional reporter tags has hampered the development of multiplexed miRNA assays. In this study, we have used lanthanide-labeled DNA probes for the detection of miRNAs on membranes using laser ablation inductively...

  18. A multiplex PCR/LDR assay for simultaneous detection and identification of the NIAID category B bacterial food and water-borne pathogens.

    Science.gov (United States)

    Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis

    2014-06-01

    Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Hg(2+) detection using a phosphorothioate RNA probe adsorbed on graphene oxide and a comparison with thymine-rich DNA.

    Science.gov (United States)

    Huang, Po-Jung Jimmy; van Ballegooie, Courtney; Liu, Juewen

    2016-06-07

    Mercury is a highly toxic heavy metal and many DNA-based biosensors have been recently developed for Hg(2+) detection in water. Among them, thymine-rich DNA is the most commonly used for designing Hg(2+) sensors. However, the thymine-Hg(2+) interaction is strongly affected by the buffer conditions. We recently reported a molecular beacon containing phosphorothioate (PS)-modified RNA linkages that can be cleaved by Hg(2+). In this work, the fluorescence quenching and DNA adsorption properties of nano-sized graphene oxide (NGO) were used to develop a new sensor using the PS-RNA chemistry. Three DNA probes, containing one, three and five PS-RNA linkages, respectively, were tested. Finally, a fluorophore-labeled poly-A DNA with five PS-RNA linkages was selected and adsorbed by NGO. In the presence of Hg(2+), the fluorophore was released from NGO due to the cleavage reaction, resulting in a fluorescence enhancement. This sensor is highly selective for Hg(2+) with a detection limit of 8.5 nM Hg(2+). For comparison, a fluorophore-labeled poly-T DNA was also tested, which responded to Hg(2+) more slowly and was inhibited by high NaCl concentrations, while the PS-RNA probe was more tolerant to different buffer conditions. This work indicates a new method for interfacing DNA with NGO for Hg(2+) detection.

  20. Viral RNA testing and automation on the bead-based CBNE detection microsystem.

    Energy Technology Data Exchange (ETDEWEB)

    Galambos, Paul C.; Bourdon, Christopher Jay; Farrell, Cara M.; Rossito, Paul (University of California at Davis); McClain, Jaime L.; Derzon, Mark Steven; Cullor, James Sterling (University of California at Davis); Rahimian, Kamayar

    2008-09-01

    We developed prototype chemistry for nucleic acid hybridization on our bead-based diagnostics platform and we established an automatable bead handling protocol capable of 50 part-per-billion (ppb) sensitivity. We are working towards a platform capable of parallel, rapid (10 minute), raw sample testing for orthogonal (in this case nucleic acid and immunoassays) identification of biological (and other) threats in a single sensor microsystem. In this LDRD we developed the nucleic acid chemistry required for nucleic acid hybridization. Our goal is to place a non-cell associated RNA virus (Bovine Viral Diarrhea, BVD) on the beads for raw sample testing. This key pre-requisite to showing orthogonality (nucleic acid measurements can be performed in parallel with immunoassay measurements). Orthogonal detection dramatically reduces false positives. We chose BVD because our collaborators (UC-Davis) can supply samples from persistently infected animals; and because proof-of-concept field testing can be performed with modification of the current technology platform at the UC Davis research station. Since BVD is a cattle-prone disease this research dovetails with earlier immunoassay work on Botulinum toxin simulant testing in raw milk samples. Demonstration of BVD RNA detection expands the repertoire of biological macromolecules that can be adapted to our bead-based detection. The resources of this late start LDRD were adequate to partially demonstrate the conjugation of the beads to the nucleic acids. It was never expected to be adequate for a full live virus test but to motivate that additional investment. In addition, we were able to reduce the LOD (Limit of Detection) for the botulinum toxin stimulant to 50 ppb from the earlier LOD of 1 ppm. A low LOD combined with orthogonal detection provides both low false negatives and low false positives. The logical follow-on steps to this LDRD research are to perform live virus identification as well as concurrent nucleic acid and

  1. Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens.

    Directory of Open Access Journals (Sweden)

    Linxiang Chen

    Full Text Available Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests, which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05 were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains.

  2. Aptamer-based hydrogel barcodes for the capture and detection of multiple types of pathogenic bacteria.

    Science.gov (United States)

    Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin

    2018-02-15

    Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

    Science.gov (United States)

    Thaitrong, Numrin; Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Karoonuthaisiri, Nitsara

    2013-01-01

    Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac), watermelon silver mottle virus (WSMoV), and melon yellow spot virus (MYSV) screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

  4. Implementation of microfluidic sandwich ELISA for superior detection of plant pathogens.

    Directory of Open Access Journals (Sweden)

    Numrin Thaitrong

    Full Text Available Rapid and economical screening of plant pathogens is a high-priority need in the seed industry. Crop quality control and disease surveillance demand early and accurate detection in addition to robustness, scalability, and cost efficiency typically required for selective breeding and certification programs. Compared to conventional bench-top detection techniques routinely employed, a microfluidic-based approach offers unique benefits to address these needs simultaneously. To our knowledge, this work reports the first attempt to perform microfluidic sandwich ELISA for Acidovorax citrulli (Ac, watermelon silver mottle virus (WSMoV, and melon yellow spot virus (MYSV screening. The immunoassay occurs on the surface of a reaction chamber represented by a microfluidic channel. The capillary force within the microchannel draws a reagent into the reaction chamber as well as facilitates assay incubation. Because the underlying pad automatically absorbs excess fluid, the only operation required is sequential loading of buffers/reagents. Buffer selection, antibody concentrations, and sample loading scheme were optimized for each pathogen. Assay optimization reveals that the 20-folds lower sample volume demanded by the microchannel structure outweighs the 2- to 4-folds higher antibody concentrations required, resulting in overall 5-10 folds of reagent savings. In addition to cutting the assay time by more than 50%, the new platform offers 65% cost savings from less reagent consumption and labor cost. Our study also shows 12.5-, 2-, and 4-fold improvement in assay sensitivity for Ac, WSMoV, and MYSV, respectively. Practical feasibility is demonstrated using 19 real plant samples. Given a standard 96-well plate format, the developed assay is compatible with commercial fluorescent plate readers and readily amendable to robotic liquid handling systems for completely hand-free assay automation.

  5. Helicase-dependent isothermal amplification: a novel tool in the development of molecular-based analytical systems for rapid pathogen detection.

    Science.gov (United States)

    Barreda-García, Susana; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

    2018-01-01

    Highly sensitive testing of nucleic acids is essential to improve the detection of pathogens, which pose a major threat for public health worldwide. Currently available molecular assays, mainly based on PCR, have a limited utility in point-of-need control or resource-limited settings. Consequently, there is a strong interest in developing cost-effective, robust, and portable platforms for early detection of these harmful microorganisms. Since its description in 2004, isothermal helicase-dependent amplification (HDA) has been successfully applied in the development of novel molecular-based technologies for rapid, sensitive, and selective detection of viruses and bacteria. In this review, we highlight relevant analytical systems using this simple nucleic acid amplification methodology that takes place at a constant temperature and that is readily compatible with microfluidic technologies. Different strategies for monitoring HDA amplification products are described. In addition, we present technological advances for integrating sample preparation, HDA amplification, and detection. Future perspectives and challenges toward point-of-need use not only for clinical diagnosis but also in food safety testing and environmental monitoring are also discussed. Graphical Abstract Expanding the analytical toolbox for the detection of DNA sequences specific of pathogens with isothermal helicase dependent amplification (HDA).

  6. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-01-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  7. Future research needs involving pathogens in groundwater

    Science.gov (United States)

    Bradford, Scott A.; Harvey, Ronald W.

    2017-06-01

    Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.

  8. Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle.

    Science.gov (United States)

    Załuga, Joanna; Stragier, Pieter; Baeyen, Steve; Haegeman, Annelies; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

    2014-05-22

    The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and

  9. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    2009-05-01

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  10. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  11. Potent host-directed small-molecule inhibitors of myxovirus RNA-dependent RNA-polymerases.

    Directory of Open Access Journals (Sweden)

    Stefanie A Krumm

    Full Text Available Therapeutic targeting of host cell factors required for virus replication rather than of pathogen components opens new perspectives to counteract virus infections. Anticipated advantages of this approach include a heightened barrier against the development of viral resistance and a broadened pathogen target spectrum. Myxoviruses are predominantly associated with acute disease and thus are particularly attractive for this approach since treatment time can be kept limited. To identify inhibitor candidates, we have analyzed hit compounds that emerged from a large-scale high-throughput screen for their ability to block replication of members of both the orthomyxovirus and paramyxovirus families. This has returned a compound class with broad anti-viral activity including potent inhibition of different influenza virus and paramyxovirus strains. After hit-to-lead chemistry, inhibitory concentrations are in the nanomolar range in the context of immortalized cell lines and human PBMCs. The compound shows high metabolic stability when exposed to human S-9 hepatocyte subcellular fractions. Antiviral activity is host-cell species specific and most pronounced in cells of higher mammalian origin, supporting a host-cell target. While the compound induces a temporary cell cycle arrest, host mRNA and protein biosynthesis are largely unaffected and treated cells maintain full metabolic activity. Viral replication is blocked at a post-entry step and resembles the inhibition profile of a known inhibitor of viral RNA-dependent RNA-polymerase (RdRp activity. Direct assessment of RdRp activity in the presence of the reagent reveals strong inhibition both in the context of viral infection and in reporter-based minireplicon assays. In toto, we have identified a compound class with broad viral target range that blocks host factors required for viral RdRp activity. Viral adaptation attempts did not induce resistance after prolonged exposure, in contrast to rapid

  12. Depletion of Human DNA in Spiked Clinical Specimens for Improvement of Sensitivity of Pathogen Detection by Next-Generation Sequencing

    OpenAIRE

    Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter

    2016-01-01

    Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...

  13. Nucleic Acid-Based Detection and Identification of Bacterial and Fungal Plant Pathogens - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Kingsley, Mark T.

    2001-03-13

    The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.

  14. Deconstructing host-pathogen interactions in Drosophila

    Directory of Open Access Journals (Sweden)

    Ethan Bier

    2012-01-01

    Full Text Available Many of the cellular mechanisms underlying host responses to pathogens have been well conserved during evolution. As a result, Drosophila can be used to deconstruct many of the key events in host-pathogen interactions by using a wealth of well-developed molecular and genetic tools. In this review, we aim to emphasize the great leverage provided by the suite of genomic and classical genetic approaches available in flies for decoding details of host-pathogen interactions; these findings can then be applied to studies in higher organisms. We first briefly summarize the general strategies by which Drosophila resists and responds to pathogens. We then focus on how recently developed genome-wide RNA interference (RNAi screens conducted in cells and flies, combined with classical genetic methods, have provided molecular insight into host-pathogen interactions, covering examples of bacteria, fungi and viruses. Finally, we discuss novel strategies for how flies can be used as a tool to examine how specific isolated virulence factors act on an intact host.

  15. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Science.gov (United States)

    Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

  17. Lawrence Livermore National Laboratory Workshop Characterization of Pathogenicity, Virulence and Host-Pathogen Interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krishnan, A

    2006-08-30

    The threats of bio-terrorism and newly emerging infectious diseases pose serious challenges to the national security infrastructure. Rapid detection and diagnosis of infectious disease in human populations, as well as characterizing pathogen biology, are critical for reducing the morbidity and mortality associated with such threats. One of the key challenges in managing an infectious disease outbreak, whether through natural causes or acts of overt terrorism, is detection early enough to initiate effective countermeasures. Much recent attention has been directed towards the utility of biomarkers or molecular signatures that result from the interaction of the pathogen with the host for improving our ability to diagnose and mitigate the impact of a developing infection during the time window when effective countermeasures can be instituted. Host responses may provide early signals in blood even from localized infections. Multiple innate and adaptive immune molecules, in combination with other biochemical markers, may provide disease-specific information and new targets for countermeasures. The presence of pathogen specific markers and an understanding of the molecular capabilities and adaptations of the pathogen when it interacts with its host may likewise assist in early detection and provide opportunities for targeting countermeasures. An important question that needs to be addressed is whether these molecular-based approaches will prove useful for early diagnosis, complement current methods of direct agent detection, and aid development and use of countermeasures. Lawrence Livermore National Laboratory (LLNL) will host a workshop to explore the utility of host- and pathogen-based molecular diagnostics, prioritize key research issues, and determine the critical steps needed to transition host-pathogen research to tools that can be applied towards a more effective national bio-defense strategy. The workshop will bring together leading researchers/scientists in the

  18. RNA-seq Transcriptome Response of Flax (Linum usitatissimum L.) to the Pathogenic Fungus Fusarium oxysporum f. sp. lini.

    Science.gov (United States)

    Galindo-González, Leonardo; Deyholos, Michael K

    2016-01-01

    Fusarium oxysporum f. sp. lini is a hemibiotrophic fungus that causes wilt in flax. Along with rust, fusarium wilt has become an important factor in flax production worldwide. Resistant flax cultivars have been used to manage the disease, but the resistance varies, depending on the interactions between specific cultivars and isolates of the pathogen. This interaction has a strong molecular basis, but no genomic information is available on how the plant responds to attempted infection, to inform breeding programs on potential candidate genes to evaluate or improve resistance across cultivars. In the current study, disease progression in two flax cultivars [Crop Development Center (CDC) Bethune and Lutea], showed earlier disease symptoms and higher susceptibility in the later cultivar. Chitinase gene expression was also divergent and demonstrated and earlier molecular response in Lutea. The most resistant cultivar (CDC Bethune) was used for a full RNA-seq transcriptome study through a time course at 2, 4, 8, and 18 days post-inoculation (DPI). While over 100 genes were significantly differentially expressed at both 4 and 8 DPI, the broadest deployment of plant defense responses was evident at 18 DPI with transcripts of more than 1,000 genes responding to the treatment. These genes evidenced a reception and transduction of pathogen signals, a large transcriptional reprogramming, induction of hormone signaling, activation of pathogenesis-related genes, and changes in secondary metabolism. Among these, several key genes that consistently appear in studies of plant-pathogen interactions, had increased transcript abundance in our study, and constitute suitable candidates for resistance breeding programs. These included: an induced R PMI-induced protein kinase; transcription factors WRKY3, WRKY70, WRKY75, MYB113 , and MYB108 ; the ethylene response factors ERF1 and ERF14 ; two genes involved in auxin/glucosinolate precursor synthesis ( CYP79B2 and CYP79B3 ); the flavonoid

  19. RNA-seq Transcriptome Response of Flax (Linum usitatissimum L. to the Pathogenic Fungus Fusarium oxysporum f. sp. lini.

    Directory of Open Access Journals (Sweden)

    Leonardo Miguel Galindo-González

    2016-11-01

    Full Text Available Fusarium oxysporum f. sp. lini is a hemibiotrophic fungus that causes wilt in flax. Along with rust, fusarium wilt has become an important factor in flax production worldwide. Resistant flax cultivars have been used to manage the disease, but the resistance varies, depending on the interactions between specific cultivars and isolates of the pathogen. This interaction has a strong molecular basis, but no genomic information is available on how the plant responds to attempted infection, to inform breeding programs on potential candidate genes to evaluate or improve resistance across cultivars. In the current study, disease progression in two flax cultivars (CDC Bethune and Lutea, showed earlier disease symptoms and higher susceptibility in the later cultivar. Chitinase gene expression was also divergent and demonstrated and earlier molecular response in Lutea. The most resistant cultivar (CDC Bethune was used for a full RNA-seq transcriptome study through a time-course at 2, 4, 8 and 18 days post-inoculation (DPI. While over 100 genes were significantly differentially expressed at both 4 and 8 DPI, the broadest deployment of plant defense responses was evident at 18 DPI with transcripts of more than 1,000 genes responding to the treatment. These genes evidenced a reception and transduction of pathogen signals, a large transcriptional reprogramming, induction of hormone signalling, activation of pathogenesis-related (PR genes, and changes in secondary metabolism. Among these several key genes, that consistently appear in studies of plant-pathogen interactions, had increased transcript abundance in our study, and constitute suitable candidates for resistance breeding programs. These included: an induced RPMI-induced protein kinase (RIPK; transcription factors WRKY3, WRKY70, WRKY75, MYB113 and MYB108; the ethylene response factors ERF1 and ERF14; two genes involved in auxin/glucosinolate precursor synthesis (CYP79B2 and CYP79B3; the flavonoid

  20. Protection and systemic translocation of siRNA following oral administration of chitosan/siRNA nanoparticles

    DEFF Research Database (Denmark)

    Gonzalez, Borja Ballarin; Dagnæs-Hansen, Frederik; Fenton, Robert A.

    2013-01-01

    , gastrointestinal (GI) deposition, and translocation into peripheral tissue of nonmodified siRNA after oral gavage of chitosan/siRNA nanoparticles in mice. In contrast to naked siRNA, retained structural integrity and deposition in the stomach, proximal and distal small intestine, and colon was observed at 1 and 5...... hours for siRNA within nanoparticles. Furthermore, histological detection of fluorescent siRNA at the apical regions of the intestinal epithelium suggests mucoadhesion provided by chitosan. Detection of intact siRNA in the liver, spleen, and kidney was observed 1 hour after oral gavage, with an organ...

  1. Overlapping Patterns of Rapid Evolution in the Nucleic Acid Sensors cGAS and OAS1 Suggest a Common Mechanism of Pathogen Antagonism and Escape.

    Science.gov (United States)

    Hancks, Dustin C; Hartley, Melissa K; Hagan, Celia; Clark, Nathan L; Elde, Nels C

    2015-05-01

    A diverse subset of pattern recognition receptors (PRRs) detects pathogen-associated nucleic acids to initiate crucial innate immune responses in host organisms. Reflecting their importance for host defense, pathogens encode various countermeasures to evade or inhibit these immune effectors. PRRs directly engaged by pathogen inhibitors often evolve under recurrent bouts of positive selection that have been described as molecular 'arms races.' Cyclic GMP-AMP synthase (cGAS) was recently identified as a key PRR. Upon binding cytoplasmic double-stranded DNA (dsDNA) from various viruses, cGAS generates the small nucleotide secondary messenger cGAMP to signal activation of innate defenses. Here we report an evolutionary history of cGAS with recurrent positive selection in the primate lineage. Recent studies indicate a high degree of structural similarity between cGAS and 2'-5'-oligoadenylate synthase 1 (OAS1), a PRR that detects double-stranded RNA (dsRNA), despite low sequence identity between the respective genes. We present comprehensive comparative evolutionary analysis of cGAS and OAS1 primate sequences and observe positive selection at nucleic acid binding interfaces and distributed throughout both genes. Our data revealed homologous regions with strong signatures of positive selection, suggesting common mechanisms employed by unknown pathogen encoded inhibitors and similar modes of evasion from antagonism. Our analysis of cGAS diversification also identified alternately spliced forms missing multiple sites under positive selection. Further analysis of selection on the OAS family in primates, which comprises OAS1, OAS2, OAS3 and OASL, suggests a hypothesis where gene duplications and domain fusion events result in paralogs that provide another means of escaping pathogen inhibitors. Together our comparative evolutionary analysis of cGAS and OAS provides new insights into distinct mechanisms by which key molecular sentinels of the innate immune system have adapted

  2. Overlapping Patterns of Rapid Evolution in the Nucleic Acid Sensors cGAS and OAS1 Suggest a Common Mechanism of Pathogen Antagonism and Escape.

    Directory of Open Access Journals (Sweden)

    Dustin C Hancks

    2015-05-01

    Full Text Available A diverse subset of pattern recognition receptors (PRRs detects pathogen-associated nucleic acids to initiate crucial innate immune responses in host organisms. Reflecting their importance for host defense, pathogens encode various countermeasures to evade or inhibit these immune effectors. PRRs directly engaged by pathogen inhibitors often evolve under recurrent bouts of positive selection that have been described as molecular 'arms races.' Cyclic GMP-AMP synthase (cGAS was recently identified as a key PRR. Upon binding cytoplasmic double-stranded DNA (dsDNA from various viruses, cGAS generates the small nucleotide secondary messenger cGAMP to signal activation of innate defenses. Here we report an evolutionary history of cGAS with recurrent positive selection in the primate lineage. Recent studies indicate a high degree of structural similarity between cGAS and 2'-5'-oligoadenylate synthase 1 (OAS1, a PRR that detects double-stranded RNA (dsRNA, despite low sequence identity between the respective genes. We present comprehensive comparative evolutionary analysis of cGAS and OAS1 primate sequences and observe positive selection at nucleic acid binding interfaces and distributed throughout both genes. Our data revealed homologous regions with strong signatures of positive selection, suggesting common mechanisms employed by unknown pathogen encoded inhibitors and similar modes of evasion from antagonism. Our analysis of cGAS diversification also identified alternately spliced forms missing multiple sites under positive selection. Further analysis of selection on the OAS family in primates, which comprises OAS1, OAS2, OAS3 and OASL, suggests a hypothesis where gene duplications and domain fusion events result in paralogs that provide another means of escaping pathogen inhibitors. Together our comparative evolutionary analysis of cGAS and OAS provides new insights into distinct mechanisms by which key molecular sentinels of the innate immune system

  3. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D. T. J.

    2015-01-01

    Roč. 8, JUN 19 2015 (2015), s. 336 ISSN 1756-3305 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR(CZ) GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Diplostomum (Platyhelminthes: Trematoda) * fish pathogens * mitochondrial genome * ribosomal RNA * illumina next-generation sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.234, year: 2015

  4. RNA aptasensor for rapid detection of natively folded type A botulinum neurotoxin.

    Science.gov (United States)

    Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Lou, Jianlong; Marks, James D; Cai, Shuowei

    2013-12-15

    A surface plasmon resonance based RNA aptasensor for rapid detection of natively folded type A botulinum neurotoxin is reported. Using detoxified recombinant type A botulinum neurotoxin as the surrogate, the aptasensor detects active toxin within 90 min. The detection limit of the aptasensor in phosphate buffered saline, carrot juice, and fat free milk is 5.8 ng/ml, 20.3 ng/ml and 23.4 ng/ml, respectively, while that in 5-fold diluted human serum is 22.5 ng/ml. Recovery of toxin from disparate sample matrices are within 91-116%. Most significant is the ability of this aptasensor to effectively differentiate the natively folded toxin from denatured, inactive toxin, which is important for homeland security surveillance and threat assessment. The aptasensor is stable for more than 30 days and over 400 injections/regeneration cycles. Such an aptasensor holds great promise for rapid detection of active botulinum neurotoxin for field surveillance due to its robustness, stability and reusability. © 2013 Elsevier B.V. All rights reserved.

  5. Rapid and high-throughput detection of highly pathogenic bacteria by Ibis PLEX-ID technology.

    Directory of Open Access Journals (Sweden)

    Daniela Jacob

    Full Text Available In this manuscript, we describe the identification of highly pathogenic bacteria using an assay coupling biothreat group-specific PCR with electrospray ionization mass spectrometry (PCR/ESI-MS run on an Ibis PLEX-ID high-throughput platform. The biothreat cluster assay identifies most of the potential bioterrorism-relevant microorganisms including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia mallei and pseudomallei, Brucella species, and Coxiella burnetii. DNA from 45 different reference materials with different formulations and different concentrations were chosen and sent to a service screening laboratory that uses the PCR/ESI-MS platform to provide a microbial identification service. The standard reference materials were produced out of a repository built up in the framework of the EU funded project "Establishment of Quality Assurances for Detection of Highly Pathogenic Bacteria of Potential Bioterrorism Risk" (EQADeBa. All samples were correctly identified at least to the genus level.

  6. Development of Electrochemical Biosensors for Ultrasensitive Detection of Bacteria in the Environment

    DEFF Research Database (Denmark)

    Fapyane, Deby

    2018-01-01

    to those conventional methods, are intensively studied. Biosensor technology is one of the strategies for rapid monitoring of pathogens such as bacteria, virus, and parasites in the environment. Among them, the electrochemical biosensor offers simple, rapid, cost-effective and possibility...... for ultrasensitive detection of bacterial cells, DNA and rRNA. Several key operational parameters were assessed such as the optimization of probe design and labeling molecules. Here, more specifically we used two novel labels for the development of the electrochemical biosensor for bacteria detection; cellulase...

  7. Use of Metagenomic Shotgun Sequencing Technology To Detect Foodborne Pathogens within the Microbiome of the Beef Production Chain.

    Science.gov (United States)

    Yang, Xiang; Noyes, Noelle R; Doster, Enrique; Martin, Jennifer N; Linke, Lyndsey M; Magnuson, Roberta J; Yang, Hua; Geornaras, Ifigenia; Woerner, Dale R; Jones, Kenneth L; Ruiz, Jaime; Boucher, Christina; Morley, Paul S; Belk, Keith E

    2016-04-01

    Foodborne illnesses associated with pathogenic bacteria are a global public health and economic challenge. The diversity of microorganisms (pathogenic and nonpathogenic) that exists within the food and meat industries complicates efforts to understand pathogen ecology. Further, little is known about the interaction of pathogens within the microbiome throughout the meat production chain. Here, a metagenomic approach and shotgun sequencing technology were used as tools to detect pathogenic bacteria in environmental samples collected from the same groups of cattle at different longitudinal processing steps of the beef production chain: cattle entry to feedlot, exit from feedlot, cattle transport trucks, abattoir holding pens, and the end of the fabrication system. The log read counts classified as pathogens per million reads for Salmonella enterica,Listeria monocytogenes,Escherichia coli,Staphylococcus aureus, Clostridium spp. (C. botulinum and C. perfringens), and Campylobacter spp. (C. jejuni,C. coli, and C. fetus) decreased over subsequential processing steps. Furthermore, the normalized read counts for S. enterica,E. coli, and C. botulinumwere greater in the final product than at the feedlots, indicating that the proportion of these bacteria increased (the effect on absolute numbers was unknown) within the remaining microbiome. From an ecological perspective, data indicated that shotgun metagenomics can be used to evaluate not only the microbiome but also shifts in pathogen populations during beef production. Nonetheless, there were several challenges in this analysis approach, one of the main ones being the identification of the specific pathogen from which the sequence reads originated, which makes this approach impractical for use in pathogen identification for regulatory and confirmation purposes. Copyright © 2016 Yang et al.

  8. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  9. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  10. [Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

    Science.gov (United States)

    Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

    2009-07-01

    Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

  11. Detecting microRNA activity from gene expression data

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-05-18

    Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  12. Detecting microRNA activity from gene expression data.

    LENUS (Irish Health Repository)

    Madden, Stephen F

    2010-01-01

    BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

  13. Rapid detection and identification of viral and bacterial fish pathogens using a DNA array‐based multiplex assay

    DEFF Research Database (Denmark)

    Lievens, B.; Frans, I.; Heusdens, C.

    2011-01-01

    for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...

  14. Dual Enlargement of Gold Nanoparticles: From Mechanism to Scanometric Detection of Pathogenic Bacteria

    DEFF Research Database (Denmark)

    Cao, Cuong; Gontard, Lionel Cervera; Le Ly, Tram Thuy

    2011-01-01

    the electron density of the nanostructures, leading to a stronger intensity for colorimetric discrimination as well as better sensitivity for quantitative measurement. Based on this, a simple scanometric assay for the on‐slide detection of the food‐born pathogen Campylobacter jejuni is developed. After...... capturing the target bacteria, gold‐tagged immunoprobes are added to create a signal on a solid substrate. The signal is then amplified by the dual enlargement process, resulting in a strong color intensity that can easily be recognized by the unaided eye, or measured by an inexpensive flatbed scanner...

  15. An RNA-Seq strategy to detect the complete coding and non-coding transcriptome including full-length imprinted macro ncRNAs.

    Directory of Open Access Journals (Sweden)

    Ru Huang

    Full Text Available Imprinted macro non-protein-coding (nc RNAs are cis-repressor transcripts that silence multiple genes in at least three imprinted gene clusters in the mouse genome. Similar macro or long ncRNAs are abundant in the mammalian genome. Here we present the full coding and non-coding transcriptome of two mouse tissues: differentiated ES cells and fetal head using an optimized RNA-Seq strategy. The data produced is highly reproducible in different sequencing locations and is able to detect the full length of imprinted macro ncRNAs such as Airn and Kcnq1ot1, whose length ranges between 80-118 kb. Transcripts show a more uniform read coverage when RNA is fragmented with RNA hydrolysis compared with cDNA fragmentation by shearing. Irrespective of the fragmentation method, all coding and non-coding transcripts longer than 8 kb show a gradual loss of sequencing tags towards the 3' end. Comparisons to published RNA-Seq datasets show that the strategy presented here is more efficient in detecting known functional imprinted macro ncRNAs and also indicate that standardization of RNA preparation protocols would increase the comparability of the transcriptome between different RNA-Seq datasets.

  16. Effects of Different Animal Waste Treatment Technologies on Detection and Viability of Porcine Enteric Viruses▿

    Science.gov (United States)

    Costantini, Verónica P.; Azevedo, Ana C.; Li, Xin; Williams, Mike C.; Michel, Frederick C.; Saif, Linda J.

    2007-01-01

    Enteric pathogens in animal waste that is not properly processed can contaminate the environment and food. The persistence of pathogens in animal waste depends upon the waste treatment technology, but little is known about persistence of porcine viruses. Our objectives were to characterize the porcine enteric viruses (porcine noroviruses [PoNoVs], porcine sapoviruses [PoSaVs], rotavirus A [RV-A], RV-B, and RV-C) in fresh feces or manure and to evaluate the effects of different candidate environmentally superior technologies (ESTs) for animal waste treatment on the detection of these viruses. Untreated manure and samples collected at different stages during and after treatment were obtained from swine farms that used conventional waste management (CWM) and five different candidate ESTs. The RNA from porcine enteric viruses was detected by reverse transcription-PCR and/or seminested PCR; PoSaV and RV-A were also detected by enzyme-linked immunosorbent assay. Cell culture immunofluorescence (CCIF) and experimental inoculation of gnotobiotic (Gn) pigs were used to determine RV-A/C infectivity in posttreatment samples. The PoSaV and RV-A were detected in pretreatment samples from each farm, whereas PoNoV and RV-C were detected in pretreatment feces from three of five and four of five farms using the candidate ESTs, respectively. After treatment, PoSaV RNA was detected only in the samples from the farm using CWM and not from the farms using the candidate ESTs. RV-A and RV-C RNAs were detected in four of five and three of four candidate ESTs, respectively, after treatment, but infectious particles were not detected by CCIF, nor were clinical signs or seroconversion detected in inoculated Gn pigs. These results indicate that only RV-A/C RNA, but no viral infectivity, was detected after treatment. Our findings address a public health concern regarding environmental quality surrounding swine production units. PMID:17601821

  17. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    Science.gov (United States)

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  18. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  19. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  20. Nanomechanical microcantilever operated in vibration modes with use of RNA aptamer as receptor molecules for label-free detection of HCV helicase.

    Science.gov (United States)

    Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song

    2007-11-30

    We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.