A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.
Álvarez-Martos, Isabel; Ferapontova, Elena E
2017-08-05
A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.
Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition
Directory of Open Access Journals (Sweden)
Alexey Berezhnoy
2012-01-01
Full Text Available Oligonucleotide aptamer-mediated in vivo cell targeting of small interfering RNAs (siRNAs is emerging as a useful approach to enhance the efficacy and reduce the adverse effects resulting from siRNA-mediated genetic interference. A current main impediment in aptamer-mediated siRNA targeting is that the activity of the siRNA is often compromised when conjugated to an aptamer, often requiring labor intensive and time consuming design and testing of multiple configurations to identify a conjugate in which the siRNA activity has not been significantly reduced. Here, we show that the thermal stability of the siRNA is an important parameter of siRNA activity in its conjugated form, and that siRNAs with lower melting temperature (Tm are not or are minimally affected when conjugated to the 3′ end of 2′F-pyrimidine-modified aptamers. In addition, the configuration of the aptamer-siRNA conjugate retains activity comparable with the free siRNA duplex when the passenger strand is co-transcribed with the aptamer and 3′ overhangs on the passenger strand are removed. The approach described in this paper significantly reduces the time and effort necessary to screening siRNA sequences that retain biological activity upon aptamer conjugation, facilitating the process of identifying candidate aptamer-siRNA conjugates suitable for in vivo testing.
Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.
Jiang, F; Kumar, R A; Jones, R A; Patel, D J
1996-07-11
The catalytic properties of RNA and its well known role in gene expression and regulation are the consequence of its unique solution structures. Identification of the structural determinants of ligand recognition by RNA molecules is of fundamental importance for understanding the biological functions of RNA, as well as for the rational design of RNA Sequences with specific catalytic activities. Towards this latter end, Szostak et al. used in vitro selection techniques to isolate RNA sequences ('aptamers') containing a high-affinity binding site for ATP, the universal currency of cellular energy, and then used this motif to engineer ribozymes with polynucleotide kinase activity. Here we present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically 13C-, 15N-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The aptamer adopts an L-shaped structure with two nearly orthogonal stems, each capped proximally by a G x G mismatch pair, binding the AMP ligand at their junction in a GNRA-like motif.
Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data
Directory of Open Access Journals (Sweden)
William H Thiel
2016-01-01
Full Text Available Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment. High-throughput sequencing (HTS revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.
Computational Selection of RNA Aptamer against Angiopoietin-2 and Experimental Evaluation
Directory of Open Access Journals (Sweden)
Wen-Pin Hu
2015-01-01
Full Text Available Angiogenesis plays a decisive role in the growth and spread of cancer and angiopoietin-2 (Ang2 is in the spotlight of studies for its unique role in modulating angiogenesis. The aim of this study was to introduce a computational simulation approach to screen aptamers with high binding ability for Ang2. We carried out computational simulations of aptamer-protein interactions by using ZDOCK and ZRANK functions in Discovery Studio 3.5 starting from the available information of aptamers generated through the systematic evolution of ligands by exponential enrichment (SELEX in the literature. From the best of three aptamers on the basis of ZRANK scores, 189 sequences with two-point mutations were created and simulated with Ang2. Then, we used a surface plasmon resonance (SPR biosensor to test 3 mutant sequences of high ZRANK scores along with a high and a low affinity binding sequence as reported in the literature. We found a selected RNA aptamer has a higher binding affinity and SPR response than a reported sequence with the highest affinity. This is the first study of in silico selection of aptamers against Ang2 by using the ZRANK scoring function, which should help to increase the efficiency of selecting aptamers with high target-binding ability.
Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.
Park, Yoojin; Nim-Anussornkul, Duangrat; Vilaivan, Tirayut; Morii, Takashi; Kim, Byeang Hyean
2018-01-15
We have developed RNA-based quencher-free molecular aptamer beacons (RNA-based QF-MABs) for the detection of ATP, taking advantage of the conformational changes associated with ATP binding to the ATP-binding RNA aptamer. The RNA aptamer, with its well-defined structure, was readily converted to the fluorescence sensors by incorporating a fluorophore into the loop region of the hairpin structure. These RNA-based QF-MABs exhibited fluorescence signals in the presence of ATP relative to their low background signals in the absence of ATP. The fluorescence emission intensity increased upon formation of a RNA-based QF-MAB·ATP complex. Copyright © 2017 Elsevier Ltd. All rights reserved.
Structure and Sequence Search on Aptamer-Protein Docking
Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie
2015-03-01
Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.
International Nuclear Information System (INIS)
Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H
2012-01-01
We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.
Rapid detection of food pathogens using RNA aptamers-immobilized slide.
Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin
2012-07-01
The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.
Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E
2014-06-10
Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.
Directory of Open Access Journals (Sweden)
Airi Furukawa
2016-11-01
Full Text Available Group I self-splicing intron constitutes an important class of functional RNA molecules that can promote chemical transformation. Although the fundamental mechanism of the auto-excision from its precursor RNA has been established, convenient assay systems for its splicing activity are still useful for a further understanding of its detailed mechanism and of its application. Because some host RNA sequences, to which group I introns inserted form stable three-dimensional (3D structures, the effects of the 3D structures of exonic elements on the splicing efficiency of group I introns are important but not a fully investigated issue. We developed an assay system for group I intron self-splicing by employing a fluorescent aptamer RNA (spinach RNA as a model exonic sequence inserted by the Tetrahymena group I intron. We investigated self-splicing of the intron from spinach RNA, serving as a model exonic sequence with a 3D structure.
An improved radiolabelled RNA aptamer molecule for HER2 imaging in cancers.
Varmira, Kambiz; Hosseinimehr, Seyed Jalal; Noaparast, Zohreh; Abedi, Seyed Mohammad
2014-02-01
Human epidermal growth factor receptor 2 (HER2) expression has been shown to be increased in several types of human tumours. In this study, for the imaging of HER2-related tumours, a modified RNA aptamer with HER2-specific targeting was labelled with (99m)Tc, by using hydrazino nicotinamide (HYNIC) as the chelator in the presence of tricine or ethylenediamine-N,N'-diacetic acid (EDDA) as the co-ligand. Stability testing of the radiolabelled aptamers in the serum was performed through SDS-PAGE. The aptamer-radionuclide conjugate was evaluated for its cellular HER2-specific binding in ovarian cancer cells (SKOV-3), and its biodistribution properties were assessed in normal and SKOV-3 tumour-bearing mice. In the presence of either tricine or EDDA, the HYNIC-RNA aptamers were labelled with (99m)Tc at a high yield and radiochemical purity. Cellular experiments confirmed the specific binding of the RNA aptamer to the HER2 receptor. In the animal biodistribution study, uptake of the EDDA-co-liganded (99m)Tc-HYNIC-RNA aptamer by the liver and spleen was remarkably lower than that of the aptamer with tricine. Tumours also showed a higher accumulation of radioactivity with the EDDA-co-liganded aptamer complex. This study demonstrated EDDA to be better than tricine for use as a co-ligand with the RNA aptamer, which can be a potential tool for the molecular imaging of HER2-overexpressing cancers.
Nomura, Yusuke; Tanaka, Yoichiro; Fukunaga, Jun-ichi; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi
2013-12-01
AML1/RUNX1 is an essential transcription factor involved in the differentiation of hematopoietic cells. AML1 binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. In a previous study, we obtained RNA aptamers against the AML1 Runt domain by systematic evolution of ligands by exponential enrichment and revealed that RNA aptamers exhibit higher affinity for the Runt domain than that for RDE and possess the 5'-GCGMGNN-3' and 5'-N'N'CCAC-3' conserved motif (M: A or C; N and N' form Watson-Crick base pairs) that is important for Runt domain binding. In this study, to understand the structural basis of recognition of the Runt domain by the aptamer motif, the solution structure of a 22-mer RNA was determined using nuclear magnetic resonance. The motif contains the AH(+)-C mismatch and base triple and adopts an unusual backbone structure. Structural analysis of the aptamer motif indicated that the aptamer binds to the Runt domain by mimicking the RDE sequence and structure. Our data should enhance the understanding of the structural basis of DNA mimicry by RNA molecules.
Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein
Energy Technology Data Exchange (ETDEWEB)
Lee, Young Ju [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of); Lee, Seong-Wook, E-mail: SWL0208@dankook.ac.kr [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of)
2012-01-06
Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.
Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein
International Nuclear Information System (INIS)
Lee, Young Ju; Lee, Seong-Wook
2012-01-01
Highlights: ► Identification of RNA aptamer specific to AFP with high affinity. ► Specific induction of HCC proliferation by AFP. ► Efficient increase in oncogene expression by AFP. ► Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. ► Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K D of ∼33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.
In vitro selection of RNA aptamer specific to Salmonella typhimurium.
Han, Seung Ryul; Lee, Seong-Wook
2013-06-28
Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.
Massively Parallel Interrogation of Aptamer Sequence, Structure and Function
Energy Technology Data Exchange (ETDEWEB)
Fischer, N O; Tok, J B; Tarasow, T M
2008-02-08
Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.
Massively parallel interrogation of aptamer sequence, structure and function.
Directory of Open Access Journals (Sweden)
Nicholas O Fischer
Full Text Available BACKGROUND: Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. METHODOLOGY/PRINCIPAL FINDINGS: High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and inter-chip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. CONCLUSION AND SIGNIFICANCE: The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.
Friedman, Adam D; Kim, Dongwook; Liu, Rihe
2015-01-01
When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2' modification. This study aims to develop a novel class of highly stable, 2'-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2'-F-dG, 2'-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2'-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and specifically deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials.
Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1
Zhou, Jiehua; Lazar, Daniel; Li, Haitang; Xia, Xin; Satheesan, Sangeetha; Charlins, Paige; O'Mealy, Denis; Akkina, Ramesh; Saayman, Sheena; Weinberg, Marc S.; Rossi, John J.; Morris, Kevin V.
2018-01-01
Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. Methods: We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. Results: We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates in vivo, HIV-1-infected humanized NOD/SCID/IL2 rγnull mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Principle conclusions: Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1. PMID:29556342
A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules
DEFF Research Database (Denmark)
Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.
2018-01-01
-SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...
Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers
Directory of Open Access Journals (Sweden)
Iwao Waga
2010-08-01
Full Text Available Sphingosylphosphorylcholine (SPC is a lysosphingolipid that exerts multiple functions, including acting as a spasmogen, as a mitogenic factor for various types of cells, and sometimes as an inflammatory mediator. Currently, liquid chromatography/tandem mass spectrometry (LC/MS/MS is used for the quantitation of SPC. However, because of the complicated procedures required it may not be cost effective, hampering its regular usage in a routine practical SPC monitoring. In this report, we have generated RNA aptamers that bind to SPC with high affinity using an in vitro selection procedure and developed an enzyme-linked aptamer assay system using the minimized SPC aptamer that can successfully distinguish SPC from the structurally related sphingosine 1-phosphate (S1P. This is the first case of the Systematic Evolution of Ligands by EXponential enrichment (SELEX process being performed with a lysosphingolipid. The SPC aptamers would be valuable tools for the development of aptamer-based medical diagnosis and for elucidating the biological role of SPC.
Regulation of photosensitisation processes by an RNA aptamer
Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori
2017-02-01
One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.
Highly Stable Aptamers Selected from a 2′-Fully Modified fGmH RNA Library for Targeting Biomaterials
Friedman, Adam D.; Kim, Dongwook; Liu, Rihe
2014-01-01
When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2′ modification. This study aims to develop a novel class of highly stable, 2′-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2′-F-dG, 2′-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2′-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and further deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials. PMID:25443790
Mallik, Prabhat K; Shi, Hua; Pande, Jayanti
2017-09-16
The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.
Ping, Juan; Shen, Zhi-Hui; Wang, Bao-Quan; Zhao, Na; Li, Rui; Li, Mian; Pang, Xiao-Bin; Chen, Chuan-Bo
2015-04-01
To explore the effects of aptamer-siRNA nucleic acid compound on growth and apoptosis in myeloid leukemia cell line K562. the changes of cellular morphology and structure were observed by using fluorescence microscope, laser confocal microscope, JEM-4000EX transmission electron microscopy; MTT assay were performed to evaluate the sensibility of K562 cells to aptamer-siRNA compound, the apoptosis was detected by DNA gel electro-phoresis. The remarkably changes of morphology and structure of K562 cells treated with 200 µmol/L aptamer-siRNA were observed under fluorescence microscopy and electromicroscopy. As compared with control, the aptamer-siRNA compound showed more inhibitory effect on K562 cells and there was significant difference (Pcompound for K562 cells was 150 µmol/L. According to agarose gel electrophoresis observation, when the aptamer-siRNA compound showed effect on K562 cells, the typical DNA lader could be observed. The aptamer-siRNA compound can significantly induce K562 cell apoptosis, and provide reference for gene therapy of patients with chronic myelocytic lenkemia.
RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine
DEFF Research Database (Denmark)
Farjami, Elahe; Campos, Rui; Nielsen, Jesper Sejrup
2013-01-01
, including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine......, norepinephrine, 3,4-dihydroxy-phenylalanine (l-DOPA), 3,4-dihydroxyphenylacetic acid (DOPAC), methyldopamine, and tyramine, which gave negligible signals under conditions of experiments (electroanalysis at 0.185 V vs Ag/AgCl). The interference from ascorbic and uric acids was eliminated by application...... as a general strategy not to restrict the conformational freedom and binding properties of surface-bound aptamers and, thus, be applicable for the development of other aptasensors...
Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.
Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E
2013-04-01
Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites.
Directory of Open Access Journals (Sweden)
Daniel M Dupont
Full Text Available Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126 with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA. We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A controlling uPA activities. One of the aptamers (upanap-126 binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12 binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site.
Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.
Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong
2016-07-11
Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi
2008-01-01
An RNA aptamer in complex with the human IgG Fc fragment have been crystallized. The stirring technique with a rotary shaker was used to improve the crystals and to ensure that they were of high quality and single, resulting in crystals that diffracted to 2.2 Å resolution. Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution
Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells.
Autour, Alexis; C Y Jeng, Sunny; D Cawte, Adam; Abdolahzadeh, Amir; Galli, Angela; Panchapakesan, Shanker S S; Rueda, David; Ryckelynck, Michael; Unrau, Peter J
2018-02-13
Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.
CSIR Research Space (South Africa)
London, GM
2015-01-01
Full Text Available Aptamers, which are artificial nucleic acid ligands akin to antibodies in function, represent a new class of molecules that can prevent HIV infection. In this study, we isolated RNA aptamers against whole HV-1CAP45 enveloped pseudotyped virus...
Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX
Directory of Open Access Journals (Sweden)
Seyedeh Alia Moosavian
2015-06-01
Full Text Available Objective(s: Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2 is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX. Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy.
Directory of Open Access Journals (Sweden)
Hui Feng
Full Text Available BACKGROUND: The specific interaction between hepatitis B virus (HBV polymerase (P protein and the ε RNA stem-loop on pregenomic (pg RNA is crucial for viral replication. It triggers both pgRNA packaging and reverse transcription and thus represents an attractive antiviral target. RNA decoys mimicking ε in P protein binding but not supporting replication might represent novel HBV inhibitors. However, because generation of recombinant enzymatically active HBV polymerase is notoriously difficult, such decoys have as yet not been identified. METHODOLOGY/PRINCIPAL FINDINGS: Here we used a SELEX approach, based on a new in vitro reconstitution system exploiting a recombinant truncated HBV P protein (miniP, to identify potential ε decoys in two large ε RNA pools with randomized upper stem. Selection of strongly P protein binding RNAs correlated with an unexpected strong enrichment of A residues. Two aptamers, S6 and S9, displayed particularly high affinity and specificity for miniP in vitro, yet did not support viral replication when part of a complete HBV genome. Introducing S9 RNA into transiently HBV producing HepG2 cells strongly suppressed pgRNA packaging and DNA synthesis, indicating the S9 RNA can indeed act as an ε decoy that competitively inhibits P protein binding to the authentic ε signal on pgRNA. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the first successful identification of human HBV ε aptamers by an in vitro SELEX approach. Effective suppression of HBV replication by the S9 aptamer provides proof-of-principle for the ability of ε decoy RNAs to interfere with viral P-ε complex formation and suggests that S9-like RNAs may further be developed into useful therapeutics against chronic hepatitis B.
Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.
Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio
2018-05-03
RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.
In vivo SELEX for Identification of Brain-penetrating Aptamers
Directory of Open Access Journals (Sweden)
Congsheng Cheng
2013-01-01
Full Text Available The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain.
Directory of Open Access Journals (Sweden)
Lasse H Lauridsen
Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.
In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis
Energy Technology Data Exchange (ETDEWEB)
Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R., E-mail: crisrcorrea@gmail.com, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de Ciencias Biologicas. Dept. de Imunologia e Bioquimica
2013-07-01
Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were {sup 32}P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)
In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis
International Nuclear Information System (INIS)
Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R.; Goes, A.M.
2013-01-01
Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were 32 P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)
Assignment methodology for larger RNA oligonucleotides: Application to an ATP-binding RNA aptamer
International Nuclear Information System (INIS)
Dieckmann, Thorsten; Feigon, Juli
1997-01-01
The use of uniform 13C, 15N labeling in the NMR spectroscopic study of RNA structures has greatly facilitated the assignment process in small RNA oligonucleotides. For ribose spinsystem assignments, exploitation of these labels has followed previously developed methods for the study of proteins. However, for sequential assignment of the exchangeable and nonexchangeable protons of the nucleotides, it has been necessary to develop a variety of new NMR experiments. Even these are of limited utility in the unambiguous assignment of larger RNAs due to the short carbon relaxation times and extensive spectral overlap for all nuclei.These problems can largely be overcome by the additional use of base-type selectively 13C, 15N-labeled RNA in combination with a judicious use of related RNAs with base substitutions. We report the application of this approach to a 36-nucleotide ATP-binding RNA aptamer in complex with AMP. Complete sequential 1H assignments, as well as the majority of 13C and 15N assignments, were obtained
Directory of Open Access Journals (Sweden)
Regina Stoltenburg
2018-02-01
Full Text Available New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus. In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of KD = 20 ± 1 nM.
Stoltenburg, Regina; Strehlitz, Beate
2018-02-24
New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus . In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of K D = 20 ± 1 nM.
Energy Technology Data Exchange (ETDEWEB)
Chavez, Jorge L. [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States); MacCuspie, Robert I. [National Institute of Standards and Technology, Ceramics Division (United States); Stone, Morley O.; Kelley-Loughnane, Nancy, E-mail: Nancy.Kelley-Loughnane@wpafb.af.mil [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States)
2012-10-15
A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA-AuNP conjugates (RBA-AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA-AuNPs' stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5 Prime end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA-AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA-AuNPs' stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer-AuNPs conjugates and their sensing response.
Loo, Jacky Fong-Chuen; Yang, Chengbin; Tsang, Hing Lun; Lau, Pui Man; Yong, Ken-Tye; Ho, Ho Pui; Kong, Siu Kai
2017-10-07
With modifications to an ultra-sensitive bio-barcode (BBC) assay, we have developed a next generation aptamer-based bio-barcode (ABC) assay to detect cytochrome-c (Cyto-c), a cell death marker released from cancer cells, for anti-cancer drug screening. An aptamer is a short single-stranded DNA selected from a synthetic DNA library that is capable of binding to its target with high affinity and specificity based on its unique DNA sequence and 3D structure after folding. Similar to the BBC assay, Cyto-c is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Ab) and an aptamer specifically against Cyto-c to form sandwich structures ([MMP-Ab]-[Cyto-c]-[Aptamer]). After washing and melting, our aptamers, acting as a DNA bio-barcode, are released from the sandwiches and hybridized with the probes specially designed for RNase H for surface plasmon resonance (SPR) sensing. In an aptamer-probe duplex, RNase H digests the RNA in the probe and releases the intact aptamer for another round of hybridization and digestion. With signal enhancement effects from gold-nanorods (Au-NRs) on probes for SPR sensing, the detection limit was found to be 1 nM for the aptamer and 80 pM for Cyto-c. Without the time-consuming DNA amplification steps by PCR, the detection process of this new ABC assay can be completed within three hours. As a proof-of-concept, phenylarsine oxide was found to be a potent agent to kill liver cancer cells with multi-drug resistance at the nano-molar level. This approach thus provides a fast, sensitive and robust tool for anti-cancer drug screening.
RNA aptamer probes as optical imaging agents for the detection of amyloid plaques.
Directory of Open Access Journals (Sweden)
Christian T Farrar
Full Text Available Optical imaging using multiphoton microscopy and whole body near infrared imaging has become a routine part of biomedical research. However, optical imaging methods rely on the availability of either small molecule reporters or genetically encoded fluorescent proteins, which are challenging and time consuming to develop. While directly labeled antibodies can also be used as imaging agents, antibodies are species specific, can typically not be tagged with multiple fluorescent reporters without interfering with target binding, and are bioactive, almost always eliciting a biological response and thereby influencing the process that is being studied. We examined the possibility of developing highly specific and sensitive optical imaging agents using aptamer technology. We developed a fluorescently tagged anti-Aβ RNA aptamer, β55, which binds amyloid plaques in both ex vivo human Alzheimer's disease brain tissue and in vivo APP/PS1 transgenic mice. Diffuse β55 positive halos, attributed to oligomeric Aβ, were observed surrounding the methoxy-XO4 positive plaque cores. Dot blots of synthetic Aβ aggregates provide further evidence that β55 binds both fibrillar and non-fibrillar Aβ. The high binding affinity, the ease of probe development, and the ability to incorporate multiple and multimodal imaging reporters suggest that RNA aptamers may have complementary and perhaps advantageous properties compared to conventional optical imaging probes and reporters.
Construction of a Bivalent Thrombin Binding Aptamer and Its Antidote with Improved Properties
Directory of Open Access Journals (Sweden)
Quintin W. Hughes
2017-10-01
Full Text Available Aptamers are short synthetic DNA or RNA oligonucleotides that adopt secondary and tertiary conformations based on Watson–Crick base-pairing interactions and can be used to target a range of different molecules. Two aptamers, HD1 and HD22, that bind to exosites I and II of the human thrombin molecule, respectively, have been extensively studied due to their anticoagulant potentials. However, a fundamental issue preventing the clinical translation of many aptamers is degradation by nucleases and reduced pharmacokinetic properties requiring higher dosing regimens more often. In this study, we have chemically modified the design of previously described thrombin binding aptamers targeting exosites I, HD1, and exosite II, HD22. The individual aptamers were first modified with an inverted deoxythymidine nucleotide, and then constructed bivalent aptamers by connecting the HD1 and HD22 aptamers either through a triethylene glycol (TEG linkage or four consecutive deoxythymidines together with an inverted deoxythymidine nucleotide at the 3′-end. The anticoagulation potential, the reversal of coagulation with different antidote sequences, and the nuclease stability of the aptamers were then investigated. The results showed that a bivalent aptamer RNV220 containing an inverted deoxythymidine and a TEG linkage chemistry significantly enhanced the anticoagulation properties in blood plasma and nuclease stability compared to the existing aptamer designs. Furthermore, a bivalent antidote sequence RNV220AD efficiently reversed the anticoagulation effect of RNV220 in blood plasma. Based on our results, we believe that RNV220 could be developed as a potential anticoagulant therapeutic molecule.
Regina Stoltenburg; Beate Strehlitz
2018-01-01
New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aur...
A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery
Directory of Open Access Journals (Sweden)
John C. Leach
2016-03-01
Full Text Available The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA, was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells.
Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao
2017-07-01
We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11 M to 9.0 × 10 -10 M, and as low as 1.0 × 10 -11 M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8 M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.
Wheeler, Lee Adam; Trifonova, Radiana; Vrbanac, Vladimir; Basar, Emre; McKernan, Shannon; Xu, Zhan; Seung, Edward; Deruaz, Maud; Dudek, Tim; Einarsson, Jon Ivar; Yang, Linda; Allen, Todd M.; Luster, Andrew D.; Tager, Andrew M.; Dykxhoorn, Derek M.; Lieberman, Judy
2011-01-01
The continued spread of the HIV epidemic underscores the need to interrupt transmission. One attractive strategy is a topical vaginal microbicide. Sexual transmission of herpes simplex virus type 2 (HSV-2) in mice can be inhibited by intravaginal siRNA application. To overcome the challenges of knocking down gene expression in immune cells susceptible to HIV infection, we used chimeric RNAs composed of an aptamer fused to an siRNA for targeted gene knockdown in cells bearing an aptamer-binding receptor. Here, we showed that CD4 aptamer-siRNA chimeras (CD4-AsiCs) specifically suppress gene expression in CD4+ T cells and macrophages in vitro, in polarized cervicovaginal tissue explants, and in the female genital tract of humanized mice. CD4-AsiCs do not activate lymphocytes or stimulate innate immunity. CD4-AsiCs that knock down HIV genes and/or CCR5 inhibited HIV infection in vitro and in tissue explants. When applied intravaginally to humanized mice, CD4-AsiCs protected against HIV vaginal transmission. Thus, CD4-AsiCs could be used as the active ingredient of a microbicide to prevent HIV sexual transmission. PMID:21576818
STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma
Directory of Open Access Journals (Sweden)
Carla Lucia Esposito
2018-03-01
Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.
Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song
2007-11-30
We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.
Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko
2013-07-01
AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.
Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Cai, Shuowei
2016-09-01
Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive-based systematic evolution of ligands by exponential enrichment (SELEX) process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nanomolar range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting that they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that the 2'-fluorine-pyrimidine-modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for SELEX, by using regular nucleotide during SELEX, and 2'-fluorine-pyrimidine-modified nucleotide for final application to enhance their RNase-resistance.
Computer-Aided Design of RNA Origami Structures.
Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S
2017-01-01
RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.
International Nuclear Information System (INIS)
Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.
2006-01-01
Locked nucleic acid (LNA) nucleotides are RNA analogues with a useful additional conformational constraint; the current investigation will provide the first crystallographic view of an all-LNA duplex. The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°
Using Aptamers for Cancer Biomarker Discovery
Directory of Open Access Journals (Sweden)
Yun Min Chang
2013-01-01
Full Text Available Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment SELEX and cell-based SELEX (cell-SELEX. Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics.
Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy
Directory of Open Access Journals (Sweden)
Hongguang Sun
2014-01-01
Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.
DNA-Aptamers Binding Aminoglycoside Antibiotics
Directory of Open Access Journals (Sweden)
Nadia Nikolaus
2014-02-01
Full Text Available Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.
An RNA aptamer specific to Hsp70-ATP conformation inhibits its ATPase activity independent of Hsp40.
Thirunavukarasu, Deepak; Shi, Hua
2015-04-01
The highly conserved and ubiquitous molecular chaperone heat shock protein 70 (Hsp70) plays a critical role in protein homeostasis (proteostasis). Controlled by its ATPase activity, Hsp70 cycles between two conformations, Hsp70-ATP and Hsp70-ADP, to bind and release its substrate. Chemical tools with distinct modes of action, especially those capable of modulating the ATPase activity of Hsp70, are being actively sought after in the mechanistic dissection of this system. Here, we report a conformation-specific RNA aptamer that binds only to Hsp70-ATP but not to Hsp70-ADP. We have refined this aptamer and demonstrated its inhibitory effect on Hsp70's ATPase activity. We have also shown that this inhibitory effect on Hsp70 is independent of its interaction with the Hsp40 co-chaperone. As Hsp70 is increasingly being recognized as a drug target in a number of age related diseases such as neurodegenerative, protein misfolding diseases and cancer, this aptamer is potentially useful in therapeutic applications. Moreover, this work also demonstrates the feasibility of using aptamers to target ATPase activity as a general therapeutic strategy.
Thermodynamics of Ligand Binding to a Heterogeneous RNA Population in the Malachite Green Aptamer
Sokoloski, Joshua E.; Dombrowski, Sarah E.; Bevilacqua, Philip C.
2011-01-01
The malachite green aptamer binds two closely related ligands, malachite green (MG) and tetramethylrosamine (TMR), with near equal affinity. The MG ligand consists of three phenyl rings emanating from a central carbon, while TMR has two of the three rings connected by an ether linkage. The binding pockets for MG and TMR in the aptamer, known from high-resolution structure, differ only in the conformation of a few nucleotides. Herein, we applied isothermal titration calorimetry (ITC) to compare the thermodynamics for binding of MG and TMR to the aptamer. Binding heat capacities were obtained from ITC titrations over the temperature range of 15 to 60 °C. Two temperature regimes were found for MG binding: one from 15 to 45 °C where MG bound with a large negative heat capacity and an apparent stoichiometry (n) of ~0.4, and another from 50 to 60 °C where MG bound with positive heat capacity and n~1.1. The binding of TMR, on the other hand, revealed only one temperature regime for binding, with a more modest negative heat capacity and n~1.2. The large difference in heat capacity between the two ligands suggests that significantly more conformational rearrangement occurs upon the binding of MG than TMR, which is consistent with differences in solvent accessible surface area calculated for available ligand-bound structures. Lastly, we note that binding stoichiometry of MG was improved not only by raising the temperature, but also by lowering the concentration of Mg2+ or increasing the time between ITC injections. These studies suggest that binding of a dynamical ligand to a functional RNA requires the RNA itself to have significant dynamics. PMID:22192051
Labeling RNAs in Live Cells Using Malachite Green Aptamer Scaffolds as Fluorescent Probes.
Yerramilli, V Siddartha; Kim, Kyung Hyuk
2018-03-16
RNAs mediate many different processes that are central to cellular function. The ability to quantify or image RNAs in live cells is very useful in elucidating such functions of RNA. RNA aptamer-fluorogen systems have been increasingly used in labeling RNAs in live cells. Here, we use the malachite green aptamer (MGA), an RNA aptamer that can specifically bind to malachite green (MG) dye and induces it to emit far-red fluorescence signals. Previous studies on MGA showed a potential for the use of MGA for genetically tagging other RNA molecules in live cells. However, these studies also exhibited low fluorescence signals and high background noise. Here we constructed and tested RNA scaffolds containing multiple tandem repeats of MGA as a strategy to increase the brightness of the MGA aptamer-fluorogen system as well as to make the system fluoresce when tagging various RNA molecules, in live cells. We demonstrate that our MGA scaffolds can induce fluorescence signals by up to ∼20-fold compared to the basal level as a genetic tag for other RNA molecules. We also show that our scaffolds function reliably as genetically encoded fluorescent tags for mRNAs of fluorescent proteins and other RNA aptamers.
A Universal Aptamer Chimera for the Delivery of Functional microRNA-126.
Rohde, Jan-H; Weigand, Julia E; Suess, Beatrix; Dimmeler, Stefanie
2015-06-01
microRNAs (miRs) regulate vascular diseases such as atherosclerosis and cancer. miR-126 is important for endothelial cell signaling and promotes angiogenesis, protects against atherosclerosis, and reduces breast cancer cell growth and metastasis. The overexpression of miR-126, therefore, may be an attractive therapeutic strategy for the treatment of cardiovascular disease or cancer. Here we report a novel strategy to deliver miR-126 to endothelial and breast cancer cells. We tested three different strategies to deliver miR-126 by linking the miR to an aptamer for the ubiquitously expressed transferrin receptor (transferrin receptor aptamer, TRA). Linking the precursor of miR-126 (pre-miR-126) to the TRA by annealing of a complementary stick led to efficient uptake and processing of miR-126, resulting in the delivery of 1.6×10(6)±0.3×10(6) copies miR-126-3p per ng RNA in human endothelial cells and 7.4×10(5)±2×10(5) copies miR-126-3p per ng in MCF7 breast cancer cells. The functionality of the active TRA-miR-126 chimera was further demonstrated by showing that the chimera represses the known miR-126 target VCAM-1 and improved endothelial cell sprouting in a spheroid assay. Moreover, the TRA-miR-126 chimera reduced proliferation and paracrine endothelial cell recruitment of breast cancer cells to a similar extent as miR-126-3p mimics introduced by conventional liposome-based transfection. Together, this data demonstrates that pre-miR-126 can be delivered by a non-specific aptamer to exert biological functions in two different cell models. The use of the TRA-miR-126 chimera or the combination of the delivery strategy with other endothelial or tumor specific aptamers may provide an interesting therapeutic option to treat vascular disease or cancers.
Directory of Open Access Journals (Sweden)
Christopher H Stuart
2016-01-01
Full Text Available Breast cancer (BC results in ≃40,000 deaths each year in the United States and even among survivors treatment of the disease may have devastating consequences, including increased risk for heart disease and cognitive impairment resulting from the toxic effects of chemotherapy. Aptamer-mediated drug delivery can contribute to improved treatment outcomes through the selective delivery of chemotherapy to BC cells, provided suitable cancer-specific antigens can be identified. We report here the use of capillary electrophoresis in conjunction with next generation sequencing to develop the first vitronectin (VN binding aptamer (VBA-01; Kd 405 nmol/l, the first aptamer to vitronectin (VN; Kd = 405 nmol/l, a protein that plays an important role in wound healing and that is present at elevated levels in BC tissue and in the blood of BC patients relative to the corresponding nonmalignant tissues. We used VBA-01 to develop DVBA-01, a dimeric aptamer complex, and conjugated doxorubicin (Dox to DVBA-01 (7:1 ratio using pH-sensitive, covalent linkages. Dox conjugation enhanced the thermal stability of the complex (60.2 versus 46.5°C and did not decrease affinity for the VN target. The resulting DVBA-01-Dox complex displayed increased cytotoxicity to MDA-MB-231 BC cells that were cultured on plasticware coated with VN (1.8 × 10−6mol/l relative to uncoated plates (2.4 × 10−6 mol/l, or plates coated with the related protein fibronectin (2.1 × 10−6 mol/l. The VBA-01 aptamer was evaluated for binding to human BC tissue using immunohistochemistry and displayed tissue specific binding and apparent association with BC cells. In contrast, a monoclonal antibody that preferentially binds to multimeric VN primarily stained extracellular matrix and vessel walls of BC tissue. Our results indicate a strong potential for using VN-targeting aptamers to improve drug delivery to treat BC.
Aptamer-Gated Nanoparticles for Smart Drug Delivery
Directory of Open Access Journals (Sweden)
Huseyin Avni Oktem
2011-08-01
Full Text Available Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.
Directory of Open Access Journals (Sweden)
Becka M Warfield
Full Text Available RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)
2014-10-31
Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.
International Nuclear Information System (INIS)
Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi
2014-01-01
Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy
Direct fluorescence anisotropy assay for cocaine using tetramethylrhodamine-labeled aptamer.
Liu, Yingxiong; Zhao, Qiang
2017-06-01
Development of simple, sensitive, and rapid method for cocaine detection is important in medicine and drug abuse monitoring. Taking advantage of fluorescence anisotropy and aptamer, this study reports a direct fluorescence anisotropy (FA) assay for cocaine by employing an aptamer probe with tetramethylrhodamine (TMR) labeled on a specific position. The binding of cocaine and the aptamer causes a structure change of the TMR-labeled aptamer, leading to changes of the interaction between labeled TMR and adjacent G bases in aptamer sequence, so FA of TMR varies with increasing of cocaine. After screening different labeling positions of the aptamer, including thymine (T) bases and terminals of the aptamer, we obtained a favorable aptamer probe with TMR labeled on the 25th base T in the sequence, which exhibited sensitive and significant FA-decreasing responses upon cocaine. Under optimized assay conditions, this TMR-labeled aptamer allowed for direct FA detection of cocaine as low as 5 μM. The maximum FA change reached about 0.086. This FA method also enabled the detection of cocaine spiked in diluted serum and urine samples, showing potential for applications. Graphical Abstract The binding of cocaine to the TMR-labeled aptamer causes conformation change and alteration of the intramolecular interaction between TMR and bases of aptamer, leading to variance of fluorescence anisotropy (FA) of TMR, so direct FA analyis of cocaine is achieved.
The use of oligonucleotide aptamers in cancer therapy
Directory of Open Access Journals (Sweden)
Adrian Odrzywolski
2016-05-01
Full Text Available Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers – particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug.
Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J
2018-01-09
Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Recent Advances in Aptamers Targeting Immune System.
Hu, Piao-Ping
2017-02-01
The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.
CELL-SELEX: Novel Perspectives of Aptamer-Based Therapeutics
Directory of Open Access Journals (Sweden)
Hans P. Wendel
2008-04-01
Full Text Available Aptamers, single stranded DNA or RNA molecules, generated by a method called SELEX (systematic evolution of ligands by exponential enrichment have been widely used in various biomedical applications. The newly developed Cell-SELEX (cell based-SELEX targeting whole living cells has raised great expectations for cancer biology, -therapy and regenerative medicine. Combining nanobiotechnology with aptamers, this technology opens the way to more sophisticated applications in molecular diagnosis. This paper gives a review of recent developments in SELEX technologies and new applications of aptamers.
antaRNA: ant colony-based RNA sequence design.
Kleinkauf, Robert; Mann, Martin; Backofen, Rolf
2015-10-01
RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
International Nuclear Information System (INIS)
Correa, C.R.; Andrade, A.S.R.; Augusto-Pinto, L.; Goes, A.M.
2011-01-01
Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da
Energy Technology Data Exchange (ETDEWEB)
Correa, C.R.; Andrade, A.S.R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Augusto-Pinto, L. [BioAptus, Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Departamento de Imunologia e Bioquimica. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais. Belo Horizonte, MG (Brazil)
2011-07-01
Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da
Selection of LNA-containing DNA aptamers against recombinant human CD73
DEFF Research Database (Denmark)
Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G
2015-01-01
tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences......LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX...... with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several...
Computational Methods for Modeling Aptamers and Designing Riboswitches
Directory of Open Access Journals (Sweden)
Sha Gong
2017-11-01
Full Text Available Riboswitches, which are located within certain noncoding RNA region perform functions as genetic “switches”, regulating when and where genes are expressed in response to certain ligands. Understanding the numerous functions of riboswitches requires computation models to predict structures and structural changes of the aptamer domains. Although aptamers often form a complex structure, computational approaches, such as RNAComposer and Rosetta, have already been applied to model the tertiary (three-dimensional (3D structure for several aptamers. As structural changes in aptamers must be achieved within the certain time window for effective regulation, kinetics is another key point for understanding aptamer function in riboswitch-mediated gene regulation. The coarse-grained self-organized polymer (SOP model using Langevin dynamics simulation has been successfully developed to investigate folding kinetics of aptamers, while their co-transcriptional folding kinetics can be modeled by the helix-based computational method and BarMap approach. Based on the known aptamers, the web server Riboswitch Calculator and other theoretical methods provide a new tool to design synthetic riboswitches. This review will represent an overview of these computational methods for modeling structure and kinetics of riboswitch aptamers and for designing riboswitches.
Aptamer and its applications in neurodegenerative diseases.
Qu, Jing; Yu, Shuqing; Zheng, Yuan; Zheng, Yan; Yang, Hui; Zhang, Jianliang
2017-02-01
Aptamers are small single-stranded DNA or RNA oligonucleotide fragments or small peptides, which can bind to targets by high affinity and specificity. Because aptamers are specific, non-immunogenic and non-toxic, they are ideal materials for clinical applications. Neurodegenerative disorders are ravaging the lives of patients. Even though the mechanism of these diseases is still elusive, they are mainly characterized by the accumulation of misfolded proteins in the central nervous system. So it is essential to develop potential measures to slow down or prevent the onset of these diseases. With the advancements of the technologies, aptamers have opened up new areas in this research field. Aptamers could bind with these related target proteins to interrupt their accumulation, subsequently blocking or preventing the process of neurodegenerative diseases. This review presents recent advances in the aptamer generation and its merits and limitations, with emphasis on its applications in neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, transmissible spongiform encephalopathy, Huntington's disease and multiple sclerosis.
Aptamer-based technology for food analysis.
Liu, Xiaofei; Zhang, Xuewu
2015-01-01
Aptamers are short and functional single-stranded oligonucleotide sequences selected from systematic evolution of ligands by exponential enrichment (SELEX) process, which have the capacity to recognize various classes of target molecules with high affinity and specificity. Various analytical aptamers acquired by SELEX are widely used in many research fields, such as medicine, biology, and chemistry. However, the application of this innovative and emerging technology to food safety is just in infant stage. Food safety plays a very important role in our daily lives because varieties of poisonous and harmful substances in food affect human health. Aptamer technique is promising, which can overcome many disadvantages of existing detection methods in food safety, such as long detection time, low sensitivity, difficult, and expensive antibody preparation. This review provides an overview of various aptamer screening technologies and summarizes the recent applications of aptamers in food safety, and future prospects are also discussed.
DNA aptamers against the Lup an 1 food allergen.
Directory of Open Access Journals (Sweden)
Pedro Nadal
Full Text Available Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX. Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs.
DEFF Research Database (Denmark)
Botkjaer, Kenneth A; Deryugina, Elena I; Dupont, Daniel Miotto
2012-01-01
, because the topology of the proteases' active sites are highly similar. In an effort to generate highly specific uPA inhibitors with new inhibitory modalities, we isolated uPA-binding RNA aptamers by screening a library of 35 nucleotides long 2'-fluoro-pyrimidine RNA molecules using a version of human pro......-uPA lacking the epidermal growth factor-like and kringle domains as bait. One pro-uPA-binding aptamer sequence, referred to as upanap-126, proved to be highly specific for human uPA. Upanap-126 delayed the proteolytic conversion of human pro-uPA to active uPA, but did not inhibit plasminogen activation...... catalyzed by two-chain uPA. The aptamer also inhibited the binding of pro-uPA to uPAR and the binding of vitronectin to the preformed pro-uPA/uPAR complex, both in cell-free systems and on cell surfaces. Furthermore, upanap-126 inhibited human tumor cell invasion in vitro in the Matrigel assay and in vivo...
DEFF Research Database (Denmark)
Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan
2012-01-01
Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...
International Nuclear Information System (INIS)
Liu Xianggang; Cheng Ziqiang; Fan Hai; Ai Shiyun; Han Ruixia
2011-01-01
Highlights: → A sensitive electrochemical biosensor for the detection of gene sequence was developed. → The biosensor was assembled by MWNT, polypyrrole nanowires and gold nanoparticles. → The hybrid nanomaterials could provide a porous structure with good properties. → The biosensor has highly selectivity and sensitivity. → The design strategy is expected to have extensive applications in other biosensors - Abstract: A sensitive electrochemical method for the detection of avian influenza virus (AIV) H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode was developed. To enhance the selectivity and sensitivity, the modified electrode was assembled with multi-wall carbon nanotubes (MWNT), polypyrrole nanowires (PPNWs) and gold nanoparticles (GNPs). This electrode offered a porous structure with a large effective surface area, highly electrocatalytic activities and electronic conductivity. Therefore, the amount of DNA aptamer immobilized onto the electrode was increased while the accessibility of the detection target was maintained. The biosensor is based on the hybridization and preferred orientation of a DNA aptamer immobilized onto a modified electrode surface with its target (H5N1 specific sequence) present in solution. It is selective for the H5N1 specific sequence, and the signal of the indicator was approximately linear to log(concentration) of the H5N1 specific sequence from 5.0 x 10 -12 to 1.0 x 10 -9 M (R = 0.9863) with a detection limit of 4.3 x 10 -13 M. These studies showed that the new hybrid nanomaterial (MWNT/PPNWs/GNPs) and the DNA aptamer could be used to fabricate an electrochemical biosensor for gene sequence detection. Furthermore, this design strategy is expected to have extensive applications in other biosensors.
Energy Technology Data Exchange (ETDEWEB)
Liu Xianggang [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Cheng Ziqiang, E-mail: czqsd@126.com [College of Animal Science and Technology, Shandong Agricultural University, Taian 271018, Shandong (China); Fan Hai [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Ai Shiyun, E-mail: ashy@sdau.edu.cn [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Han Ruixia [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China)
2011-07-15
Highlights: > A sensitive electrochemical biosensor for the detection of gene sequence was developed. > The biosensor was assembled by MWNT, polypyrrole nanowires and gold nanoparticles. > The hybrid nanomaterials could provide a porous structure with good properties. > The biosensor has highly selectivity and sensitivity. > The design strategy is expected to have extensive applications in other biosensors - Abstract: A sensitive electrochemical method for the detection of avian influenza virus (AIV) H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode was developed. To enhance the selectivity and sensitivity, the modified electrode was assembled with multi-wall carbon nanotubes (MWNT), polypyrrole nanowires (PPNWs) and gold nanoparticles (GNPs). This electrode offered a porous structure with a large effective surface area, highly electrocatalytic activities and electronic conductivity. Therefore, the amount of DNA aptamer immobilized onto the electrode was increased while the accessibility of the detection target was maintained. The biosensor is based on the hybridization and preferred orientation of a DNA aptamer immobilized onto a modified electrode surface with its target (H5N1 specific sequence) present in solution. It is selective for the H5N1 specific sequence, and the signal of the indicator was approximately linear to log(concentration) of the H5N1 specific sequence from 5.0 x 10{sup -12} to 1.0 x 10{sup -9} M (R = 0.9863) with a detection limit of 4.3 x 10{sup -13} M. These studies showed that the new hybrid nanomaterial (MWNT/PPNWs/GNPs) and the DNA aptamer could be used to fabricate an electrochemical biosensor for gene sequence detection. Furthermore, this design strategy is expected to have extensive applications in other biosensors.
Aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.
Reinemann, Christine; Strehlitz, Beate
2014-01-06
Aptamers are single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) oligonucleotides, which are able to bind their target with high selectivity and affinity. Owing to their multiple talents, aptamers combined with nanoparticles are nanosystems well qualified for the development of new biomedical devices for analytical, imaging, drug delivery and many other medical applications. Because of their target affinity, aptamers can direct the transport of aptamer-nanoparticle conjugates. The binding of the aptamers to the target "anchors" the nanoparticle-aptamer conjugates at their site of action. In this way, nanoparticle-based bioimaging and smart drug delivery are enabled, especially by use of systematically developed aptamers for cancer-associated biomarkers. This review article gives a brief overview of recent relevant research into aptamers and trends in their use in cancer diagnostics and therapy. A concise description of aptamers, their development and functionalities relating to nanoparticle modification is given. The main part of the article is dedicated to current developments of aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.
Aptamer selection and applications for breast cancer diagnostics and therapy
Directory of Open Access Journals (Sweden)
Mei Liu
2017-11-01
Full Text Available Abstract Aptamers are short non-coding, single-stranded oligonucleotides (RNA or DNA developed through Systematic Evolution of Ligands by Exponential enrichment (SELEX in vitro. Similar to antibodies, aptamers can bind to specific targets with high affinity, and are considered promising therapeutic agents as they have several advantages over antibodies, including high specificity, stability, and non-immunogenicity. Furthermore, aptamers can be produced at a low cost and easily modified, and are, therefore, called “chemical antibodies”. In the past years, a variety of aptamers specifically bound to both breast cancer biomarkers and cells had been selected. Besides, taking advantage of nanomaterials, there were a number of aptamer-nanomaterial conjugates been developed and widely investigated for diagnostics and targeted therapy of breast cancer. In this short review, we first present a systematical review of various aptamer selection methods. Then, various aptamer-based diagnostic and therapeutic strategies of breast cancer were provided. Finally, the current problems, challenges, and future perspectives in the field were thoroughly discussed.
Structural insights into the osteopontin-aptamer complex y molecular dynamics simulations
La Penna, Giovanni; Chelli, Riccardo
2018-01-01
Osteopontin is an intrinsically disordered protein involved in tissue remodeling. As a biomarker for pathological hypertrophy and fibrosis, the protein is targeted by an RNA aptamer. In this work, we model the interactions between osteopontin and its aptamer, including mono- (Na+) and divalent (Mg2+) cations. The molecular dynamics simulations suggest that the presence of divalent cations forces the N-terminus of osteopontin to bind the shell of divalent cations adsorbed over the surface of its RNA aptamer, the latter exposing a high negative charge density. The osteopontin plasticity as a function of the local concentration of Mg is discussed in the frame of the proposed strategies for osteopontin targeting as biomarker and in theranostic.
Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus.
Cao, Xiaoxiao; Li, Shaohua; Chen, Liucun; Ding, Hongmei; Xu, Hua; Huang, Yanping; Li, Jie; Liu, Nongle; Cao, Weihong; Zhu, Yanjun; Shen, Beifen; Shao, Ningsheng
2009-08-01
In this article, a panel of ssDNA aptamers specific to Staphylococcus aureus was obtained by a whole bacterium-based SELEX procedure and applied to probing S. aureus. After several rounds of selection with S. aureus as the target and Streptococcus and S. epidermidis as counter targets, the highly enriched oligonucleic acid pool was sequenced and then grouped under different families on the basis of the homology of the primary sequence and the similarity of the secondary structure. Eleven sequences from different families were selected for further characterization by confocal imaging and flow cytometry analysis. Results showed that five aptamers demonstrated high specificity and affinity to S. aureus individually. The five aptamers recognize different molecular targets by competitive experiment. Combining these five aptamers had a much better effect than the individual aptamer in the recognition of different S. aureus strains. In addition, the combined aptamers can probe single S. aureus in pyogenic fluids. Our work demonstrates that a set of aptamers specific to one bacterium can be used in combination for the identification of the bacterium instead of a single aptamer.
Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites
DEFF Research Database (Denmark)
Dupont, Daniel Miotto; Thuesen, Cathrine K; Bøtkjær, Kenneth A
2015-01-01
Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless...
Aptamers as radiopharmaceuticals for nuclear imaging and therapy
International Nuclear Information System (INIS)
Gijs, Marlies; Aerts, An; Impens, Nathalie; Baatout, Sarah; Luxen, André
2016-01-01
Today, radiopharmaceuticals belong to the standard instrumentation of nuclear medicine, both in the context of diagnosis and therapy. The majority of radiopharmaceuticals consist of targeting biomolecules which are designed to interact with a disease-related molecular target. A plethora of targeting biomolecules of radiopharmaceuticals exists, including antibodies, antibody fragments, proteins, peptides and nucleic acids. Nucleic acids have some significant advantages relative to proteinaceous biomolecules in terms of size, production, modifications, possible targets and immunogenicity. In particular, aptamers (non-coding, synthetic, single-stranded DNA or RNA oligonucleotides) are of interest because they can bind a molecular target with high affinity and specificity. At present, few aptamers have been investigated preclinically for imaging and therapeutic applications. In this review, we describe the use of aptamers as targeting biomolecules of radiopharmaceuticals. We also discuss the chemical modifications which are needed to turn aptamers into valuable (radio-)pharmaceuticals, as well as the different radiolabeling strategies that can be used to radiolabel oligonucleotides and, in particular, aptamers.
High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces
Directory of Open Access Journals (Sweden)
Orada Chumphukam
2014-04-01
Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.
Direct, rapid RNA sequence analysis
International Nuclear Information System (INIS)
Peattie, D.A.
1987-01-01
The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions
Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production
Directory of Open Access Journals (Sweden)
Junji Tominaga4
2012-04-01
Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.
Methods To Identify Aptamers against Cell Surface Biomarkers
Directory of Open Access Journals (Sweden)
Frédéric Ducongé
2011-09-01
Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.
RNA signal amplifier circuit with integrated fluorescence output.
Akter, Farhima; Yokobayashi, Yohei
2015-05-15
We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.
Aptamer-based impedimetric sensor for bacterial typing.
Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V
2012-10-02
The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform.
Aptamers in Diagnostics and Treatment of Viral Infections
Directory of Open Access Journals (Sweden)
Tomasz Wandtke
2015-02-01
Full Text Available Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment. It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus, HBV (Hepatitis B Virus, HCV (Hepatitis C Virus, SARS (Severe Acute Respiratory Syndrome, H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases.
Aptamers for Targeted Drug Delivery
Directory of Open Access Journals (Sweden)
Partha Ray
2010-05-01
Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.
Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi
2014-10-31
Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.
Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL
Directory of Open Access Journals (Sweden)
Margherita Iaboni
2016-01-01
Full Text Available TNF-related apoptosis-inducing ligand (TRAIL is a promising antitumor agent for its remarkable ability to selectively induce apoptosis in cancer cells, without affecting the viability of healthy bystander cells. The TRAIL tumor suppressor pathway is deregulated in many human malignancies including lung cancer. In human non-small cell lung cancer (NSCLC cells, sensitization to TRAIL therapy can be restored by increasing the expression levels of the tumor suppressor microRNA-212 (miR-212 leading to inhibition of the anti-apoptotic protein PED/PEA-15 implicated in treatment resistance. In this study, we exploited a previously described RNA aptamer inhibitor of the tyrosine kinase receptor Axl (GL21.T expressed on lung cancer cells, as a means to deliver miR-212 into human NSCLC cells expressing Axl. We demonstrate efficient delivery of miR-212 following conjugation of the miR to GL21.T (GL21.T-miR212 chimera. We show that the chimera downregulates PED and restores TRAIL-mediate cytotoxicity in cancer cells. Importantly, treatment of Axl+ lung cancer cells with the chimera resulted in (i an increase in caspase activation and (ii a reduction of cell viability in combination with TRAIL therapy. In conclusion, we demonstrate that the GL21.T-miR212 chimera can be employed as an adjuvant to TRAIL therapy for the treatment of lung cancer.
International Nuclear Information System (INIS)
Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile
2016-01-01
Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)
Generating Aptamers by Cell-SELEX for Applications in Molecular Medicine
Directory of Open Access Journals (Sweden)
Huixia Liu
2012-03-01
Full Text Available Aptamers are single-stranded oligonucleotides of DNA or RNA that bind to target molecules with high affinity and specificity. Typically, aptamers are generated by an iterative selection process, called systematic evolution of ligands by exponential enrichment (SELEX. Recent advancements in SELEX technology have extended aptamer selection from comparatively simple mixtures of purified proteins to whole living cells, and now cell-based SELEX (or cell-SELEX can isolate aptamers that bind to specific target cells. Combined with nanotechnology, microchips, microfluidic devices, RNAi and other advanced technologies, cell-SELEX represents an integrated platform providing ultrasensitive and highly specific tools for clinical medicine. In this review, we describe the recent progress made in the application of cell-SELEX for diagnosis, therapy and biomarker discovery.
Organic additives stabilize RNA aptamer binding of malachite green.
Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J
2016-11-01
Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. Copyright © 2016 Elsevier B.V. All rights reserved.
Imaging gene expression in real-time using aptamers
Energy Technology Data Exchange (ETDEWEB)
Shin, Il Chung [Iowa State Univ., Ames, IA (United States)
2011-01-01
Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging
Imaging gene expression in real-time using aptamers
Energy Technology Data Exchange (ETDEWEB)
Shin, Ilchung [Iowa State Univ., Ames, IA (United States)
2012-01-01
Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging
Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong
2016-06-01
Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright
Jenkins, Jermaine L.; Krucinska, Jolanta; McCarty, Reid M.; Bandarian, Vahe; Wedekind, Joseph E.
2011-01-01
Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters...
Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong
2012-08-01
Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.
International Nuclear Information System (INIS)
Chávez, Jorge L.; MacCuspie, Robert I.; Stone, Morley O.; Kelley-Loughnane, Nancy
2012-01-01
A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA–AuNP conjugates (RBA–AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA–AuNPs’ stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5′ end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA–AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA–AuNPs’ stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer–AuNPs conjugates and their sensing response.
Selection of aptamers for use as radiopharmaceuticals in bacterial infection diagnosis
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Ieda Mendes; Faria, Ligia Santana de; Correa, Cristiane Rodrigues; Andrade, Antero Silva Ribeiro de, E-mail: imendesf@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)
2013-07-01
The difficulty in early detection of specific foci in the bacterial infection caused by bacteria has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy has the advantage that an image of the whole body could be obtained. This study aims to obtain aptamers specific bacteria for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as {sup 99m}Tc, {sup 18}F and {sup 32}P. In this study aptamers anti-peptidoglycan, the main component of the outer cell wall of bacteria, were obtained through SELEX. The SELEX started with a pool of ssDNA that had 10{sup 15}different sequences (library), each oligo has two fixed regions merging a portion of 25 random nucleotides. Initially, the library of ssDNA was incubated with peptidoglycan, for 1h at 37 dec C with stirring. Subsequently, amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reaction). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 rounds of selection the oligonucleotides were cloned using TOPO plasmid and Escherichia coli strain Top10F'. The plasmid DNA from 40 colonies were extracted and quantified. The plasmids were sequenced using the sequencing MegaBase, and two different aptamers sequences were obtained from all clones. The aptamers obtained were synthesized and subsequently labeled with {sup 32}P in the 5' end. The labeled aptamers were incubated
Selection of aptamers for use as radiopharmaceuticals in bacterial infection diagnosis
International Nuclear Information System (INIS)
Ferreira, Ieda Mendes; Faria, Ligia Santana de; Correa, Cristiane Rodrigues; Andrade, Antero Silva Ribeiro de
2013-01-01
The difficulty in early detection of specific foci in the bacterial infection caused by bacteria has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy has the advantage that an image of the whole body could be obtained. This study aims to obtain aptamers specific bacteria for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as 99m Tc, 18 F and 32 P. In this study aptamers anti-peptidoglycan, the main component of the outer cell wall of bacteria, were obtained through SELEX. The SELEX started with a pool of ssDNA that had 10 15 different sequences (library), each oligo has two fixed regions merging a portion of 25 random nucleotides. Initially, the library of ssDNA was incubated with peptidoglycan, for 1h at 37 dec C with stirring. Subsequently, amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reaction). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 rounds of selection the oligonucleotides were cloned using TOPO plasmid and Escherichia coli strain Top10F'. The plasmid DNA from 40 colonies were extracted and quantified. The plasmids were sequenced using the sequencing MegaBase, and two different aptamers sequences were obtained from all clones. The aptamers obtained were synthesized and subsequently labeled with 32 P in the 5' end. The labeled aptamers were incubated with 10 7 Staphylococcus aureus
Aptamer therapeutics: A review of current practice
International Nuclear Information System (INIS)
Perkins, A.C.; Missailidis, S.
2007-01-01
Full text: The development of nuclease resistant oligonucleotide agents known as aptamers, offers an alternative to antibodies as targeting, diagnostic and delivery agents. The production technique of specific receptor binding molecules based on defined nucleic acid sequences is known as systematic evolution of ligands by exponential enrichment (SELEX). Using this technique, aptamers can be produced rapidly and with high homogeneity. Furthermore, they are stable over long term storage at ambient room temperatures. A monomeric aptamer is small in size, with a molecular weight as low as 5 to 10 kDa. However, the aptamer molecule may be used as a building block for custom designed targeting agents, offering several advantages. Aptamers have been found to bind their targets with high specificity and with dissociation constants in the subnanomolar or picomolar range. The first pharmaceutical aptamer formulation, Macugen (pegaptanib sodium injection) was approved in the United States in December of 2004. This is an anti-VEGF aptamer formulation used for the treatment of Neovascular agerelated macular degeneration. Other possibilities in cardiovascular, neurodegenerative and tropical medicine are apparent. As tumour targeting agents, aptamers penetrate tissues readily, reach peak levels quickly and clear from the body rapidly, thus having properties of low toxicity and immunoreactivity. Work with radiolabelled aptamers is limited to pre-clinical studies, but the body of evidence is steadily growing and aptamers are emerging as valuable clinical products for diagnostic imaging and therapy. Peptide coupling reactions between amino and carboxylic groups offer the possibility of labelling the aptamers with a number of chelators that, coupled with appropriate radionuclides, would generate novel targeted radiopharmaceuticals for the diagnosis and therapy of disease. The unparalleled combinatorial chemical diversity, small size and modification ability of aptamers is expected to
Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.
Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed
2017-12-18
The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this
Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.
Directory of Open Access Journals (Sweden)
Birgit Piater
Full Text Available The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF. Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX. CLN64 and a previously described single-stranded DNA (ssDNA aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding.
Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.
Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong
2013-01-01
To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.
Aptamer-Based Technologies in Foodborne Pathogen Detection.
Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang
2016-01-01
Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.
Aptamer-Based Technologies in Foodborne Pathogen Detection
Directory of Open Access Journals (Sweden)
Jun Teng
2016-09-01
Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.
Radiolabelled aptamers for tumour imaging and therapy
International Nuclear Information System (INIS)
Perkins, A.C.; Missailidis, S.
2005-01-01
Full text: The growth in biotechnology has led to new techniques for the design, selection and production of ligands capable of molecular recognition. One promising approach is the production of specific receptor binding molecules based on specific nucleic acid sequences that are capable of recognising a wide array of target molecules. These oligonuclide ligands are known as aptamers. The technology that allows production of aptamer molecules is known as systematic evolution of ligands by exponential enrichment (SELEX). We have used combinatorial chemistry techniques coupled with polymerase chain reaction (PCR) to rapidly select aptamers from degenerate libraries that bind with high affinity and specificity to the protein core of the MUC1 antigen, a tumour marker previously extensively used in tumour imaging and therapy. MUC1 is widely expressed by normal glandular epithelial cells, however this expression is dramatically increased when the cells become malignant. This has been well documented for breast and ovarian cancer, as well as some lung, pancreatic and prostate cancers. Recently it has also been shown that MUC1 is a valuable marker for bladder and has been used for the imaging and targeted therapy of bladder cancer. The aptamer selection process was performed on affinity chromatography matrices. After ten rounds of selection and amplification, aptamers were cloned and sequenced. Post SELEX amino modifications have been used to confer nuclease resistance and coupling potential. The aptamers bound to MUC1 antigen with a Kd of 5nm and high specificity, demonstrated by fluorescent microscopy on MUC1-expressing tumour cells. Using peptide coupling reactions, we have successfully attached chelators for Tc-99m radiolabelling. Two of the constructs tested were based on mono-aptamer chelator complexes, one with commercially available MAG3 and one with a novel designed cyclen-based chelator. The other two constructs were based on the use of multi-aptamer complexes
Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.
Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping
2012-04-25
A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.
Screening and Identification of ssDNA Aptamer for Human GP73
Directory of Open Access Journals (Sweden)
Jingchun Du
2015-01-01
Full Text Available As one tumor marker of HCC, Golgi Protein 73 (GP73 is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens.
Cataldo, Rosella; Alfinito, Eleonora; Reggiani, Lino
2017-12-01
Aptamers are single stranded DNA, RNA, or peptide sequences having the ability to bind several specific targets (proteins, molecules as well as ions). Therefore, aptamer production and selection for therapeutic and diagnostic applications is very challenging. Usually, they are generated in vitro, although computational approaches have been recently developed for the in silico production. Despite these efforts, the mechanism of aptamer-ligand formation is not completely clear, and producing high-affinity aptamers is still quite difficult. This paper aims to develop a computational model able to describe aptamer-ligand affinity. Topological tools, such as the conventional degree distribution, the rank-degree distribution (hierarchy), and the node assortativity are employed. In doing so, the macromolecules tertiary-structures are mapped into appropriate graphs. These graphs reproduce the main topological features of the macromolecules, by preserving the distances between amino acids (nucleotides). Calculations are applied to the thrombin binding aptamer (TBA), and the TBA-thrombin complex produced in the presence of Na + or K + . The topological analysis is able to detect several differences between complexes obtained in the presence of the two cations, as expected by previous investigations. These results support graph analysis as a novel computational tool for testing affinity. Otherwise, starting from the graphs, an electrical network can be obtained by using the specific electrical properties of amino acids and nucleobases. Therefore, a further analysis concerns with the electrical response, revealing that the resistance is sensitively affected by the presence of sodium or potassium, thus suggesting resistance as a useful physical parameter for testing binding affinity.
Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid
Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena
2013-01-01
The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905
DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.
Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A
2011-09-01
A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.
A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches
Directory of Open Access Journals (Sweden)
John G. Bruno
2013-03-01
Full Text Available The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies.
Nucleic Acid Aptamers Against Biotoxins: A New Paradigm Toward the Treatment and Diagnostic Approach
DEFF Research Database (Denmark)
Lauridsen, Lasse Holm; Veedu, Rakesh N.
2012-01-01
Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody-based therape......Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody......-based therapeutic and diagnostic approach currently employed against biotoxins pose major limitations such as the requirement of a live animal for the in vivo enrichment of the antibody species, decreased stability, high production cost, and side effects. Aptamer technology is a viable alternative that can be used...
DSAP: deep-sequencing small RNA analysis pipeline.
Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus
2010-07-01
DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.
Selection of aptamers for Candida albicans by cell-SELEX
International Nuclear Information System (INIS)
Miranda, Alessandra Nunes Duarte
2017-01-01
The growing concern with invasive fungal infections, responsible for an alarming mortality rate of immunosuppressed patients and in Intensive Care Units, evidences the need for a fast and specific method for the Candida albicans detection, since this species is identified as one of the main causes of septicemia. Commonly, it is a challenge for clinicians to determine the primary infection foci, the dissemination degree, or whether the site of a particular surgery is involved. Although scintigraphic imaging represents a promising tool for infectious foci detection, it still lacks a methodology for C. albicans diagnosis due to the absence of specific radiotracers for this microorganism. Aptamers are molecules that have almost ideal properties for use as diagnostic radiopharmaceuticals, such as high specificity for their molecular targets, lack of immunogenicity and toxicity, high tissue penetration and rapid blood clearance. Aptamers can also be labeled with different radionuclides. This work aims to obtain aptamers for specific binding to C. albicans cells for future application as a radiopharmaceutical. It was used a variation of the SELEX (Systematic Evolution of Ligands by EXponential Enrichment) technique, termed cell-SELEX, in which cells are the targets for selection. A selection protocol was standardized using a random library of single-stranded oligonucleotides, each containing two fixed regions flanking a sequence of 40 random nucleotides. This library was incubated with C. albicans cells in the presence of competitors. Then, the binding sequences were separated by centrifugation, resuspended and amplified by PCR. The amplification was confirmed by agarose gel electrophoresis. After that, the ligands were purified to obtain a new pool of ssDNA, from which a new incubation was carried out. The selection parameters were gradually modified in order to increase stringency. This cycle was repeated 12 times to allow the selection of sequences with the maximum
Comparison of classifications of aptamers against Vibrio ...
African Journals Online (AJOL)
ELO
2012-01-05
Jan 5, 2012 ... research on selection of aptamers against pathogens. MATERIALS AND .... actually stem from the variations in the middle sequences, it is essential to ... loops that are connected by double strand DNA, so the two loops are in ...
Ramlal, Shylaja; Mondal, Bhairab; Lavu, Padma Sudharani; N, Bhavanashri; Kingston, Joseph
2018-01-16
In the present study, a high throughput whole cell SELEX method has been applied successfully in selecting specific aptamers against whole cells of Staphylococcus aureus, a potent food poisoning bacterium. A total ten rounds of SELEX and three rounds of intermittent counter SELEX, was performed to obtain specific aptamers. Obtained oligonucleotide pool were cloned, sequenced and then grouped into different families based on their primary sequence homology and secondary structure similarity. FITC labeled sequences from different families were selected for further characterization via flow cytometry analysis. The dissociation constant (K d ) values of specific and higher binders ranged from 34 to 128nM. Binding assays to assess the selectivity of aptamer RAB10, RAB 20, RAB 28 and RAB 35 demonstrated high affinity against S. aureus and low binding affinity for other bacteria. To demonstrate the potential use of the aptamer a sensitive dual labeled sandwich detection system was developed using aptamer RAB10 and RAB 35 with a detection limit of 10 2 CFU/mL. Furthermore detection from mixed cell population and spiked sample emphasized the robustness as well as applicability of the developed method. Altogether, the established assay could be a reliable detection tool for the routine investigation of Staphylococcus aureus in samples from food and clinical sources. Copyright © 2017. Published by Elsevier B.V.
Development of aptamers for use as radiopharmaceuticals in the bacterial infection identification
International Nuclear Information System (INIS)
Ferreira, Ieda Mendes
2013-01-01
. The product of recombination was used to transform Escherichia coli ToplOF'. The plasmid DNA from 40 selected colonies were extracted and quantified. The plasmids were sequenced, two different sequences (Antibac1 and Antibac2) were obtained and their secondary structures determined. The aptamers obtained were synthesized and labeled with 32 p. The labeled aptamers were incubated with S. aureus cells and the amount of radiolabeled ssDNA was determined by liquid scintillation spectrometry. The oligonucleotides library labeled with 32 p was used as control. For the aptamer Antibac1 the radiation linked to the pellet was 28 times higher than obtained with the control and for the Antibac2 was 22 higher. A specific assay was conducted with labeled aptamers using S. aureus, E. co ti, Candida albicans and human fibroblasts. For both aptamers (Antibac1 and Antibac2) binding to bacterial cells was significantly higher than for C. albicans and fibroblasts, demonstrating their specificity for bacteria. For B process, after 15 SELEX rounds was performed the cell-SELEX starting with the products 15th round being incubated with S. aureus cells. The amplified oligonucleotides were incubated again with the bacteria in the next round and so on. At the end of the 5 rounds of selection, the selected oligonucleotides were cloned and sequenced as in A process. Eleven different sequences from 21 clones were obtained and their secondary structures were determined. The aptamers obtained by process A showed high affinity and specificity for bacteria. The aptamers obtained by process B will be evaluated for these parameters in a future work. (author)
RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.
Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A
2013-12-01
Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.
International Nuclear Information System (INIS)
Soheili, Vahid; Taghdisi, Seyed Mohammad; Khayyat, Mohammad Hassanzadeh; Abnous, Khalil; Bazzaz, BiBi Sedigheh Fazly; Ramezani, Mohammad
2016-01-01
Aptamers specific for the antibiotic streptomycin were identified by a modified SELEX procedure that employs magnetic beads. After eight rounds of selection, twenty-six aptamers were identified and clustered into seven groups according to similarities in their sequences. The binding constant of three sequences from different groups were determined by colorimetric assays using unmodified gold nanoparticles (AuNPs). These most suitable aptamers were then truncated, and finally a 23-base sequence was identified that has the highest affinity (K_d = 132.3 nM) and selectivity. The assay was employed to analyze streptomycin residue in raw milk samples by ratiometric spectrophotometry at 520 and 660 nm, respectively. The analytical range extends from 180 to 1000 nM, and the LOD is 47.2 nM which is better than that of HPLC (4 μM). The interaction between aptamer and streptomycin was studied by molecular modeling. In our perception, this colorimetric assay provides a viable method for fast analysis of streptomycin in raw milk. (author)
Aptamer-based viability impedimetric sensor for bacteria.
Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V
2012-11-06
The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform.
Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.
Tan, M K
1991-08-01
A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.
Amouzadeh Tabrizi, Mahmoud; Shamsipur, Mojtaba; Saber, Reza; Sarkar, Saeed
2018-07-01
Herein, aptamer-modified self-propelled nanomotors were used for transportation of human promyelocytic leukemia cells (HL-60) from a human serum sample. For this purpose, the fabricated manganese oxide nanosheets-polyethyleneimine decorated with nickel/gold nanoparticles (MnO 2 -PEI/Ni/Au) as nanomotors were added to a vial containing thiolated aptamer KH1C12 solution as a capture aptamer to attach to the gold nanoparticles on the surface of nanomotors covalently. The aptamer-modified self-propelled nanomotors (aptamer KH1C12 /nanomotors) were then separated by placing the vial in a magnetic stand. The aptamer-modified self-propelled nanomotors were rinsed three times with water to remove the non-attached aptamers. Then, the resulting aptamer KH1C12 /nanomotors were applied for the on-the-fly" transporting of HL-60 cancer cell from a human serum sample. To release of the captured HL-60 cancer cells, the complementary nucleotide sequences of KH1C12 aptamer solution (releasing aptamer) that has a with capture aptamer was added to phosphate buffer solution (1 M, pH 7.4) containing HL-60/aptamer KH1C12 /nanomotors. Because of the high affinity of capture aptamer to complementary nucleotide sequences of aptamer KH1C12 , the HL-60 cancer cells released on the surface of aptamer KH1C12 /nanomotors into the solution. The second goal of the present work was determining the concentration of HL-60 cancer cell in the human serum samples. The electrochemical impedance spectroscopy technique (EIS) was used for the determination of HL-60 cancer cell. The concentration of separated cancer cell was determined by aptamer/gold nanoparticles-poly(3,4-ethylene dioxythiophene) modified GC electrode (GC/PEDOT-Au nano /aptamer KH1C12 ). The proposed aptasensor exhibited a good response to the concentration of HL-60 cancer cells in the range of 2.5 × 10 1 to 5 × 10 5 cells mL -1 with a low limit of detection of 250 cells mL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.
Hahn, Ulrich
2017-12-06
Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2'-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers-in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.
Ligand-regulated peptide aptamers.
Miller, Russell A
2009-01-01
The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.
Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.
Matkovich, Scot J; Dorn, Gerald W
2015-01-01
MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.
Directory of Open Access Journals (Sweden)
David Porciani
2015-01-01
Full Text Available Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i target tumor cells via an antitransferrin receptor RNA aptamer and (ii perform selective codelivery of a chemotherapeutic drug (Doxorubicin and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment. Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells.
Function and dynamics of aptamers: A case study on the malachite green aptamer
Energy Technology Data Exchange (ETDEWEB)
Wang, Tianjiao [Iowa State Univ., Ames, IA (United States)
2008-01-01
Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH- is sterically excluded from the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD
Ditzler, Mark A.
2014-01-01
RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.
In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.
Directory of Open Access Journals (Sweden)
Regina Stoltenburg
Full Text Available A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.
In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.
Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate
2015-01-01
A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.
Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun
2015-04-15
Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.
Directory of Open Access Journals (Sweden)
Jihea Moon
2015-04-01
Full Text Available Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.
RNA motif search with data-driven element ordering.
Rampášek, Ladislav; Jimenez, Randi M; Lupták, Andrej; Vinař, Tomáš; Brejová, Broňa
2016-05-18
In this paper, we study the problem of RNA motif search in long genomic sequences. This approach uses a combination of sequence and structure constraints to uncover new distant homologs of known functional RNAs. The problem is NP-hard and is traditionally solved by backtracking algorithms. We have designed a new algorithm for RNA motif search and implemented a new motif search tool RNArobo. The tool enhances the RNAbob descriptor language, allowing insertions in helices, which enables better characterization of ribozymes and aptamers. A typical RNA motif consists of multiple elements and the running time of the algorithm is highly dependent on their ordering. By approaching the element ordering problem in a principled way, we demonstrate more than 100-fold speedup of the search for complex motifs compared to previously published tools. We have developed a new method for RNA motif search that allows for a significant speedup of the search of complex motifs that include pseudoknots. Such speed improvements are crucial at a time when the rate of DNA sequencing outpaces growth in computing. RNArobo is available at http://compbio.fmph.uniba.sk/rnarobo .
2017-01-01
Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld. PMID:29211023
Directory of Open Access Journals (Sweden)
Ulrich Hahn
2017-12-01
Full Text Available Interleukin-6 (IL-6 is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT. Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.
Chimira: analysis of small RNA sequencing data and microRNA modifications.
Vitsios, Dimitrios M; Enright, Anton J
2015-10-15
Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
A general excimer signaling approach for aptamer sensors.
Wu, Cuichen; Yan, Ling; Wang, Chunming; Lin, Haoxue; Wang, Chi; Chen, Xi; Yang, Chaoyong James
2010-06-15
Simple, fast and direct analysis or monitoring of significant molecules in complex biological samples is important for many biological study, clinical diagnosis and forensic investigations. Herein we highlight a general method to tailor aptamer sequence into functional subunits to design target-induced light-switching excimer sensors for rapid, sensitive and selective detection of important molecules in complex biological fluids. Our approach is to split one single strand aptamer into two pieces and each terminally labeled with a pyrene molecule while maintaining their binding affinity to target molecules. In the presence of target molecules, two aptamer fragments are induced to self-assemble to form aptamer-target complex and bring two pyrene molecules into a close proximity to form an excimer, resulting in fluorescent switching from approximately 400 nm to 485 nm. With an anti-cocaine sensor, as low as 1 microM of cocaine can be detected using steady-state fluorescence assays and more importantly low picomole level of target can be directly visualized with naked eyes. Because the excimer has a long fluorescence lifetime, time-resolved measurements were used to directly detect as low as 5 microM cocaine in urine samples quantitatively without any sample pretreatment. Copyright 2010 Elsevier B.V. All rights reserved.
Bjerregaard, Nils; Bøtkjær, Kenneth A; Helsen, Nicky; Andreasen, Peter A; Dupont, Daniel M
2015-07-01
Recombinant tissue-type plasminogen activator (tPA, trade name Alteplase), currently the only drug approved by the US Food and Drug Administration and the European Medicines Agency for the treatment of cerebral ischaemic stroke, has been implicated in a number of adverse effects reportedly mediated by interactions with the low-density lipoprotein (LDL) family receptors, including neuronal cell death and an increased risk of cerebral haemorrhage. The tissue-type plasminogen activator is the principal initiator of thrombolysis in human physiology, an effect that is mediated directly via localised activation of the plasmin zymogen plasminogen at the surface of fibrin clots in the vascular lumen. Here, we sought to identify a ligand to tPA capable of inhibiting the relevant LDL family receptors without interfering with the fibrinolytic activity of tPA. Systematic evolution of ligands by exponential enrichment (SELEX) was employed to isolate tPA-binding RNA aptamers, which were characterised in biochemical assays of tPA association to low density lipoprotein receptor-related protein-1 (LRP-1, an LDL receptor family member); tPA-mediated in vitro and ex vivo clot lysis; and tPA-mediated plasminogen activation in the absence and presence of a stimulating soluble fibrin fragment. Two aptamers, K18 and K32, had minimal effects on clot lysis, but were able to efficiently inhibit tPA-LRP-1 association and LDL receptor family-mediated endocytosis in human vascular endothelial cells and astrocytes. These observations suggest that coadministration alongside tPA may be a viable strategy to improve the safety of thrombolytic treatment of cerebral ischaemic stroke by restricting tPA activity to the vascular lumen.
Directory of Open Access Journals (Sweden)
Wei Zhang
2018-02-01
Full Text Available Water pollution has become one of the leading causes of human health problems. Low molecular weight pollutants, even at trace concentrations in water sources, have aroused global attention due to their toxicity after long-time exposure. There is an increased demand for appropriate methods to detect these pollutants in aquatic systems. Aptamers, single-stranded DNA or RNA, have high affinity and specificity to each of their target molecule, similar to antigen-antibody interaction. Aptamers can be selected using a method called Systematic Evolution of Ligands by EXponential enrichment (SELEX. Recent years we have witnessed great progress in developing aptamer selection and aptamer-based sensors for low molecular weight pollutants in water sources, such as tap water, seawater, lake water, river water, as well as wastewater and its effluents. This review provides an overview of aptamer-based methods as a novel approach for detecting low molecular weight pollutants in water sources.
Using a Specific RNA-Protein Interaction To Quench the Fluorescent RNA Spinach.
Roszyk, Laura; Kollenda, Sebastian; Hennig, Sven
2017-12-15
RNAs are involved in interaction networks with other biomolecules and are crucial for proper cell function. Yet their biochemical analysis remains challenging. For Förster Resonance Energy Transfer (FRET), a common tool to study such interaction networks, two interacting molecules have to be fluorescently labeled. "Spinach" is a genetically encodable RNA aptamer that starts to fluoresce upon binding of an organic molecule. Therefore, it is a biological fluorophore tag for RNAs. However, spinach has never been used in a FRET assembly before. Here, we describe how spinach is quenched when close to acceptors. We used RNA-DNA hybridization to bring quenchers or red organic dyes in close proximity to spinach. Furthermore, we investigate RNA-protein interactions quantitatively on the example of Pseudomonas aeruginosa phage coat protein 7 (PP7) and its interacting pp7-RNA. We utilize spinach quenching as a fully genetically encodable system even under lysate conditions. Therefore, this work represents a direct method to analyze RNA-protein interactions by quenching the spinach aptamer.
Nucleic Acid Aptamers Against Proteases
DEFF Research Database (Denmark)
Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø
2011-01-01
, directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection......Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...
Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles
Directory of Open Access Journals (Sweden)
Sijin Guo
2017-12-01
Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.
DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin.
Vivekananda, Jeevalatha; Salgado, Christi; Millenbaugh, Nancy J
2014-02-14
Staphylococcus aureus is a versatile pathogen capable of causing a broad spectrum of diseases ranging from superficial skin infections to life threatening conditions such as endocarditis, septicemia, pneumonia and toxic shock syndrome. In vitro and in vivo studies identified an exotoxin, α-toxin, as a major cause of S. aureus toxicity. Because S. aureus has rapidly evolved resistance to a number of antibiotics, including methicillin, it is important to identify new therapeutic strategies, other than antibiotics, for inhibiting the harmful effects of this pathogen. Aptamers are single-stranded DNA or RNA oligonucleotides with three-dimensional folded conformations that bind with high affinity and selectivity to targets and modulate their biological functions. The goal of this study was to isolate DNA aptamers that specifically inhibit the cytotoxic activity of α-toxin. After 10 rounds of Systematic Evolution of Ligands by EXponential Enrichment (SELEX), 49 potential anti-α-toxin aptamers were identified. In vitro neutralization assays demonstrated that 4 of these 49 aptamers, AT-27, AT-33, AT-36, and AT-49, significantly inhibited α-toxin-mediated cell death in Jurkat T cells. Furthermore, RT-PCR analysis revealed that α-toxin increased the transcription of the inflammatory cytokines TNF-α and IL-17 and that anti-α-toxin aptamers AT-33 and AT-36 inhibited the upregulation of these genes. Collectively, the data suggest the feasibility of generating functionally effective aptamers against α-toxin for treatment of S. aureus infections. Published by Elsevier Inc.
Energy Technology Data Exchange (ETDEWEB)
Ilgu, Muslum [Iowa State Univ., Ames, IA (United States)
2012-01-01
A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.
Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David
2018-03-19
To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.
In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.
Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C
2017-12-14
Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
de Sousa Lacerda, Camila Maria; Ferreira, Iêda Mendes; Dos Santos, Sara Roberta; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro
2017-03-01
Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n=6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17±0.22 for seq6 and 2.66±0.10 for seq30. These ratios were statistically higher than the value (1.54±0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53±0.03, 1.64±0.12 and 1.08±0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sousa Lacerda, Camila Maria de; Ferreira, Iêda Mendes; Santos, Sara Roberta dos; Barros, André Luís Branco de; Fernandes, Simone Odília
2017-01-01
Introduction: Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1 → 3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1 → 3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Methods: Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n = 6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Results: There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17 ± 0.22 for seq6 and 2.66 ± 0.10 for seq30. These ratios were statistically higher than the value (1.54 ± 0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53 ± 0.03, 1.64 ± 0.12 and 1.08 ± 0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Conclusions: Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored.
Rfam: annotating families of non-coding RNA sequences.
Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W
2015-01-01
The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.
Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate
2016-09-21
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.
miRBase: integrating microRNA annotation and deep-sequencing data.
Kozomara, Ana; Griffiths-Jones, Sam
2011-01-01
miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.
Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.
Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan
2017-12-15
RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Carol Ying-Ying Szeto
2014-01-01
Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.
Deep-sequencing protocols influence the results obtained in small-RNA sequencing.
Directory of Open Access Journals (Sweden)
Joern Toedling
Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.
Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel
2017-07-01
Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.
Optical Aptamer Probes of Fluorescent Imaging to Rapid Monitoring of Circulating Tumor Cell
Directory of Open Access Journals (Sweden)
Ji Yeon Hwang
2016-11-01
Full Text Available Fluorescence detecting of exogenous EpCAM (epithelial cell adhesion molecule or muc1 (mucin1 expression correlated to cancer metastasis using nanoparticles provides pivotal information on CTC (circulating tumor cell occurrence in a noninvasive tool. In this study, we study a new skill to detect extracellular EpCAM/muc1 using quantum dot-based aptamer beacon (QD-EpCAM/muc1 ALB (aptamer linker beacon. The QD-EpCAM/muc1 ALB was designed using QDs (quantum dots and probe. The EpCAM/muc1-targeting aptamer contains a Ep-CAM/muc1 binding sequence and BHQ1 (black hole quencher 1 or BHQ2 (black hole quencher2. In the absence of target EpCAM/muc1, the QD-EpCAM/muc1 ALB forms a partial duplex loop-like aptamer beacon and remained in quenched state because the BHQ1/2 quenches the fluorescence signal-on of the QD-EpCAM/muc1 ALB. The binding of EpCAM/muc1 of CTC to the EpCAM/muc1 binding aptamer sequence of the EpCAM/muc1-targeting oligonucleotide triggered the dissociation of the BHQ1/2 quencher and subsequent signal-on of a green/red fluorescence signal. Furthermore, acute inflammation was stimulated by trigger such as caerulein in vivo, which resulted in increased fluorescent signal of the cy5.5-EpCAM/muc1 ALB during cancer metastasis due to exogenous expression of EpCAM/muc1 in Panc02-implanted mouse model.
Unraveling Prion Protein Interactions with Aptamers and Other PrP-Binding Nucleic Acids.
Macedo, Bruno; Cordeiro, Yraima
2017-05-17
Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative disorders that affect humans and other mammals. The etiologic agents common to these diseases are misfolded conformations of the prion protein (PrP). The molecular mechanisms that trigger the structural conversion of the normal cellular PrP (PrP C ) into the pathogenic conformer (PrP Sc ) are still poorly understood. It is proposed that a molecular cofactor would act as a catalyst, lowering the activation energy of the conversion process, therefore favoring the transition of PrP C to PrP Sc . Several in vitro studies have described physical interactions between PrP and different classes of molecules, which might play a role in either PrP physiology or pathology. Among these molecules, nucleic acids (NAs) are highlighted as potential PrP molecular partners. In this context, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology has proven extremely valuable to investigate PrP-NA interactions, due to its ability to select small nucleic acids, also termed aptamers, that bind PrP with high affinity and specificity. Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into a wide range of structures (from harpins to G-quadruplexes). They are selected from a nucleic acid pool containing a large number (10 14 -10 16 ) of random sequences of the same size (~20-100 bases). Aptamers stand out because of their potential ability to bind with different affinities to distinct conformations of the same protein target. Therefore, the identification of high-affinity and selective PrP ligands may aid the development of new therapies and diagnostic tools for TSEs. This review will focus on the selection of aptamers targeted against either full-length or truncated forms of PrP, discussing the implications that result from interactions of PrP with NAs, and their potential advances in the studies of prions. We will also provide a critical evaluation
Computational prediction of miRNA genes from small RNA sequencing data
Directory of Open Access Journals (Sweden)
Wenjing eKang
2015-01-01
Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.
Chen, Wen; Zeng, Wen; Sun, Jiansen; Yang, Mingcan; Li, Li; Zhou, Jingting; Wu, Yangxiao; Sun, Jun; Liu, Ge; Tang, Rui; Tan, Ju; Zhu, Chuhong
2015-06-23
The application of tissue-engineered blood vessels (TEBVs) is the main developmental direction of vascular replacement therapy. Due to few and/or dysfunctional endothelial progenitor cells (EPCs), it is difficult to successfully construct EPC capture TEBVs in diabetes. RNA has a potential application in cell protection and diabetes treatment, but poor specificity and low efficiency of RNA transfection in vivo limit the application of RNA. On the basis of an acellular vascular matrix, we propose an aptamer-siRNA chimera-modified TEBV that can maintain a satisfactory patency in diabetes. This TEBV consists of two parts, CD133-adenosine kinase (ADK) chimeras and a TEBV scaffold. Our results showed that CD133-ADK chimeras could selectively capture the CD133-positive cells in vivo, and then captured cells can internalize the bound chimeras to achieve RNA self-transfection. Subsequently, CD133-ADK chimeras were cut into ADK siRNA by a dicer, resulting in depletion of ADK. An ADK-deficient cell may act as a bioreactor that sustainably releases adenosine. To reduce nonspecific RNA transfection, we increased the proportion of HAuCl4 during the material preparation, through which the transfection capacity of polyethylenimine (PEI)/polyethylene glycol (PEG)-capped gold nanoparticles (PEI/PEG-AuNPs) was significantly decreased and the ability of TEBV to resist tensile and liquid shear stress was greatly enhanced. PEG and 2'-O-methyl modification was used to enhance the in vivo stability of RNA chimeras. At day 30 postgrafting, the patency rate of CD133-ADK chimera-modified TEBVs reached 90% in diabetic rats and good endothelialization was observed.
RNA sequencing: current and prospective uses in metabolic research.
Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay
2014-10-01
Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.
A Cancer Cell-Activatable Aptamer-Reporter System for One-Step Assay of Circulating Tumor Cells
Directory of Open Access Journals (Sweden)
Zihua Zeng
2014-01-01
Full Text Available The current antibody-mediated numeration assays of circulating tumor cells (CTCs require multiple steps and are time-consuming. To overcome these technical limitations, a cancer cell-activatable aptamer-reporter was formulated by conjugating a biomarker-specific aptamer sequence with paired fluorochrome-quencher molecules. In contrast to the antibody probes, the intact aptamer-reporter was optically silent in the absence of cells of interest. However, when used in an assay, the aptamer selectively targeted cancer cells through interaction with a specific surface biomarker, which triggered internalization of the aptamer-reporter and, subsequently, into cell lysosomes. Rapid lysosomal degradation of the aptamer-reporter resulted in separation of the paired fluorochrome-quencher molecules. The released fluorochrome emitted bright fluorescent signals exclusively within the targeted cancer cells, with no background noise in the assay. Thus, the assays could be completed in a single step within minutes. By using this one-step assay, CTCs in whole blood and marrow aspirate samples of patients with lymphoma tumors were selectively highlighted and rapidly detected with no off-target signals from background blood cells. The development of the cancer cell-activatable aptamer-reporter system allows for the possibility of a simple and robust point-of-care test for CTC detection, which is currently unavailable.
Directory of Open Access Journals (Sweden)
Sohee Jeong
2012-01-01
Full Text Available A competitive enzyme-linked aptamer assay (ELAA to detect tetracycline in milk was performed by using two different aptamers individually; one is 76 mer-DNA aptamer and the other is 57 mer-RNA aptamer. The best optimum condition was obtained without monovalent ion, Na+ and also by adding no Mg2+ ion in the assay buffer, along with RT incubation. The optimized ELAA showed a good sensitivity (LOD of 2.10 × 10−8 M with a wide dynamic range (3.16 × 10−8 M ~ 3.16 × 10−4 M. In addition, the average R.S.D. across all data points of the curve was less than 2.5% with good recoveries (~101.8% from the milk media. Thus, this method provides a good tool to monitor tetracycline in milk from MRLs’ point of view. However, this ELAA method was not superior to the ELISA method in terms of specificity. This paper describes that it does not always give better sensitivity and specificity in assays even though aptamers have several advantages over antibodies and have been known to be good binders for binding assays.
Screening and Initial Binding Assessment of Fumonisin B1 Aptamers
Directory of Open Access Journals (Sweden)
Maria C. DeRosa
2010-11-01
Full Text Available Fumonisins are mycotoxins produced by Fusarium verticillioides and F. proliferatum, fungi that are ubiquitous in corn (maize. Insect damage and some other environmental conditions result in the accumulation of fumonisins in corn-based products worldwide. Current methods of fumonisin detection rely on the use of immunoaffinity columns and high-performance liquid chromatography (HPLC. The use of aptamers offers a good alternative to the use of antibodies in fumonisin cleanup and detection due to lower costs and improved stability. Aptamers are single-stranded oligonucleotides that are selected using Systematic Evolution of Ligands by EXponential enrichment (SELEX for their ability to bind to targets with high affinity and specificity. Sequences obtained after 18 rounds of SELEX were screened for their ability to bind to fumonisin B1. Six unique sequences were obtained, each showing improved binding to fumonisin B1 compared to controls. Sequence FB1 39 binds to fumonisin with a dissociation constant of 100 ± 30 nM and shows potential for use in fumonisin biosensors and solid phase extraction columns.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Novel Approach to Analyzing MFE of Noncoding RNA Sequences.
George, Tina P; Thomas, Tessamma
2016-01-01
Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.
Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA
Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong
2006-01-01
RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690
Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.
Directory of Open Access Journals (Sweden)
Kiran Zahid
2015-01-01
Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.
Aptamer-based multiplexed proteomic technology for biomarker discovery.
Directory of Open Access Journals (Sweden)
Larry Gold
2010-12-01
Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.
Aptamer-based multiplexed proteomic technology for biomarker discovery.
Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom
2010-12-07
The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.
Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.
Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K
2016-10-24
DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparison of classifications of aptamers against Vibrio ...
African Journals Online (AJOL)
As a novel method to detect the pathogen Vibrio alginolyticus, 45 aptamers were previously selected and tested. In order to better understand the properties of these aptamers, it was essential to classify these aptamers based on appropriate criteria. The primary structure of 45 aptamers against V. alginolyticus was analyzed ...
Jenkins, Jermaine L; Krucinska, Jolanta; McCarty, Reid M; Bandarian, Vahe; Wedekind, Joseph E
2011-07-15
Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters expression signal accessibility. Here we present crystal structures of the preQ(1) riboswitch from Thermoanaerobacter tengcongensis in the preQ(1)-bound and free states. Although the mode of preQ(1) recognition is similar to that observed for preQ(0), surface plasmon resonance revealed an apparent K(D) of 2.1 ± 0.3 nm for preQ(1) but a value of 35.1 ± 6.1 nm for preQ(0). This difference can be accounted for by interactions between the preQ(1) methylamine and base G5 of the aptamer. To explore conformational states in the absence of metabolite, the free-state aptamer structure was determined. A14 from the ceiling of the ligand pocket shifts into the preQ(1)-binding site, resulting in "closed" access to the metabolite while simultaneously increasing exposure of the ribosome-binding site. Solution scattering data suggest that the free-state aptamer is compact, but the "closed" free-state crystal structure is inadequate to describe the solution scattering data. These observations are distinct from transcriptional preQ(1) riboswitches of the same class that exhibit strictly ligand-dependent folding. Implications for gene regulation are discussed.
Aptamer-functionalized nano-biosensors.
Chiu, Tai-Chia; Huang, Chih-Ching
2009-01-01
Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs), metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs). We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused.
Aptamer-Functionalized Nano-Biosensors
Directory of Open Access Journals (Sweden)
Tai-Chia Chiu
2009-12-01
Full Text Available Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs, metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs. We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused.
mESAdb: microRNA expression and sequence analysis database.
Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen
2011-01-01
microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.
RISC RNA sequencing for context-specific identification of in vivo microRNA targets.
Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W
2011-01-07
MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
Moon, Jihea; Kim, Giyoung; Lee, Sangdae; Park, Saetbyeol
2013-11-01
Conventional methods for detection of infective organisms, such as Salmonella, are complicated and require multiple steps, and the need for rapid detection has increased. Biosensors show great potential for rapid detection of pathogens. In turn, aptamers have great potential for biosensor assay development, given their small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost of production than antibodies, and high target specificity. In this study, ssDNA aptamers specific to Salmonella Typhimurium were obtained by a whole bacterium-based systematic evolution of ligands by exponential enrichment (SELEX) procedure and applied to probing S. Typhimurium. After 10 rounds of selection with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli and Staphylococcus aureus as counter targets, the highly enriched oligonucleic acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from different families were sequenced and grouped. Fluorescent analysis demonstrated that aptamer C4 had particularly high binding affinity and selectivity; this aptamer was then further characterized. © 2013 Elsevier B.V. All rights reserved.
Gong, Xue; Li, Jinfu; Zhou, Wenjiao; Xiang, Yun; Yuan, Ruo; Chai, Yaqin
2014-05-30
Based on target recycling amplification, the development of a new label-free, simple and sensitive colorimetric detection method for ATP by using un-modified aptamers and DNAzymes is described. The association of the model target molecules (ATP) with the corresponding aptamers of the dsDNA probes leads to the release of the G-quadruplex sequences. The ATP-bound aptamers can be further degraded by Exonuclease III to release ATP, which can again bind the aptamers of the dsDNA probes to initiate the target recycling amplification process. Due to this target recycling amplification, the amount of the released G-quadruplex sequences is significantly enhanced. Subsequently, these G-quadruplex sequences bind hemin to form numerous peroxidase mimicking DNAzymes, which cause substantially intensified color change of the probe solution for highly sensitive colorimetric detection of ATP down to the sub-nanomolar (0.33nM) level. Our method is highly selective toward ATP against other control molecules and can be performed in one single homogeneous solution, which makes our sensing approach hold great potential for sensitive colorimetric detection of other small molecules and proteins. Copyright © 2014 Elsevier B.V. All rights reserved.
BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.
Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun
2015-01-15
It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Targeting MED1 LxxLL Motifs for Tissue-Selective Treatment of Human Breast Cancer
2013-09-01
AU U UG AU AU CG UA GC au gc gc AA AA AU CG UA GC UA CG UA AU UA UA CG CG UA UA GC GC AU CG GC GU 5́ 3́ U U MG aptamer Survivin siRNA Folate ...DNA/RNA sequence FIGURE 19.5 Diagram of RNA nanoparticle harboring malachite green aptamer, survivin siRNA and folate -DNA/RNA sequence for targeting...modifications were extensively exam- ined to increase its stability in serum by fluori- nation, methylation , and addition of a 3’-3’-linked
Aptamer-Modified Magnetic Beads in Biosensing
Scheper, Thomas; Walter, Johanna-Gabriela
2018-01-01
Magnetic beads (MBs) are versatile tools for the purification, detection, and quantitative analysis of analytes from complex matrices. The superparamagnetic property of magnetic beads qualifies them for various analytical applications. To provide specificity, MBs can be decorated with ligands like aptamers, antibodies and peptides. In this context, aptamers are emerging as particular promising ligands due to a number of advantages. Most importantly, the chemical synthesis of aptamers enables straightforward and controlled chemical modification with linker molecules and dyes. Moreover, aptamers facilitate novel sensing strategies based on their oligonucleotide nature that cannot be realized with conventional peptide-based ligands. Due to these benefits, the combination of aptamers and MBs was already used in various analytical applications which are summarized in this article. PMID:29601533
Isolation and characterization of high affinity aptamers against DNA polymerase iota.
Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V
2012-02-01
Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.
Pi, Fengmei; Binzel, Daniel W.; Lee, Tae Jin; Li, Zhefeng; Sun, Meiyan; Rychahou, Piotr; Li, Hui; Haque, Farzin; Wang, Shaoying; Croce, Carlo M.; Guo, Bin; Evers, B. Mark; Guo, Peixuan
2018-01-01
Nanotechnology offers many benefits, and here we report an advantage of applying RNA nanotechnology for directional control. The orientation of arrow-shaped RNA was altered to control ligand display on extracellular vesicle membranes for specific cell targeting, or to regulate intracellular trafficking of small interfering RNA (siRNA) or microRNA (miRNA). Placing membrane-anchoring cholesterol at the tail of the arrow results in display of RNA aptamer or folate on the outer surface of the extracellular vesicle. In contrast, placing the cholesterol at the arrowhead results in partial loading of RNA nanoparticles into the extracellular vesicles. Taking advantage of the RNA ligand for specific targeting and extracellular vesicles for efficient membrane fusion, the resulting ligand-displaying extracellular vesicles were capable of specific delivery of siRNA to cells, and efficiently blocked tumour growth in three cancer models. Extracellular vesicles displaying an aptamer that binds to prostate-specific membrane antigen, and loaded with survivin siRNA, inhibited prostate cancer xenograft. The same extracellular vesicle instead displaying epidermal growth-factor receptor aptamer inhibited orthotopic breast cancer models. Likewise, survivin siRNA-loaded and folate-displaying extracellular vesicles inhibited patient-derived colorectal cancer xenograft.
Reconstruction of ancestral RNA sequences under multiple structural constraints.
Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme
2016-11-11
Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Wang, Zhaoyin; Zhao, Jian; Dai, Zhihui
2016-06-20
Herein, a label-free fluorescent adenosine triphosphate (ATP) aptasensor is fabricated with a DNA hairpin and an overhanging aptamer. In the presence of ATP, the overhanging sequences of the aptamer may form preferred substrates of exo III, and thus trigger the enzyme-assisted amplification, which results in the release of G-rich sequences. Free G-rich sequences subsequently generate an enhanced flourescent signal by binding with thioflavin T. However, if ATP is absent, the overhanging sequence can induce steric hindrance and protect the DNA hairpin against the digestion of exo III, significantly reducing the noise of this biosensor. Accordingly, the signal-to-noise ratio of the sensing system is greatly improved, which ensures the desirable analytical performance of the proposed aptasensor both in pure samples and real samples.
Reconstruction of ancestral RNA sequences under multiple structural constraints
Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me
2016-01-01
Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...
Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng
2018-05-09
Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.
Rapid Complexation of Aptamers by Their Specific Antidotes
Directory of Open Access Journals (Sweden)
Heidi Stoll
2017-06-01
Full Text Available Nucleic acid ligands, aptamers, harbor the unique characteristics of small molecules and antibodies. The specificity and high affinity of aptamers enable their binding to different targets, such as small molecules, proteins, or cells. Chemical modifications of aptamers allow increased bioavailability. A further great benefit of aptamers is the antidote (AD-mediated controllability of their effect. In this study, the AD-mediated complexation and neutralization of the thrombin binding aptamer NU172 and Toll-like receptor 9 (TLR9 binding R10-60 aptamer were determined. Thereby, the required time for the generation of aptamer/AD-complexes was analyzed at 37 °C in human serum using gel electrophoresis. Afterwards, the blocking of aptamers’ effects was analyzed by determining the activated clotting time (ACT in the case of the NU172 aptamer, or the expression of immune activation related genes IFN-1β, IL-6, CXCL-10, and IL-1β in the case of the R10-60 aptamer. Gel electrophoresis analyses demonstrated the rapid complexation of the NU172 and R10-60 aptamers by complementary AD binding after just 2 min of incubation in human serum. A rapid neutralization of anticoagulant activity of NU172 was also demonstrated in fresh human whole blood 5 min after addition of AD. Furthermore, the TLR9-mediated activation of PMDC05 cells was interrupted after the addition of the R10-60 AD. Using these two different aptamers, the rapid antagonizability of the aptamers was demonstrated in different environments; whole blood containing numerous proteins, cells, and different small molecules, serum, or cell culture media. Thus, nucleic acid ADs are promising molecules, which offer several possibilities for different in vivo applications, such as antagonizing aptamer-based drugs, immobilization, or delivery of oligonucleotides to defined locations.
International Nuclear Information System (INIS)
Kim, Gang-Il; Sung, Yun-Mo; Kim, Kyung-Woo; Oh, Min-Kyu
2009-01-01
High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ∼0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.
Russo Krauss, Irene; Napolitano, Valeria; Petraccone, Luigi; Troisi, Romualdo; Spiridonova, Vera; Mattia, Carlo Andrea; Sica, Filomena
2018-02-01
Recently, mixed duplex/quadruplex oligonucleotides have attracted great interest for use as biomedical aptamers. In the case of anti-thrombin aptamers, the addition of duplex-forming sequences to a G-quadruplex module identical or very similar to the best-known G-quadruplex of the Thrombin Binding Aptamer (HD1) results in new or improved biological properties, such as higher activity or different recognition properties with respect to HD1. Remarkably, this bimodular fold was hypothesized, based on its sequence, for the only anti-thrombin aptamer in advanced clinical trial, NU172. Whereas cation modulation of G-quadruplex conformation and stability is well characterized, only few data from similar analysis on duplex/quadruplex oligonucleotides exist. Here we have performed a characterization of structure and stability of four different duplex/quadruplex anti-thrombin aptamers, including NU172, in the presence of different cations and in physiological-mimicking conditions in comparison to HD1, by means of spectroscopic techniques (UV and circular dichroism) and differential scanning calorimetry. Our data show a strong reciprocal influence of each domain on the stability of the other and in particular suggest a stabilizing effect of the duplex region in the presence of solutions mimicking the physiological conditions, strengthening the idea that bimodular aptamers present better therapeutic potentialities than those containing a single G-quadruplex domain. Copyright © 2017 Elsevier B.V. All rights reserved.
Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.
Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk
2010-01-01
The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.
Mutation of miRNA target sequences during human evolution
DEFF Research Database (Denmark)
Gardner, Paul P; Vinther, Jeppe
2008-01-01
It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Aptamers as Both Drugs and Drug-Carriers
Directory of Open Access Journals (Sweden)
Md. Ashrafuzzaman
2014-01-01
Full Text Available Aptamers are short nucleic acid oligos. They may serve as both drugs and drug-carriers. Their use as diagnostic tools is also evident. They can be generated using various experimental, theoretical, and computational techniques. The systematic evolution of ligands by exponential enrichment which uses iterative screening of nucleic acid libraries is a popular experimental technique. Theory inspired methodology entropy-based seed-and-grow strategy that designs aptamer templates to bind specifically to targets is another one. Aptamers are predicted to be highly useful in producing general drugs and theranostic drugs occasionally for certain diseases like cancer, Alzheimer’s disease, and so on. They bind to various targets like lipids, nucleic acids, proteins, small organic compounds, and even entire organisms. Aptamers may also serve as drug-carriers or nanoparticles helping drugs to get released in specific target regions. Due to better target specific physical binding properties aptamers cause less off-target toxicity effects. Therefore, search for aptamer based drugs, drug-carriers, and even diagnostic tools is expanding fast. The biophysical properties in relation to the target specific binding phenomena of aptamers, energetics behind the aptamer transport of drugs, and the consequent biological implications will be discussed. This review will open up avenues leading to novel drug discovery and drug delivery.
Cibiel, Agnes; Nguyen Quang, Nam; Gombert, Karine; Thézé, Benoit; Garofalakis, Anikitos; Ducongé, Frédéric
2014-01-01
Background Cell-SELEX is now widely used for the selection of aptamers against cell surface biomarkers. However, despite negative selection steps using mock cells, this method sometimes results in aptamers against undesirable targets that are expressed both on mock and targeted cells. Studying these junk aptamers might be useful for further applications than those originally envisaged. Methodology/Principal Findings Cell-SELEX was performed to identify aptamers against CHO-K1 cells expressing human Endothelin type B receptor (ETBR). CHO-K1 cells were used for negative selection of aptamers. Several aptamers were identified but no one could discriminate between both cell lines. We decided to study one of these aptamers, named ACE4, and we identified that it binds to the Annexin A2, a protein overexpressed in many cancers. Radioactive binding assays and flow cytometry demonstrated that the aptamer was able to bind several cancer cell lines from different origins, particularly the MCF-7 cells. Fluorescence microscopy revealed it could be completely internalized in cells in 2 hours. Finally, the tumor targeting of the aptamer was evaluated in vivo in nude mice xenograft with MCF-7 cells using fluorescence diffuse optical tomography (fDOT) imaging. Three hours after intravenous injection, the aptamer demonstrated a significantly higher uptake in the tumor compared to a scramble sequence. Conclusions/Significance Although aptamers could be selected during cell-SELEX against other targets than those initially intended, they represent a potential source of ligands for basic research, diagnoses and therapy. Here, studying such aptamers, we identify one with high affinity for Annexin A2 that could be a promising tool for biomedical application. PMID:24489826
SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data
Directory of Open Access Journals (Sweden)
Yuxiang Tan
2015-01-01
Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.
sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.
Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai
2017-12-01
Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline
Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.
2017-01-01
Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500
Thimmaiah, Tim; Voje, William E; Carothers, James M
2015-01-01
With progress toward inexpensive, large-scale DNA assembly, the demand for simulation tools that allow the rapid construction of synthetic biological devices with predictable behaviors continues to increase. By combining engineered transcript components, such as ribosome binding sites, transcriptional terminators, ligand-binding aptamers, catalytic ribozymes, and aptamer-controlled ribozymes (aptazymes), gene expression in bacteria can be fine-tuned, with many corollaries and applications in yeast and mammalian cells. The successful design of genetic constructs that implement these kinds of RNA-based control mechanisms requires modeling and analyzing kinetically determined co-transcriptional folding pathways. Transcript design methods using stochastic kinetic folding simulations to search spacer sequence libraries for motifs enabling the assembly of RNA component parts into static ribozyme- and dynamic aptazyme-regulated expression devices with quantitatively predictable functions (rREDs and aREDs, respectively) have been described (Carothers et al., Science 334:1716-1719, 2011). Here, we provide a detailed practical procedure for computational transcript design by illustrating a high throughput, multiprocessor approach for evaluating spacer sequences and generating functional rREDs. This chapter is written as a tutorial, complete with pseudo-code and step-by-step instructions for setting up a computational cluster with an Amazon, Inc. web server and performing the large numbers of kinefold-based stochastic kinetic co-transcriptional folding simulations needed to design functional rREDs and aREDs. The method described here should be broadly applicable for designing and analyzing a variety of synthetic RNA parts, devices and transcripts.
Reconstruction of ancestral RNA sequences under multiple structural constraints
Directory of Open Access Journals (Sweden)
Olivier Tremblay-Savard
2016-11-01
Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX
Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong
2015-01-01
Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223
DEFF Research Database (Denmark)
Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.
2012-01-01
Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...
Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang
2014-03-05
RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.
APTAMER-BASED SERRS SENSOR FOR THROMBIN DETECTION
Energy Technology Data Exchange (ETDEWEB)
Cho, H; Baker, B R; Wachsmann-Hogiu, S; Pagba, C V; Laurence, T A; Lane, S M; Lee, L P; Tok, J B
2008-07-02
We describe an aptamer-based Surface Enhanced Resonance Raman Scattering (SERRS) sensor with high sensitivity, specificity, and stability for the detection of a coagulation protein, human a-thrombin. The sensor achieves high sensitivity and a limit of detection of 100 pM by monitoring the SERRS signal change upon the single step of thrombin binding to immobilized thrombin binding aptamer. The selectivity of the sensor is demonstrated by the specific discrimination of thrombin from other protein analytes. The specific recognition and binding of thrombin by the thrombin binding aptamer is essential to the mechanism of the aptamer-based sensor, as shown through measurements using negative control oligonucleotides. In addition, the sensor can detect 1 nM thrombin in the presence of complex biofluids, such as 10% fetal calf serum, demonstrating that the immobilized, 5{prime}-capped, 3{prime}-capped aptamer is sufficiently robust for clinical diagnostic applications. Furthermore, the proposed sensor may be implemented for multiplexed detection using different aptamer-Raman probe complexes.
A tale of two sequences: microRNA-target chimeric reads.
Broughton, James P; Pasquinelli, Amy E
2016-04-04
In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.
Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali
2016-09-01
Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Özlem Cesur
2015-06-01
Full Text Available Human papillomavirus (HPV is the most common viral infection of the reproductive tract, affecting both men and women. High-risk oncogenic types are responsible for almost 90% of anogenital and oropharyngeal cancers including cervical cancer. Some of the HPV “early” genes, particularly E6 and E7, are known to act as oncogenes that promote tumour growth and malignant transformation. Most notably, HPV-16 E7 interacts with the tumour suppressor protein pRb, promoting its degradation, leading to cell cycle dysregulation in infected cells. We have previously shown that an RNA aptamer (termed A2 selectively binds to HPV16 E7 and is able to induce apoptosis in HPV16-transformed cervical carcinoma cell lines (SiHa through reduction of E7 levels. In this study, we investigated the effects of the A2 aptamer on E7 localisation in order to define its effects on E7 activity. We demonstrate for the first time that E7 localised to the plasma membrane. In addition, we show that A2 enhanced E7 localisation in the ER and that the A2-mediated reduction of E7 was not associated with proteasomal degradation. These data suggest that A2 perturbs normal E7 trafficking through promoting E7 ER retention.
Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan
2016-10-07
RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential
Directory of Open Access Journals (Sweden)
Manal Helal
Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra
Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C
2018-03-29
The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.
Energy Technology Data Exchange (ETDEWEB)
Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang, Jin, E-mail: jinxxwang@263.net [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); Huang, Nan [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)
2016-11-15
Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.
International Nuclear Information System (INIS)
Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan
2016-01-01
Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.
"Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing.
Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger
2018-01-25
Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.
FRET-Aptamer Assays for Bone Marker Assessment, C-Telopeptide, Creatinine, and Vitamin D
Bruno, John G.
2013-01-01
called a "lights on" FRET response. The vitamin D aptamer beacon gives a "lights off" or inversely proportional fluorescence response to the amount of vitamin D present in diluted serum. These FRET-aptamer assays are rapid (<30 minutes), sensitive (low ng/mL detection limits), and quite easy to carry out (add sample, mix, and detect in the handheld reader). Benefits include the speed of the assays as well as the small amount of space taken up by the handheld reader and cuvette assays. The aptamer DNA sequences represent novel additional features of the existing (patent-pending) FRET-aptamer assay platform.
Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.
Directory of Open Access Journals (Sweden)
Thomas Birkballe Hansen
Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.
A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids.
Roncancio, Daniel; Yu, Haixiang; Xu, Xiaowen; Wu, Shuo; Liu, Ran; Debord, Joshua; Lou, Xinhui; Xiao, Yi
2014-11-18
We report a rapid and specific aptamer-based method for one-step cocaine detection with minimal reagent requirements. The feasibility of aptamer-based detection has been demonstrated with sensors that operate via target-induced conformational change mechanisms, but these have generally exhibited limited target sensitivity. We have discovered that the cocaine-binding aptamer MNS-4.1 can also bind the fluorescent molecule 2-amino-5,6,7-trimethyl-1,8-naphthyridine (ATMND) and thereby quench its fluorescence. We subsequently introduced sequence changes into MNS-4.1 to engineer a new cocaine-binding aptamer (38-GC) that exhibits higher affinity to both ligands, with reduced background signal and increased signal gain. Using this aptamer, we have developed a new sensor platform that relies on the cocaine-mediated displacement of ATMND from 38-GC as a result of competitive binding. We demonstrate that our sensor can detect cocaine within seconds at concentrations as low as 200 nM, which is 50-fold lower than existing assays based on target-induced conformational change. More importantly, our assay achieves successful cocaine detection in body fluids, with a limit of detection of 10.4, 18.4, and 36 μM in undiluted saliva, urine, and serum samples, respectively.
International Nuclear Information System (INIS)
Förster, Charlotte; Oberthuer, Dominik; Gao, Jiang; Eichert, André; Quast, Frederick G.; Betzel, Christian; Nitsche, Andreas; Erdmann, Volker A.; Fürste, Jens P.
2009-01-01
An all-LNA duplex was designed from the stem region of an RNA aptamer which has been generated against ricin. The LNA duplex was crystallized and preliminary X-ray diffraction analysis revealed diffraction to a resolution of up to 2.8 Å. Locked nucleic acids (LNAs) are modified nucleic acids which contain a modified sugar such as β-d-2′-O,4′-C methylene-bridged ribofuranose or other sugar derivatives in LNA analogues. The β-d-2′-O,4′-C methylene ribofuranose LNAs in particular possess high stability and melting temperatures, which makes them of interest for stabilizing the structure of different nucleic acids. Aptamers, which are DNAs or RNAs targeted against specific ligands, are candidates for substitution with LNAs in order to increase their stability. A 7-mer helix derived from the terminal part of an aptamer that was targeted against ricin was chosen. The ricin aptamer originally consisted of natural RNA building blocks and showed high affinity in ricin binding. For future stabilization of the aptamer, the terminal helix has been constructed as an ‘all-locked’ LNA and was successfully crystallized in order to investigate its structural properties. Optimization of crystal growth succeeded by the use of different metal salts as additives, such as CuCl 2 , MgCl 2 , MnCl 2 , CaCl 2 , CoCl 2 and ZnSO 4 . Preliminary X-ray diffraction data were collected and processed to 2.8 Å resolution. The LNA crystallized in space group P6 5 , with unit-cell parameters a = 50.11, b = 50.11, c = 40.72 Å. The crystals contained one LNA helix per asymmetric unit with a Matthews coefficient of 3.17 Å 3 Da −1 , which implies a solvent content of 70.15%
Predicting the Uncertain Future of Aptamer-Based Diagnostics and Therapeutics.
Bruno, John G
2015-04-16
Despite the great promise of nucleic acid aptamers in the areas of diagnostics and therapeutics for their facile in vitro development, lack of immunogenicity and other desirable properties, few truly successful aptamer-based products exist in the clinical or other markets. Core reasons for these commercial deficiencies probably stem from industrial commitment to antibodies including a huge financial investment in humanized monoclonal antibodies and a general ignorance about aptamers and their performance among the research and development community. Given the early failures of some strong commercial efforts to gain government approval and bring aptamer-based products to market, it may seem that aptamers are doomed to take a backseat to antibodies forever. However, the key advantages of aptamers over antibodies coupled with niche market needs that only aptamers can fill and more recent published data still point to a bright commercial future for aptamers in areas such as infectious disease and cancer diagnostics and therapeutics. As more researchers and entrepreneurs become familiar with aptamers, it seems inevitable that aptamers will at least be considered for expanded roles in diagnostics and therapeutics. This review also examines new aptamer modifications and attempts to predict new aptamer applications that could revolutionize biomedical technology in the future and lead to marketed products.
MicroRNA sequence motifs reveal asymmetry between the stem arms
DEFF Research Database (Denmark)
Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.
2006-01-01
The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...
International Nuclear Information System (INIS)
Jin, Fen; Lian, Yan; Li, Jishan; Zheng, Jing; Hu, Yaping; Liu, Jinhua; Huang, Jin; Yang, Ronghua
2013-01-01
Graphical abstract: Adenosine-binding aptamer was splitted into two fragments P2 and P3 which labeled pyrene molecules, mainly produce monomer signal. γ-CD cavity brings P2 and P3 in close proximity, allowing for weak excimer emission. In the presence of target, P2 and P3 are expected to bind ATP and form an aptamer/target complex, leads to large increase of the pyrene excimer fluorescence. -- Highlights: •We assembled split aptamer and γ-cyclodextrin fluorescence biosensors for ATP detection. •The biosensor increased quantum yield and emission lifetime of the excimer. •Time-resolved fluorescence is effective for ATP assay in complicated environment. -- Abstract: A highly sensitive and selective fluorescence aptamer biosensors for the determination of adenosine triphosphate (ATP) was developed. Binding of a target with splitting aptamers labeled with pyrene molecules form stable pyrene dimer in the γ-cyclodextrin (γ-CD) cavity, yielding a strong excimer emission. We have found that inclusion of pyrene dimer in γ-cyclodextrin cavity not only exhibits additive increases in quantum yield and emission lifetime of the excimer, but also facilitates target-induced fusion of the splitting aptamers to form the aptamer/target complex. As proof-of-principle, the approach was applied to fluorescence detection of adenosine triphosphate. With an anti-ATP aptamer, the approach exhibits excimer fluorescence response toward ATP with a maximum signal-to-background ratio of 32.1 and remarkably low detection limit of 80 nM ATP in buffer solution. Moreover, due to the additive fluorescence lifetime of excimer induced by γ-cyclodextrin, time-resolved measurements could be conveniently used to detect as low as 0.5 μM ATP in blood serum quantitatively
Cell-Specific Aptamers as Emerging Therapeutics
Directory of Open Access Journals (Sweden)
Cindy Meyer
2011-01-01
Full Text Available Aptamers are short nucleic acids that bind to defined targets with high affinity and specificity. The first aptamers have been selected about two decades ago by an in vitro process named SELEX (systematic evolution of ligands by exponential enrichment. Since then, numerous aptamers with specificities for a variety of targets from small molecules to proteins or even whole cells have been selected. Their applications range from biosensing and diagnostics to therapy and target-oriented drug delivery. More recently, selections using complex targets such as live cells have become feasible. This paper summarizes progress in cell-SELEX techniques and highlights recent developments, particularly in the field of medically relevant aptamers with a focus on therapeutic and drug-delivery applications.
From selection hits to clinical leads: progress in aptamer discovery
Directory of Open Access Journals (Sweden)
Keith E Maier
2016-01-01
Full Text Available Aptamers were discovered more than 25 years ago, yet only one has been approved by the US Food and Drug Administration to date. With some noteworthy advances in their chemical design and the enzymes we use to make them, aptamers and aptamer-based therapeutics have seen a resurgence in interest. New aptamer drugs are being approved for clinical evaluation, and it is certain that we will see increasingly more aptamers and aptamer-like drugs in the future. In this review, we will discuss the production of aptamers with an emphasis on the advances and modifications that enabled early aptamers to succeed in clinical trials as well as those that are likely to be important for future generations of these drugs.
DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data.
Tsuji, Junko; Weng, Zhiping
2016-01-01
With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.
Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.
Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C
2012-09-01
Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Study design requirements for RNA sequencing-based breast cancer diagnostics.
Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias
2016-02-01
Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.
Klerk, Eleonora de
2015-01-01
The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing
Organism-specific rRNA capture system for application in next-generation sequencing.
Directory of Open Access Journals (Sweden)
Sai-Kam Li
Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.
Aptamer-assembled nanomaterials for fluorescent sensing and imaging
Lu, Danqing; He, Lei; Zhang, Ge; Lv, Aiping; Wang, Ruowen; Zhang, Xiaobing; Tan, Weihong
2017-01-01
Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX), represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.
Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey
2016-10-01
sequence of loops in the G-quadruplex module provided an equilibrium of antiparallel and parallel G-quadruplexes that shifted with cation binding. In conclusion, structures of G-quadruplex aptamers are flexible enough and are fine-tuned with different cation coordination.
High throughput 16S rRNA gene amplicon sequencing
DEFF Research Database (Denmark)
Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup
S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
Aptamer-Based Molecular Recognition of Lysergamine, Metergoline and Small Ergot Alkaloids
Directory of Open Access Journals (Sweden)
Johan Robbens
2012-12-01
Full Text Available Ergot alkaloids are mycotoxins produced by fungi of the genus Claviceps, which infect cereal crops and grasses. The uptake of ergot alkaloid contaminated cereal products can be lethal to humans and animals. For food safety assessment, analytical techniques are currently used to determine the presence of ergot alkaloids in food and feed samples. However, the number of samples which can be analyzed is limited, due to the cost of the equipment and the need for skilled personnel. In order to compensate for the lack of rapid tests for the detection of ergot alkaloids, the aim of this study was to develop a specific recognition element for ergot alkaloids, which could be further applied to produce a colorimetric reaction in the presence of these toxins. As recognition elements, single-stranded DNA ligands were selected by using an iterative selection procedure named SELEX, i.e., Systematic Evolution of Ligands by EXponential enrichment. After several selection cycles, the resulting aptamers were cloned and sequenced. A surface plasmon resonance analysis enabled determination of the dissociation constants of the complexes of aptamers and lysergamine. Dissociation constants in the nanomolar range were obtained with three selected aptamers. One of the selected aptamers, having a dissociation constant of 44 nM, was linked to gold nanoparticles and it was possible to produce a colorimetric reaction in the presence of lysergamine. This system could also be applied to small ergot alkaloids in an ergot contaminated flour sample.
Generation of Internal-Image Functional Aptamers of Okadaic Acid via Magnetic-Bead SELEX
Directory of Open Access Journals (Sweden)
Chao Lin
2015-12-01
Full Text Available Okadaic acid (OA is produced by Dinophysis and Prorocentrum dinoflagellates and primarily accumulates in bivalves, and this toxin has harmful effects on consumers and operators. In this work, we first report the use of aptamers as novel non-toxic probes capable of binding to a monoclonal antibody against OA (OA-mAb. Aptamers that mimic the OA toxin with high affinity and selectivity were generated by the magnetic bead-assisted systematic evolution of ligands by exponential enrichment (SELEX strategy. After 12 selection rounds, cloning, sequencing and enzyme-linked immunosorbent assay (ELISA analysis, four candidate aptamers (O24, O31, O39, O40 were selected that showed high affinity and specificity for OA-mAb. The affinity constants of O24, O31, O39 and O40 were 8.3 × 108 M−1, 1.47 × 109 M−1, 1.23 × 109 M−1 and 1.05 × 109 M−1, respectively. Indirect competitive ELISA was employed to determine the internal-image function of the aptamers. The results reveal that O31 has a similar competitive function as free OA toxin, whereas the other three aptamers did not bear the necessary internal-image function. Based on the derivation of the curvilinear equation for OA/O31, the equation that defined the relationship between the OA toxin content and O31 was Y = 2.185X − 1.78. The IC50 of O31 was 3.39 ng·mL−1, which was close to the value predicted by the OA ELISA (IC50 = 4.4 ng·mL−1; the IC10 was 0.33 ng·mL−1. The above data provides strong evidence that internal-image functional aptamers could be applicable as novel probes in a non-toxic assay.
Huh, Jung Wook; Kim, Sung Chun; Sohn, Insuk; Jung, Sin-Ho; Kim, Hee Cheol
2016-01-01
Background In this study, we established and validated a model for predicting prognosis of stage IIA colon cancer patients based on expression profiles of aptamers in serum. Methods Bloods samples were collected from 227 consecutive patients with pathologic T3N0M0 (stage IIA) colon cancer. We incubated 1,149 serum molecule-binding aptamer pools of clinical significance with serum from patients to obtain aptamers bound to serum molecules, which were then amplified and marked. Oligonucleotide arrays were constructed with the base sequences of the 1,149 aptamers, and the marked products identified above were reacted with one another to produce profiles of the aptamers bound to serum molecules. These profiles were organized into low- and high-risk groups of colon cancer patients based on clinical information for the serum samples. Cox proportional hazards model and leave-one-out cross-validation (LOOCV) were used to evaluate predictive performance. Results During a median follow-up period of 5 years, 29 of the 227 patients (11.9%) experienced recurrence. There were 212 patients (93.4%) in the low-risk group and 15 patients (6.6%) in the high-risk group in our aptamer prognosis model. Postoperative recurrence significantly correlated with age and aptamer risk stratification (p = 0.046 and p = 0.001, respectively). In multivariate analysis, aptamer risk stratification (p recurrence. Disease-free survival curves calculated according to aptamer risk level predicted through a LOOCV procedure and age showed significant differences (p < 0.001 from permutations). Conclusion Aptamer risk stratification can be a valuable prognostic factor in stage II colon cancer patients. PMID:26908450
Phylogenetic relationships of Salmonella based on rRNA sequences
DEFF Research Database (Denmark)
Christensen, H.; Nordentoft, Steen; Olsen, J.E.
1998-01-01
separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa
2016-01-01
Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target
Capture, isolation and release of cancer cells with aptamer-functionalized glass bead array.
Wan, Yuan; Liu, Yaling; Allen, Peter B; Asghar, Waseem; Mahmood, M Arif Iftakher; Tan, Jifu; Duhon, Holli; Kim, Young-tae; Ellington, Andrew D; Iqbal, Samir M
2012-11-21
Early detection and isolation of circulating tumor cells (CTC) can enable better prognosis for cancer patients. A Hele-Shaw device with aptamer functionalized glass beads is designed, modeled, and fabricated to efficiently isolate cancer cells from a cellular mixture. The glass beads are functionalized with anti-epidermal growth factor receptor (EGFR) aptamer and sit in ordered array of pits in polydimethylsiloxane (PDMS) channel. A PDMS encapsulation is then used to cover the channel and to flow through cell solution. The beads capture cancer cells from flowing solution depicting high selectivity. The cell-bound glass beads are then re-suspended from the device surface followed by the release of 92% cells from glass beads using combination of soft shaking and anti-sense RNA. This approach ensures that the cells remain in native state and undisturbed during capture, isolation and elution for post-analysis. The use of highly selective anti-EGFR aptamer with the glass beads in an array and subsequent release of cells with antisense molecules provide multiple levels of binding and release opportunities that can help in defining new classes of CTC enumeration devices.
Recent progresses in biomedical applications of aptamer-functionalized systems.
Ding, Fei; Gao, Yangguang; He, Xianran
2017-09-15
Aptamers, known as "chemical antibodies" are screened via a combinational technology of systematic evolution of ligands by exponential enrichment (SELEX). Due to their specific targeting ability, high binding affinity, low immunogenicity and easy modification, aptamer-functionalized systems have been extensively applied in various fields and exhibit favorable results. However, there is still a long way for them to be commercialized, and few aptamer-functionalized systems have yet successfully entered clinical and industrial use. Thus, it is necessary to overview the recent research progresses of aptamer-functionalized systems for the researchers to improve or design novel and better aptamer-functionalized systems. In this review, we first introduce the recent progresses of aptamer-functionalized systems' applications in biosensing, targeted drug delivery, gene therapy and cancer cell imaging, followed by a discussion of the challenges faced with extensive applications of aptamer-functionalized systems and speculation of the future prospects of them. Copyright © 2017 Elsevier Ltd. All rights reserved.
Protein Detection with Aptamer Biosensors
Directory of Open Access Journals (Sweden)
Regina Stoltenburg
2008-07-01
Full Text Available Aptamers have been developed for different applications. Their use as new biological recognition elements in biosensors promises progress for fast and easy detection of proteins. This new generation of biosensor (aptasensors will be more stable and well adapted to the conditions of real samples because of the specific properties of aptamers.
Directory of Open Access Journals (Sweden)
Chen Chun
2008-03-01
Full Text Available Abstract Background With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. Results RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1 present a robust and effective way for RNA structural data compression; (2 design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. Conclusion A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool
Energy Technology Data Exchange (ETDEWEB)
Miranda, Alessandra Nunes Duarte
2017-07-01
The growing concern with invasive fungal infections, responsible for an alarming mortality rate of immunosuppressed patients and in Intensive Care Units, evidences the need for a fast and specific method for the Candida albicans detection, since this species is identified as one of the main causes of septicemia. Commonly, it is a challenge for clinicians to determine the primary infection foci, the dissemination degree, or whether the site of a particular surgery is involved. Although scintigraphic imaging represents a promising tool for infectious foci detection, it still lacks a methodology for C. albicans diagnosis due to the absence of specific radiotracers for this microorganism. Aptamers are molecules that have almost ideal properties for use as diagnostic radiopharmaceuticals, such as high specificity for their molecular targets, lack of immunogenicity and toxicity, high tissue penetration and rapid blood clearance. Aptamers can also be labeled with different radionuclides. This work aims to obtain aptamers for specific binding to C. albicans cells for future application as a radiopharmaceutical. It was used a variation of the SELEX (Systematic Evolution of Ligands by EXponential Enrichment) technique, termed cell-SELEX, in which cells are the targets for selection. A selection protocol was standardized using a random library of single-stranded oligonucleotides, each containing two fixed regions flanking a sequence of 40 random nucleotides. This library was incubated with C. albicans cells in the presence of competitors. Then, the binding sequences were separated by centrifugation, resuspended and amplified by PCR. The amplification was confirmed by agarose gel electrophoresis. After that, the ligands were purified to obtain a new pool of ssDNA, from which a new incubation was carried out. The selection parameters were gradually modified in order to increase stringency. This cycle was repeated 12 times to allow the selection of sequences with the maximum
Zheng, X; Hu, B; Gao, S X; Liu, D J; Sun, M J; Jiao, B H; Wang, L H
2015-07-01
Saxitoxin (STX), a member of the family of paralytic shellfish poisoning toxins, poses toxicological and ecotoxicological risks. To develop an analytical recognition element for STX, a DNA aptamer (APT(STX1)) was previously discovered via an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX) by Handy et al. Our study focused on generating an improved aptamer based on APT(STX1) through rational site-directed mutation and truncation. In this study, we generated the aptamer, M-30f, with a 30-fold higher affinity for STX compared with APT(STX1). The Kd value for M-30f was 133 nM, which was calculated by Bio-Layer Interferometry. After optimization, we detected and compared the interaction of STX with aptamers (APT(STX1) or M-30f) through several techniques (ELISA, cell bioassay, and mouse bioassay). Both aptamers' STX-binding ability was demonstrated in all three methods. Moreover, M-30f performs better than its parent sequence with higher suppressive activity against STX. As a molecular recognition element, M-30f has good prospects for practical application. Copyright © 2015 Elsevier Ltd. All rights reserved.
A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore
Energy Technology Data Exchange (ETDEWEB)
Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC
2014-08-21
Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.
Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin
Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo
2015-10-01
Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.
Selection and characterization of DNA aptamers
Ruigrok, V.J.B.
2013-01-01
This thesis focusses on the selection and characterisation of DNA aptamers and the various aspects related to their selection from large pools of randomized oligonucleotides. Aptamers are affinity tools that can specifically recognize and bind predefined target molecules; this ability, however,
Bayraç, Ceren; Öktem, Hüseyin Avni
2017-02-01
To monitor the specificity of Staphylococcus aureus aptamer (SA-31) against its target cell, we used enzyme-linked aptamer assay. In the presence of target cell, horseradish peroxidase-conjugated streptavidin bound to biotin-labeled SA-31 showed specific binding to S aureus among 3 different bacteria with limit of detection of 10 3 colony-forming unit per milliliter. The apparent K a was 1.39 μM -1 ± 0.3 μM -1 . The binding of SA-31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K a , ΔH, and ΔG). Since binding of aptamer to its targets solely depends on its 3-dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA-31 to its target on surface of bacteria. At 4°C, SA-31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA-31 slightly varied from K a = 1.56 μM -1 ± 0.69 μM -1 at 25°C to K a = 1.03 μM -1 ± 0.9 μM -1 at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S aureus aptamer to its target were also 9.44 μM -1 ± 0.38 μM -1 at 50mM, 1.60 μM -1 ± 0.11 μM -1 at 137mM, and 3.28 μM -1 ± 0.46 μM -1 at 200 mM of salt concentration. In this study, it was demonstrated that enzyme-linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S aureus. Copyright © 2016 John Wiley & Sons, Ltd.
Development of aptamers against unpurified proteins.
Goto, Shinichi; Tsukakoshi, Kaori; Ikebukuro, Kazunori
2017-12-01
SELEX (Systematic Evolution of Ligands by EXponential enrichment) has been widely used for the generation of aptamers against target proteins. However, its requirement for pure target proteins remains a major problem in aptamer selection, as procedures for protein purification from crude bio-samples are not only complicated but also time and labor consuming. This is because native proteins can be found in a large number of diverse forms because of posttranslational modifications and their complicated molecular conformations. Moreover, several proteins are difficult to purify owing to their chemical fragility and/or rarity in native samples. An alternative route is the use of recombinant proteins for aptamer selection, because they are homogenous and easily purified. However, aptamers generated against recombinant proteins produced in prokaryotic cells may not interact with the same proteins expressed in eukaryotic cells because of posttranslational modifications. Moreover, to date recombinant proteins have been constructed for only a fraction of proteins expressed in the human body. Therefore, the demand for advanced SELEX methods not relying on complicated purification processes from native samples or recombinant proteins is growing. This review article describes several such techniques that allow researchers to directly develop an aptamer from various unpurified samples, such as whole cells, tissues, serum, and cell lysates. The key advantages of advanced SELEX are that it does not require a purification process from a crude bio-sample, maintains the functional states of target proteins, and facilitates the development of aptamers against unidentified and uncharacterized proteins in unpurified biological samples. © 2017 Wiley Periodicals, Inc.
Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado
Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús
2012-01-01
A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).
Nucleic acid aptamers: an emerging frontier in cancer therapy.
Zhu, Guizhi; Ye, Mao; Donovan, Michael J; Song, Erqun; Zhao, Zilong; Tan, Weihong
2012-11-04
The last two decades have witnessed the development and application of nucleic acid aptamers in a variety of fields, including target analysis, disease therapy, and molecular and cellular engineering. The efficient and widely applicable aptamer selection, reproducible chemical synthesis and modification, generally impressive target binding selectivity and affinity, relatively rapid tissue penetration, low immunogenicity, and rapid systemic clearance make aptamers ideal recognition elements for use as therapeutics or for in vivo delivery of therapeutics. In this feature article, we discuss the development and biomedical application of nucleic acid aptamers, with emphasis on cancer cell aptamer isolation, targeted cancer therapy, oncology biomarker identification and drug discovery.
Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori
2006-11-01
The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Aptamer-Targeted Plasmonic Photothermal Therapy of Cancer
Directory of Open Access Journals (Sweden)
Olga S. Kolovskaya
2017-12-01
Full Text Available Novel nanoscale bioconjugates combining unique plasmonic photothermal properties of gold nanoparticles (AuNPs with targeted delivery using cell-specific DNA aptamers have a tremendous potential for medical diagnostics and therapy of many cell-based diseases. In this study, we demonstrate the high anti-cancer activity of aptamer-conjugated, 37-nm spherical gold nanoparticles toward Ehrlich carcinoma in tumor-bearing mice after photothermal treatment. The synthetic anti-tumor aptamers bring the nanoparticles precisely to the desired cells and selectively eliminate cancer cells after the subsequent laser treatment. To prove tumor eradication, we used positron emission tomography (PET utilizing radioactive glucose and computer tomography, followed by histological analysis of cancer tissue. Three injections of aptamer-conjugated AuNPs and 5 min of laser irradiations are enough to make the tumor undetectable by PET. Histological analysis proves PET results and shows lower damage of healthy tissue in addition to a higher treatment efficiency and selectivity of the gold nanoparticles functionalized with aptamers in comparison to control experiments using free unconjugated nanoparticles.
TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences
Directory of Open Access Journals (Sweden)
Sharma Gaurav
2011-04-01
Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Ieda Mendes
2013-08-01
were cloned. The product of recombination was used to transform Escherichia coli ToplOF'. The plasmid DNA from 40 selected colonies were extracted and quantified. The plasmids were sequenced, two different sequences (Antibac1 and Antibac2) were obtained and their secondary structures determined. The aptamers obtained were synthesized and labeled with {sup 32}p. The labeled aptamers were incubated with S. aureus cells and the amount of radiolabeled ssDNA was determined by liquid scintillation spectrometry. The oligonucleotides library labeled with {sup 32}p was used as control. For the aptamer Antibac1 the radiation linked to the pellet was 28 times higher than obtained with the control and for the Antibac2 was 22 higher. A specific assay was conducted with labeled aptamers using S. aureus, E. co ti, Candida albicans and human fibroblasts. For both aptamers (Antibac1 and Antibac2) binding to bacterial cells was significantly higher than for C. albicans and fibroblasts, demonstrating their specificity for bacteria. For B process, after 15 SELEX rounds was performed the cell-SELEX starting with the products 15th round being incubated with S. aureus cells. The amplified oligonucleotides were incubated again with the bacteria in the next round and so on. At the end of the 5 rounds of selection, the selected oligonucleotides were cloned and sequenced as in A process. Eleven different sequences from 21 clones were obtained and their secondary structures were determined. The aptamers obtained by process A showed high affinity and specificity for bacteria. The aptamers obtained by process B will be evaluated for these parameters in a future work. (author)
Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado
Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.
2012-01-01
A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720
Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Edge, Allison
2012-01-01
A dominant aptamer loop structure from a library of nearly 100 candidate aptamer sequences developed against immobilized 25-hydroxyvitamin D(3) (calcidiol) was converted into a 5'-TYE 665 and 3'-Iowa black-labelled aptamer beacon. The aptamer beacon exhibited a mild 'lights on' reaction in buffer as a function of increasing concentrations of several vitamin D analogues and metabolites, with a limit of detection of approximately 200 ng/mL, and was not specific for any particular congener. In 10% or 50% human serum, the same aptamer beacon inverted its fluorescence behaviour to become a more intense 'lights off' reaction with an improved limit of detection in the range 4-16 ng/mL. We hypothesized that this drastic change in fluorescence behaviour was due to the presence of creatinine and urea in serum, which might destabilize the quenched beacon, causing an increase in fluorescence followed by decreasing fluorescence as a function of vitamin D concentrations that may bind and quench increasingly greater fractions of the denatured beacons. However, the results of several control experiments in the presence of physiological or greater concentrations of creatinine and urea, alone or combined in buffer, failed to produce the beacon fluorescence inversion. Other possible mechanistic hypotheses are also discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems
Directory of Open Access Journals (Sweden)
Feng Jiang
2015-10-01
Full Text Available Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX, are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems.
RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.
Brule, C E; Dean, K M; Grayhack, E J
2016-01-01
The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.
Chlorin e6 Conjugated Interleukin-6 Receptor Aptamers Selectively Kill Target Cells Upon Irradiation
Directory of Open Access Journals (Sweden)
Sven Kruspe
2014-01-01
Full Text Available Photodynamic therapy (PDT uses the therapeutic properties of light in combination with certain chemicals, called photosensitizers, to successfully treat brain, breast, prostate, and skin cancers. To improve PDT, current research focuses on the development of photosensitizers to specifically target cancer cells. In the past few years, aptamers have been developed to directly deliver cargo molecules into target cells. We conjugated the photosensitizer chlorin e6 (ce6 with a human interleukin-6 receptor (IL-6R binding RNA aptamer, AIR-3A yielding AIR-3A-ce6 for application in high efficient PDT. AIR-3A-ce6 was rapidly and specifically internalized by IL-6R presenting (IL-6R+ cells. Upon light irradiation, targeted cells were selectively killed, while free ce6 did not show any toxic effect. Cells lacking the IL-6R were also not affected by AIR-3A-ce6. With this approach, we improved the target specificity of ce6-mediated PDT. In the future, other tumor-specific aptamers might be used to selectively localize photosensitizers into cells of interest and improve the efficacy and specificity of PDT in cancer and other diseases.
Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation.
Lao, Yeh-Hsing; Phua, Kyle K L; Leong, Kam W
2015-03-24
Aptamer nanomedicine, including therapeutic aptamers and aptamer nanocomplexes, is beginning to fulfill its potential in both clinical trials and preclinical studies. Especially in oncology, aptamer nanomedicine may perform better than conventional or antibody-based chemotherapeutics due to specificity compared to the former and stability compared to the latter. Many proof-of-concept studies on applying aptamers to drug delivery, gene therapy, and cancer imaging have shown promising efficacy and impressive safety in vivo toward translation. Yet, there remains ample room for improvement and critical barriers to be addressed. In this review, we will first introduce the recent progress in clinical trials of aptamer nanomedicine, followed by a discussion of the barriers at the design and in vivo application stages. We will then highlight recent advances and engineering strategies proposed to tackle these barriers. Aptamer cancer nanomedicine has the potential to address one of the most important healthcare issues of the society.
Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing
DEFF Research Database (Denmark)
Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf
2009-01-01
Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....
Identification of Bacterial Small RNAs by RNA Sequencing
DEFF Research Database (Denmark)
Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren
2014-01-01
sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....
SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.
Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver
2012-07-15
In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
The chemical structure of DNA sequence signals for RNA transcription
George, D. G.; Dayhoff, M. O.
1982-01-01
The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.
CD28 Aptamers as Powerful Immune Response Modulators
Directory of Open Access Journals (Sweden)
Fernando Pastor
2013-01-01
Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.
Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications.
Wen, Lin; Qiu, Liping; Wu, Yongxiang; Hu, Xiaoxiao; Zhang, Xiaobing
2017-07-28
Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.
Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications
Directory of Open Access Journals (Sweden)
Lin Wen
2017-07-01
Full Text Available Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.
3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.
Goldfarb, Katherine C; Cech, Thomas R
2013-09-21
Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.
Design Strategies for Aptamer-Based Biosensors
Han, Kun; Liang, Zhiqiang; Zhou, Nandi
2010-01-01
Aptamers have been widely used as recognition elements for biosensor construction, especially in the detection of proteins or small molecule targets, and regarded as promising alternatives for antibodies in bioassay areas. In this review, we present an overview of reported design strategies for the fabrication of biosensors and classify them into four basic modes: target-induced structure switching mode, sandwich or sandwich-like mode, target-induced dissociation/displacement mode and competitive replacement mode. In view of the unprecedented advantages brought about by aptamers and smart design strategies, aptamer-based biosensors are expected to be one of the most promising devices in bioassay related applications. PMID:22399891
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications
Directory of Open Access Journals (Sweden)
Annamaria eRuscito
2016-05-01
Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Small molecule alteration of RNA sequence in cells and animals.
Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D
2017-10-18
RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.
Common 5S rRNA variants are likely to be accepted in many sequence contexts
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Directory of Open Access Journals (Sweden)
Rajesh Ahirwar
Full Text Available An increase in the expression of estrogen receptors (ER and the expanded population of ER-positive cells are two common phenotypes of breast cancer. Detection of the aberrantly expressed ERα in breast cancer is carried out using ERα-antibodies and radiolabelled ligands to make decisions about cancer treatment and targeted therapy. Capitalizing on the beneficial advantages of aptamer over the conventional antibody or radiolabelled ligand, we have identified a DNA aptamer that selectively binds and facilitates the detection of ERα in human breast cancer tissue sections. The aptamer is identified using the high throughput sequencing assisted SELEX screening. Biophysical characterization confirms the binding and formation of a thermodynamically stable complex between the identified DNA aptamer (ERaptD4 and ERα (Ka = 1.55±0.298×108 M(-1; ΔH = 4.32×104±801.1 cal/mol; ΔS = -108 cal/mol/deg. Interestingly, the specificity measurements suggest that the ERaptD4 internalizes into ERα-positive breast cancer cells in a target-selective manner and localizes specifically in the nuclear region. To harness these characteristics of ERaptD4 for detection of ERα expression in breast cancer samples, we performed the aptamer-assisted histochemical analysis of ERα in tissue samples from breast cancer patients. The results were validated by performing the immunohistochemistry on same samples with an ERα-antibody. We found that the two methods agree strongly in assay output (kappa value = 0.930, p-value <0.05 for strong ERα positive and the ERα negative samples; kappa value = 0.823, p-value <0.05 for the weak/moderate ER+ve samples, n = 20. Further, the aptamer stain the ERα-positive cells in breast tissues without cross-reacting to ERα-deficient fibroblasts, adipocytes, or the inflammatory cells. Our results demonstrate a significant consistency in the aptamer-assisted detection of ERα in strong ERα positive, moderate ERα positive and ERα negative
Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor.
Yu, Xiaofan; Chen, Fang; Wang, Ronghui; Li, Yanbin
2018-01-20
The rapid detection of foodborne pathogens is critical to ensure food safety. The objective of this study is to select aptamers specifically bound to Escherichia coli O157:H7 using the whole-bacterium SELEX (Systematic Evolution of Ligands by Exponential Enrichment) and apply the selected aptamer to a QCM (quartz crystal microbalance) sensor for rapid and sensitive detection of target bacteria. A total of 19 rounds of selection against live E. coli O157:H7 and 6 rounds of counter selection against a mixture of Staphylococcus aureus, Listeria monocytogenes, and Salmonella Typhimurium, were performed. The aptamer pool from the last round was cloned and sequenced. One sequence S1 that appeared 16 times was characterized and a dissociation constant (K d ) of 10.30nM was obtained. Subsequently, a QCM aptasensor was developed for the rapid detection of E. coli O157:H7. The limit of detection (LOD) and the detection time of the aptasensor was determined to be 1.46×10 3 CFU/ml and 50min, respectively. This study demonstrated that the ssDNA aptamer selected by the whole-bacterium SELEX possessed higher sensitivity than previous work and the potential use of the constructed QCM aptasensor in rapid screening of foodborne pathogens. Copyright © 2017 Elsevier B.V. All rights reserved.
Development of aptamers for in vivo and in vitro biosensor applications
DEFF Research Database (Denmark)
Lauridsen, Lasse Holm
block chemicals are now being sustainably produced in bacterial cell-factories. The development of new bacterial cell-factories is a difficult and expensive process, in part due to time required to screen for and optimize productions strains. A new promising way of reducing the development time...... is generating new and faster ways of screening and optimizing using biosensors. In this thesis we develop new functional biological recognition modules for biosensors. These DNA- and RNA-based recognition modules are called aptamers and are developed to interact with targets of choice. Aptamers are developed...... application) and small molecule food additives (for optimization production in cell factories). Additionally, the characterization an all-polymer physicochemical biosensor is presented for the detection of antibiotics in food products. These results have lead to the ongoing development of a high...
Finding the most significant common sequence and structure motifs in a set of RNA sequences
DEFF Research Database (Denmark)
Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.
1997-01-01
We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...
Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu
2012-01-01
Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
A Conjugated Aptamer-Gold Nanoparticle Fluorescent Probe for Highly Sensitive Detection of rHuEPO-α
Directory of Open Access Journals (Sweden)
Zhaoyang Zhang
2011-11-01
Full Text Available We present here a novel conjugated aptamer-gold nanoparticle (Apt-AuNPs fluorescent probe and its application for specific detection of recombinant human erythropoietin-α (rHuEPO-α. In this nanobiosensor, 12 nm AuNPs function as both a nano-scaffold and a nano-quencher (fluorescent energy acceptor, on the surface of which the complementary sequences are linked (as cODN-AuNPs and pre-hybridized with carboxymethylfluorescein (FAM-labeled anti-rHuEPO-α aptamers. Upon target protein binding, the aptamers can be released from the AuNP surface and the fluorescence signal is restored. Key variables such as the length of linker, the hybridization site and length have been designed and optimized. Full performance evaluation including sensitivity, linear range and interference substances are also described. This nanobiosensor provides a promising approach for a simple and direct quantification of rHuEPO-α concentrations as low as 0.92 nM within a few hours.
CPSS: a computational platform for the analysis of small RNA deep sequencing data.
Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua
2012-07-15
Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.
Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.
Directory of Open Access Journals (Sweden)
Jan Zoll
Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
Directory of Open Access Journals (Sweden)
Felipe Opazo
2015-01-01
Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.
Development of an aptamer beacon for detection of interferon-gamma.
Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander
2010-03-01
Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.
Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer
2017-09-01
AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an
Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters
Akki, Spurti U.; Werth, Charles J.; Silverman, Scott K.
2015-01-01
© 2015 American Chemical Society. We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.
Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters
Akki, Spurti U.
2015-08-18
© 2015 American Chemical Society. We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.
Directory of Open Access Journals (Sweden)
Rana Nagarkatti
Full Text Available Trypanosoma cruzi, a blood-borne parasite, is the etiological agent of Chagas disease. T. cruzi trypomastigotes, the infectious life cycle stage, can be detected in blood of infected individuals using PCR-based methods. However, soon after a natural infection, or during the chronic phase of Chagas disease, the number of parasites in blood may be very low and thus difficult to detect by PCR. To facilitate PCR-based detection methods, a parasite concentration approach was explored. A whole cell SELEX strategy was utilized to develop serum stable RNA aptamers that bind to live T. cruzi trypomastigotes. These aptamers bound to the parasite with high affinities (8-25 nM range. The highest affinity aptamer, Apt68, also demonstrated high specificity as it did not interact with the insect stage epimastigotes of T. cruzi nor with other related trypanosomatid parasites, L. donovani and T. brucei, suggesting that the target of Apt68 was expressed only on T. cruzi trypomastigotes. Biotinylated Apt68, immobilized on a solid phase, was able to capture live parasites. These captured parasites were visible microscopically, as large motile aggregates, formed when the aptamer coated paramagnetic beads bound to the surface of the trypomastigotes. Additionally, Apt68 was also able to capture and aggregate trypomastigotes from several isolates of the two major genotypes of the parasite. Using a magnet, these parasite-bead aggregates could be purified from parasite-spiked whole blood samples, even at concentrations as low as 5 parasites in 15 ml of whole blood, as detected by a real-time PCR assay. Our results show that aptamers can be used as pathogen specific ligands to capture and facilitate PCR-based detection of T. cruzi in blood.
Complete sequence of RNA1 of grapevine Anatolian ringspot virus.
Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic
2012-10-01
The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.
High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.
Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M
2016-09-07
Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.
Zhang, Yinze; Wu, Fan; Wang, Manni; Zhuang, Naibao; Zhou, Huayou; Xu, Hua
2018-02-01
Rhesus (Rh) D antigen is the most important antigen in the Rh blood group system because of its strong immunogenicity. When RhD-negative individuals are exposed to RhD-positive blood, they may produce anti-D alloantibody, potentially resulting in delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn, which are difficult to treat. Inhibition of the binding of anti-D antibody with RhD antigens on the surface of red blood cells may effectively prevent immune haemolytic diseases. In this study, single-stranded (ss) DNA aptamers, specifically binding to anti-D antibodies, were selected via systematic evolution of ligands by exponential enrichment (SELEX) technology. After 14 rounds of selection, the purified ssDNA was sequenced using a Personal Genome Machine system. Haemagglutination inhibition assays were performed to screen aptamers for biological activity in terms of blocking antigen-antibody reactions: the affinity and specificity of the aptamers were also determined. In addition to high specificity, the aptamers which were selected showed high affinity for anti-D antibodies with dissociation constant (K d ) values ranging from 51.46±14.90 to 543.30±92.59 nM. By the combined use of specific ssDNA aptamer 7 and auxiliary ssDNA aptamer 2, anti-D could be effectively neutralised at low concentrations of the aptamers. Our results demonstrate that ssDNA aptamers may be a novel, promising strategy for the treatment of delayed haemolytic transfusion reactions and Rh haemolytic disease of the foetus and newborn.
Periostin-Binding DNA Aptamer Treatment Ameliorates Peritoneal Dialysis-Induced Peritoneal Fibrosis
Directory of Open Access Journals (Sweden)
Bo Young Nam
2017-06-01
Full Text Available Peritoneal fibrosis is a major complication in peritoneal dialysis (PD patients, which leads to dialysis discontinuation. Periostin, increased by transforming growth factor β1 (TGF-β1 stimulation, induces the expression of extracellular matrix (ECM genes. Aberrant periostin expression has been demonstrated to be associated with PD-related peritoneal fibrosis. Therefore, the effect of periostin inhibition by an aptamer-based inhibitor on peritoneal fibrosis was evaluated. In vitro, TGF-β1 treatment upregulated periostin, fibronectin, α-smooth muscle actin (α-SMA, and Snail expression and reduced E-cadherin expression in human peritoneal mesothelial cells (HPMCs. Periostin small interfering RNA (siRNA treatment ameliorated the TGF-β1-induced periostin, fibronectin, α-SMA, and Snail expression and restored E-cadherin expression in HPMCs. Similarly, the periostin-binding DNA aptamer (PA also attenuated fibronectin, α-SMA, and Snail upregulation and E-cadherin downregulation in TGF-β1-stimulated HPMCs. In mice treated with PD solution for 4 weeks, the expression of periostin, fibronectin, α-SMA, and Snail was significantly increased in the peritoneum, whereas E-cadherin expression was significantly decreased. The thickness of the submesothelial layer and the intensity of Masson’s trichrome staining in the PD group were significantly increased compared to the untreated group. These changes were significantly abrogated by the intraperitoneal administration of PA. These findings suggest that PA can be a potential therapeutic strategy for peritoneal fibrosis in PD patients.
Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri.
Shin, Woo-Ri; Sekhon, Simranjeet Singh; Rhee, Sung-Keun; Ko, Jung Ho; Ahn, Ji-Young; Min, Jiho; Kim, Yang-Hoon
2018-05-14
Aptamer-based paper strip sensor for detecting Vibrio fischeri was developed. Our method was based on the aptamer sandwich assay between whole live cells, V. fischeri and DNA aptamer probes. Following 9 rounds of Cell-SELEX and one of the negative-SELEX, V. fischeri Cell Aptamer (VFCA)-02 and -03 were isolated, with the former showing approximately 10-fold greater avidity (in the subnanomolar range) for the target cells when arrayed on a surface. The colorimetric response of a paper sensor based on VFCA-02 was linear in the range of 4 × 10 1 to 4 × 10 5 CFU/mL of target cell by using scanning reader. The linear regression correlation coefficient ( R 2 ) was 0.9809. This system shows promise for use in aptamer-conjugated gold nanoparticle probes in paper strip format for in-field detection of marine bioindicating bacteria.
High-Throughput Sequencing Based Methods of RNA Structure Investigation
DEFF Research Database (Denmark)
Kielpinski, Lukasz Jan
In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...
Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...
African Journals Online (AJOL)
Asdmin
2014-01-15
Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.
Directory of Open Access Journals (Sweden)
Santiago Grijalvo
2018-02-01
Full Text Available Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs or restoring the anomalous levels of non-coding RNAs (ncRNAs that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs, carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs, peptide nucleic acids (PNAs as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed.
Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).
Entzian, Clemens; Schubert, Thomas
2016-03-15
Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule. Copyright © 2015 Elsevier Inc. All rights reserved.
Ray, Partha; Rialon-Guevara, Kristy L; Veras, Emanuela; Sullenger, Bruce A; White, Rebekah R
2012-05-01
Most cases of pancreatic cancer are not diagnosed until they are no longer curable with surgery. Therefore, it is critical to develop a sensitive, preferably noninvasive, method for detecting the disease at an earlier stage. In order to identify biomarkers for pancreatic cancer, we devised an in vitro positive/negative selection strategy to identify RNA ligands (aptamers) that could detect structural differences between the secretomes of pancreatic cancer and non-cancerous cells. Using this molecular recognition approach, we identified an aptamer (M9-5) that differentially bound conditioned media from cancerous and non-cancerous human pancreatic cell lines. This aptamer further discriminated between the sera of pancreatic cancer patients and healthy volunteers with high sensitivity and specificity. We utilized biochemical purification methods and mass-spectrometric analysis to identify the M9-5 target as cyclophilin B (CypB). This molecular recognition-based strategy simultaneously identified CypB as a serum biomarker and generated a new reagent to recognize it in body fluids. Moreover, this approach should be generalizable to other diseases and complementary to traditional approaches that focus on differences in expression level between samples. Finally, we suggest that the aptamer we identified has the potential to serve as a tool for the early detection of pancreatic cancer.
Modeling bias and variation in the stochastic processes of small RNA sequencing.
Argyropoulos, Christos; Etheridge, Alton; Sakhanenko, Nikita; Galas, David
2017-06-20
The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.
Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L
1990-07-01
The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.
Li, Kun; Xiu, Chen-Lin; Gao, Li-Ming; Liang, Hua-Gang; Xu, Shu-Feng; Shi, Ming; Li, Jian; Liu, Zhi-Wei
2017-07-01
Lung cancer is by far the leading cause of cancer death in the world. Despite the improvements in diagnostic methods, the status of early detection was not achieved. So, a new diagnostic method is needed. The aim of this study is to obtain the highly specific nucleic acid aptamers with strong affinity to tumor markers in the serum of the lung cancer patients for targeting the serum. Aptamers specifically binding to tumor markers in the serum of the lung cancer patients were screened from the random single-stranded DNA library with agarose beads as supports and the serum as a target by target-substituting subtractive SELEX technique and real-time quantitative polymerase chain reaction technique. Subsequently, the secondary single-stranded DNA library obtained by 10 rounds of screening was amplified to double-stranded DNA, followed by high-throughput genome sequence analysis to screen aptamers with specific affinity to tumor markers in the serum of the lung cancer patients. Finally, six aptamers obtained by 10 rounds of screening were identified with high specific affinity to tumor markers in the serum of the lung cancer patients. Compared with other five aptamers, the aptamer 43 was identified both with the highest specificity to bind target molecule and without any obvious affinity to non-specific proteins. The screened aptamers have relatively high specificity to combine tumor markers in the serum of the lung cancer patients, which provides breakthrough points for early diagnosis and treatment of lung cancer.
Neves, Miguel A D; Shoara, Aron A; Reinstein, Oren; Abbasi Borhani, Okty; Martin, Taylor R; Johnson, Philip E
2017-10-27
Understanding how aptamer structure and function are related is crucial in the design and development of aptamer-based biosensors. We have analyzed a series of cocaine-binding aptamers with different lengths of their stem 1 in order to understand the role that this stem plays in the ligand-induced structure-switching binding mechanism utilized in many of the sensor applications of this aptamer. In the cocaine-binding aptamer, the length of stem 1 controls whether the structure-switching binding mechanism for this aptamer occurs or not. We varied the length of stem 1 from being one to seven base pairs long and found that the structural transition from unfolded to folded in the unbound aptamer is when the aptamer elongates from 3 to 4 base pairs in stem 1. We then used this knowledge to achieve new binding selectivity of this aptamer for quinine over cocaine by using an aptamer with a stem 1 two base pairs long. This selectivity is achieved by means of the greater affinity quinine has for the aptamer compared with cocaine. Quinine provides enough free energy to both fold and bind the 2-base pair-long aptamer while cocaine does not. This tuning of binding selectivity of an aptamer by reducing its stability is likely a general mechanism that could be used to tune aptamer specificity for tighter binding ligands.
Wickramasinghe, Rochana D; Ko Ferrigno, Paul; Roghi, Christian
2010-07-23
Peptide aptamers are combinatorial protein reagents that bind to targets with a high specificity and a strong affinity thus providing a molecular tool kit for modulating the function of their targets in vivo. Here we report the isolation of a peptide aptamer named swiggle that interacts with the very short (21 amino acid long) intracellular domain of membrane type 1-metalloproteinase (MT1-MMP), a key cell surface protease involved in numerous and crucial physiological and pathological cellular events. Expression of swiggle in mammalian cells was found to increase the cell surface expression of MT1-MMP by impairing its internalisation. Swiggle interacts with the LLY573 internalisation motif of MT1-MMP intracellular domain, thus disrupting the interaction with the mu2 subunit of the AP-2 internalisation complex required for endocytosis of the protease. Interestingly, swiggle-mediated inhibition of MT1-MMP clathrin-mediated internalisation was also found to promote MT1-MMP-mediated cell migration. Taken together, our results provide further evidence that peptide aptamers can be used to dissect molecular events mediated by individual protein domains, in contrast to the pleiotropic effects of RNA interference techniques.
Directory of Open Access Journals (Sweden)
Hideyuki Tamaki
Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.
3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing
2013-01-01
Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768
ISVASE: identification of sequence variant associated with splicing event using RNA-seq data.
Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Yu, Jun; Hu, Songnian
2017-06-28
Exon recognition and splicing precisely and efficiently by spliceosome is the key to generate mature mRNAs. About one third or a half of disease-related mutations affect RNA splicing. Software PVAAS has been developed to identify variants associated with aberrant splicing by directly using RNA-seq data. However, it bases on the assumption that annotated splicing site is normal splicing, which is not true in fact. We develop the ISVASE, a tool for specifically identifying sequence variants associated with splicing events (SVASE) by using RNA-seq data. Comparing with PVAAS, our tool has several advantages, such as multi-pass stringent rule-dependent filters and statistical filters, only using split-reads, independent sequence variant identification in each part of splicing (junction), sequence variant detection for both of known and novel splicing event, additional exon-exon junction shift event detection if known splicing events provided, splicing signal evaluation, known DNA mutation and/or RNA editing data supported, higher precision and consistency, and short running time. Using a realistic RNA-seq dataset, we performed a case study to illustrate the functionality and effectiveness of our method. Moreover, the output of SVASEs can be used for downstream analysis such as splicing regulatory element study and sequence variant functional analysis. ISVASE is useful for researchers interested in sequence variants (DNA mutation and/or RNA editing) associated with splicing events. The package is freely available at https://sourceforge.net/projects/isvase/ .
The RNA world, automatic sequences and oncogenetics
Energy Technology Data Exchange (ETDEWEB)
Tahir Shah, K
1993-04-01
We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.
The RNA world, automatic sequences and oncogenetics
International Nuclear Information System (INIS)
Tahir Shah, K.
1993-04-01
We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs
Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis
Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min
2015-11-01
MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.
International Nuclear Information System (INIS)
Lin, Zihan; Ma, Qiang; Fei, Xiaofang; Zhang, Hao; Su, Xingguang
2014-01-01
Graphical abstract: - Highlights: • The daunorubicin (DNR)-loaded MUC1 aptamer-NIR CuInS 2 QDs conjugates were developed. • DNR can intercalate into the double-stranded CG sequence of the MUC1 (CGA) 7 –QDs. The aptamer-QDs can sense DNR by the change of photoluminescence intensity of QDs. • The probe can image and sense the delivery of DNR to targeted prostate tumor cell. - Abstract: In this paper, a novel daunorubicin (DNR)-loaded MUC1 aptamer-near infrared (NIR) CuInS 2 quantum dot (DNR–MUC1–QDs) conjugates were developed, which can be used as a targeted cancer imaging and sensing system. After the NIR CuInS 2 QDs conjugated with the MUC1 aptamer–(CGA) 7 , DNR can intercalate into the double-stranded CG sequence of the MUC1–QDs. The incorporation of multiple CG sequences within the stem of the aptamers may further increase the loading efficiency of DNR on these conjugates. DNR–MUC1–QDs can be used to target prostate cancer cells. We evaluated the capacity of MUC1–CuInS 2 QDs for delivering DNR to cancer cells in vitro, and its binding affinity to MUC1-positive and MUC1-negative cells. This novel aptamer functionalized QDs bio-nano-system can not only deliver DNR to the targeted prostate cancer cells, but also can sense DNR by the change of photoluminescence intensity of CuInS 2 QDs, which concurrently images the cancer cells. The quenched fluorescence intensity of MUC1–QDs was proportional to the concentration of DNR in the concentration ranges of 33–88 nmol L −1 . The detection limit (LOD) for DNR was 19 nmol L −1 . We demonstrate the specificity and sensitivity of this DNR–MUC1–QDs probe as a cancer cell imaging, therapy and sensing system in vitro
Sequence analysis of L RNA of Lassa virus
International Nuclear Information System (INIS)
Vieth, Simon; Torda, Andrew E.; Asper, Marcel; Schmitz, Herbert; Guenther, Stephan
2004-01-01
The L RNA of three Lassa virus strains originating from Nigeria, Ghana/Ivory Coast, and Sierra Leone was sequenced and the data subjected to structure predictions and phylogenetic analyses. The L gene products had 2218-2221 residues, diverged by 18% at the amino acid level, and contained several conserved regions. Only one region of 504 residues (positions 1043-1546) could be assigned a function, namely that of an RNA polymerase. Secondary structure predictions suggest that this domain is very similar to RNA-dependent RNA polymerases of known structure encoded by plus-strand RNA viruses, permitting a model to be built. Outside the polymerase region, there is little structural data, except for regions of strong alpha-helical content and probably a coiled-coil domain at the N terminus. No evidence for reassortment or recombination during Lassa virus evolution was found. The secondary structure-assisted alignment of the RNA polymerase region permitted a reliable reconstruction of the phylogeny of all negative-strand RNA viruses, indicating that Arenaviridae are most closely related to Nairoviruses. In conclusion, the data provide a basis for structural and functional characterization of the Lassa virus L protein and reveal new insights into the phylogeny of negative-strand RNA viruses
Probing the Structure of DNA Aptamers with a Classic Heterocycle.
Directory of Open Access Journals (Sweden)
G. Reid Bishop
2004-02-01
Full Text Available DNA aptamers are synthetic, single-stranded DNA oligonucleotides selectedby SELEX methods for their binding with specific ligands. Here we present ethidiumbinding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARGthat bind L-argininamide (L-Arm. The ligand bound form of each aptamer's structurehas been reported and each are found to be composed primarily of two domainsconsisting of a stem helical region and a loop domain that forms a binding pocket for thecognate ligand. Previous thermodynamic experiments demonstrated that the DNAaptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Herewe extend those linkage binding studies by examining the binding of the heterocyclicintercalator ethidium to each of the three aptamers by fluorescence and absorptionspectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with∆Go's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for eachaptamer and is quantitatively diminished in the presence of L-Arm as is the overallfluorescence intensity of ethidium. Together, these results demonstrate that a portion ofthe bound ethidium is excluded from the aptamer in the presence of a saturating amountof L-Arm. These results demonstrate the utility of ethidium and related compounds forthe probing of non-conventional DNA structures and reveal an interesting fundamentalthermodynamic linkage in DNA aptamers. Results are discussed in the context of thethermodynamic stability and structure of each of the aptamers examined.
Directory of Open Access Journals (Sweden)
Hironobu Yanagisawa
2016-03-01
Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.
Preparation of highly multiplexed small RNA sequencing libraries.
Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos
2017-08-01
MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.
Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.
Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J
2017-10-18
Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the
Trends in the Design and Development of Specific Aptamers Against Peptides and Proteins.
Tabarzad, Maryam; Jafari, Marzieh
2016-04-01
Aptamers are single stranded oligonucleotides, comparable to monoclonal antibodies (mAbs) in selectivity and affinity and have significant strategic properties in design, development and applications more than mAbs. Ease of design and development, simple chemical modification and the attachment of functional groups, easily handling and more adaptability with analytical methods, small size and adaptation with nanostructures are the valuable characteristics of aptamers in comparison to large protein based ligands. Among a broad range of targets that their specific aptamers developed, proteins and peptides have significant position according to the number of related studies performed so far. Since proteins control many of important physiological and pathological incidents in the living organisms, particularly human beings and because of the benefits of aptamers in clinical and analytical applications, aptamer related technologies in the field of proteins and peptides are under progress, exclusively. Currently, there is only one FDA approved therapeutic aptamer in the pharmaceutical market, which is specific to vascular endothelial growth factor and is prescribed for age related macular degenerative disease. Additionally, there are several aptamers in the different phases of clinical trials. Almost all of these aptamers are specific to clinically important peptide or protein targets. In addition, the application of protein specific aptamers in the design and development of targeted drug delivery systems and diagnostic biosensors is another interesting field of aptamer technology. In this review, significant efforts related to development and applications of aptamer technologies in proteins and peptides sciences were considered to emphasis on the importance of aptamers in medicinal and clinical applications.
Accurate identification of RNA editing sites from primitive sequence with deep neural networks.
Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie
2018-04-16
RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.
Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer
DEFF Research Database (Denmark)
Opazo, Felipe; Eiden, Laura; Hansen, Line
2015-01-01
cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...
Directory of Open Access Journals (Sweden)
Ferrigno Paul
2010-07-01
Full Text Available Abstract Background Peptide aptamers are combinatorial protein reagents that bind to targets with a high specificity and a strong affinity thus providing a molecular tool kit for modulating the function of their targets in vivo. Results Here we report the isolation of a peptide aptamer named swiggle that interacts with the very short (21 amino acid long intracellular domain of membrane type 1-metalloproteinase (MT1-MMP, a key cell surface protease involved in numerous and crucial physiological and pathological cellular events. Expression of swiggle in mammalian cells was found to increase the cell surface expression of MT1-MMP by impairing its internalisation. Swiggle interacts with the LLY573 internalisation motif of MT1-MMP intracellular domain, thus disrupting the interaction with the μ2 subunit of the AP-2 internalisation complex required for endocytosis of the protease. Interestingly, swiggle-mediated inhibition of MT1-MMP clathrin-mediated internalisation was also found to promote MT1-MMP-mediated cell migration. Conclusions Taken together, our results provide further evidence that peptide aptamers can be used to dissect molecular events mediated by individual protein domains, in contrast to the pleiotropic effects of RNA interference techniques.
Single-Cell RNA Sequencing of Glioblastoma Cells.
Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G
2018-01-01
Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Directory of Open Access Journals (Sweden)
Sara Kangaspeska
Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
Target binding improves relaxivity in aptamer-gadolinium conjugates.
Bernard, Elyse D; Beking, Michael A; Rajamanickam, Karunanithi; Tsai, Eve C; Derosa, Maria C
2012-12-01
MRI contrast agents (CA) have been heavily used over the past several decades to enhance the diagnostic value of the obtained images. From a design perspective, two avenues to improve the efficacy of contrast agents are readily evident: optimization of magnetic properties of the CA, and optimization of the pharmacokinetics and distribution of the CA in the patient. Contrast agents consisting of DNA aptamer-gadolinium(III) conjugates provide a single system in which these factors can be addressed simultaneously. In this proof-of-concept study, the 15mer thrombin aptamer was conjugated to diethylenetriaminepentaacetic (DTPA) dianhydride to form a monoamide derivative of the linear open-chain chelate present in the commonly used contrast agent Magnevist(®). The stability of the conjugated DNA aptamer-DTPA-Gd(III) chelate in a transmetallation study using Zn(II) was found to be similar to that reported for DTPA-Gd(III). Relaxivity enhancements of 35 ± 4 and 20 ± 1 % were observed in the presence of thrombin compared to a control protein at fields of 9.4 and 1.5 T, respectively. The inclusion of spacers between the aptamer and the DTPA to eliminate possible steric effects was also investigated but not found to improve the relaxation enhancement achieved in comparison to the unaltered aptamer conjugate.
Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus
Cao, Xiaoxiao; Li, Shaohua; Chen, Liucun; Ding, Hongmei; Xu, Hua; Huang, Yanping; Li, Jie; Liu, Nongle; Cao, Weihong; Zhu, Yanjun; Shen, Beifen; Shao, Ningsheng
2009-01-01
In this article, a panel of ssDNA aptamers specific to Staphylococcus aureus was obtained by a whole bacterium-based SELEX procedure and applied to probing S. aureus. After several rounds of selection with S. aureus as the target and Streptococcus and S. epidermidis as counter targets, the highly enriched oligonucleic acid pool was sequenced and then grouped under different families on the basis of the homology of the primary sequence and the similarity of the secondary structure. Eleven sequ...
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H
2004-04-01
Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.
Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.
Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C
2016-07-01
Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.
incaRNAfbinv: a web server for the fragment-based design of RNA sequences
Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny
2016-01-01
Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893
Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish
Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.
2013-01-01
Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of
Aptamer Based Microsphere Biosensor for Thrombin Detection
Directory of Open Access Journals (Sweden)
Xudong Fan
2006-08-01
Full Text Available We have developed an optical microsphere resonator biosensor using aptamer asreceptor for the measurement of the important biomolecule thrombin. The sphere surface ismodified with anti-thrombin aptamer, which has excellent binding affinity and selectivityfor thrombin. Binding of the thrombin at the sphere surface is monitored by the spectralposition of the microsphere’s whispering gallery mode resonances. A detection limit on theorder of 1 NIH Unit/mL is demonstrated. Control experiments with non-aptameroligonucleotide and BSA are also carried out to confirm the specific binding betweenaptamer and thrombin. We expect that this demonstration will lead to the development ofhighly sensitive biomarker sensors based on aptamer with lower cost and higher throughputthan current technology.
Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life
DEFF Research Database (Denmark)
Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J
2016-01-01
Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...
Aptamer based electrochemical sensors for emerging environmental pollutants
Directory of Open Access Journals (Sweden)
Akhtar eHAYAT
2014-06-01
Full Text Available Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.
RNA-DNA sequence differences spell genetic code ambiguities
DEFF Research Database (Denmark)
Bentin, Thomas; Nielsen, Michael L
2013-01-01
A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...
MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.
Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W
2016-07-18
Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.
Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.
Lama, Lodoe; Ryan, Kevin
2016-01-01
Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.
2011-01-01
Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas
Aptamer-Mediated Polymeric Vehicles for Enhanced Cell-Targeted Drug Delivery.
Tan, Kei X; Danquah, Michael K; Sidhu, Amandeep; Yon, Lau Sie; Ongkudon, Clarence M
2018-02-08
The search for smart delivery systems for enhanced pre-clinical and clinical pharmaceutical delivery and cell targeting continues to be a major biomedical research endeavor owing to differences in the physicochemical characteristics and physiological effects of drug molecules, and this affects the delivery mechanisms to elicit maximum therapeutic effects. Targeted drug delivery is a smart evolution essential to address major challenges associated with conventional drug delivery systems. These challenges mostly result in poor pharmacokinetics due to the inability of the active pharmaceutical ingredients to specifically act on malignant cells thus, causing poor therapeutic index and toxicity to surrounding normal cells. Aptamers are oligonucleotides with engineered affinities to bind specifically to their cognate targets. Aptamers have gained significant interests as effective targeting elements for enhanced therapeutic delivery as they can be generated to specifically bind to wide range of targets including proteins, peptides, ions, cells and tissues. Notwithstanding, effective delivery of aptamers as therapeutic vehicles is challenged by cell membrane electrostatic repulsion, endonuclease degradation, low pH cleavage, and binding conformation stability. The application of molecularly engineered biodegradable and biocompatible polymeric particles with tunable features such as surface area and chemistry, particulate size distribution and toxicity creates opportunities to develop smart aptamer-mediated delivery systems for controlled drug release. This article discusses opportunities for particulate aptamer-drug formulations to advance current drug delivery modalities by navigating active ingredients through cellular and biomolecular traffic to target sites for sustained and controlled release at effective therapeutic dosages while minimizing systemic cytotoxic effects. A proposal for a novel drug-polymer-aptamer-polymer (DPAP) design of aptamer-drug formulation with
Development of an aptamer-based affinity purification method for vascular endothelial growth factor
Directory of Open Access Journals (Sweden)
Maren Lönne
2015-12-01
Full Text Available Since aptamers bind their targets with high affinity and specificity, they are promising alternative ligands in protein affinity purification. As aptamers are chemically synthesized oligonucleotides, they can be easily produced in large quantities regarding GMP conditions allowing their application in protein production for therapeutic purposes. Several advantages of aptamers compared to antibodies are described in general within this paper. Here, an aptamer directed against the human Vascular Endothelial Growth Factor (VEGF was used as affinity ligand for establishing a purification platform for VEGF in small scale. The aptamer was covalently immobilized on magnetic beads in a controlled orientation resulting in a functional active affinity matrix. Target binding was optimized by introduction of spacer molecules and variation of aptamer density. Further, salt-induced target elution was demonstrated as well as VEGF purification from a complex protein mixture proving the specificity of protein-aptamer binding.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
Aptamer-conjugated dendrimer-modified quantum dots for glioblastoma cells imaging
International Nuclear Information System (INIS)
Li Zhiming; Huang Peng; He Rong; Bao Chenchen; Cui Daxiang; Zhang Xiaomin; Ren Qiushi
2009-01-01
Targeted quantum dots have shown potential as a platform for development of cancer imaging. Aptamers have recently been demonstrated as ideal candidates for molecular targeting applications. In present work, polyamidoamine dendrimers were used to modify surface of quantum dots and improve their solubility in water solution. Then, dendrimer-modified quantum dots were conjugated with DNA aptamer, GBI-10, can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. The dendrimer-modified quantum dots exhibit water-soluble, high quantum yield, and good biocompatibility. Aptamer-conjugated quantum dots can specifically target U251 human glioblastoma cells. High-performance aptamer-conjugated dendrimers modified quantum dot-based nanoprobes have great potential in application such as cancer imaging.
Combinatorial selection of aptamers: new radioligands for in vivo molecular imaging
International Nuclear Information System (INIS)
Pestourie, C.
2005-10-01
Aptamers are oligonucleotide structures selected for their capacity to bind to a desired target. The first part of this work focuses on the selection of aptamers directed against the oncogenic form of the tyrosine kinase receptor Ret (RetC634Y). We compared different selection protocols: i) selection against the purified RetC634Y recombinant protein, ii) selection against whole living cells which express RetC634Y and iii) a crossover selection alternating between cells and recombinant protein. One aptamer, D4, was found to be able to inhibit Ret and to reverse the cell phenotype induced by the activation of the receptor. Then, we developed the in vivo use of the selected aptamers. Finally, we used the whole living cells selection protocol to develop aptamers against HLA-G. This protein is characterised by its function in immuno tolerance. Taken together, these studies should pave the way for the in vivo use of aptamers as new therapeutic and diagnostic agents for in vivo PET imaging. (author)
Directory of Open Access Journals (Sweden)
Flanagan Keith
2014-06-01
Full Text Available The rapid and cost-effective identification of bacterial species is crucial, especially for clinical diagnosis and treatment. Peptide aptamers have been shown to be valuable for use as a component of novel, direct detection methods. These small peptides have a number of advantages over antibodies, including greater specificity and longer shelf life. These properties facilitate their use as the detector components of biosensor devices. However, the identification of suitable aptamer targets for particular groups of organisms is challenging. We present a semi-automated processing pipeline for the identification of candidate aptamer targets from whole bacterial genome sequences. The pipeline can be configured to search for protein sequence fragments that uniquely identify a set of strains of interest. The system is also capable of identifying additional organisms that may be of interest due to their possession of protein fragments in common with the initial set. Through the use of Cloud computing technology and distributed databases, our system is capable of scaling with the rapidly growing genome repositories, and consequently of keeping the resulting data sets up-to-date. The system described is also more generically applicable to the discovery of specific targets for other diagnostic approaches such as DNA probes, PCR primers and antibodies.
Flanagan, Keith; Cockell, Simon; Harwood, Colin; Hallinan, Jennifer; Nakjang, Sirintra; Lawry, Beth; Wipat, Anil
2014-06-30
The rapid and cost-effective identification of bacterial species is crucial, especially for clinical diagnosis and treatment. Peptide aptamers have been shown to be valuable for use as a component of novel, direct detection methods. These small peptides have a number of advantages over antibodies, including greater specificity and longer shelf life. These properties facilitate their use as the detector components of biosensor devices. However, the identification of suitable aptamer targets for particular groups of organisms is challenging. We present a semi-automated processing pipeline for the identification of candidate aptamer targets from whole bacterial genome sequences. The pipeline can be configured to search for protein sequence fragments that uniquely identify a set of strains of interest. The system is also capable of identifying additional organisms that may be of interest due to their possession of protein fragments in common with the initial set. Through the use of Cloud computing technology and distributed databases, our system is capable of scaling with the rapidly growing genome repositories, and consequently of keeping the resulting data sets up-to-date. The system described is also more generically applicable to the discovery of specific targets for other diagnostic approaches such as DNA probes, PCR primers and antibodies.
MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing
Directory of Open Access Journals (Sweden)
Jisheng Li
2014-12-01
Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.
Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing
Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Evaluation of aptamers labelled with 99mTc for identification of Staphylococcus aureus bacteria
International Nuclear Information System (INIS)
dos Santos, Sara Roberta
2014-01-01
Staphylococcus aureus is specie of great medical importance because it is often associated with many infections in humans. This bacterium can cause diseases ranging from simple infections to life-threatening infections such as endocarditis, pneumonia, meningitis, toxic shock syndrome, septicemia, osteomyelitis, among others. S. aureus is the most commonly agent found in infections of the skin and soft tissues, bone infections and bone prostheses. The difficulty in early detection of specific foci caused by bacteria has raised the need to search for new techniques for this purpose. Diagnosis by scintigraphy has advantages over other methods because it is able to identify damage tissues without the need of invasive procedures and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis of bacterial infections, since specific radiopharmaceuticals were developed. Aptamers are oligonucleotides that have high affinity and specificity for their molecular targets and are emerging as a new class of molecules for radiopharmaceuticals development. Radiolabeled aptamers specific to the infectious agents, could give a significant contribution to the infection diagnosis by scintigraphy. In this study, aptamers selected to S. aureus were labeled with 99m Tc and used for the bacteria identification in vitro and in vivo. The aptamers labeled with 32 P and incubated in vitro with S. aureus cells showed high affinity for the bacterial cells when compared with the library of oligonucleotides with random sequences used as control. The aptamers labeled with 99m Tc also showed affinity for S. aureus cells when compared with the library, but unspecific binding was also verified. The 99m Tc labelled aptamers were stable in 0.9% saline, plasma of Swiss mice and in excess of cysteine. The in vivo biodistribution studies using Swiss mice with intramuscular infection in the right thigh showed that the aptamers labeled
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin
Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng
2016-02-01
Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.
Thrombin–aptamer recognition: a revealed ambiguity
Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena
2011-01-01
Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...
International Nuclear Information System (INIS)
Ara, Mst Naznin; Hyodo, Mamoru; Ohga, Noritaka; Akiyama, Kosuke; Hida, Kyoko; Hida, Yasuhiro; Shinohara, Nobuo; Harashima, Hideyoshi
2014-01-01
The identification of a specific biomarker involves the development of new clinical diagnostic tools, and an in-depth understanding of the disease at the molecular level. When new blood vessels form in tumor cells, endothelial cell production is induced, a process that plays a key role in disease progression and metastasis to distinct organs for solid tumor types. The present study reports on the identification of a new biomarker on primary cultured mouse tumor endothelial cells (mTECs) using our recently developed high-affinity DNA aptamer AraHH001 (K d = 43 nmol/L) assisted proteomics approach. We applied a strategy involving aptamer-facilitated biomarker discovery. Biotin-tagged AraHH001 was incubated with lysates of mTECs and the aptamer-proteins were then conjugated with streptavidin magnetic beads. Finally, the bound proteins were separated by sodiumdodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with silver staining. We identified troponin T via matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, the molecular target of aptamer AraHH001, and its presence was confirmed by measuring mRNA, protein levels, western blot, immunostaining, a gel shift assay of AraHH001 with troponin T. We first report here on the discovery of troponin T on mTECs, a promising and interesting diagnostic tool in the development of antiangiogenic therapy techniques the involves the targeting of the tumor vasculature
Small RNA sequencing reveals metastasis-related microRNAs in lung adenocarcinoma
DEFF Research Database (Denmark)
Daugaard, Iben; Venø, Morten T.; Yan, Yan
2017-01-01
The majority of lung cancer deaths are caused by metastatic disease. MicroRNAs (miRNAs) are posttranscriptional regulators of gene expression and miRNA dysregulation can contribute to metastatic progression. Here, small RNA sequencing was used to profile the miRNA and piwi-interacting RNA (piRNA......) transcriptomes in relation to lung cancer metastasis. RNA-seq was performed using RNA extracted from formalin-fixed paraffin embedded (FFPE) lung adenocarcinomas (LAC) and brain metastases from 8 patients, and LACs from 8 patients without detectable metastatic disease. Impact on miRNA and piRNA transcriptomes...... was subtle with 9 miRNAs and 8 piRNAs demonstrating differential expression between metastasizing and non-metastasizing LACs. For piRNAs, decreased expression of piR-57125 was the most significantly associated with distant metastasis. Validation by RT-qPCR in a LAC cohort comprising 52 patients confirmed...
Directory of Open Access Journals (Sweden)
Hoorig Nassanian
2007-08-01
Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.
Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants
Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...
On the optimal trimming of high-throughput mRNA sequence data
Directory of Open Access Journals (Sweden)
Matthew D MacManes
2014-01-01
Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.
Energy Technology Data Exchange (ETDEWEB)
Duan, Nuo; Wu, Shijia [State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122 (China); Yu, Ye [Zhangjiagang Entry-Exit Inspection and Quarantine Bureau, Zhangjiangang 215600 (China); Ma, Xiaoyuan; Xia, Yu; Chen, Xiujuan; Huang, Yukun [State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122 (China); Wang, Zhouping, E-mail: wangzp@jiangnan.edu.cn [State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122 (China)
2013-12-04
Graphical abstract: -- Highlights: •Two bacteria were simultaneously detected using QD-apt as labels by flow cytometry. •QD-apt were used for recognition and fluorescence detection of two bacteria. •The method was applied successfully for bacteria detection in real samples. -- Abstract: A sensitive, specific method for the collection and detection of pathogenic bacteria was demonstrated using quantum dots (QDs) as a fluorescence marker coupled with aptamers as the molecular recognition element by flow cytometry. The aptamer sequences were selected using a bacterium-based SELEX strategy in our laboratory for Vibrio parahaemolyticus and Salmonella typhimurium that, when applied in this method, allows for the specific recognition of the bacteria from complex mixtures including shrimp samples. Aptamer-modified QDs (QD-apt) were employed to selectively capture and simultaneously detect the target bacteria with high sensitivity using the fluorescence of the labeled QDs. The signal intensity is amplified due to the high photostability of QDs nanoparticles, resulting in improved sensitivity over methods using individual dye-labeled probes. This proposed method is promising for the sensitive detection of other pathogenic bacteria in food stuff if suitable aptamers are chosen. The method may also provide another potential platform for the application of aptamer-conjugated QDs in flow cytometry.
International Nuclear Information System (INIS)
Duan, Nuo; Wu, Shijia; Yu, Ye; Ma, Xiaoyuan; Xia, Yu; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping
2013-01-01
Graphical abstract: -- Highlights: •Two bacteria were simultaneously detected using QD-apt as labels by flow cytometry. •QD-apt were used for recognition and fluorescence detection of two bacteria. •The method was applied successfully for bacteria detection in real samples. -- Abstract: A sensitive, specific method for the collection and detection of pathogenic bacteria was demonstrated using quantum dots (QDs) as a fluorescence marker coupled with aptamers as the molecular recognition element by flow cytometry. The aptamer sequences were selected using a bacterium-based SELEX strategy in our laboratory for Vibrio parahaemolyticus and Salmonella typhimurium that, when applied in this method, allows for the specific recognition of the bacteria from complex mixtures including shrimp samples. Aptamer-modified QDs (QD-apt) were employed to selectively capture and simultaneously detect the target bacteria with high sensitivity using the fluorescence of the labeled QDs. The signal intensity is amplified due to the high photostability of QDs nanoparticles, resulting in improved sensitivity over methods using individual dye-labeled probes. This proposed method is promising for the sensitive detection of other pathogenic bacteria in food stuff if suitable aptamers are chosen. The method may also provide another potential platform for the application of aptamer-conjugated QDs in flow cytometry
MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing
Directory of Open Access Journals (Sweden)
Marcus Menger
2016-07-01
Full Text Available Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either “evolution in the test tube” of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs. The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the “biological” degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.
Aptamer based vanillin sensor using an ion-sensitive field-effect transistor.
Kuznetsov, Alexander; Komarova, Natalia; Andrianova, Maria; Grudtsov, Vitaliy; Kuznetsov, Evgeniy
2017-12-02
An aptamer for vanillin was obtained and then used for the development of an aptasensor based on an ion-sensitive field-effect transistor (ISFET). This aptamer (a single-stranded DNA;ssDNA) was selected using the Capture-SELEX protocol, which suites well for selection of aptamers to small molecules. Among six aptamer candidates, the aptamer Van_74 with the highest affinity for vanillin was chosen (elution of 35% of the aptamer from a solid support in the presence of 2 mM of vanillin). Van_74 was characterized using nondenaturating PAGE of washouts from magnetic beads. It is shown that Van_74 binds to vanillin with an dissociation constant of >7.8 μM (determined by nondenaturating PAGE) and it was specific to vanillin in comparison with interferents: benzaldehyde, guaiacol, furaneol, ethyl guaiacol and ethyl vanillin. Also it was shown that change of buffer composition greatly affected the binding ability of Van_74. For biosensor fabrication aptamer was immobilised on the Ta 2 O 5 -sensitive surface of the ISFET via "click-chemistry". Detection scheme implied dehybridisation of the ssDNA probe from the aptamer and release in the solution during the addition of vanillin. As a result, the surface potential increase upon vanillin binding with the aptamer was detected by the transistor. The biosensor had a detection limit of 1.55 × 10 -7 M and a dynamic range from 1.55 × 10 -7 M to 1 × 10 -6 M. Effective constant K d,eff for vanillin binding on biosensor surface was calculated to be (9 ± 3) × 10 -7 M. This allows selective detection of vanillin in the mixture of interferents and in samples of coffee extract. Graphical abstract A biosensor for vanillin was developed on the basis of an aptamer that was obtained via Capture-SELEX and by using an ISFET. This biosensor can be used for vanillin detection in presence of interferents and in real sample using an approach of ssDNA probe dehybridization.
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)
2013-07-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.
2013-01-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
Directory of Open Access Journals (Sweden)
Nicholas J Schurch
Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.
Aptamer-based radioimmunotherapy. The feasibility and prospect in cancer therapy
International Nuclear Information System (INIS)
Li Li; Hui Wang; Shujie Liao; Wei Li; Weina Zhang; Dan Liu; Bo Cao; Shixuan Wang; Ding Ma; Wei Wang; Nanfang Hospital, Southern Medical University, Guangzhou; Xiangshang Xu; Keng Shen
2011-01-01
Radioimmunotherapy (RIT) has emerged as an attractive and promising strategy for the management of malignant diseases. It has been proven to be quite effective in the treatment of numerous tumors, such as non-Hodgkin lymphoma, metastatic prostate cancer, melanoma, thyroid cancer, colon cancer and so on. The RIT currently used is mainly based on monoclonal antibodies to recognize target antigens. As antibodies are large molecules, this method of RIT has some limitations in in vivo use, such as the immunogenicity, the high costs and low efficiency of production. Aptamer is discovered and selected by SELEX technology. As specific recognizers and binders, aptamers and antibodies have such a close similarity as to be interchangeable to some extent. But, aptamers have many advantages over antibodies: higher affinity and specificity, smaller molecular weight, more easily synthesized and modified, more rapidly penetrating into tumors, higher tumor-to-blood distribution ratio and more easily to be cleared. In addition, since aptamer has almost no immunogenicity in vivo, it can be repeatedly administered. Thus, we believe that aptamer-based RIT will be a feasible and promising way to treat human cancers, and it might display better results in cancer treatment than antibody-based RIT. In conclusion, aptamer-based RIT is hopeful to become a key therapeutics in cancer radiotherapy in the near future. (author)
Genetic selection and DNA sequences of 4.5S RNA homologs
DEFF Research Database (Denmark)
Brown, S; Thon, G; Tolentino, E
1989-01-01
A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
Osteomyelitis diagnosis by 99mTc radiolabeled aptamers
International Nuclear Information System (INIS)
Santos, S.R.; Ferreira, I.M.; Andrade, A.S.R.; Barros, A.L.B.; Cardoso, V.N.; Diniz, O.F.
2015-01-01
Osteomyelitis, which is characterized by progressive inflammatory destruction and new opposition of bone, is still a difficult infection to treat. The clinical diagnosis in late stages is achieved easily, but an early diagnosis is more challenging. Staphylococcus aureus is a common agent found in osteomyelitis and bone prostheses infection. Diagnosis by scintigraphy has advantages because it is a non-invasive procedure and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis since specific radiopharmaceuticals were developed. In this study, aptamers selected to Staphylococcus aureus were labeled with 99m Tc and used for bacteria identification in an osteomyelitis experimental model. The aptamers selected to S. aureus were directly labelled with 99m Tc and were evaluated by biodistribution studies. Wistar rats with intraosseous infection in the right paw were used. A random aptamer labelled with 99m Tc was as control. Six animals were used in each group. The aptamers labeled with 99m Tc were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 2,23 ± 0,20, after 3 h. The control group presented a target/non-target ratio 1,08 ± 0.23. The results indicated that the radiolabeled aptamers were able to identify specifically the infection foci and they should be further explored for infection diagnosis by scintigraphy. (author)
Lou, Tzu-Fang; Weidmann, Chase A; Killingsworth, Jordan; Tanaka Hall, Traci M; Goldstrohm, Aaron C; Campbell, Zachary T
2017-04-15
RNA-binding proteins (RBPs) collaborate to control virtually every aspect of RNA function. Tremendous progress has been made in the area of global assessment of RBP specificity using next-generation sequencing approaches both in vivo and in vitro. Understanding how protein-protein interactions enable precise combinatorial regulation of RNA remains a significant problem. Addressing this challenge requires tools that can quantitatively determine the specificities of both individual proteins and multimeric complexes in an unbiased and comprehensive way. One approach utilizes in vitro selection, high-throughput sequencing, and sequence-specificity landscapes (SEQRS). We outline a SEQRS experiment focused on obtaining the specificity of a multi-protein complex between Drosophila RBPs Pumilio (Pum) and Nanos (Nos). We discuss the necessary controls in this type of experiment and examine how the resulting data can be complemented with structural and cell-based reporter assays. Additionally, SEQRS data can be integrated with functional genomics data to uncover biological function. Finally, we propose extensions of the technique that will enhance our understanding of multi-protein regulatory complexes assembled onto RNA. Copyright © 2016 Elsevier Inc. All rights reserved.
Targeted therapy of hepatocellular carcinoma with aptamer-functionalized biodegradable nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Weigum, Shannon, E-mail: sweigum@txstate.edu [Texas State University, Department of Biology (United States); McIvor, Elizabeth; Munoz, Christopher; Feng, Richard [Texas State University, Department of Chemistry and Biochemistry (United States); Cantu, Travis [Texas State University, Materials Science, Engineering, and Commercialization Program (United States); Walsh, Kyle [Texas State University, Department of Chemistry and Biochemistry (United States); Betancourt, Tania, E-mail: tania.betancourt@txstate.edu [Texas State University, Materials Science, Engineering, and Commercialization Program (United States)
2016-11-15
Hepatocellular carcinoma (HCC) is the most common form of liver cancer, occurring primarily in regions where viral hepatitis infections are common. Unfortunately, most HCC cases remain undiagnosed until late stages of the disease when patient outcome is poor, typically limiting survival from a few months to a year after initial diagnosis. In order to better care for HCC patients, new target-specific approaches are needed to improve early detection and therapeutic intervention. In this work, polymeric nanoparticles functionalized with a HCC-specific aptamer were examined as potential targeted drug delivery vehicles. Specifically, doxorubicin-loaded nanoparticles were prepared via nanoprecipitation of blends of poly(lactic-co-glycolic acid)-b-poly(ethylene glycol). These particles were further functionalized with the HCC-specific TLS11a aptamer. The in vitro interaction and therapeutic efficacy of the aptamer and aptamer-functionalized nanoparticles were characterized in a hepatoma cell line. Nanoparticles were found to be spherical in shape, roughly 100–125 nm in diameter, with a low polydispersity (≤0.2) and slightly negative surface potential. Doxorubicin was encapsulated within the particles at ~40 % efficiency. Drug release was found to occur through anomalous transport influenced by diffusion and polymer relaxation, releasing ~50 % doxorubicin in the first 10 h and full release occurring within 36 h. Confocal microscopy confirmed binding and attachment of aptamer-targeted nanoparticles to the cell surface of cultured HCC cells. Efficacy studies demonstrated a significant improvement in doxorubicin delivery and cell-killing capacity using the aptamer-functionalized, drug-loaded nanoparticles versus controls further supporting use of aptamer nanoparticles as a targeted drug delivery system for HCC tumors.
Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering
Energy Technology Data Exchange (ETDEWEB)
Ardjomandi, N.; Huth, J. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Stamov, D.R. [JPK Instruments AG, Berlin (Germany); Henrich, A. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Klein, C. [Dental Practice Zahngesundheit Waiblingen, Waiblingen (Germany); Wendel, H.-P. [Department of Thoracic, Cardiac and Vascular Surgery, University Hospital, Tübingen (Germany); Reinert, S. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Alexander, D., E-mail: dorothea.alexander@med.uni-tuebingen.de [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany)
2016-10-01
Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. - Highlights: • Covalent binding of aptamer 74 on PLGA-coated β-tricalcium phosphate constructs. • AFM analysis of rupture forces between aptamer 74 and jaw periosteal cells. • Analysis of jaw periosteal cell functions on aptamer coated β-TCP constructs.
Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering
International Nuclear Information System (INIS)
Ardjomandi, N.; Huth, J.; Stamov, D.R.; Henrich, A.; Klein, C.; Wendel, H.-P.; Reinert, S.; Alexander, D.
2016-01-01
Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. - Highlights: • Covalent binding of aptamer 74 on PLGA-coated β-tricalcium phosphate constructs. • AFM analysis of rupture forces between aptamer 74 and jaw periosteal cells. • Analysis of jaw periosteal cell functions on aptamer coated β-TCP constructs.
Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.
Directory of Open Access Journals (Sweden)
Malachi Griffith
2015-08-01
Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.
The role of upstream sequences in selecting the reading frame on tmRNA
Directory of Open Access Journals (Sweden)
Dewey Jonathan D
2008-06-01
Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.
Luo, Zhaofeng; Zhou, Hongmin; Jiang, Hao; Ou, Huichao; Li, Xin; Zhang, Liyun
2015-04-21
Aptamers have attracted much attention due to their ability to bind to target molecules with high affinity and specificity. The development of an approach capable of efficiently generating aptamers through systematic evolution of ligands by exponential enrichment (SELEX) is particularly challenging. Herein, a fraction collection approach in capillary electrophoresis SELEX (FCE-SELEX) for the partition of a bound DNA-target complex is developed. By integrating fraction collection with a facile oil seal method for avoiding contamination while amplifying the bound DNA-target complex, in a single round of selection, a streptavidin-binding aptamer (SBA) has been generated. The affinity of aptamer SBA-36 for streptavidin (SA) is determined as 30.8 nM by surface plasmon resonance (SPR). Selectivity and biotin competition experiments demonstrate that the SBA-36 aptamer selected by FCE-SELEX is as efficient as those from other methods. Based on the ability of fraction collection in partition and collection of the aptamer-target complex from the original DNA library, FCE-SELEX can be a universal tool for the development of aptamers.
StarScan: a web server for scanning small RNA targets from degradome sequencing data.
Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu
2015-07-01
Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Evaluation of different strategies for magnetic particle functionalization with DNA aptamers.
Pérez-Ruiz, Elena; Lammertyn, Jeroen; Spasic, Dragana
2016-12-25
The optimal bio-functionalization of magnetic particles is essential for developing magnetic particle-based bioassays. Whereas functionalization with antibodies is generally well established, immobilization of DNA probes, such as aptamers, is not yet fully explored. In this work, four different types of commercially available magnetic particles, coated with streptavidin, maleimide or carboxyl groups, were evaluated for their surface coverage with aptamer bioreceptors, efficiency in capturing target protein and non-specific protein adsorption on their surface. A recently developed aptamer against the peanut allergen, Ara h 1 protein, was used as a model system. Conjugation of biotinylated Ara h 1 aptamer to the streptavidin particles led to the highest surface coverage, whereas the coverage of maleimide particles was 25% lower. Carboxylated particles appeared to be inadequate for DNA functionalization. Streptavidin particles also showed the greatest target capturing efficiency, comparable to the one of particles functionalized with anti-Ara h 1 antibody. The performance of streptavidin particles was additionally tested in a sandwich assay with the aptamer as a capture receptor on the particle surface. While the limit of detection obtained was comparable to the same assay system with antibody as capture receptor, it was superior to previously reported values using the same aptamer in similar assay schemes with different detection platforms. These results point to the promising application of the Ara h 1 aptamer-functionalized particles in bioassay development. Copyright © 2016 Elsevier B.V. All rights reserved.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Energy Technology Data Exchange (ETDEWEB)
Song, Min Young [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Jurng, Jongsoo [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Park, Young-Kwon [School of Environmental Engineering, University of Seoul, Seoulsiripdae-ro 163, Dongdaemun-gu, Seoul 02504 (Korea, Republic of); Kim, Byoung Chan, E-mail: bchankim@kist.re.kr [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of)
2016-11-15
Highlights: • Aptamer-conjugated TiO{sub 2} was developed for target-specific bacterial inactivation. • TiO{sub 2}-aptamer cocktail can enhance inactivation of target bacteria faster than TiO{sub 2}. • TiO{sub 2}-aptamer cocktail can enhance inactivation of target bacteria in mixed culture. • Efficient ROS transfer to the bacteria is caused by close contact of TiO{sub 2}-aptamer. - Abstract: We developed TiO{sub 2} particles conjugated with an Escherichia coli surface-specific ssDNA aptamer cocktail (composed of three different aptamers isolated from E. coli) for targeted and enhanced disinfection of E. coli. We examined the target-specific and enhanced inactivation of this composite (TiO{sub 2}-Apc), which were compared to those of TiO{sub 2} conjugated with a single aptamer (one of the three different aptamers, TiO{sub 2}-Aps) and non-modified TiO{sub 2}. We found that TiO{sub 2}-Apc enhanced the inactivation of targeted E. coli under UV irradiation compared to both the non-modified TiO{sub 2} and TiO{sub 2}-Aps. A higher number of TiO{sub 2}-Apc than TiO{sub 2}-Aps particles was observed on the surface of E. coli. The amount of TiO{sub 2}-Apc required to inactivate ∼99.9% of E. coli (10{sup 6} CFU/ml) was 10 times lower than that of non-modified TiO{sub 2}. The close proximity of functionalized particles with E. coli resulting from the interaction between the target surface and the aptamer induced the efficient and fast transfer of reactive oxygen species to the cells. In a mixed culture of different bacteria (E. coli and Staphylococcus epidermidis), TiO{sub 2}-Apc enhanced the inactivation of only E. coli. Taken together, these results support the use of aptamer cocktail-conjugated TiO{sub 2} for improvement of the target-specific inactivation of bacteria.
Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping
Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.
2018-05-01
Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.
Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing
Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li
2010-01-01
Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resoluti...
Unifying cancer and normal RNA sequencing data from different sources
Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus
2018-01-01
Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468
Kavruk, M; Celikbicak, O; Ozalp, V C; Borsa, B A; Hernandez, F J; Bayramoglu, G; Salih, B; Arica, M Y
2015-05-18
In this study, we designed aptamer-gated nanocapsules for the specific targeting of cargo to bacteria with controlled release of antibiotics based on aptamer-receptor interactions. Aptamer-gates caused a specific decrease in minimum inhibitory concentration (MIC) values of vancomycin for Staphylococcus aureus when mesoporous silica nanoparticles (MSNs) were used for bacteria-targeted delivery.
Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I
2013-01-01
Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.
International Nuclear Information System (INIS)
Mi Jing; Zhang Xiuwu; Giangrande, Paloma H.; McNamara, James O.; Nimjee, Shahid M.; Sarraf-Yazdi, Shiva; Sullenger, Bruce A.; Clary, Bryan M.
2005-01-01
αvβ3 integrin is a crucial factor involved in a variety of physiological processes, such as cell growth and migration, tumor invasion and metastasis, angiogenesis, and wound healing. αvβ3 integrin exerts its effect by regulating endothelial cell (EC) migration, proliferation, and survival. Inhibiting the function of αvβ3 integrin, therefore, represents a potential anti-cancer, anti-thrombotic, and anti-inflammatory strategy. In this study, we tested an RNA aptamer, Apt-αvβ3 that binds recombinant αvβ3 integrin, for its ability to bind endogenous αvβ3 integrin on the surface of cells in culture and to subsequently affect cellular response. Our data illustrate that Apt-αvβ3 binds αvβ3 integrin expressed on the surface of live HUVECs. This interaction significantly decreases both basal and PDGF-induced cell proliferation as well as inhibition of cell adhesion. Apt-αvβ3 can also reduce PDGF-stimulated tube formation and increase HUVEC apoptosis through inhibition of FAK phosphorylation pathway. Our results demonstrate that by binding to its target, Apt-αvβ3 can efficiently inhibit human EC proliferation and survival, resulting in reduced angiogenesis. It predicts that Apt-αvβ3 could become useful in both tumor imaging and the treatment of tumor growth, atherosclerosis, thrombosis, and inflammation
Directory of Open Access Journals (Sweden)
David Kryza
Full Text Available The human Matrix MetalloProtease-9 (hMMP-9 is overexpressed in tumors where it promotes the release of cancer cells thus contributing to tumor metastasis. We raised aptamers against hMMP-9, which constitutes a validated marker of malignant tumors, in order to design probes for imaging tumors in human beings. A chemically modified RNA aptamer (F3B, fully resistant to nucleases was previously described. This compound was subsequently used for the preparation of F3B-Cy5, F3B-S-acetylmercaptoacetyltriglycine (MAG and F3B-DOTA. The binding properties of these derivatives were determined by surface plasmon resonance and electrophoretic mobility shift assay. Optical fluorescence imaging confirmed the binding to hMMP-9 in A375 melanoma bearing mice. Quantitative biodistribution studies were performed at 30 min, 1h and 2 h post injection of 99mTc-MAG-aptamer and 111In-DOTA-F3B. 99mTc radiolabeled aptamer specifically detected hMMP-9 in A375 melanoma tumors but accumulation in digestive tract was very high. Following i.v. injection of 111In-DOTA-F3B, high level of radioactivity was observed in kidneys and bladder but digestive tract uptake was very limited. Tumor uptake was significantly (student t test, p<0.05 higher for 111In-DOTA-F3B with 2.0%ID/g than for the 111In-DOTA-control oligonucleotide (0.7%ID/g with tumor to muscle ratio of 4.0. Such difference in tumor accumulation has been confirmed by ex vivo scintigraphic images performed at 1h post injection and by autoradiography, which revealed the overexpression of hMMP-9 in sections of human melanomas. These results demonstrate that F3B aptamer is of interest for detecting hMMP-9 in melanoma tumor.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers
National Research Council Canada - National Science Library
Fan, Maomian; Roper, Shelly; Andrews, Carrie; Allman, Amity; Bruno, John; Kiel, Jonathan
2008-01-01
...). This process has been used to select aptamers against different types of targets (Bacillus anthracis spores, Bacillus thuringiensis spores, MS-2 bacteriophage, ovalbumin, and botulinum neurotoxin...
Zou, Ying; Duan, Nuo; Wu, Shijia; Shen, Mofei; Wang, Zhouping
2018-06-06
Enterohemorrhagic Escherichia coli O157:H7 ( E. coli O157:H7) is known as an important food-borne pathogen related to public health. In this study, aptamers which could bind to different stages of E. coli O157:H7 (adjustment phase, log phase, and stationary phase) with high affinity and specificity were obtained by the whole cell-SELEX method through 14 selection rounds including three counter-selection rounds. Altogether, 32 sequences were obtained, and nine families were classified to select the optimal aptamer. To analyze affinity and specificity by flow cytometer, an ssDNA aptamer named Apt-5 was picked out as the optimal aptamer that recognizes different stages of E. coli O157:H7 specifically with the K d value of 9.04 ± 2.80 nM. In addition, in order to study the binding mechanism, target bacteria were treated by proteinase K and trypsin, indicating that the specific binding site is not protein on the cell membrane. Furthermore, when we treated E. coli O157:H7 with EDTA, the result showed that the binding site might be lipopolysaccharide (LPS) on the outer membrane of E. coli O157:H7.
Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking
Directory of Open Access Journals (Sweden)
Le Meuth-Metzinger Valerie
2002-06-01
Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.
Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).
Watters, Kyle E; Lucks, Julius B
2016-01-01
Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences
Directory of Open Access Journals (Sweden)
Robert C. Edgar
2018-04-01
Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.
A novel RNA sequencing data analysis method for cell line authentication.
Directory of Open Access Journals (Sweden)
Erik Fasterius
Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.
Glutamate Receptor Aptamers and ALS
National Research Council Canada - National Science Library
Niu, Li
2008-01-01
.... An aptamer is a single-stranded nucleic acid that directly inhibits a protein's function by folding into a specific tertiary structure that dictates high-affinity binding to the target protein...
Development of Aptamer Beacons for Antemortem Diagnosis of Chronic Wasting Disease
National Research Council Canada - National Science Library
Clinkenbeard, Kenneth D
2005-01-01
.... Once selected, the CWD aptamers will be configured as aptamer beacons that can act as molecular switches to turn "on" a novel and highly sensitive diagnostic technology termed amplifying fluorescing polymer...
Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%
DEFF Research Database (Denmark)
Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.
2005-01-01
detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...
Use of Aptamers as Diagnostics Tools and Antiviral Agents for Human Viruses
Directory of Open Access Journals (Sweden)
Víctor M. González
2016-12-01
Full Text Available Appropriate diagnosis is the key factor for treatment of viral diseases. Time is the most important factor in rapidly developing and epidemiologically dangerous diseases, such as influenza, Ebola and SARS. Chronic viral diseases such as HIV-1 or HCV are asymptomatic or oligosymptomatic and the therapeutic success mainly depends on early detection of the infective agent. Over the last years, aptamer technology has been used in a wide range of diagnostic and therapeutic applications and, concretely, several strategies are currently being explored using aptamers against virus proteins. From a diagnostics point of view, aptamers are being designed as a bio-recognition element in diagnostic systems to detect viral proteins either in the blood (serum or plasma or into infected cells. Another potential use of aptamers is for therapeutics of viral infections, interfering in the interaction between the virus and the host using aptamers targeting host-cell matrix receptors, or attacking the virus intracellularly, targeting proteins implicated in the viral replication cycle. In this paper, we review how aptamers working against viral proteins are discovered, with a focus on recent advances that improve the aptamers’ properties as a real tool for viral infection detection and treatment.
In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis.
Savory, Nasa; Lednor, Danielle; Tsukakoshi, Kaori; Abe, Koichi; Yoshida, Wataru; Ferri, Stefano; Jones, Brian V; Ikebukuro, Kazunori
2013-10-01
Proteus mirabilis is a prominent cause of catheter-associated urinary tract infections (CAUTIs) among patients undergoing long-term bladder catheterization. There are currently no effective means of preventing P. mirabilis infections, and strategies for prophylaxis and rapid early diagnosis are urgently required. Aptamers offer significant potential for development of countermeasures against P. mirabilis CAUTI and are an ideal class of molecules for the development of diagnostics and therapeutics. Here we demonstrate the application of Cell-SELEX to identify DNA aptamers that show high affinity for P. mirabilis. While the aptamers identified displayed high affinity for P. mirabilis cells in dot blotting assays, they also bound to other uropathogenic bacteria. To improve aptamer specificity for P. mirabilis, an in silico maturation (ISM) approach was employed. Two cycles of ISM allowed the identification of an aptamer showing 36% higher specificity, evaluated as a ratio of binding signal for P. mirabilis to that for Escherichia coli (also a cause of CAUTI and the most common urinary tract pathogen). Aptamers that specifically recognize P. mirabilis would have diagnostic and therapeutic values and constitute useful tools for studying membrane-associated proteins in this organism. Copyright © 2013 Wiley Periodicals, Inc.
Synthetic mRNA devices that detect endogenous proteins and distinguish mammalian cells.
Kawasaki, Shunsuke; Fujita, Yoshihiko; Nagaike, Takashi; Tomita, Kozo; Saito, Hirohide
2017-07-07
Synthetic biology has great potential for future therapeutic applications including autonomous cell programming through the detection of protein signals and the production of desired outputs. Synthetic RNA devices are promising for this purpose. However, the number of available devices is limited due to the difficulty in the detection of endogenous proteins within a cell. Here, we show a strategy to construct synthetic mRNA devices that detect endogenous proteins in living cells, control translation and distinguish cell types. We engineered protein-binding aptamers that have increased stability in the secondary structures of their active conformation. The designed devices can efficiently respond to target proteins including human LIN28A and U1A proteins, while the original aptamers failed to do so. Moreover, mRNA delivery of an LIN28A-responsive device into human induced pluripotent stem cells (hiPSCs) revealed that we can distinguish living hiPSCs and differentiated cells by quantifying endogenous LIN28A protein expression level. Thus, our endogenous protein-driven RNA devices determine live-cell states and program mammalian cells based on intracellular protein information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Beasley, Jonathan [Ames Laboratory (AMES), Ames, IA (United States)
2013-01-01
In this thesis, we explore both total syntheses and methodologies of several aromatic heterocyclic molecules. Extensions of the Kraus indole synthesis toward 2-substituted and 2,3-disubstituted indoles, as well as biologically attractive indolo[2,1-a]isoquinolines are described. Recent renewable efforts directed to commodity maleic acid and the first reported furan-based ionic liquids are described. Our total synthesis of mRNA aptamer ligand PDC-Gly, and its dye coupled forms, plus aminoglycoside dye coupled ligands used in molecular imaging, are described.
Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1.
Huang, Yukun; Chen, Xiujuan; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Wei, Xinlin; Wang, Yuanfeng
2015-01-01
Enterotoxins from pathogenic bacteria are known as the main reason that can cause the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in vitro by twelve rounds of selection based on magnetic separation technology, with a low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. Aptamer-based quantification of SEC1 in the food sample by a graphene oxide (GO)-based method was implemented to investigate the potential of the aptamer against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, biosensors using the selected SEC1 aptamers as new molecular recognition elements could be applied for innovative determinations of SEC1. Copyright © 2014 Elsevier Ltd. All rights reserved.
Development of Aptamer Beacons for Antemortem Diagnosis of Chronic Wasting Disease
National Research Council Canada - National Science Library
Clinkenbeard, Kenneth
2004-01-01
.... Once selected, the CWD aptamers will be configured as aptamer beacons that can act as molecular switches to turn on a novel and highly sensitive diagnostic technology termed amplifying fluorescing polymer. Objective...
International Nuclear Information System (INIS)
Wang, Hai-Yan; Song, Ze-Yang; Zhang, Hui-Sheng; Chen, Si-Ping
2016-01-01
The α-hemolysin (αHL) nanopore is capable of analyzing DNA duplex and DNA aptamer as they can be electrophoretically driven into the vestibule from the cis entrance. The current study describes the competitive interaction induced by Pb 2+ that changes the secondary structure of DNA duplex in asymmetrical electrolyte solution. DNA duplex formed by the partial complementary DNA and DNA aptamer sequence produced unzipping blockages with the dwell unzipping time lasting 2.84 ± 0.7 ms. By cation-DNA interaction with Pb 2+ , the DNA duplex will unwind and then form Pb 2+ -stabilized-DNA aptamer, which will be captured and unfolded in vestibule. The pore conductance were reduced to 54 % and 94 % with mean dwell unfolding times of 165 ± 12 ms. The competitive behavior between Pb 2+ and single-strand DNA was further utilized to detect Pb 2+ in solution with a detection limit of 0.5 nM. This nanopore platform also provides a powerful tool for studying the cation-DNA interactions in DNA aptamer conformational changes. Thus, the results drawn from these studies provide insights into the applications of α-hemolysin nanopore as a molecular sieve to different DNA secondary structure in future application of nanopore analysis. (author)
Label free luminescence strategy for sensitive detection of ATP using aptamer-Ru(II) complexes
Energy Technology Data Exchange (ETDEWEB)
Babu, Eththilu [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Muthu Mareeswaran, Paulpandian [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Department of Industrial Chemistry, Alagappa Univesity, Karaikudi 630003, Tamil Nadu (India); Ramdass, Arumugam [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Research Department of Chemistry, Aditanar College of Arts and Science, Tiruchendur 628216, Tamil Nadu (India); Ramesh, Pandian [UCIBIO-REQUIMTE, Departmento de Química, Faculdade de Ciências e Tecnologia, Universidade NOVA de Lisboa, 2829-516 Caparica (Portugal); Rajagopal, Seenivasan, E-mail: rajagopalseenivasan@yahoo.com [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India)
2016-07-15
A simple and sensitive aptamer-based luminescence strategy for ATP detection is developed using Ru(II) complexes as probe molecule. It is based on the fact that Ru(II)-dppz complexes show the light switching behavior with DNA aptamers and found to show significant luminescence spectral change on the addition of ATP molecules. The binding efficiencies of aptamer with ATP, ADP and AMP are calculated and compared. The structural change of aptamer is also studied using circular dichroism (CD) spectral techniques. Moreover, the binding nature of aptamer with ATP, ADP and AMP is demonstrated by computational techniques. The proposed strategy was successfully applied to the detection of ATP.
Label free luminescence strategy for sensitive detection of ATP using aptamer-Ru(II) complexes
International Nuclear Information System (INIS)
Babu, Eththilu; Muthu Mareeswaran, Paulpandian; Ramdass, Arumugam; Ramesh, Pandian; Rajagopal, Seenivasan
2016-01-01
A simple and sensitive aptamer-based luminescence strategy for ATP detection is developed using Ru(II) complexes as probe molecule. It is based on the fact that Ru(II)-dppz complexes show the light switching behavior with DNA aptamers and found to show significant luminescence spectral change on the addition of ATP molecules. The binding efficiencies of aptamer with ATP, ADP and AMP are calculated and compared. The structural change of aptamer is also studied using circular dichroism (CD) spectral techniques. Moreover, the binding nature of aptamer with ATP, ADP and AMP is demonstrated by computational techniques. The proposed strategy was successfully applied to the detection of ATP.
Combined sequencing of mRNA and DNA from human embryonic stem cells
Directory of Open Access Journals (Sweden)
Florian Mertes
2016-06-01
Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.
Osteomyelitis diagnosis by {sup 99m}Tc radiolabeled aptamers
Energy Technology Data Exchange (ETDEWEB)
Santos, S.R.; Ferreira, I.M.; Andrade, A.S.R., E-mail: sararoberta7@hotmail.com, E-mail: imendesf@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, A.L.B.; Cardoso, V.N.; Diniz, O.F., E-mail: brancodebarros@yahoo.com.br, E-mail: valbertcardoso@yahoo.com.br, E-mail: simoneodilia@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas
2015-07-01
Osteomyelitis, which is characterized by progressive inflammatory destruction and new opposition of bone, is still a difficult infection to treat. The clinical diagnosis in late stages is achieved easily, but an early diagnosis is more challenging. Staphylococcus aureus is a common agent found in osteomyelitis and bone prostheses infection. Diagnosis by scintigraphy has advantages because it is a non-invasive procedure and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis since specific radiopharmaceuticals were developed. In this study, aptamers selected to Staphylococcus aureus were labeled with {sup 99m}Tc and used for bacteria identification in an osteomyelitis experimental model. The aptamers selected to S. aureus were directly labelled with {sup 99m}Tc and were evaluated by biodistribution studies. Wistar rats with intraosseous infection in the right paw were used. A random aptamer labelled with {sup 99m}Tc was as control. Six animals were used in each group. The aptamers labeled with {sup 99m}Tc were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 2,23 ± 0,20, after 3 h. The control group presented a target/non-target ratio 1,08 ± 0.23. The results indicated that the radiolabeled aptamers were able to identify specifically the infection foci and they should be further explored for infection diagnosis by scintigraphy. (author)
Directory of Open Access Journals (Sweden)
Hilal Kazan
2010-07-01
Full Text Available Metazoan genomes encode hundreds of RNA-binding proteins (RBPs. These proteins regulate post-transcriptional gene expression and have critical roles in numerous cellular processes including mRNA splicing, export, stability and translation. Despite their ubiquity and importance, the binding preferences for most RBPs are not well characterized. In vitro and in vivo studies, using affinity selection-based approaches, have successfully identified RNA sequence associated with specific RBPs; however, it is difficult to infer RBP sequence and structural preferences without specifically designed motif finding methods. In this study, we introduce a new motif-finding method, RNAcontext, designed to elucidate RBP-specific sequence and structural preferences with greater accuracy than existing approaches. We evaluated RNAcontext on recently published in vitro and in vivo RNA affinity selected data and demonstrate that RNAcontext identifies known binding preferences for several control proteins including HuR, PTB, and Vts1p and predicts new RNA structure preferences for SF2/ASF, RBM4, FUSIP1 and SLM2. The predicted preferences for SF2/ASF are consistent with its recently reported in vivo binding sites. RNAcontext is an accurate and efficient motif finding method ideally suited for using large-scale RNA-binding affinity datasets to determine the relative binding preferences of RBPs for a wide range of RNA sequences and structures.
Wang, ShaoPeng; Zhang, Yu-Hang; Lu, Jing; Cui, Weiren; Hu, Jerry; Cai, Yu-Dong
2016-01-01
The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request.
Aptamer-mediated colorimetric method for rapid and sensitive detection of chloramphenicol in food.
Yan, Chao; Zhang, Jing; Yao, Li; Xue, Feng; Lu, Jianfeng; Li, Baoguang; Chen, Wei
2018-09-15
We report an aptamer-mediated colorimetric method for sensitive detection of chloramphenicol (CAP). The aptamer of CAP is immobilized by the hybridization with pre-immobilized capture probe in the microtiter plate. The horseradish peroxidase (HRP) is covalently attached to the aptamer by the biotin-streptavidin system for signal production. CAP will preferably bind with aptamer due to the high binding affinity, which attributes to the release of aptamer and HRP and thus, affects the optical signal intensity. Quantitative determination of CAP is successfully achieved in the wide range from 0.001 to 1000 ng/mL with detection limit of 0.0031 ng/mL, which is more sensitive than traditional immunoassays. This method is further validated by measuring the recovery of CAP spiked in two different food matrices (honey and fish). The aptamer-mediated colorimetric method can be a useful protocol for rapid and sensitive screening of CAP, and may be used as an alternative means for traditional immunoassays. Copyright © 2018 Elsevier Ltd. All rights reserved.
miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments.
Hackenberg, Michael; Sturm, Martin; Langenberger, David; Falcón-Pérez, Juan Manuel; Aransay, Ana M
2009-07-01
Next-generation sequencing allows now the sequencing of small RNA molecules and the estimation of their expression levels. Consequently, there will be a high demand of bioinformatics tools to cope with the several gigabytes of sequence data generated in each single deep-sequencing experiment. Given this scene, we developed miRanalyzer, a web server tool for the analysis of deep-sequencing experiments for small RNAs. The web server tool requires a simple input file containing a list of unique reads and its copy numbers (expression levels). Using these data, miRanalyzer (i) detects all known microRNA sequences annotated in miRBase, (ii) finds all perfect matches against other libraries of transcribed sequences and (iii) predicts new microRNAs. The prediction of new microRNAs is an especially important point as there are many species with very few known microRNAs. Therefore, we implemented a highly accurate machine learning algorithm for the prediction of new microRNAs that reaches AUC values of 97.9% and recall values of up to 75% on unseen data. The web tool summarizes all the described steps in a single output page, which provides a comprehensive overview of the analysis, adding links to more detailed output pages for each analysis module. miRanalyzer is available at http://web.bioinformatics.cicbiogune.es/microRNA/.
Current advances in aptamer-assisted technologies for detecting bacterial and fungal toxins.
Alizadeh, N; Memar, M Y; Mehramuz, B; Abibiglou, S S; Hemmati, F; Samadi Kafil, H
2018-03-01
Infectious diseases are among the common leading causes of morbidity and mortality worldwide. Associated with the emergence of new infectious diseases, the increasing number of antimicrobial-resistant isolates presents a serious threat to public health and hospitalized patients. A microbial pathogen may elicit several host responses and use a variety of mechanisms to evade host defences. These methods and mechanisms include capsule, lipopolysaccharides or cell wall components, adhesions and toxins. Toxins inhibit phagocytosis, cause septic shock and host cell damages by binding to host surface receptors and invasion. Bacterial and fungal pathogens are able to apply many different toxin-dependent mechanisms to disturb signalling pathways and the structural integrity of host cells for establishing and maintaining infections Initial techniques for analysis of bacterial toxins were based on in vivo or in vitro assessments. There is a permanent demand for appropriate detection methods which are affordable, practical, careful, rapid, sensitive, efficient and economical. Aptamers are DNA or RNA oligonucleotides that are selected by systematic evolution of ligands using exponential enrichment (SELEX) methods and can be applied in diagnostic applications. This review provides an overview of aptamer-based methods as a novel approach for detecting toxins in bacterial and fungal pathogens. © 2017 The Society for Applied Microbiology.
Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate
2016-01-01
Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...
How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.
Reinhard, Sören; Wagner, Ernst
2017-01-01
RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Yang, J.; Palla, M.; Bosco, F. G.
2013-01-01
This paper presents a microchip incorporating an aptamer-functionalized nanopillar substrate, enabling the specific detection of low-abundance biomolecules using surface enhanced Raman spectroscopy (SERS). In a temperature controlled microchamber, aptamers immobilized on the nanostructure surface...
Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.
Directory of Open Access Journals (Sweden)
Arjan P Palstra
Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter
2014-01-13
Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.
Directory of Open Access Journals (Sweden)
T. Holden
2013-01-01
Full Text Available Long noncoding RNA (lncRNA within mRNA sequences of Alzheimer’s disease genes, namely, APP, APOE, PSEN1, and PSEN2, has been analyzed using fractal dimension (FD computation and correlation analysis. We examined lncRNA by comparing mRNA FD to corresponding coding DNA sequences (CDSs FD. APP, APOE, and PSEN1 CDSs select slightly higher FDs compared to the mRNA, while PSEN2 CDSs FDs are lower. The correlation coefficient for these sequences is 0.969. A comparative study of differentially expressed MAPK signaling pathway lncRNAs in pancreatic cancer cells shows a correlation of 0.771. Selection of higher FD CDSs could indicate interaction of Alzheimer’s gene products APP, APOE, and PSEN1. Including hypocretin sequences (where all CDSs have higher fractal dimensions than mRNA in the APP, APOE, and PSEN1 sequence analyses improves correlation, but the inclusion of erythropoietin (where all CDSs have higher FD than mRNA would suppress correlation, suggesting that HCRT, a hypothalamus neurotransmitter related to the wake/sleep cycle, might be better when compared to EPO, a glycoprotein hormone, for targeting Alzheimer’s disease drug development. Fractal dimension and entropy correlation have provided supporting evidence, consistent with evolutionary studies, for using a zebrafish model together with a mouse model, in HCRT drug development.
Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny
2015-01-01
Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619
Directory of Open Access Journals (Sweden)
Olfa Siala
2010-01-01
Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.
Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA
Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid
2013-01-01
Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and
Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.
Directory of Open Access Journals (Sweden)
Antheia Kissopoulou
Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components
Detection of Cryptosporidium parvum Oocysts on Fresh Produce Using DNA Aptamers.
Directory of Open Access Journals (Sweden)
Asma Iqbal
Full Text Available There are currently no standard methods for the detection of Cryptosporidium spp., or other protozoan parasites, in foods, and existing methods are often inadequate, with low and variable recovery efficiencies. Food testing is difficult due to the low concentrations of parasites, the difficulty in eluting parasites from some foods, the lack of enrichment methods, and the presence of PCR inhibitors. The main objectives of the present study were to obtain DNA aptamers binding to the oocyst wall of C. parvum, and to use the aptamers to detect the presence of this parasite in foods. DNA aptamers were selected against C. parvum oocysts using SELEX (Systematic Evolution of Ligands by EXponential enrichment. Ten rounds of selection led to the discovery of 14 aptamer clones with high affinities for C. parvum oocysts. For detecting parasite-bound aptamers, a simple electrochemical sensor was employed, which used a gold nanoparticle-modified screen-printed carbon electrode. This aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and the anti- C. parvum aptamer. Square wave voltammetry was employed to quantitate C. parvum in the range of 150 to 800 oocysts, with a detection limit of approximately 100 oocysts. The high sensitivity and specificity of the developed aptasensor suggests that this novel method is very promising for the detection and identification of C. parvum oocysts on spiked fresh fruits, as compared to conventional methods such as microscopy and PCR.
Alfinito, Eleonora; Reggiani, Lino; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele
2017-02-01
Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors (aptasensors), with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer aptamer (TBA), has been widely explored around the possibility of using it in aptasensors. This paper proposes a microscopic model of the electrical properties of TBA and of the aptamer-thrombin complex, combining information from both structure and function, following the issues addressed in an emerging branch of electronics known as proteotronics. The theoretical results are compared and validated with measurements reported in the literature. Finally, the model suggests resistance measurements as a novel tool for testing aptamer-target affinity.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei
2015-01-01
Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy.
He, Xiaoxiao; Li, Yuhong; He, Dinggen; Wang, Kemin; Shangguan, Jingfang; Shi, Hui
2014-07-01
This paper describes a sensitive and specific determination strategy for Staphylococcus aureus (S. aureus) detection using aptamer recognition and fluorescent silica nanoparticles (FSiNPs) label based dual-color flow cytometry assay (Aptamer/FSiNPs-DCFCM). In the protocol, an aptamer, having high affinity to S. aureus, was first covalently immobilized onto chloropropyl functionalized FSiNPs through a click chemistry approach to generate aptamer-nanoparticles bioconjugates (Aptamer/FSiNPs). Next, S. aureus was incubated with Aptamer/FSiNPs, and then stained with SYBR Green I (a special staining material for the duplex DNA). Upon target binding and nucleic acid staining with SYBR Green I, the S. aureus was determined using two-color flow cytometry. The method took advantage of the specificity of aptamer, signal amplification of FSiNPs label and decreased false positives of two-color flow cytometry assay. It was demonstrated that these Aptamer/FSiNPs could efficiently recognize and fluorescently label target S. aureus. Through multiparameter determination with flow cytometry, this assay allowed for detection of as low as 1.5 x 10(2) and 7.6 x 10(2) cells mL(-1) S. aureus in buffer and spiked milk, respectively, with higher sensitivity than the Aptamer/FITC based flow cytometry.
Actuation of chitosan-aptamer nanobrush borders for pathogen sensing.
Hills, Katherine D; Oliveira, Daniela A; Cavallaro, Nicholas D; Gomes, Carmen L; McLamore, Eric S
2018-03-26
We demonstrate a sensing mechanism for rapid detection of Listeria monocytogenes in food samples using the actuation of chitosan-aptamer nanobrush borders. The bio-inspired soft material and sensing strategy mimic natural symbiotic systems, where low levels of bacteria are selectively captured from complex matrices. To engineer this biomimetic system, we first develop reduced graphene oxide/nanoplatinum (rGO-nPt) electrodes, and characterize the fundamental electrochemical behavior in the presence and absence of chitosan nanobrushes during actuation (pH-stimulated osmotic swelling). We then characterize the electrochemical behavior of the nanobrush when receptors (antibodies or DNA aptamers) are conjugated to the surface. Finally, we test various techniques to determine the most efficient capture strategy based on nanobrush actuation, and then apply the biosensors in a food product. Maximum cell capture occurs when aptamers conjugated to the nanobrush bind cells in the extended conformation (pH 6). The aptamer-nanobrush hybrid material was more efficient than the antibody-nanobrush material, which was likely due to the relatively high adsorption capacity for aptamers. The biomimetic material was used to develop a rapid test (17 min) for selectively detecting L. monocytogenes at concentrations ranging from 9 to 107 CFU mL-1 with no pre-concentration, and in the presence of other Gram-positive cells (Listeria innocua and Staphylococcus aureus). Use of this bio-inspired material is among the most efficient for L. monocytogenes sensing to date, and does not require sample pretreatment, making nanobrush borders a promising new material for rapid pathogen detection in food.
Deep sequencing analysis of the developing mouse brain reveals a novel microRNA
Directory of Open Access Journals (Sweden)
Piltz Sandra
2011-04-01
Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.
Identification and cloning of four riboswitches from Burkholderia pseudomallei strain K96243
Munyati-Othman, Noor; Fatah, Ahmad Luqman Abdul; Piji, Mohd Al Akmarul Fizree Bin Md; Ramlan, Effirul Ikhwan; Raih, Mohd Firdaus
2015-09-01
Structured RNAs referred as riboswitches have been predicted to be present in the genome sequence of Burkholderia pseudomallei strain K96243. Four of the riboswitches were identified and analyzed through BLASTN, Rfam search and multiple sequence alignment. The RNA aptamers belong to the following riboswitch classifications: glycine riboswitch, cobalamin riboswitch, S-adenosyl-(L)-homocysteine (SAH) riboswitch and flavin mononucleotide (FMN) riboswitch. The conserved nucleotides for each aptamer were identified and were marked on the secondary structure generated by RNAfold. These riboswitches were successfully amplified and cloned for further study.
Directory of Open Access Journals (Sweden)
Ralf Landgraf
2012-05-01
Full Text Available The use of nucleic acid derived aptamers has rapidly expanded since the introduction of SELEX in 1990. Nucleic acid aptamers have demonstrated their ability to target a broad range of molecules in ways that rival antibodies, but advances have been very uneven for different biochemical classes of targets, and clinical applications have been slow to emerge. What sets different aptamers apart from each other and from rivaling molecular recognition platforms, specifically proteins? What advantages do aptamers as a reagent class offer, and how do the chemical properties and selection procedures of aptamers influence their function? Do the building blocks of nucleic acid aptamers dictate inherent limitations in the nature of molecular targets, and do existing aptamers give us insight in how these challenges might be overcome? This review is written as an introduction for potential endusers of aptamer technology who are evaluating the advantages of aptamers as a versatile, affordable, yet highly expandable platform to target a broad range of biological processes or interactions.
Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent
2017-06-01
Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
Zhang, Hanyuan; Vieira Resende E Silva, Bruno; Cui, Juan
2018-05-01
Small RNA sequencing is the most widely used tool for microRNA (miRNA) discovery, and shows great potential for the efficient study of miRNA cross-species transport, i.e., by detecting the presence of exogenous miRNA sequences in the host species. Because of the increased appreciation of dietary miRNAs and their far-reaching implication in human health, research interests are currently growing with regard to exogenous miRNAs bioavailability, mechanisms of cross-species transport and miRNA function in cellular biological processes. In this article, we present microRNA Discovery (miRDis), a new small RNA sequencing data analysis pipeline for both endogenous and exogenous miRNA detection. Specifically, we developed and deployed a Web service that supports the annotation and expression profiling data of known host miRNAs and the detection of novel miRNAs, other noncoding RNAs, and the exogenous miRNAs from dietary species. As a proof-of-concept, we analyzed a set of human plasma sequencing data from a milk-feeding study where 225 human miRNAs were detected in the plasma samples and 44 show elevated expression after milk intake. By examining the bovine-specific sequences, data indicate that three bovine miRNAs (bta-miR-378, -181* and -150) are present in human plasma possibly because of the dietary uptake. Further evaluation based on different sets of public data demonstrates that miRDis outperforms other state-of-the-art tools in both detection and quantification of miRNA from either animal or plant sources. The miRDis Web server is available at: http://sbbi.unl.edu/miRDis/index.php.
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
DEFF Research Database (Denmark)
Harrington, C.S.; On, Stephen L.W.
1999-01-01
Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...
International Nuclear Information System (INIS)
Santos, Sara Roberta dos; Rodrigues Corrêa, Cristiane; Branco de Barros, André Luís; Serakides, Rogéria; Fernandes, Simone Odília
2015-01-01
Introduction: Aptamers are oligonucleotides that have high affinity and specificity for their molecular targets which are emerging as a new class of molecules for radiopharmaceuticals development. In this study, aptamers selected to Staphylococcus aureus were evaluated for bacterial infection identification. Methods: Anti S. aureus aptamers were labeled with 99m Tc by the direct method. The radiolabel yield and complex stability were assessed by thin-layer chromatography (TLC). Three groups of Swiss mice containing 6 animals each were used. The first group was infected intramuscularly in the right thigh with S. aureus. The second group was infected in the same way with C. albicans and the third group was injected with zymosan to induce aseptic inflammation. After 24 h, radiolabeled aptamers (22.2 MBq) were injected by the tail vein. The mice were euthanized 4 h post injection and tissue sample activities measured in a gamma counter. Results: The 99m Tc labeled aptamers were stable in saline, plasma and cystein excess. Radiolabeled aptamers showed increased uptake in the kidneys for all groups indicating a main renal excretion, which is consistent with the hydrophilic nature and small size of aptamers. The radiopharmaceutical showed rapid blood clearance indicated by a reduced dose (% ID/g) in the blood. The biodistribution showed that aptamers were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 4.0 ± 0.5. This ratio for mice infected with C. albicans was 2.0 ± 0.4 while for mice with aseptic inflammation was 1.2 ± 0.2. Histology confirmed the presence of infection in groups 1 and 2, and inflammation in group 3. Conclusions: The biodistibution study demonstrated a statistically higher uptake in the S. aureus foci relative to inflammation and C. albicans infected areas. These results highlight the potential of aptamers labeled directly with 99m Tc for bacterial infection diagnosis by scintigraphy
Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent
2013-01-01
Small RNAs (sRNAs) are 20–25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the...
Abbaspour, Abdolkarim; Norouz-Sarvestani, Fatemeh; Noori, Abolhassan; Soltani, Noushin
2015-06-15
Staphylococcus aureus (S. aureus) is one of the most important human pathogens and causes numerous illnesses. In this study, we report a sensitive and highly selective dual-aptamer-based sandwich immunosensor for the detection of S. aureus. In this bioassay system, a biotinylated primary anti-S.aureus aptamer was immobilized on streptavidin coated magnetic beads (MB), which serves as a capture probe. A secondary anti-S.aureus aptamer was conjugated to silver nanoparticles (Apt-AgNP) that sensitively reports the detection of the target. In the presence of target bacterium, an Apt/S.aureus/apt-AgNP sandwich complex is formed on the MB surface and the electrochemical signal of AgNPs followed through anodic stripping voltammetry. The proposed sandwich assay benefits from advantageous of a sandwich assay for increased specificity, MB as carriers of affinity ligands for solution-phase recognition and fast magnetic separation, AgNPs for signal amplification, and an electrochemical stripping voltammetry read-out as a simple and sensitive detection. The electrochemical immunosensor shows an extended dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL (S/N=3). Furthermore, the possible interference of other analog bacteria was studied. To assess the general applicability of this sensor, we investigated the quantification of S. aureus in real water samples. The results were compared to the experimental results obtained from a plate counting method, which demonstrated an acceptable consistency. Copyright © 2014 Elsevier B.V. All rights reserved.
MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
DEFF Research Database (Denmark)
Nielsen, M; Hansen, J H; Hedegaard, J
2010-01-01
levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...
Sex chromosomes and germline transcriptomics explored by single-cell sequencing and RNA-tomography
Vértesy, Ábel
2018-01-01
In our study of germ cell differentiation, we applied two recently developed technologies on the germline of various model organisms: single-cell mRNA sequencing and RNA-tomography. For the first time we could look at gene expression with such a high resolution, and this led us to discover the
Aptamer-Phage Reporters for Ultrasensitive Lateral Flow Assays.
Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E V; Kourentzi, Katerina; Conrad, Jacinta C; Willson, Richard C
2015-12-01
We introduce the modification of bacteriophage particles with aptamers for use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ∼100 times lower than those of previously reported IgE assays.
Directory of Open Access Journals (Sweden)
Teshome Tilahun Bizuayehu
Full Text Available BACKGROUND: microRNAs (miRNAs are implicated in regulation of many cellular processes. miRNAs are processed to their mature functional form in a step-wise manner by multiple proteins and cofactors in the nucleus and cytoplasm. Many miRNAs are conserved across vertebrates. Mature miRNAs have recently been characterized in Atlantic halibut (Hippoglossus hippoglossus L.. The aim of this study was to identify and characterize precursor miRNA (pre-miRNAs and miRNA targets in this non-model flatfish. Discovery of miRNA precursor forms and targets in non-model organisms is difficult because of limited source information available. Therefore, we have developed a methodology to overcome this limitation. METHODS: Genomic DNA and small transcriptome of Atlantic halibut were sequenced using Roche 454 pyrosequencing and SOLiD next generation sequencing (NGS, respectively. Identified pre- miRNAs were further validated with reverse-transcription PCR. miRNA targets were identified using miRanda and RNAhybrid target prediction tools using sequences from public databases. Some of miRNA targets were also identified using RACE-PCR. miRNA binding sites were validated with luciferase assay using the RTS34st cell line. RESULTS: We obtained more than 1.3 M and 92 M sequence reads from 454 genomic DNA sequencing and SOLiD small RNA sequencing, respectively. We identified 34 known and 9 novel pre-miRNAs. We predicted a number of miRNA target genes involved in various biological pathways. miR-24 binding to kisspeptin 1 receptor-2 (kiss1-r2 was confirmed using luciferase assay. CONCLUSION: This study demonstrates that identification of conserved and novel pre-miRNAs in a non-model vertebrate lacking substantial genomic resources can be performed by combining different next generation sequencing technologies. Our results indicate a wide conservation of miRNA precursors and involvement of miRNA in multiple regulatory pathways, and provide resources for further research on miRNA
Targeting Extracellular Histones with Novel RNA Bio drugs for the Treatment of Acute Lung Injury
2017-10-01
AWARD NUMBER: W81XWH-16-1-0179 TITLE: Targeting Extracellular Histones with Novel RNA Bio -drugs for the Treatment of Acute Lung Injury...4. TITLE AND SUBTITLE Targeting Extracellular Histones with Novel RNA Bio -drugs for the Treatment of Acute Lung Injury 5a. CONTRACT NUMBER 5b...and field situations. To accomplish this goal, we developed novel bio -reagents (RNA aptamers) that bind to those histones known to cause MODS/ARDS and
Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun
2015-01-01
Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, s...
Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25
International Nuclear Information System (INIS)
Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya
2006-01-01
Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
2012-01-01
Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
Directory of Open Access Journals (Sweden)
Ma Lei
2012-08-01
Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.
Shu, Yi; Shu, Dan; Haque, Farzin; Guo, Peixuan
2013-01-01
RNA nanotechnology is a term that refers to the design, fabrication, and utilization of nanoparticles mainly composed of ribonucleic acids via bottom-up self-assembly. The packaging RNA (pRNA) of the bacteriophage phi29 DNA packaging motor has been developed into a nano-delivery platform. This protocol describes the synthesis, assembly, and functionalization of pRNA nanoparticles based on three ‘toolkits’ derived from pRNA structural features: interlocking loops for hand-in-hand interactions, palindrome sequences for foot-to-foot interactions, and an RNA three-way junction for branch-extension. siRNAs, ribozymes, aptamers, chemical ligands, fluorophores, and other functionalities can also be fused to the pRNA prior to the assembly of the nanoparticles, so as to ensure the production of homogeneous nanoparticles and the retention of appropriate folding and function of the incorporated modules. The resulting self-assembled multivalent pRNA nanoparticles are thermodynamically and chemically stable, and they remain intact at ultra-low concentrations. Gene silencing effects are progressively enhanced with increasing number of siRNA in each pRNA nanoparticle. Systemic injection of the pRNA nanoparticles into xenograft-bearing mice has revealed strong binding to tumors without accumulation in vital organs or tissues. The pRNA-based nano-delivery scaffold paves a new way towards nanotechnological application of pRNA-based nanoparticles for disease detection and treatment. The time required for completing one round of this protocol is 3–4 weeks, including in vitro functional assays, or 2–3 months including in vivo studies. PMID:23928498
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Directory of Open Access Journals (Sweden)
James Angus eChandler
2015-03-01
Full Text Available Mosquitoes, most often recognized for the microbial agents of disease they may carry, harbor diverse microbial communities that include viruses, bacteria, and fungi, collectively called the microbiota. The composition of the microbiota can directly and indirectly affect disease transmission through microbial interactions that could be revealed by its characterization in natural populations of mosquitoes. Furthermore, the use of shotgun metagenomic sequencing (SMS approaches could allow the discovery of unknown members of the microbiota. In this study, we use RNA SMS to characterize the microbiota of seven individual mosquitoes (species include Culex pipiens, Culiseta incidens, and Ochlerotatus sierrensis collected from a variety of habitats in California, USA. Sequencing was performed on the Illumina HiSeq platform and the resulting sequences were quality-checked and assembled into contigs using the A5 pipeline. Sequences related to single stranded RNA viruses of the Bunyaviridae and Rhabdoviridae were uncovered, along with an unclassified genus of double-stranded RNA viruses. Phylogenetic analysis finds that in all three cases, the closest relatives of the identified viral sequences are other mosquito-associated viruses, suggesting widespread host-group specificity among disparate viral taxa. Interestingly, we identified a Narnavirus of fungi, also reported elsewhere in mosquitoes, that potentially demonstrates a nested host-parasite association between virus, fungi, and mosquito. Sequences related to 8 bacterial families and 13 fungal families were found across the seven samples. Bacillus and Escherichia/Shigella were identified in all samples and Wolbachia was identified in all Cx. pipiens samples, while no single fungal genus was found in more than two samples. This study exemplifies the utility of RNA SMS in the characterization of the natural microbiota of mosquitoes and, in particular, the value of identifying all microbes associated with
DEFF Research Database (Denmark)
Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per
2015-01-01
the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...
Directory of Open Access Journals (Sweden)
Jonathan A Scolnick
Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.
DEFF Research Database (Denmark)
Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia
2017-01-01
-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer......-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment...... of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4...
Directory of Open Access Journals (Sweden)
Wang Shengqi
2010-10-01
Full Text Available Abstract Background Previous studies have shown that microRNA precursors (pre-miRNAs have considerably more stable secondary structures than other native RNAs (tRNA, rRNA, and mRNA and artificial RNA sequences. However, pre-miRNAs with ultra stable secondary structures have not been investigated. It is not known if there is a tendency in pre-miRNA sequences towards or against ultra stable structures? Furthermore, the relationship between the structural thermodynamic stability of pre-miRNA and their evolution remains unclear. Results We investigated the correlation between pre-miRNA sequence conservation and structural stability as measured by adjusted minimum folding free energies in pre-miRNAs isolated from human, mouse, and chicken. The analysis revealed that conserved and non-conserved pre-miRNA sequences had structures with similar average stabilities. However, the relatively ultra stable and unstable pre-miRNAs were more likely to be non-conserved than pre-miRNAs with moderate stability. Non-conserved pre-miRNAs had more G+C than A+U nucleotides, while conserved pre-miRNAs contained more A+U nucleotides. Notably, the U content of conserved pre-miRNAs was especially higher than that of non-conserved pre-miRNAs. Further investigations showed that conserved and non-conserved pre-miRNAs exhibited different structural element features, even though they had comparable levels of stability. Conclusions We proposed that there is a correlation between structural thermodynamic stability and sequence conservation for pre-miRNAs from human, mouse, and chicken genomes. Our analyses suggested that pre-miRNAs with relatively ultra stable or unstable structures were less favoured by natural selection than those with moderately stable structures. Comparison of nucleotide compositions between non-conserved and conserved pre-miRNAs indicated the importance of U nucleotides in the pre-miRNA evolutionary process. Several characteristic structural elements were
High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..
Directory of Open Access Journals (Sweden)
Livia Donaire
Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.
International Nuclear Information System (INIS)
Chen, Fan; Zhou, Jing; Luo, Fengling; Mohammed, Al-Bayati; Zhang, Xiao-Lian
2007-01-01
Worldwide, tuberculosis (TB) remains the most frequent and important infectious disease causing morbidity and death. One-third of the world's population is infected with Mycobacterium tuberculosis (MTB), the etiologic agent of TB. Because of the global health problems of TB, the development of potent new anti-TB drugs without cross-resistance with known antimycobacterial agents is urgently needed. In this study, we have applied a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process to identify a single aptamer (NK2) that binds to virulent strain M. tuberculosis (H37Rv) with high affinity and specificity. We have found that this aptamer improves CD4 + T cells to produce IFN-γ after binding to H37Rv. The different component between H37Rv and BCG was identified as some membrane protein. Moreover, the survival rates of mice challenged with i.v. H37Rv have been prolonged after treatment with single injection of aptamer NK2. The bacterial numbers were significantly lower in the spleen of mice treated with aptamer NK2. The histopathological examination of lung biopsy specimens showed lesser pulmonary alveolar fusion and swelling in the presence of the aptamer. These results suggest that aptamer NK2 has inhibitory effects on M. tuberculosis and can be used as antimycobacterial agent
Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie
2016-06-15
Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by
Thiel, William H; Giangrande, Paloma H
2016-03-15
The development of DNA and RNA aptamers for research as well as diagnostic and therapeutic applications is a rapidly growing field. In the past decade, the process of identifying aptamers has been revolutionized with the advent of high-throughput sequencing (HTS). However, bioinformatics tools that enable the average molecular biologist to analyze these large datasets and expedite the identification of candidate aptamer sequences have been lagging behind the HTS revolution. The Galaxy Project was developed in order to efficiently analyze genome, exome, and transcriptome HTS data, and we have now applied these tools to aptamer HTS data. The Galaxy Project's public webserver is an open source collection of bioinformatics tools that are powerful, flexible, dynamic, and user friendly. The online nature of the Galaxy webserver and its graphical interface allow users to analyze HTS data without compiling code or installing multiple programs. Herein we describe how tools within the Galaxy webserver can be adapted to pre-process, compile, filter and analyze aptamer HTS data from multiple rounds of selection. Copyright © 2015 Elsevier Inc. All rights reserved.
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera.
Chen, X; Yu, X; Cai, Y; Zheng, H; Yu, D; Liu, G; Zhou, Q; Hu, S; Hu, F
2010-12-01
MicroRNAs (miRNAs) are key regulators in various physiological and pathological processes via post-transcriptional regulation of gene expression. The honey bee (Apis mellifera) is a key model for highly social species, and its complex social behaviour can be interpreted theoretically as changes in gene regulation, in which miRNAs are thought to be involved. We used the SOLiD sequencing system to identify the repertoire of miRNAs in the honey bee by sequencing a mixed small RNA library from different developmental stages. We obtained a total of 36,796,459 raw sequences; of which 5,491,100 short sequences were fragments of mRNA and other noncoding RNAs (ncRNA), and 1,759,346 reads mapped to the known miRNAs. We predicted 267 novel honey bee miRNAs representing 380,182 short reads, including eight miRNAs of other insects in 14,107,583 genome-mapped sequences. We verified 50 of them using stem-loop reverse-transcription PCR (RT-PCR), in which 35 yielded PCR products. Cross-species analyses showed 81 novel miRNAs with homologues in other insects, suggesting that they were authentic miRNAs and have similar functions. The results of this study provide a basis for studies of the miRNA-modulating networks in development and some intriguing phenomena such as caste differentiation in A. mellifera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.
Selection and characterization of single stranded DNA aptamers recognizing fumonisin B1
International Nuclear Information System (INIS)
Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping; Zhu, Changqing; Jiang, Yuan
2014-01-01
We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B 1 (FB 1 ). FB 1 is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB 1 were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB 1 via aptasensors. (author)
Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J
1996-12-24
Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.
Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia; Kuhlmann, Matthias; Cameron, Jason; Sørensen, Esben S.; Wengel, Jesper; Howard, Kenneth A.
2017-05-01
Aptamers are an attractive molecular medicine that offers high target specificity. Nucleic acid-based aptamers, however, are prone to nuclease degradation and rapid renal excretion that require blood circulatory half-life extension enabling technologies. The long circulatory half-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate linker, were successfully prepared and purified by high performance liquid chromatography as confirmed by gel electrophoresis band-shift analysis and matrix-assisted laser desorption/ionization time of flight. Minimal reduction (∼25%) in activity of WT-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer interferometry. Binding could be rescued by aptamer conjugation to recombinant albumin engineered for higher FcRn affinity (HB) that exhibited an 8-fold affinity compared to WT alone. This work describes a novel albumin-based aptamer delivery system whose hFcRn binding can be increased using a HB engineered albumin.
Directory of Open Access Journals (Sweden)
Kang Kang
Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.
Directory of Open Access Journals (Sweden)
Ajay Bansal
Full Text Available Barrett's esophagus (BE is transition from squamous to columnar mucosa as a result of gastroesophageal reflux disease (GERD. The role of microRNA during this transition has not been systematically studied.For initial screening, total RNA from 5 GERD and 6 BE patients was size fractionated. RNA <70 nucleotides was subjected to SOLiD 3 library preparation and next generation sequencing (NGS. Bioinformatics analysis was performed using R package "DEseq". A p value<0.05 adjusted for a false discovery rate of 5% was considered significant. NGS-identified miRNA were validated using qRT-PCR in an independent group of 40 GERD and 27 BE patients. MicroRNA expression of human BE tissues was also compared with three BE cell lines.NGS detected 19.6 million raw reads per sample. 53.1% of filtered reads mapped to miRBase version 18. NGS analysis followed by qRT-PCR validation found 10 differentially expressed miRNA; several are novel (-708-5p, -944, -224-5p and -3065-5p. Up- or down- regulation predicted by NGS was matched by qRT-PCR in every case. Human BE tissues and BE cell lines showed a high degree of concordance (70-80% in miRNA expression. Prediction analysis identified targets that mapped to developmental signaling pathways such as TGFβ and Notch and inflammatory pathways such as toll-like receptor signaling and TGFβ. Cluster analysis found similarly regulated (up or down miRNA to share common targets suggesting coordination between miRNA.Using highly sensitive next-generation sequencing, we have performed a comprehensive genome wide analysis of microRNA in BE and GERD patients. Differentially expressed miRNA between BE and GERD have been further validated. Expression of miRNA between BE human tissues and BE cell lines are highly correlated. These miRNA should be studied in biological models to further understand BE development.
Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr
2014-04-01
Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...
Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase.
Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander
2017-12-26
The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).
A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly
Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.
2016-01-01
DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622
Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas
2015-01-01
Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989
Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin.
Gao, Shunxiang; Zheng, Xin; Hu, Bo; Sun, Mingjuan; Wu, Jihong; Jiao, Binghua; Wang, Lianghua
2017-03-15
In this study, we coupled biolayer interferometry (BLI) with competitive binding assay through an enzyme-linked aptamer and developed a real-time, ultra-sensitive, rapid quantitative method for detection of the marine biotoxin palytoxin. Horseradish peroxidase-labeled aptamers were used as biorecognition receptors to competitively bind with palytoxin, which was immobilized on the biosensor surface. The palytoxin: horseradish peroxidase-aptamer complex was then submerged in a 3,3'-diaminobenzidine solution, which resulted in formation of a precipitated polymeric product directly on the biosensor surface and a large change in the optical thickness of the biosensor layer. This change could obviously shift the interference pattern and generate a response profile on the BLI biosensor. The biosensor showed a broad linear range for palytoxin (200-700pg/mL) with a low detection limit (0.04pg/mL). Moreover, the biosensor was applied to the detection of palytoxin in spiked extracts and showed a high degree of selectivity for palytoxin, good reproducibility, and stability. This enzyme-linked, aptamer-based, competitive BLI biosensor offers a promising method for rapid and sensitive detection of palytoxin and other analytes. Copyright © 2016 Elsevier B.V. All rights reserved.
Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles.
Chang, Tianjun; Wang, Libo; Zhao, Kexu; Ge, Yu; He, Meng; Li, Gang
2016-06-01
Staphylococcus aureus is the top common pathogen causing infections and food poisoning. Identification of S. aureus is crucial for the disease diagnosis and regulation of food hygiene. Herein, we report an aptamer-AuNPs based method for duplex identification of S. aureus. Using AuNPs as an indicator, SA23, an aptamer against S. aureus, can well identify its target from Escherichia coli, Listeria monocytogenes and Pseudomonas aeruginosa. Furthermore, we find citrate-coated AuNPs can strongly bind to S. aureus, but not bind to Salmonella enterica and Proteus mirabilis, which leads to different color changes in salt solution. This colorimetric response is capable of distinguishing S. aureus from S. enteritidis and P. mirabilis. Thus, using the aptasensor and AuNPs together, S. aureus can be accurately identified from the common pathogens. This duplex identification system is a promising platform for simple visual identification of S. aureus. Additionally, in the aptasensing process, bacteria are incubated with aptamers and then be removed before the aptamers adding to AuNPs, which may avoid the interactions between bacteria and AuNPs. This strategy can be potentially applied in principle to detect other cells by AuNPs-based aptasensors.
In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A
Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate
2015-01-01
A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for moni...
Directory of Open Access Journals (Sweden)
Masfique Mehedi
Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.