WorldWideScience

Sample records for rna aptamer sequences

  1. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Use of a Fluorescent Aptamer RNA as an Exonic Sequence to Analyze Self-Splicing Ability of a Group I Intron from Structured RNAs

    Directory of Open Access Journals (Sweden)

    Airi Furukawa

    2016-11-01

    Full Text Available Group I self-splicing intron constitutes an important class of functional RNA molecules that can promote chemical transformation. Although the fundamental mechanism of the auto-excision from its precursor RNA has been established, convenient assay systems for its splicing activity are still useful for a further understanding of its detailed mechanism and of its application. Because some host RNA sequences, to which group I introns inserted form stable three-dimensional (3D structures, the effects of the 3D structures of exonic elements on the splicing efficiency of group I introns are important but not a fully investigated issue. We developed an assay system for group I intron self-splicing by employing a fluorescent aptamer RNA (spinach RNA as a model exonic sequence inserted by the Tetrahymena group I intron. We investigated self-splicing of the intron from spinach RNA, serving as a model exonic sequence with a 3D structure.

  3. Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition

    Directory of Open Access Journals (Sweden)

    Alexey Berezhnoy

    2012-01-01

    Full Text Available Oligonucleotide aptamer-mediated in vivo cell targeting of small interfering RNAs (siRNAs is emerging as a useful approach to enhance the efficacy and reduce the adverse effects resulting from siRNA-mediated genetic interference. A current main impediment in aptamer-mediated siRNA targeting is that the activity of the siRNA is often compromised when conjugated to an aptamer, often requiring labor intensive and time consuming design and testing of multiple configurations to identify a conjugate in which the siRNA activity has not been significantly reduced. Here, we show that the thermal stability of the siRNA is an important parameter of siRNA activity in its conjugated form, and that siRNAs with lower melting temperature (Tm are not or are minimally affected when conjugated to the 3′ end of 2′F-pyrimidine-modified aptamers. In addition, the configuration of the aptamer-siRNA conjugate retains activity comparable with the free siRNA duplex when the passenger strand is co-transcribed with the aptamer and 3′ overhangs on the passenger strand are removed. The approach described in this paper significantly reduces the time and effort necessary to screening siRNA sequences that retain biological activity upon aptamer conjugation, facilitating the process of identifying candidate aptamer-siRNA conjugates suitable for in vivo testing.

  4. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    Directory of Open Access Journals (Sweden)

    William H Thiel

    2016-01-01

    Full Text Available Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment. High-throughput sequencing (HTS revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.

  5. In vitro selection of RNA aptamer specific to Salmonella typhimurium.

    Science.gov (United States)

    Han, Seung Ryul; Lee, Seong-Wook

    2013-06-28

    Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.

  6. Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

    Science.gov (United States)

    Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

    2014-06-10

    Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

  7. Structure and Sequence Search on Aptamer-Protein Docking

    Science.gov (United States)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  8. Computational Selection of RNA Aptamer against Angiopoietin-2 and Experimental Evaluation

    Directory of Open Access Journals (Sweden)

    Wen-Pin Hu

    2015-01-01

    Full Text Available Angiogenesis plays a decisive role in the growth and spread of cancer and angiopoietin-2 (Ang2 is in the spotlight of studies for its unique role in modulating angiogenesis. The aim of this study was to introduce a computational simulation approach to screen aptamers with high binding ability for Ang2. We carried out computational simulations of aptamer-protein interactions by using ZDOCK and ZRANK functions in Discovery Studio 3.5 starting from the available information of aptamers generated through the systematic evolution of ligands by exponential enrichment (SELEX in the literature. From the best of three aptamers on the basis of ZRANK scores, 189 sequences with two-point mutations were created and simulated with Ang2. Then, we used a surface plasmon resonance (SPR biosensor to test 3 mutant sequences of high ZRANK scores along with a high and a low affinity binding sequence as reported in the literature. We found a selected RNA aptamer has a higher binding affinity and SPR response than a reported sequence with the highest affinity. This is the first study of in silico selection of aptamers against Ang2 by using the ZRANK scoring function, which should help to increase the efficiency of selecting aptamers with high target-binding ability.

  9. Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.

    Science.gov (United States)

    Park, Yoojin; Nim-Anussornkul, Duangrat; Vilaivan, Tirayut; Morii, Takashi; Kim, Byeang Hyean

    2018-01-15

    We have developed RNA-based quencher-free molecular aptamer beacons (RNA-based QF-MABs) for the detection of ATP, taking advantage of the conformational changes associated with ATP binding to the ATP-binding RNA aptamer. The RNA aptamer, with its well-defined structure, was readily converted to the fluorescence sensors by incorporating a fluorophore into the loop region of the hairpin structure. These RNA-based QF-MABs exhibited fluorescence signals in the presence of ATP relative to their low background signals in the absence of ATP. The fluorescence emission intensity increased upon formation of a RNA-based QF-MAB·ATP complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.

    Science.gov (United States)

    Jiang, F; Kumar, R A; Jones, R A; Patel, D J

    1996-07-11

    The catalytic properties of RNA and its well known role in gene expression and regulation are the consequence of its unique solution structures. Identification of the structural determinants of ligand recognition by RNA molecules is of fundamental importance for understanding the biological functions of RNA, as well as for the rational design of RNA Sequences with specific catalytic activities. Towards this latter end, Szostak et al. used in vitro selection techniques to isolate RNA sequences ('aptamers') containing a high-affinity binding site for ATP, the universal currency of cellular energy, and then used this motif to engineer ribozymes with polynucleotide kinase activity. Here we present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically 13C-, 15N-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The aptamer adopts an L-shaped structure with two nearly orthogonal stems, each capped proximally by a G x G mismatch pair, binding the AMP ligand at their junction in a GNRA-like motif.

  11. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  12. Massively parallel interrogation of aptamer sequence, structure and function.

    Directory of Open Access Journals (Sweden)

    Nicholas O Fischer

    Full Text Available BACKGROUND: Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. METHODOLOGY/PRINCIPAL FINDINGS: High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and inter-chip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. CONCLUSION AND SIGNIFICANCE: The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  13. Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Iwao Waga

    2010-08-01

    Full Text Available Sphingosylphosphorylcholine (SPC is a lysosphingolipid that exerts multiple functions, including acting as a spasmogen, as a mitogenic factor for various types of cells, and sometimes as an inflammatory mediator. Currently, liquid chromatography/tandem mass spectrometry (LC/MS/MS is used for the quantitation of SPC. However, because of the complicated procedures required it may not be cost effective, hampering its regular usage in a routine practical SPC monitoring. In this report, we have generated RNA aptamers that bind to SPC with high affinity using an in vitro selection procedure and developed an enzyme-linked aptamer assay system using the minimized SPC aptamer that can successfully distinguish SPC from the structurally related sphingosine 1-phosphate (S1P. This is the first case of the Systematic Evolution of Ligands by EXponential enrichment (SELEX process being performed with a lysosphingolipid. The SPC aptamers would be valuable tools for the development of aptamer-based medical diagnosis and for elucidating the biological role of SPC.

  14. Regulation of photosensitisation processes by an RNA aptamer

    Science.gov (United States)

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  15. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection

    International Nuclear Information System (INIS)

    Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H

    2012-01-01

    We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.

  16. Solution structure of a DNA mimicking motif of an RNA aptamer against transcription factor AML1 Runt domain.

    Science.gov (United States)

    Nomura, Yusuke; Tanaka, Yoichiro; Fukunaga, Jun-ichi; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi

    2013-12-01

    AML1/RUNX1 is an essential transcription factor involved in the differentiation of hematopoietic cells. AML1 binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. In a previous study, we obtained RNA aptamers against the AML1 Runt domain by systematic evolution of ligands by exponential enrichment and revealed that RNA aptamers exhibit higher affinity for the Runt domain than that for RDE and possess the 5'-GCGMGNN-3' and 5'-N'N'CCAC-3' conserved motif (M: A or C; N and N' form Watson-Crick base pairs) that is important for Runt domain binding. In this study, to understand the structural basis of recognition of the Runt domain by the aptamer motif, the solution structure of a 22-mer RNA was determined using nuclear magnetic resonance. The motif contains the AH(+)-C mismatch and base triple and adopts an unusual backbone structure. Structural analysis of the aptamer motif indicated that the aptamer binds to the Runt domain by mimicking the RDE sequence and structure. Our data should enhance the understanding of the structural basis of DNA mimicry by RNA molecules.

  17. A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.

    2018-01-01

    -SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...

  18. An improved radiolabelled RNA aptamer molecule for HER2 imaging in cancers.

    Science.gov (United States)

    Varmira, Kambiz; Hosseinimehr, Seyed Jalal; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2014-02-01

    Human epidermal growth factor receptor 2 (HER2) expression has been shown to be increased in several types of human tumours. In this study, for the imaging of HER2-related tumours, a modified RNA aptamer with HER2-specific targeting was labelled with (99m)Tc, by using hydrazino nicotinamide (HYNIC) as the chelator in the presence of tricine or ethylenediamine-N,N'-diacetic acid (EDDA) as the co-ligand. Stability testing of the radiolabelled aptamers in the serum was performed through SDS-PAGE. The aptamer-radionuclide conjugate was evaluated for its cellular HER2-specific binding in ovarian cancer cells (SKOV-3), and its biodistribution properties were assessed in normal and SKOV-3 tumour-bearing mice. In the presence of either tricine or EDDA, the HYNIC-RNA aptamers were labelled with (99m)Tc at a high yield and radiochemical purity. Cellular experiments confirmed the specific binding of the RNA aptamer to the HER2 receptor. In the animal biodistribution study, uptake of the EDDA-co-liganded (99m)Tc-HYNIC-RNA aptamer by the liver and spleen was remarkably lower than that of the aptamer with tricine. Tumours also showed a higher accumulation of radioactivity with the EDDA-co-liganded aptamer complex. This study demonstrated EDDA to be better than tricine for use as a co-ligand with the RNA aptamer, which can be a potential tool for the molecular imaging of HER2-overexpressing cancers.

  19. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young Ju [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of); Lee, Seong-Wook, E-mail: SWL0208@dankook.ac.kr [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  20. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    International Nuclear Information System (INIS)

    Lee, Young Ju; Lee, Seong-Wook

    2012-01-01

    Highlights: ► Identification of RNA aptamer specific to AFP with high affinity. ► Specific induction of HCC proliferation by AFP. ► Efficient increase in oncogene expression by AFP. ► Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. ► Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K D of ∼33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  1. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    Science.gov (United States)

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  2. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  3. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites.

    Directory of Open Access Journals (Sweden)

    Daniel M Dupont

    Full Text Available Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126 with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA. We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A controlling uPA activities. One of the aptamers (upanap-126 binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12 binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site.

  4. Highly Stable Aptamers Selected from a 2′-Fully Modified fGmH RNA Library for Targeting Biomaterials

    Science.gov (United States)

    Friedman, Adam D.; Kim, Dongwook; Liu, Rihe

    2014-01-01

    When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2′ modification. This study aims to develop a novel class of highly stable, 2′-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2′-F-dG, 2′-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2′-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and further deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials. PMID:25443790

  5. Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials.

    Science.gov (United States)

    Friedman, Adam D; Kim, Dongwook; Liu, Rihe

    2015-01-01

    When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2' modification. This study aims to develop a novel class of highly stable, 2'-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2'-F-dG, 2'-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2'-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and specifically deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials.

  6. Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1

    Science.gov (United States)

    Zhou, Jiehua; Lazar, Daniel; Li, Haitang; Xia, Xin; Satheesan, Sangeetha; Charlins, Paige; O'Mealy, Denis; Akkina, Ramesh; Saayman, Sheena; Weinberg, Marc S.; Rossi, John J.; Morris, Kevin V.

    2018-01-01

    Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. Methods: We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. Results: We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates in vivo, HIV-1-infected humanized NOD/SCID/IL2 rγnull mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Principle conclusions: Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1. PMID:29556342

  7. An Aptamer Bio-barCode (ABC) assay using SPR, RNase H, and probes with RNA and gold-nanorods for anti-cancer drug screening.

    Science.gov (United States)

    Loo, Jacky Fong-Chuen; Yang, Chengbin; Tsang, Hing Lun; Lau, Pui Man; Yong, Ken-Tye; Ho, Ho Pui; Kong, Siu Kai

    2017-10-07

    With modifications to an ultra-sensitive bio-barcode (BBC) assay, we have developed a next generation aptamer-based bio-barcode (ABC) assay to detect cytochrome-c (Cyto-c), a cell death marker released from cancer cells, for anti-cancer drug screening. An aptamer is a short single-stranded DNA selected from a synthetic DNA library that is capable of binding to its target with high affinity and specificity based on its unique DNA sequence and 3D structure after folding. Similar to the BBC assay, Cyto-c is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Ab) and an aptamer specifically against Cyto-c to form sandwich structures ([MMP-Ab]-[Cyto-c]-[Aptamer]). After washing and melting, our aptamers, acting as a DNA bio-barcode, are released from the sandwiches and hybridized with the probes specially designed for RNase H for surface plasmon resonance (SPR) sensing. In an aptamer-probe duplex, RNase H digests the RNA in the probe and releases the intact aptamer for another round of hybridization and digestion. With signal enhancement effects from gold-nanorods (Au-NRs) on probes for SPR sensing, the detection limit was found to be 1 nM for the aptamer and 80 pM for Cyto-c. Without the time-consuming DNA amplification steps by PCR, the detection process of this new ABC assay can be completed within three hours. As a proof-of-concept, phenylarsine oxide was found to be a potent agent to kill liver cancer cells with multi-drug resistance at the nano-molar level. This approach thus provides a fast, sensitive and robust tool for anti-cancer drug screening.

  8. RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine

    DEFF Research Database (Denmark)

    Farjami, Elahe; Campos, Rui; Nielsen, Jesper Sejrup

    2013-01-01

    , including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine......, norepinephrine, 3,4-dihydroxy-phenylalanine (l-DOPA), 3,4-dihydroxyphenylacetic acid (DOPAC), methyldopamine, and tyramine, which gave negligible signals under conditions of experiments (electroanalysis at 0.185 V vs Ag/AgCl). The interference from ascorbic and uric acids was eliminated by application...... as a general strategy not to restrict the conformational freedom and binding properties of surface-bound aptamers and, thus, be applicable for the development of other aptasensors...

  9. Isolation and characterization of 20'-F-RNA aptamers against whole HIV-1 subtype C envelope pseudovirus

    CSIR Research Space (South Africa)

    London, GM

    2015-01-01

    Full Text Available Aptamers, which are artificial nucleic acid ligands akin to antibodies in function, represent a new class of molecules that can prevent HIV infection. In this study, we isolated RNA aptamers against whole HV-1CAP45 enveloped pseudotyped virus...

  10. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    Directory of Open Access Journals (Sweden)

    Seyedeh Alia Moosavian

    2015-06-01

    Full Text Available Objective(s: Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2 is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX. Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy.

  11. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells.

    Science.gov (United States)

    Autour, Alexis; C Y Jeng, Sunny; D Cawte, Adam; Abdolahzadeh, Amir; Galli, Angela; Panchapakesan, Shanker S S; Rueda, David; Ryckelynck, Michael; Unrau, Peter J

    2018-02-13

    Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.

  12. Organic additives stabilize RNA aptamer binding of malachite green.

    Science.gov (United States)

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Assignment methodology for larger RNA oligonucleotides: Application to an ATP-binding RNA aptamer

    International Nuclear Information System (INIS)

    Dieckmann, Thorsten; Feigon, Juli

    1997-01-01

    The use of uniform 13C, 15N labeling in the NMR spectroscopic study of RNA structures has greatly facilitated the assignment process in small RNA oligonucleotides. For ribose spinsystem assignments, exploitation of these labels has followed previously developed methods for the study of proteins. However, for sequential assignment of the exchangeable and nonexchangeable protons of the nucleotides, it has been necessary to develop a variety of new NMR experiments. Even these are of limited utility in the unambiguous assignment of larger RNAs due to the short carbon relaxation times and extensive spectral overlap for all nuclei.These problems can largely be overcome by the additional use of base-type selectively 13C, 15N-labeled RNA in combination with a judicious use of related RNAs with base substitutions. We report the application of this approach to a 36-nucleotide ATP-binding RNA aptamer in complex with AMP. Complete sequential 1H assignments, as well as the majority of 13C and 15N assignments, were obtained

  14. RNA aptamers targeted for human αA-crystallin do not bind αB-crystallin, and spare the α-crystallin domain.

    Science.gov (United States)

    Mallik, Prabhat K; Shi, Hua; Pande, Jayanti

    2017-09-16

    The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. [Effects of Aptamer-siRNA Nucleic Acid Compound on Growth and Apoptosis in Myeloid Leukemia Cell Line K562].

    Science.gov (United States)

    Ping, Juan; Shen, Zhi-Hui; Wang, Bao-Quan; Zhao, Na; Li, Rui; Li, Mian; Pang, Xiao-Bin; Chen, Chuan-Bo

    2015-04-01

    To explore the effects of aptamer-siRNA nucleic acid compound on growth and apoptosis in myeloid leukemia cell line K562. the changes of cellular morphology and structure were observed by using fluorescence microscope, laser confocal microscope, JEM-4000EX transmission electron microscopy; MTT assay were performed to evaluate the sensibility of K562 cells to aptamer-siRNA compound, the apoptosis was detected by DNA gel electro-phoresis. The remarkably changes of morphology and structure of K562 cells treated with 200 µmol/L aptamer-siRNA were observed under fluorescence microscopy and electromicroscopy. As compared with control, the aptamer-siRNA compound showed more inhibitory effect on K562 cells and there was significant difference (Pcompound for K562 cells was 150 µmol/L. According to agarose gel electrophoresis observation, when the aptamer-siRNA compound showed effect on K562 cells, the typical DNA lader could be observed. The aptamer-siRNA compound can significantly induce K562 cell apoptosis, and provide reference for gene therapy of patients with chronic myelocytic lenkemia.

  16. A SELEX-screened aptamer of human hepatitis B virus RNA encapsidation signal suppresses viral replication.

    Directory of Open Access Journals (Sweden)

    Hui Feng

    Full Text Available BACKGROUND: The specific interaction between hepatitis B virus (HBV polymerase (P protein and the ε RNA stem-loop on pregenomic (pg RNA is crucial for viral replication. It triggers both pgRNA packaging and reverse transcription and thus represents an attractive antiviral target. RNA decoys mimicking ε in P protein binding but not supporting replication might represent novel HBV inhibitors. However, because generation of recombinant enzymatically active HBV polymerase is notoriously difficult, such decoys have as yet not been identified. METHODOLOGY/PRINCIPAL FINDINGS: Here we used a SELEX approach, based on a new in vitro reconstitution system exploiting a recombinant truncated HBV P protein (miniP, to identify potential ε decoys in two large ε RNA pools with randomized upper stem. Selection of strongly P protein binding RNAs correlated with an unexpected strong enrichment of A residues. Two aptamers, S6 and S9, displayed particularly high affinity and specificity for miniP in vitro, yet did not support viral replication when part of a complete HBV genome. Introducing S9 RNA into transiently HBV producing HepG2 cells strongly suppressed pgRNA packaging and DNA synthesis, indicating the S9 RNA can indeed act as an ε decoy that competitively inhibits P protein binding to the authentic ε signal on pgRNA. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the first successful identification of human HBV ε aptamers by an in vitro SELEX approach. Effective suppression of HBV replication by the S9 aptamer provides proof-of-principle for the ability of ε decoy RNAs to interfere with viral P-ε complex formation and suggests that S9-like RNAs may further be developed into useful therapeutics against chronic hepatitis B.

  17. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    John C. Leach

    2016-03-01

    Full Text Available The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA, was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells.

  18. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  19. RNA aptamer probes as optical imaging agents for the detection of amyloid plaques.

    Directory of Open Access Journals (Sweden)

    Christian T Farrar

    Full Text Available Optical imaging using multiphoton microscopy and whole body near infrared imaging has become a routine part of biomedical research. However, optical imaging methods rely on the availability of either small molecule reporters or genetically encoded fluorescent proteins, which are challenging and time consuming to develop. While directly labeled antibodies can also be used as imaging agents, antibodies are species specific, can typically not be tagged with multiple fluorescent reporters without interfering with target binding, and are bioactive, almost always eliciting a biological response and thereby influencing the process that is being studied. We examined the possibility of developing highly specific and sensitive optical imaging agents using aptamer technology. We developed a fluorescently tagged anti-Aβ RNA aptamer, β55, which binds amyloid plaques in both ex vivo human Alzheimer's disease brain tissue and in vivo APP/PS1 transgenic mice. Diffuse β55 positive halos, attributed to oligomeric Aβ, were observed surrounding the methoxy-XO4 positive plaque cores. Dot blots of synthetic Aβ aggregates provide further evidence that β55 binds both fibrillar and non-fibrillar Aβ. The high binding affinity, the ease of probe development, and the ability to incorporate multiple and multimodal imaging reporters suggest that RNA aptamers may have complementary and perhaps advantageous properties compared to conventional optical imaging probes and reporters.

  20. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  1. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A

    OpenAIRE

    Regina Stoltenburg; Beate Strehlitz

    2018-01-01

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aur...

  2. Thermodynamics of Ligand Binding to a Heterogeneous RNA Population in the Malachite Green Aptamer

    Science.gov (United States)

    Sokoloski, Joshua E.; Dombrowski, Sarah E.; Bevilacqua, Philip C.

    2011-01-01

    The malachite green aptamer binds two closely related ligands, malachite green (MG) and tetramethylrosamine (TMR), with near equal affinity. The MG ligand consists of three phenyl rings emanating from a central carbon, while TMR has two of the three rings connected by an ether linkage. The binding pockets for MG and TMR in the aptamer, known from high-resolution structure, differ only in the conformation of a few nucleotides. Herein, we applied isothermal titration calorimetry (ITC) to compare the thermodynamics for binding of MG and TMR to the aptamer. Binding heat capacities were obtained from ITC titrations over the temperature range of 15 to 60 °C. Two temperature regimes were found for MG binding: one from 15 to 45 °C where MG bound with a large negative heat capacity and an apparent stoichiometry (n) of ~0.4, and another from 50 to 60 °C where MG bound with positive heat capacity and n~1.1. The binding of TMR, on the other hand, revealed only one temperature regime for binding, with a more modest negative heat capacity and n~1.2. The large difference in heat capacity between the two ligands suggests that significantly more conformational rearrangement occurs upon the binding of MG than TMR, which is consistent with differences in solvent accessible surface area calculated for available ligand-bound structures. Lastly, we note that binding stoichiometry of MG was improved not only by raising the temperature, but also by lowering the concentration of Mg2+ or increasing the time between ITC injections. These studies suggest that binding of a dynamical ligand to a functional RNA requires the RNA itself to have significant dynamics. PMID:22192051

  3. Selection of a Novel Aptamer Against Vitronectin Using Capillary Electrophoresis and Next Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Christopher H Stuart

    2016-01-01

    Full Text Available Breast cancer (BC results in ≃40,000 deaths each year in the United States and even among survivors treatment of the disease may have devastating consequences, including increased risk for heart disease and cognitive impairment resulting from the toxic effects of chemotherapy. Aptamer-mediated drug delivery can contribute to improved treatment outcomes through the selective delivery of chemotherapy to BC cells, provided suitable cancer-specific antigens can be identified. We report here the use of capillary electrophoresis in conjunction with next generation sequencing to develop the first vitronectin (VN binding aptamer (VBA-01; Kd 405 nmol/l, the first aptamer to vitronectin (VN; Kd = 405 nmol/l, a protein that plays an important role in wound healing and that is present at elevated levels in BC tissue and in the blood of BC patients relative to the corresponding nonmalignant tissues. We used VBA-01 to develop DVBA-01, a dimeric aptamer complex, and conjugated doxorubicin (Dox to DVBA-01 (7:1 ratio using pH-sensitive, covalent linkages. Dox conjugation enhanced the thermal stability of the complex (60.2 versus 46.5°C and did not decrease affinity for the VN target. The resulting DVBA-01-Dox complex displayed increased cytotoxicity to MDA-MB-231 BC cells that were cultured on plasticware coated with VN (1.8 × 10−6mol/l relative to uncoated plates (2.4 × 10−6 mol/l, or plates coated with the related protein fibronectin (2.1 × 10−6 mol/l. The VBA-01 aptamer was evaluated for binding to human BC tissue using immunohistochemistry and displayed tissue specific binding and apparent association with BC cells. In contrast, a monoclonal antibody that preferentially binds to multimeric VN primarily stained extracellular matrix and vessel walls of BC tissue. Our results indicate a strong potential for using VN-targeting aptamers to improve drug delivery to treat BC.

  4. Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.

    Science.gov (United States)

    Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong

    2016-07-11

    Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites

    DEFF Research Database (Denmark)

    Dupont, Daniel Miotto; Thuesen, Cathrine K; Bøtkjær, Kenneth A

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless...

  6. A Universal Aptamer Chimera for the Delivery of Functional microRNA-126.

    Science.gov (United States)

    Rohde, Jan-H; Weigand, Julia E; Suess, Beatrix; Dimmeler, Stefanie

    2015-06-01

    microRNAs (miRs) regulate vascular diseases such as atherosclerosis and cancer. miR-126 is important for endothelial cell signaling and promotes angiogenesis, protects against atherosclerosis, and reduces breast cancer cell growth and metastasis. The overexpression of miR-126, therefore, may be an attractive therapeutic strategy for the treatment of cardiovascular disease or cancer. Here we report a novel strategy to deliver miR-126 to endothelial and breast cancer cells. We tested three different strategies to deliver miR-126 by linking the miR to an aptamer for the ubiquitously expressed transferrin receptor (transferrin receptor aptamer, TRA). Linking the precursor of miR-126 (pre-miR-126) to the TRA by annealing of a complementary stick led to efficient uptake and processing of miR-126, resulting in the delivery of 1.6×10(6)±0.3×10(6) copies miR-126-3p per ng RNA in human endothelial cells and 7.4×10(5)±2×10(5) copies miR-126-3p per ng in MCF7 breast cancer cells. The functionality of the active TRA-miR-126 chimera was further demonstrated by showing that the chimera represses the known miR-126 target VCAM-1 and improved endothelial cell sprouting in a spheroid assay. Moreover, the TRA-miR-126 chimera reduced proliferation and paracrine endothelial cell recruitment of breast cancer cells to a similar extent as miR-126-3p mimics introduced by conventional liposome-based transfection. Together, this data demonstrates that pre-miR-126 can be delivered by a non-specific aptamer to exert biological functions in two different cell models. The use of the TRA-miR-126 chimera or the combination of the delivery strategy with other endothelial or tumor specific aptamers may provide an interesting therapeutic option to treat vascular disease or cancers.

  7. An RNA aptamer specific to Hsp70-ATP conformation inhibits its ATPase activity independent of Hsp40.

    Science.gov (United States)

    Thirunavukarasu, Deepak; Shi, Hua

    2015-04-01

    The highly conserved and ubiquitous molecular chaperone heat shock protein 70 (Hsp70) plays a critical role in protein homeostasis (proteostasis). Controlled by its ATPase activity, Hsp70 cycles between two conformations, Hsp70-ATP and Hsp70-ADP, to bind and release its substrate. Chemical tools with distinct modes of action, especially those capable of modulating the ATPase activity of Hsp70, are being actively sought after in the mechanistic dissection of this system. Here, we report a conformation-specific RNA aptamer that binds only to Hsp70-ATP but not to Hsp70-ADP. We have refined this aptamer and demonstrated its inhibitory effect on Hsp70's ATPase activity. We have also shown that this inhibitory effect on Hsp70 is independent of its interaction with the Hsp40 co-chaperone. As Hsp70 is increasingly being recognized as a drug target in a number of age related diseases such as neurodegenerative, protein misfolding diseases and cancer, this aptamer is potentially useful in therapeutic applications. Moreover, this work also demonstrates the feasibility of using aptamers to target ATPase activity as a general therapeutic strategy.

  8. Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL

    Directory of Open Access Journals (Sweden)

    Margherita Iaboni

    2016-01-01

    Full Text Available TNF-related apoptosis-inducing ligand (TRAIL is a promising antitumor agent for its remarkable ability to selectively induce apoptosis in cancer cells, without affecting the viability of healthy bystander cells. The TRAIL tumor suppressor pathway is deregulated in many human malignancies including lung cancer. In human non-small cell lung cancer (NSCLC cells, sensitization to TRAIL therapy can be restored by increasing the expression levels of the tumor suppressor microRNA-212 (miR-212 leading to inhibition of the anti-apoptotic protein PED/PEA-15 implicated in treatment resistance. In this study, we exploited a previously described RNA aptamer inhibitor of the tyrosine kinase receptor Axl (GL21.T expressed on lung cancer cells, as a means to deliver miR-212 into human NSCLC cells expressing Axl. We demonstrate efficient delivery of miR-212 following conjugation of the miR to GL21.T (GL21.T-miR212 chimera. We show that the chimera downregulates PED and restores TRAIL-mediate cytotoxicity in cancer cells. Importantly, treatment of Axl+ lung cancer cells with the chimera resulted in (i an increase in caspase activation and (ii a reduction of cell viability in combination with TRAIL therapy. In conclusion, we demonstrate that the GL21.T-miR212 chimera can be employed as an adjuvant to TRAIL therapy for the treatment of lung cancer.

  9. Inhibition of HIV transmission in human cervicovaginal explants and humanized mice using CD4 aptamer-siRNA chimeras

    Science.gov (United States)

    Wheeler, Lee Adam; Trifonova, Radiana; Vrbanac, Vladimir; Basar, Emre; McKernan, Shannon; Xu, Zhan; Seung, Edward; Deruaz, Maud; Dudek, Tim; Einarsson, Jon Ivar; Yang, Linda; Allen, Todd M.; Luster, Andrew D.; Tager, Andrew M.; Dykxhoorn, Derek M.; Lieberman, Judy

    2011-01-01

    The continued spread of the HIV epidemic underscores the need to interrupt transmission. One attractive strategy is a topical vaginal microbicide. Sexual transmission of herpes simplex virus type 2 (HSV-2) in mice can be inhibited by intravaginal siRNA application. To overcome the challenges of knocking down gene expression in immune cells susceptible to HIV infection, we used chimeric RNAs composed of an aptamer fused to an siRNA for targeted gene knockdown in cells bearing an aptamer-binding receptor. Here, we showed that CD4 aptamer-siRNA chimeras (CD4-AsiCs) specifically suppress gene expression in CD4+ T cells and macrophages in vitro, in polarized cervicovaginal tissue explants, and in the female genital tract of humanized mice. CD4-AsiCs do not activate lymphocytes or stimulate innate immunity. CD4-AsiCs that knock down HIV genes and/or CCR5 inhibited HIV infection in vitro and in tissue explants. When applied intravaginally to humanized mice, CD4-AsiCs protected against HIV vaginal transmission. Thus, CD4-AsiCs could be used as the active ingredient of a microbicide to prevent HIV sexual transmission. PMID:21576818

  10. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    Science.gov (United States)

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  11. In vivo SELEX for Identification of Brain-penetrating Aptamers

    Directory of Open Access Journals (Sweden)

    Congsheng Cheng

    2013-01-01

    Full Text Available The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain.

  12. Selection of RNA Aptamers Against Botulinum Neurotoxin Type A Light Chain Through a Non-Radioactive Approach.

    Science.gov (United States)

    Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Cai, Shuowei

    2016-09-01

    Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive-based systematic evolution of ligands by exponential enrichment (SELEX) process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nanomolar range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting that they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that the 2'-fluorine-pyrimidine-modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for SELEX, by using regular nucleotide during SELEX, and 2'-fluorine-pyrimidine-modified nucleotide for final application to enhance their RNase-resistance.

  13. Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

    International Nuclear Information System (INIS)

    Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

    2008-01-01

    An RNA aptamer in complex with the human IgG Fc fragment have been crystallized. The stirring technique with a rotary shaker was used to improve the crystals and to ensure that they were of high quality and single, resulting in crystals that diffracted to 2.2 Å resolution. Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution

  14. antaRNA: ant colony-based RNA sequence design.

    Science.gov (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf

    2015-10-01

    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  15. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  16. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    2018-02-01

    Full Text Available New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus. In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of KD = 20 ± 1 nM.

  17. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A.

    Science.gov (United States)

    Stoltenburg, Regina; Strehlitz, Beate

    2018-02-24

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus . In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of K D = 20 ± 1 nM.

  18. Nanomechanical microcantilever operated in vibration modes with use of RNA aptamer as receptor molecules for label-free detection of HCV helicase.

    Science.gov (United States)

    Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song

    2007-11-30

    We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.

  19. In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R., E-mail: crisrcorrea@gmail.com, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de Ciencias Biologicas. Dept. de Imunologia e Bioquimica

    2013-07-01

    Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were {sup 32}P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)

  20. In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis

    International Nuclear Information System (INIS)

    Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R.; Goes, A.M.

    2013-01-01

    Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were 32 P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)

  1. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state.

    Directory of Open Access Journals (Sweden)

    Becka M Warfield

    Full Text Available RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are

  2. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  3. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

    Science.gov (United States)

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-07-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

  4. Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

    International Nuclear Information System (INIS)

    Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

    2006-01-01

    Locked nucleic acid (LNA) nucleotides are RNA analogues with a useful additional conformational constraint; the current investigation will provide the first crystallographic view of an all-LNA duplex. The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°

  5. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  6. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  7. Tissue-type plasminogen activator-binding RNA aptamers inhibiting low-density lipoprotein receptor family-mediated internalisation.

    Science.gov (United States)

    Bjerregaard, Nils; Bøtkjær, Kenneth A; Helsen, Nicky; Andreasen, Peter A; Dupont, Daniel M

    2015-07-01

    Recombinant tissue-type plasminogen activator (tPA, trade name Alteplase), currently the only drug approved by the US Food and Drug Administration and the European Medicines Agency for the treatment of cerebral ischaemic stroke, has been implicated in a number of adverse effects reportedly mediated by interactions with the low-density lipoprotein (LDL) family receptors, including neuronal cell death and an increased risk of cerebral haemorrhage. The tissue-type plasminogen activator is the principal initiator of thrombolysis in human physiology, an effect that is mediated directly via localised activation of the plasmin zymogen plasminogen at the surface of fibrin clots in the vascular lumen. Here, we sought to identify a ligand to tPA capable of inhibiting the relevant LDL family receptors without interfering with the fibrinolytic activity of tPA. Systematic evolution of ligands by exponential enrichment (SELEX) was employed to isolate tPA-binding RNA aptamers, which were characterised in biochemical assays of tPA association to low density lipoprotein receptor-related protein-1 (LRP-1, an LDL receptor family member); tPA-mediated in vitro and ex vivo clot lysis; and tPA-mediated plasminogen activation in the absence and presence of a stimulating soluble fibrin fragment. Two aptamers, K18 and K32, had minimal effects on clot lysis, but were able to efficiently inhibit tPA-LRP-1 association and LDL receptor family-mediated endocytosis in human vascular endothelial cells and astrocytes. These observations suggest that coadministration alongside tPA may be a viable strategy to improve the safety of thrombolytic treatment of cerebral ischaemic stroke by restricting tPA activity to the vascular lumen.

  8. Construction of a Bivalent Thrombin Binding Aptamer and Its Antidote with Improved Properties

    Directory of Open Access Journals (Sweden)

    Quintin W. Hughes

    2017-10-01

    Full Text Available Aptamers are short synthetic DNA or RNA oligonucleotides that adopt secondary and tertiary conformations based on Watson–Crick base-pairing interactions and can be used to target a range of different molecules. Two aptamers, HD1 and HD22, that bind to exosites I and II of the human thrombin molecule, respectively, have been extensively studied due to their anticoagulant potentials. However, a fundamental issue preventing the clinical translation of many aptamers is degradation by nucleases and reduced pharmacokinetic properties requiring higher dosing regimens more often. In this study, we have chemically modified the design of previously described thrombin binding aptamers targeting exosites I, HD1, and exosite II, HD22. The individual aptamers were first modified with an inverted deoxythymidine nucleotide, and then constructed bivalent aptamers by connecting the HD1 and HD22 aptamers either through a triethylene glycol (TEG linkage or four consecutive deoxythymidines together with an inverted deoxythymidine nucleotide at the 3′-end. The anticoagulation potential, the reversal of coagulation with different antidote sequences, and the nuclease stability of the aptamers were then investigated. The results showed that a bivalent aptamer RNV220 containing an inverted deoxythymidine and a TEG linkage chemistry significantly enhanced the anticoagulation properties in blood plasma and nuclease stability compared to the existing aptamer designs. Furthermore, a bivalent antidote sequence RNV220AD efficiently reversed the anticoagulation effect of RNV220 in blood plasma. Based on our results, we believe that RNV220 could be developed as a potential anticoagulant therapeutic molecule.

  9. Electrochemical detection of avian influenza virus H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode

    International Nuclear Information System (INIS)

    Liu Xianggang; Cheng Ziqiang; Fan Hai; Ai Shiyun; Han Ruixia

    2011-01-01

    Highlights: → A sensitive electrochemical biosensor for the detection of gene sequence was developed. → The biosensor was assembled by MWNT, polypyrrole nanowires and gold nanoparticles. → The hybrid nanomaterials could provide a porous structure with good properties. → The biosensor has highly selectivity and sensitivity. → The design strategy is expected to have extensive applications in other biosensors - Abstract: A sensitive electrochemical method for the detection of avian influenza virus (AIV) H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode was developed. To enhance the selectivity and sensitivity, the modified electrode was assembled with multi-wall carbon nanotubes (MWNT), polypyrrole nanowires (PPNWs) and gold nanoparticles (GNPs). This electrode offered a porous structure with a large effective surface area, highly electrocatalytic activities and electronic conductivity. Therefore, the amount of DNA aptamer immobilized onto the electrode was increased while the accessibility of the detection target was maintained. The biosensor is based on the hybridization and preferred orientation of a DNA aptamer immobilized onto a modified electrode surface with its target (H5N1 specific sequence) present in solution. It is selective for the H5N1 specific sequence, and the signal of the indicator was approximately linear to log(concentration) of the H5N1 specific sequence from 5.0 x 10 -12 to 1.0 x 10 -9 M (R = 0.9863) with a detection limit of 4.3 x 10 -13 M. These studies showed that the new hybrid nanomaterial (MWNT/PPNWs/GNPs) and the DNA aptamer could be used to fabricate an electrochemical biosensor for gene sequence detection. Furthermore, this design strategy is expected to have extensive applications in other biosensors.

  10. Electrochemical detection of avian influenza virus H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu Xianggang [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Cheng Ziqiang, E-mail: czqsd@126.com [College of Animal Science and Technology, Shandong Agricultural University, Taian 271018, Shandong (China); Fan Hai [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Ai Shiyun, E-mail: ashy@sdau.edu.cn [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China); Han Ruixia [College of Chemistry and Material Science, Shandong Agricultural University, Taian 271018, Shandong (China)

    2011-07-15

    Highlights: > A sensitive electrochemical biosensor for the detection of gene sequence was developed. > The biosensor was assembled by MWNT, polypyrrole nanowires and gold nanoparticles. > The hybrid nanomaterials could provide a porous structure with good properties. > The biosensor has highly selectivity and sensitivity. > The design strategy is expected to have extensive applications in other biosensors - Abstract: A sensitive electrochemical method for the detection of avian influenza virus (AIV) H5N1 gene sequence using a DNA aptamer immobilized onto a hybrid nanomaterial-modified electrode was developed. To enhance the selectivity and sensitivity, the modified electrode was assembled with multi-wall carbon nanotubes (MWNT), polypyrrole nanowires (PPNWs) and gold nanoparticles (GNPs). This electrode offered a porous structure with a large effective surface area, highly electrocatalytic activities and electronic conductivity. Therefore, the amount of DNA aptamer immobilized onto the electrode was increased while the accessibility of the detection target was maintained. The biosensor is based on the hybridization and preferred orientation of a DNA aptamer immobilized onto a modified electrode surface with its target (H5N1 specific sequence) present in solution. It is selective for the H5N1 specific sequence, and the signal of the indicator was approximately linear to log(concentration) of the H5N1 specific sequence from 5.0 x 10{sup -12} to 1.0 x 10{sup -9} M (R = 0.9863) with a detection limit of 4.3 x 10{sup -13} M. These studies showed that the new hybrid nanomaterial (MWNT/PPNWs/GNPs) and the DNA aptamer could be used to fabricate an electrochemical biosensor for gene sequence detection. Furthermore, this design strategy is expected to have extensive applications in other biosensors.

  11. Targeted inhibition of αvβ3 integrin with an RNA aptamer impairs endothelial cell growth and survival

    International Nuclear Information System (INIS)

    Mi Jing; Zhang Xiuwu; Giangrande, Paloma H.; McNamara, James O.; Nimjee, Shahid M.; Sarraf-Yazdi, Shiva; Sullenger, Bruce A.; Clary, Bryan M.

    2005-01-01

    αvβ3 integrin is a crucial factor involved in a variety of physiological processes, such as cell growth and migration, tumor invasion and metastasis, angiogenesis, and wound healing. αvβ3 integrin exerts its effect by regulating endothelial cell (EC) migration, proliferation, and survival. Inhibiting the function of αvβ3 integrin, therefore, represents a potential anti-cancer, anti-thrombotic, and anti-inflammatory strategy. In this study, we tested an RNA aptamer, Apt-αvβ3 that binds recombinant αvβ3 integrin, for its ability to bind endogenous αvβ3 integrin on the surface of cells in culture and to subsequently affect cellular response. Our data illustrate that Apt-αvβ3 binds αvβ3 integrin expressed on the surface of live HUVECs. This interaction significantly decreases both basal and PDGF-induced cell proliferation as well as inhibition of cell adhesion. Apt-αvβ3 can also reduce PDGF-stimulated tube formation and increase HUVEC apoptosis through inhibition of FAK phosphorylation pathway. Our results demonstrate that by binding to its target, Apt-αvβ3 can efficiently inhibit human EC proliferation and survival, resulting in reduced angiogenesis. It predicts that Apt-αvβ3 could become useful in both tumor imaging and the treatment of tumor growth, atherosclerosis, thrombosis, and inflammation

  12. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles.

    Science.gov (United States)

    Guo, Sijin; Li, Hui; Ma, Mengshi; Fu, Jian; Dong, Yizhou; Guo, Peixuan

    2017-12-15

    RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Size, Shape, and Sequence-Dependent Immunogenicity of RNA Nanoparticles

    Directory of Open Access Journals (Sweden)

    Sijin Guo

    2017-12-01

    Full Text Available RNA molecules have emerged as promising therapeutics. Like all other drugs, the safety profile and immune response are important criteria for drug evaluation. However, the literature on RNA immunogenicity has been controversial. Here, we used the approach of RNA nanotechnology to demonstrate that the immune response of RNA nanoparticles is size, shape, and sequence dependent. RNA triangle, square, pentagon, and tetrahedron with same shape but different sizes, or same size but different shapes were used as models to investigate the immune response. The levels of pro-inflammatory cytokines induced by these RNA nanoarchitectures were assessed in macrophage-like cells and animals. It was found that RNA polygons without extension at the vertexes were immune inert. However, when single-stranded RNA with a specific sequence was extended from the vertexes of RNA polygons, strong immune responses were detected. These immunostimulations are sequence specific, because some other extended sequences induced little or no immune response. Additionally, larger-size RNA square induced stronger cytokine secretion. 3D RNA tetrahedron showed stronger immunostimulation than planar RNA triangle. These results suggest that the immunogenicity of RNA nanoparticles is tunable to produce either a minimal immune response that can serve as safe therapeutic vectors, or a strong immune response for cancer immunotherapy or vaccine adjuvants.

  14. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  15. Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

    Science.gov (United States)

    George, Tina P; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  16. Reconstruction of ancestral RNA sequences under multiple structural constraints

    OpenAIRE

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldisp?hl, J?r?me

    2016-01-01

    Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given...

  17. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  18. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  19. The Subcellular Localisation of the Human Papillomavirus (HPV 16 E7 Protein in Cervical Cancer Cells and Its Perturbation by RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Özlem Cesur

    2015-06-01

    Full Text Available Human papillomavirus (HPV is the most common viral infection of the reproductive tract, affecting both men and women. High-risk oncogenic types are responsible for almost 90% of anogenital and oropharyngeal cancers including cervical cancer. Some of the HPV “early” genes, particularly E6 and E7, are known to act as oncogenes that promote tumour growth and malignant transformation. Most notably, HPV-16 E7 interacts with the tumour suppressor protein pRb, promoting its degradation, leading to cell cycle dysregulation in infected cells. We have previously shown that an RNA aptamer (termed A2 selectively binds to HPV16 E7 and is able to induce apoptosis in HPV16-transformed cervical carcinoma cell lines (SiHa through reduction of E7 levels. In this study, we investigated the effects of the A2 aptamer on E7 localisation in order to define its effects on E7 activity. We demonstrate for the first time that E7 localised to the plasma membrane. In addition, we show that A2 enhanced E7 localisation in the ER and that the A2-mediated reduction of E7 was not associated with proteasomal degradation. These data suggest that A2 perturbs normal E7 trafficking through promoting E7 ER retention.

  20. Annotating RNA motifs in sequences and alignments.

    Science.gov (United States)

    Gardner, Paul P; Eldai, Hisham

    2015-01-01

    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  2. Construction of an Aptamer-SiRNA Chimera-Modified Tissue-Engineered Blood Vessel for Cell-Type-Specific Capture and Delivery.

    Science.gov (United States)

    Chen, Wen; Zeng, Wen; Sun, Jiansen; Yang, Mingcan; Li, Li; Zhou, Jingting; Wu, Yangxiao; Sun, Jun; Liu, Ge; Tang, Rui; Tan, Ju; Zhu, Chuhong

    2015-06-23

    The application of tissue-engineered blood vessels (TEBVs) is the main developmental direction of vascular replacement therapy. Due to few and/or dysfunctional endothelial progenitor cells (EPCs), it is difficult to successfully construct EPC capture TEBVs in diabetes. RNA has a potential application in cell protection and diabetes treatment, but poor specificity and low efficiency of RNA transfection in vivo limit the application of RNA. On the basis of an acellular vascular matrix, we propose an aptamer-siRNA chimera-modified TEBV that can maintain a satisfactory patency in diabetes. This TEBV consists of two parts, CD133-adenosine kinase (ADK) chimeras and a TEBV scaffold. Our results showed that CD133-ADK chimeras could selectively capture the CD133-positive cells in vivo, and then captured cells can internalize the bound chimeras to achieve RNA self-transfection. Subsequently, CD133-ADK chimeras were cut into ADK siRNA by a dicer, resulting in depletion of ADK. An ADK-deficient cell may act as a bioreactor that sustainably releases adenosine. To reduce nonspecific RNA transfection, we increased the proportion of HAuCl4 during the material preparation, through which the transfection capacity of polyethylenimine (PEI)/polyethylene glycol (PEG)-capped gold nanoparticles (PEI/PEG-AuNPs) was significantly decreased and the ability of TEBV to resist tensile and liquid shear stress was greatly enhanced. PEG and 2'-O-methyl modification was used to enhance the in vivo stability of RNA chimeras. At day 30 postgrafting, the patency rate of CD133-ADK chimera-modified TEBVs reached 90% in diabetic rats and good endothelialization was observed.

  3. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  4. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  5. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  6. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  7. The chemical structure of DNA sequence signals for RNA transcription

    Science.gov (United States)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  8. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    Science.gov (United States)

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  9. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hongguang Sun

    2014-01-01

    Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

  10. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  11. Small molecule alteration of RNA sequence in cells and animals.

    Science.gov (United States)

    Guan, Lirui; Luo, Yiling; Ja, William W; Disney, Matthew D

    2017-10-18

    RNA regulation and maintenance are critical for proper cell function. Small molecules that specifically alter RNA sequence would be exceptionally useful as probes of RNA structure and function or as potential therapeutics. Here, we demonstrate a photochemical approach for altering the trinucleotide expanded repeat causative of myotonic muscular dystrophy type 1 (DM1), r(CUG) exp . The small molecule, 2H-4-Ru, binds to r(CUG) exp and converts guanosine residues to 8-oxo-7,8-dihydroguanosine upon photochemical irradiation. We demonstrate targeted modification upon irradiation in cell culture and in Drosophila larvae provided a diet containing 2H-4-Ru. Our results highlight a general chemical biology approach for altering RNA sequence in vivo by using small molecules and photochemistry. Furthermore, these studies show that addition of 8-oxo-G lesions into RNA 3' untranslated regions does not affect its steady state levels. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  13. Using Aptamers for Cancer Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Yun Min Chang

    2013-01-01

    Full Text Available Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment SELEX and cell-based SELEX (cell-SELEX. Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics.

  14. RNA sequencing: current and prospective uses in metabolic research.

    Science.gov (United States)

    Vikman, Petter; Fadista, Joao; Oskolkov, Nikolay

    2014-10-01

    Previous global RNA analysis was restricted to known transcripts in species with a defined transcriptome. Next generation sequencing has transformed transcriptomics by making it possible to analyse expressed genes with an exon level resolution from any tissue in any species without any a priori knowledge of which genes that are being expressed, splice patterns or their nucleotide sequence. In addition, RNA sequencing is a more sensitive technique compared with microarrays with a larger dynamic range, and it also allows for investigation of imprinting and allele-specific expression. This can be done for a cost that is able to compete with that of a microarray, making RNA sequencing a technique available to most researchers. Therefore RNA sequencing has recently become the state of the art with regards to large-scale RNA investigations and has to a large extent replaced microarrays. The only drawback is the large data amounts produced, which together with the complexity of the data can make a researcher spend far more time on analysis than performing the actual experiment. © 2014 Society for Endocrinology.

  15. DNA-Aptamers Binding Aminoglycoside Antibiotics

    Directory of Open Access Journals (Sweden)

    Nadia Nikolaus

    2014-02-01

    Full Text Available Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  16. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    Science.gov (United States)

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  17. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  18. Aptamer-based technology for food analysis.

    Science.gov (United States)

    Liu, Xiaofei; Zhang, Xuewu

    2015-01-01

    Aptamers are short and functional single-stranded oligonucleotide sequences selected from systematic evolution of ligands by exponential enrichment (SELEX) process, which have the capacity to recognize various classes of target molecules with high affinity and specificity. Various analytical aptamers acquired by SELEX are widely used in many research fields, such as medicine, biology, and chemistry. However, the application of this innovative and emerging technology to food safety is just in infant stage. Food safety plays a very important role in our daily lives because varieties of poisonous and harmful substances in food affect human health. Aptamer technique is promising, which can overcome many disadvantages of existing detection methods in food safety, such as long detection time, low sensitivity, difficult, and expensive antibody preparation. This review provides an overview of various aptamer screening technologies and summarizes the recent applications of aptamers in food safety, and future prospects are also discussed.

  19. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard

    2016-11-01

    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  20. Reconstruction of ancestral RNA sequences under multiple structural constraints.

    Science.gov (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

    2016-11-11

    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  1. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  2. Development of radiopharmaceuticals based on aptamers: selection and characterization of DNA aptamers for CEA

    International Nuclear Information System (INIS)

    Correa, C.R.; Andrade, A.S.R.; Augusto-Pinto, L.; Goes, A.M.

    2011-01-01

    Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da

  3. Development of radiopharmaceuticals based on aptamers: selection and characterization of DNA aptamers for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Andrade, A.S.R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Augusto-Pinto, L. [BioAptus, Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Departamento de Imunologia e Bioquimica. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais. Belo Horizonte, MG (Brazil)

    2011-07-01

    Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da

  4. Deep-sequencing protocols influence the results obtained in small-RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Joern Toedling

    Full Text Available Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons.

  5. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  6. Sequence analysis of L RNA of Lassa virus

    International Nuclear Information System (INIS)

    Vieth, Simon; Torda, Andrew E.; Asper, Marcel; Schmitz, Herbert; Guenther, Stephan

    2004-01-01

    The L RNA of three Lassa virus strains originating from Nigeria, Ghana/Ivory Coast, and Sierra Leone was sequenced and the data subjected to structure predictions and phylogenetic analyses. The L gene products had 2218-2221 residues, diverged by 18% at the amino acid level, and contained several conserved regions. Only one region of 504 residues (positions 1043-1546) could be assigned a function, namely that of an RNA polymerase. Secondary structure predictions suggest that this domain is very similar to RNA-dependent RNA polymerases of known structure encoded by plus-strand RNA viruses, permitting a model to be built. Outside the polymerase region, there is little structural data, except for regions of strong alpha-helical content and probably a coiled-coil domain at the N terminus. No evidence for reassortment or recombination during Lassa virus evolution was found. The secondary structure-assisted alignment of the RNA polymerase region permitted a reliable reconstruction of the phylogeny of all negative-strand RNA viruses, indicating that Arenaviridae are most closely related to Nairoviruses. In conclusion, the data provide a basis for structural and functional characterization of the Lassa virus L protein and reveal new insights into the phylogeny of negative-strand RNA viruses

  7. RNA-DNA sequence differences spell genetic code ambiguities

    DEFF Research Database (Denmark)

    Bentin, Thomas; Nielsen, Michael L

    2013-01-01

    A recent paper in Science by Li et al. 2011(1) reports widespread sequence differences in the human transcriptome between RNAs and their encoding genes termed RNA-DNA differences (RDDs). The findings could add a new layer of complexity to gene expression but the study has been criticized. ...

  8. Finding the most significant common sequence and structure motifs in a set of RNA sequences

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

    1997-01-01

    We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

  9. Aptamer therapeutics: A review of current practice

    International Nuclear Information System (INIS)

    Perkins, A.C.; Missailidis, S.

    2007-01-01

    Full text: The development of nuclease resistant oligonucleotide agents known as aptamers, offers an alternative to antibodies as targeting, diagnostic and delivery agents. The production technique of specific receptor binding molecules based on defined nucleic acid sequences is known as systematic evolution of ligands by exponential enrichment (SELEX). Using this technique, aptamers can be produced rapidly and with high homogeneity. Furthermore, they are stable over long term storage at ambient room temperatures. A monomeric aptamer is small in size, with a molecular weight as low as 5 to 10 kDa. However, the aptamer molecule may be used as a building block for custom designed targeting agents, offering several advantages. Aptamers have been found to bind their targets with high specificity and with dissociation constants in the subnanomolar or picomolar range. The first pharmaceutical aptamer formulation, Macugen (pegaptanib sodium injection) was approved in the United States in December of 2004. This is an anti-VEGF aptamer formulation used for the treatment of Neovascular agerelated macular degeneration. Other possibilities in cardiovascular, neurodegenerative and tropical medicine are apparent. As tumour targeting agents, aptamers penetrate tissues readily, reach peak levels quickly and clear from the body rapidly, thus having properties of low toxicity and immunoreactivity. Work with radiolabelled aptamers is limited to pre-clinical studies, but the body of evidence is steadily growing and aptamers are emerging as valuable clinical products for diagnostic imaging and therapy. Peptide coupling reactions between amino and carboxylic groups offer the possibility of labelling the aptamers with a number of chelators that, coupled with appropriate radionuclides, would generate novel targeted radiopharmaceuticals for the diagnosis and therapy of disease. The unparalleled combinatorial chemical diversity, small size and modification ability of aptamers is expected to

  10. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    DEFF Research Database (Denmark)

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...

  11. Chimira: analysis of small RNA sequencing data and microRNA modifications.

    Science.gov (United States)

    Vitsios, Dimitrios M; Enright, Anton J

    2015-10-15

    Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  12. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  13. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  14. Recent Advances in Aptamers Targeting Immune System.

    Science.gov (United States)

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  15. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

    International Nuclear Information System (INIS)

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-01-01

    The RNA-binding protein Hfq from B. subtilis was crystallized using the hanging-drop vapour-diffusion method in two crystal forms that belonged to space groups I422 and F222; diffraction data were collected to 2.2 Å resolution from both forms. The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis

  16. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  17. Identification of Bacterial Small RNAs by RNA Sequencing

    DEFF Research Database (Denmark)

    Gómez Lozano, María; Marvig, Rasmus Lykke; Molin, Søren

    2014-01-01

    sequencing (RNA-seq) is described that involves the preparation and analysis of three different sequencing libraries. As a signifi cant number of unique sRNAs are identifi ed in each library, the libraries can be used either alone or in combination to increase the number of sRNAs identifi ed. The approach......Small regulatory RNAs (sRNAs) in bacteria are known to modulate gene expression and control a variety of processes including metabolic reactions, stress responses, and pathogenesis in response to environmental signals. A method to identify bacterial sRNAs on a genome-wide scale based on RNA...... may be applied to identify sRNAs in any bacterium under different growth and stress conditions....

  18. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

    Science.gov (United States)

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-05-01

    The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

  19. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  20. Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

    Science.gov (United States)

    Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...

  1. Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.

    Directory of Open Access Journals (Sweden)

    Thomas Birkballe Hansen

    Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.

  2. RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

    Science.gov (United States)

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2011-01-07

    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  3. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    Science.gov (United States)

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Single-Cell RNA Sequencing of Glioblastoma Cells.

    Science.gov (United States)

    Sen, Rajeev; Dolgalev, Igor; Bayin, N Sumru; Heguy, Adriana; Tsirigos, Aris; Placantonakis, Dimitris G

    2018-01-01

    Single-cell RNA sequencing (sc-RNASeq) is a recently developed technique used to evaluate the transcriptome of individual cells. As opposed to conventional RNASeq in which entire populations are sequenced in bulk, sc-RNASeq can be beneficial when trying to better understand gene expression patterns in markedly heterogeneous populations of cells or when trying to identify transcriptional signatures of rare cells that may be underrepresented when using conventional bulk RNASeq. In this method, we describe the generation and analysis of cDNA libraries from single patient-derived glioblastoma cells using the C1 Fluidigm system. The protocol details the use of the C1 integrated fluidics circuit (IFC) for capturing, imaging and lysing cells; performing reverse transcription; and generating cDNA libraries that are ready for sequencing and analysis.

  5. Unifying cancer and normal RNA sequencing data from different sources

    Science.gov (United States)

    Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus

    2018-01-01

    Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

  6. Integrated mRNA and microRNA transcriptome sequencing characterizes sequence variants and mRNA–microRNA regulatory network in nasopharyngeal carcinoma model systems

    Directory of Open Access Journals (Sweden)

    Carol Ying-Ying Szeto

    2014-01-01

    Full Text Available Nasopharyngeal carcinoma (NPC is a prevalent malignancy in Southeast Asia among the Chinese population. Aberrant regulation of transcripts has been implicated in many types of cancers including NPC. Herein, we characterized mRNA and miRNA transcriptomes by RNA sequencing (RNASeq of NPC model systems. Matched total mRNA and small RNA of undifferentiated Epstein–Barr virus (EBV-positive NPC xenograft X666 and its derived cell line C666, well-differentiated NPC cell line HK1, and the immortalized nasopharyngeal epithelial cell line NP460 were sequenced by Solexa technology. We found 2812 genes and 149 miRNAs (human and EBV to be differentially expressed in NP460, HK1, C666 and X666 with RNASeq; 533 miRNA–mRNA target pairs were inversely regulated in the three NPC cell lines compared to NP460. Integrated mRNA/miRNA expression profiling and pathway analysis show extracellular matrix organization, Beta-1 integrin cell surface interactions, and the PI3K/AKT, EGFR, ErbB, and Wnt pathways were potentially deregulated in NPC. Real-time quantitative PCR was performed on selected mRNA/miRNAs in order to validate their expression. Transcript sequence variants such as short insertions and deletions (INDEL, single nucleotide variant (SNV, and isomiRs were characterized in the NPC model systems. A novel TP53 transcript variant was identified in NP460, HK1, and C666. Detection of three previously reported novel EBV-encoded BART miRNAs and their isomiRs were also observed. Meta-analysis of a model system to a clinical system aids the choice of different cell lines in NPC studies. This comprehensive characterization of mRNA and miRNA transcriptomes in NPC cell lines and the xenograft provides insights on miRNA regulation of mRNA and valuable resources on transcript variation and regulation in NPC, which are potentially useful for mechanistic and preclinical studies.

  7. SimFuse: A Novel Fusion Simulator for RNA Sequencing (RNA-Seq Data

    Directory of Open Access Journals (Sweden)

    Yuxiang Tan

    2015-01-01

    Full Text Available The performance evaluation of fusion detection algorithms from high-throughput sequencing data crucially relies on the availability of data with known positive and negative cases of gene rearrangements. The use of simulated data circumvents some shortcomings of real data by generation of an unlimited number of true and false positive events, and the consequent robust estimation of accuracy measures, such as precision and recall. Although a few simulated fusion datasets from RNA Sequencing (RNA-Seq are available, they are of limited sample size. This makes it difficult to systematically evaluate the performance of RNA-Seq based fusion-detection algorithms. Here, we present SimFuse to address this problem. SimFuse utilizes real sequencing data as the fusions’ background to closely approximate the distribution of reads from a real sequencing library and uses a reference genome as the template from which to simulate fusions’ supporting reads. To assess the supporting read-specific performance, SimFuse generates multiple datasets with various numbers of fusion supporting reads. Compared to an extant simulated dataset, SimFuse gives users control over the supporting read features and the sample size of the simulated library, based on which the performance metrics needed for the validation and comparison of alternative fusion-detection algorithms can be rigorously estimated.

  8. Preparation of highly multiplexed small RNA sequencing libraries.

    Science.gov (United States)

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

    2017-08-01

    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  9. Utility of RNA Sequencing for Analysis of Maize Reproductive Transcriptomes

    Directory of Open Access Journals (Sweden)

    Rebecca M. Davidson

    2011-11-01

    Full Text Available Transcriptome sequencing is a powerful method for studying global expression patterns in large, complex genomes. Evaluation of sequence-based expression profiles during reproductive development would provide functional annotation to genes underlying agronomic traits. We generated transcriptome profiles for 12 diverse maize ( L. reproductive tissues representing male, female, developing seed, and leaf tissues using high throughput transcriptome sequencing. Overall, ∼80% of annotated genes were expressed. Comparative analysis between sequence and hybridization-based methods demonstrated the utility of ribonucleic acid sequencing (RNA-seq for expression determination and differentiation of paralagous genes (∼85% of maize genes. Analysis of 4975 gene families across reproductive tissues revealed expression divergence is proportional to family size. In all pairwise comparisons between tissues, 7 (pre- vs. postemergence cobs to 48% (pollen vs. ovule of genes were differentially expressed. Genes with expression restricted to a single tissue within this study were identified with the highest numbers observed in leaves, endosperm, and pollen. Coexpression network analysis identified 17 gene modules with complex and shared expression patterns containing many previously described maize genes. The data and analyses in this study provide valuable tools through improved gene annotation, gene family characterization, and a core set of candidate genes to further characterize maize reproductive development and improve grain yield potential.

  10. Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.

    Science.gov (United States)

    Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio

    2018-05-03

    RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.

  11. Colorimetric detection with aptamer-gold nanoparticle conjugates: effect of aptamer length on response

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, Jorge L. [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States); MacCuspie, Robert I. [National Institute of Standards and Technology, Ceramics Division (United States); Stone, Morley O.; Kelley-Loughnane, Nancy, E-mail: Nancy.Kelley-Loughnane@wpafb.af.mil [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States)

    2012-10-15

    A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA-AuNP conjugates (RBA-AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA-AuNPs' stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5 Prime end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA-AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA-AuNPs' stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer-AuNPs conjugates and their sensing response.

  12. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

    Science.gov (United States)

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

    2018-05-09

    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  13. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  14. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  15. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    Science.gov (United States)

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  16. Radiolabelled aptamers for tumour imaging and therapy

    International Nuclear Information System (INIS)

    Perkins, A.C.; Missailidis, S.

    2005-01-01

    Full text: The growth in biotechnology has led to new techniques for the design, selection and production of ligands capable of molecular recognition. One promising approach is the production of specific receptor binding molecules based on specific nucleic acid sequences that are capable of recognising a wide array of target molecules. These oligonuclide ligands are known as aptamers. The technology that allows production of aptamer molecules is known as systematic evolution of ligands by exponential enrichment (SELEX). We have used combinatorial chemistry techniques coupled with polymerase chain reaction (PCR) to rapidly select aptamers from degenerate libraries that bind with high affinity and specificity to the protein core of the MUC1 antigen, a tumour marker previously extensively used in tumour imaging and therapy. MUC1 is widely expressed by normal glandular epithelial cells, however this expression is dramatically increased when the cells become malignant. This has been well documented for breast and ovarian cancer, as well as some lung, pancreatic and prostate cancers. Recently it has also been shown that MUC1 is a valuable marker for bladder and has been used for the imaging and targeted therapy of bladder cancer. The aptamer selection process was performed on affinity chromatography matrices. After ten rounds of selection and amplification, aptamers were cloned and sequenced. Post SELEX amino modifications have been used to confer nuclease resistance and coupling potential. The aptamers bound to MUC1 antigen with a Kd of 5nm and high specificity, demonstrated by fluorescent microscopy on MUC1-expressing tumour cells. Using peptide coupling reactions, we have successfully attached chelators for Tc-99m radiolabelling. Two of the constructs tested were based on mono-aptamer chelator complexes, one with commercially available MAG3 and one with a novel designed cyclen-based chelator. The other two constructs were based on the use of multi-aptamer complexes

  17. Mechanisms controlling mRNA processing and translation : decoding the regulatory layers defining gene expression through RNA sequencing

    NARCIS (Netherlands)

    Klerk, Eleonora de

    2015-01-01

    The work described in this thesis focuses on the mechanisms that give rise to alternative mRNAs and their alternative translation into proteins. Each of the described studies has been based on a specific set of high-throughput RNA sequencing technologies. An overview of the available RNA sequencing

  18. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  19. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  20. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  1. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    International Nuclear Information System (INIS)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-01-01

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

  2. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  3. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  4. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  5. Modulations of RNA sequences by cytokinin in pumpkin cotyledons

    International Nuclear Information System (INIS)

    Chang, C.; Ertl, J.; Chen, C.

    1987-01-01

    Polyadenylated mRNAs from excised pumpkin cotyledons treated with or without 10 -4 M benzyladenine (BA) for various time periods in suspension culture were assayed by in vitro translation in the presence of [ 35 S] methionine. The radioactive polypeptides were analyzed by one- and two-dimensional polyacrylamide gel electrophoresis. Specific sequences of mRNAs were enhanced, reduced, induced, or suppressed by the hormone within 60 min of the application of BA to the cotyledons. Four independent cDNA clones of cytokinin-modulated mRNAs have been selected and characterized. RNA blot hybridization using the four cDNA probes also indicates that the levels of specific mRNAs are modulated upward or downward by the hormone

  6. Computational Methods for Modeling Aptamers and Designing Riboswitches

    Directory of Open Access Journals (Sweden)

    Sha Gong

    2017-11-01

    Full Text Available Riboswitches, which are located within certain noncoding RNA region perform functions as genetic “switches”, regulating when and where genes are expressed in response to certain ligands. Understanding the numerous functions of riboswitches requires computation models to predict structures and structural changes of the aptamer domains. Although aptamers often form a complex structure, computational approaches, such as RNAComposer and Rosetta, have already been applied to model the tertiary (three-dimensional (3D structure for several aptamers. As structural changes in aptamers must be achieved within the certain time window for effective regulation, kinetics is another key point for understanding aptamer function in riboswitch-mediated gene regulation. The coarse-grained self-organized polymer (SOP model using Langevin dynamics simulation has been successfully developed to investigate folding kinetics of aptamers, while their co-transcriptional folding kinetics can be modeled by the helix-based computational method and BarMap approach. Based on the known aptamers, the web server Riboswitch Calculator and other theoretical methods provide a new tool to design synthetic riboswitches. This review will represent an overview of these computational methods for modeling structure and kinetics of riboswitch aptamers and for designing riboswitches.

  7. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  8. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  10. Aptamer and its applications in neurodegenerative diseases.

    Science.gov (United States)

    Qu, Jing; Yu, Shuqing; Zheng, Yuan; Zheng, Yan; Yang, Hui; Zhang, Jianliang

    2017-02-01

    Aptamers are small single-stranded DNA or RNA oligonucleotide fragments or small peptides, which can bind to targets by high affinity and specificity. Because aptamers are specific, non-immunogenic and non-toxic, they are ideal materials for clinical applications. Neurodegenerative disorders are ravaging the lives of patients. Even though the mechanism of these diseases is still elusive, they are mainly characterized by the accumulation of misfolded proteins in the central nervous system. So it is essential to develop potential measures to slow down or prevent the onset of these diseases. With the advancements of the technologies, aptamers have opened up new areas in this research field. Aptamers could bind with these related target proteins to interrupt their accumulation, subsequently blocking or preventing the process of neurodegenerative diseases. This review presents recent advances in the aptamer generation and its merits and limitations, with emphasis on its applications in neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, transmissible spongiform encephalopathy, Huntington's disease and multiple sclerosis.

  11. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  12. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  13. High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces

    Directory of Open Access Journals (Sweden)

    Orada Chumphukam

    2014-04-01

    Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.

  14. Hierarchy and Assortativity as New Tools for Binding-Affinity Investigation: The Case of the TBA Aptamer-Ligand Complex.

    Science.gov (United States)

    Cataldo, Rosella; Alfinito, Eleonora; Reggiani, Lino

    2017-12-01

    Aptamers are single stranded DNA, RNA, or peptide sequences having the ability to bind several specific targets (proteins, molecules as well as ions). Therefore, aptamer production and selection for therapeutic and diagnostic applications is very challenging. Usually, they are generated in vitro, although computational approaches have been recently developed for the in silico production. Despite these efforts, the mechanism of aptamer-ligand formation is not completely clear, and producing high-affinity aptamers is still quite difficult. This paper aims to develop a computational model able to describe aptamer-ligand affinity. Topological tools, such as the conventional degree distribution, the rank-degree distribution (hierarchy), and the node assortativity are employed. In doing so, the macromolecules tertiary-structures are mapped into appropriate graphs. These graphs reproduce the main topological features of the macromolecules, by preserving the distances between amino acids (nucleotides). Calculations are applied to the thrombin binding aptamer (TBA), and the TBA-thrombin complex produced in the presence of Na + or K + . The topological analysis is able to detect several differences between complexes obtained in the presence of the two cations, as expected by previous investigations. These results support graph analysis as a novel computational tool for testing affinity. Otherwise, starting from the graphs, an electrical network can be obtained by using the specific electrical properties of amino acids and nucleobases. Therefore, a further analysis concerns with the electrical response, revealing that the resistance is sensitively affected by the presence of sodium or potassium, thus suggesting resistance as a useful physical parameter for testing binding affinity.

  15. Direct fluorescence anisotropy assay for cocaine using tetramethylrhodamine-labeled aptamer.

    Science.gov (United States)

    Liu, Yingxiong; Zhao, Qiang

    2017-06-01

    Development of simple, sensitive, and rapid method for cocaine detection is important in medicine and drug abuse monitoring. Taking advantage of fluorescence anisotropy and aptamer, this study reports a direct fluorescence anisotropy (FA) assay for cocaine by employing an aptamer probe with tetramethylrhodamine (TMR) labeled on a specific position. The binding of cocaine and the aptamer causes a structure change of the TMR-labeled aptamer, leading to changes of the interaction between labeled TMR and adjacent G bases in aptamer sequence, so FA of TMR varies with increasing of cocaine. After screening different labeling positions of the aptamer, including thymine (T) bases and terminals of the aptamer, we obtained a favorable aptamer probe with TMR labeled on the 25th base T in the sequence, which exhibited sensitive and significant FA-decreasing responses upon cocaine. Under optimized assay conditions, this TMR-labeled aptamer allowed for direct FA detection of cocaine as low as 5 μM. The maximum FA change reached about 0.086. This FA method also enabled the detection of cocaine spiked in diluted serum and urine samples, showing potential for applications. Graphical Abstract The binding of cocaine to the TMR-labeled aptamer causes conformation change and alteration of the intramolecular interaction between TMR and bases of aptamer, leading to variance of fluorescence anisotropy (FA) of TMR, so direct FA analyis of cocaine is achieved.

  16. The use of oligonucleotide aptamers in cancer therapy

    Directory of Open Access Journals (Sweden)

    Adrian Odrzywolski

    2016-05-01

    Full Text Available Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers – particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug.

  17. sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

    Science.gov (United States)

    Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

    2017-12-01

    Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

    Science.gov (United States)

    Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

    2017-01-01

    Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500

  19. CELL-SELEX: Novel Perspectives of Aptamer-Based Therapeutics

    Directory of Open Access Journals (Sweden)

    Hans P. Wendel

    2008-04-01

    Full Text Available Aptamers, single stranded DNA or RNA molecules, generated by a method called SELEX (systematic evolution of ligands by exponential enrichment have been widely used in various biomedical applications. The newly developed Cell-SELEX (cell based-SELEX targeting whole living cells has raised great expectations for cancer biology, -therapy and regenerative medicine. Combining nanobiotechnology with aptamers, this technology opens the way to more sophisticated applications in molecular diagnosis. This paper gives a review of recent developments in SELEX technologies and new applications of aptamers.

  20. Comparison of classifications of aptamers against Vibrio ...

    African Journals Online (AJOL)

    ELO

    2012-01-05

    Jan 5, 2012 ... research on selection of aptamers against pathogens. MATERIALS AND .... actually stem from the variations in the middle sequences, it is essential to ... loops that are connected by double strand DNA, so the two loops are in ...

  1. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    Science.gov (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  2. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  3. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    Science.gov (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  4. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

    Science.gov (United States)

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

    2015-01-15

    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Aptamer selection and applications for breast cancer diagnostics and therapy

    Directory of Open Access Journals (Sweden)

    Mei Liu

    2017-11-01

    Full Text Available Abstract Aptamers are short non-coding, single-stranded oligonucleotides (RNA or DNA developed through Systematic Evolution of Ligands by Exponential enrichment (SELEX in vitro. Similar to antibodies, aptamers can bind to specific targets with high affinity, and are considered promising therapeutic agents as they have several advantages over antibodies, including high specificity, stability, and non-immunogenicity. Furthermore, aptamers can be produced at a low cost and easily modified, and are, therefore, called “chemical antibodies”. In the past years, a variety of aptamers specifically bound to both breast cancer biomarkers and cells had been selected. Besides, taking advantage of nanomaterials, there were a number of aptamer-nanomaterial conjugates been developed and widely investigated for diagnostics and targeted therapy of breast cancer. In this short review, we first present a systematical review of various aptamer selection methods. Then, various aptamer-based diagnostic and therapeutic strategies of breast cancer were provided. Finally, the current problems, challenges, and future perspectives in the field were thoroughly discussed.

  6. Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization.

    Science.gov (United States)

    Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong

    2012-08-01

    Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.

  7. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity.

    Science.gov (United States)

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong

    2016-06-01

    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. RNA sequencing of the exercise transcriptome in equine athletes.

    Directory of Open Access Journals (Sweden)

    Stefano Capomaccio

    Full Text Available The horse is an optimal model organism for studying the genomic response to exercise-induced stress, due to its natural aptitude for athletic performance and the relative homogeneity of its genetic and environmental backgrounds. Here, we applied RNA-sequencing analysis through the use of SOLiD technology in an experimental framework centered on exercise-induced stress during endurance races in equine athletes. We monitored the transcriptional landscape by comparing gene expression levels between animals at rest and after competition. Overall, we observed a shift from coding to non-coding regions, suggesting that the stress response involves the differential expression of not annotated regions. Notably, we observed significant post-race increases of reads that correspond to repeats, especially the intergenic and intronic L1 and L2 transposable elements. We also observed increased expression of the antisense strands compared to the sense strands in intronic and regulatory regions (1 kb up- and downstream of the genes, suggesting that antisense transcription could be one of the main mechanisms for transposon regulation in the horse under stress conditions. We identified a large number of transcripts corresponding to intergenic and intronic regions putatively associated with new transcriptional elements. Gene expression and pathway analysis allowed us to identify several biological processes and molecular functions that may be involved with exercise-induced stress. Ontology clustering reflected mechanisms that are already known to be stress activated (e.g., chemokine-type cytokines, Toll-like receptors, and kinases, as well as "nucleic acid binding" and "signal transduction activity" functions. There was also a general and transient decrease in the global rates of protein synthesis, which would be expected after strenuous global stress. In sum, our network analysis points toward the involvement of specific gene clusters in equine exercise

  9. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  10. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    Directory of Open Access Journals (Sweden)

    Huseyin Avni Oktem

    2011-08-01

    Full Text Available Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  11. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  12. High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases

    Science.gov (United States)

    Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.

    2016-01-01

    Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030

  13. Messenger RNA biomarker signatures for forensic body fluid identification revealed by targeted RNA sequencing.

    Science.gov (United States)

    Hanson, E; Ingold, S; Haas, C; Ballantyne, J

    2018-05-01

    The recovery of a DNA profile from the perpetrator or victim in criminal investigations can provide valuable 'source level' information for investigators. However, a DNA profile does not reveal the circumstances by which biological material was transferred. Some contextual information can be obtained by a determination of the tissue or fluid source of origin of the biological material as it is potentially indicative of some behavioral activity on behalf of the individual that resulted in its transfer from the body. Here, we sought to improve upon established RNA based methods for body fluid identification by developing a targeted multiplexed next generation mRNA sequencing assay comprising a panel of approximately equal sized gene amplicons. The multiplexed biomarker panel includes several highly specific gene targets with the necessary specificity to definitively identify most forensically relevant biological fluids and tissues (blood, semen, saliva, vaginal secretions, menstrual blood and skin). In developing the biomarker panel we evaluated 66 gene targets, with a progressive iteration of testing target combinations that exhibited optimal sensitivity and specificity using a training set of forensically relevant body fluid samples. The current assay comprises 33 targets: 6 blood, 6 semen, 6 saliva, 4 vaginal secretions, 5 menstrual blood and 6 skin markers. We demonstrate the sensitivity and specificity of the assay and the ability to identify body fluids in single source and admixed stains. A 16 sample blind test was carried out by one lab with samples provided by the other participating lab. The blinded lab correctly identified the body fluids present in 15 of the samples with the major component identified in the 16th. Various classification methods are being investigated to permit inference of the body fluid/tissue in dried physiological stains. These include the percentage of reads in a sample that are due to each of the 6 tissues/body fluids tested and

  14. Aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.

    Science.gov (United States)

    Reinemann, Christine; Strehlitz, Beate

    2014-01-06

    Aptamers are single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) oligonucleotides, which are able to bind their target with high selectivity and affinity. Owing to their multiple talents, aptamers combined with nanoparticles are nanosystems well qualified for the development of new biomedical devices for analytical, imaging, drug delivery and many other medical applications. Because of their target affinity, aptamers can direct the transport of aptamer-nanoparticle conjugates. The binding of the aptamers to the target "anchors" the nanoparticle-aptamer conjugates at their site of action. In this way, nanoparticle-based bioimaging and smart drug delivery are enabled, especially by use of systematically developed aptamers for cancer-associated biomarkers. This review article gives a brief overview of recent relevant research into aptamers and trends in their use in cancer diagnostics and therapy. A concise description of aptamers, their development and functionalities relating to nanoparticle modification is given. The main part of the article is dedicated to current developments of aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.

  15. DNA aptamer selection and aptamer-based fluorometric displacement assay for the hepatotoxin microcystin-RR

    International Nuclear Information System (INIS)

    Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile

    2016-01-01

    Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)

  16. RStrucFam: a web server to associate structure and cognate RNA for RNA-binding proteins from sequence information.

    Science.gov (United States)

    Ghosh, Pritha; Mathew, Oommen K; Sowdhamini, Ramanathan

    2016-10-07

    RNA-binding proteins (RBPs) interact with their cognate RNA(s) to form large biomolecular assemblies. They are versatile in their functionality and are involved in a myriad of processes inside the cell. RBPs with similar structural features and common biological functions are grouped together into families and superfamilies. It will be useful to obtain an early understanding and association of RNA-binding property of sequences of gene products. Here, we report a web server, RStrucFam, to predict the structure, type of cognate RNA(s) and function(s) of proteins, where possible, from mere sequence information. The web server employs Hidden Markov Model scan (hmmscan) to enable association to a back-end database of structural and sequence families. The database (HMMRBP) comprises of 437 HMMs of RBP families of known structure that have been generated using structure-based sequence alignments and 746 sequence-centric RBP family HMMs. The input protein sequence is associated with structural or sequence domain families, if structure or sequence signatures exist. In case of association of the protein with a family of known structures, output features like, multiple structure-based sequence alignment (MSSA) of the query with all others members of that family is provided. Further, cognate RNA partner(s) for that protein, Gene Ontology (GO) annotations, if any and a homology model of the protein can be obtained. The users can also browse through the database for details pertaining to each family, protein or RNA and their related information based on keyword search or RNA motif search. RStrucFam is a web server that exploits structurally conserved features of RBPs, derived from known family members and imprinted in mathematical profiles, to predict putative RBPs from sequence information. Proteins that fail to associate with such structure-centric families are further queried against the sequence-centric RBP family HMMs in the HMMRBP database. Further, all other essential

  17. Deep sequencing of RNA from ancient maize kernels

    DEFF Research Database (Denmark)

    Fordyce, Sarah Louise; Avila Arcos, Maria del Carmen; Rasmussen, Morten

    2013-01-01

    The characterization of biomolecules from ancient samples can shed otherwise unobtainable insights into the past. Despite the fundamental role of transcriptomal change in evolution, the potential of ancient RNA remains unexploited - perhaps due to dogma associated with the fragility of RNA. We hy...... maize kernels. The results suggest that ancient seed transcriptomics may offer a powerful new tool with which to study plant domestication....

  18. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  19. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  20. Sequence-specific RNA Photocleavage by Single-stranded DNA in Presence of Riboflavin

    Science.gov (United States)

    Zhao, Yongyun; Chen, Gangyi; Yuan, Yi; Li, Na; Dong, Juan; Huang, Xin; Cui, Xin; Tang, Zhuo

    2015-10-01

    Constant efforts have been made to develop new method to realize sequence-specific RNA degradation, which could cause inhibition of the expression of targeted gene. Herein, by using an unmodified short DNA oligonucleotide for sequence recognition and endogenic small molecue, vitamin B2 (riboflavin) as photosensitizer, we report a simple strategy to realize the sequence-specific photocleavage of targeted RNA. The DNA strand is complimentary to the target sequence to form DNA/RNA duplex containing a G•U wobble in the middle. The cleavage reaction goes through oxidative elimination mechanism at the nucleoside downstream of U of the G•U wobble in duplex to obtain unnatural RNA terminal, and the whole process is under tight control by using light as switch, which means the cleavage could be carried out according to specific spatial and temporal requirements. The biocompatibility of this method makes the DNA strand in combination with riboflavin a promising molecular tool for RNA manipulation.

  1. Hybridization-based reconstruction of small non-coding RNA transcripts from deep sequencing data.

    Science.gov (United States)

    Ragan, Chikako; Mowry, Bryan J; Bauer, Denis C

    2012-09-01

    Recent advances in RNA sequencing technology (RNA-Seq) enables comprehensive profiling of RNAs by producing millions of short sequence reads from size-fractionated RNA libraries. Although conventional tools for detecting and distinguishing non-coding RNAs (ncRNAs) from reference-genome data can be applied to sequence data, ncRNA detection can be improved by harnessing the full information content provided by this new technology. Here we present NorahDesk, the first unbiased and universally applicable method for small ncRNAs detection from RNA-Seq data. NorahDesk utilizes the coverage-distribution of small RNA sequence data as well as thermodynamic assessments of secondary structure to reliably predict and annotate ncRNA classes. Using publicly available mouse sequence data from brain, skeletal muscle, testis and ovary, we evaluated our method with an emphasis on the performance for microRNAs (miRNAs) and piwi-interacting small RNA (piRNA). We compared our method with Dario and mirDeep2 and found that NorahDesk produces longer transcripts with higher read coverage. This feature makes it the first method particularly suitable for the prediction of both known and novel piRNAs.

  2. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  3. Small RNA sequencing reveals metastasis-related microRNAs in lung adenocarcinoma

    DEFF Research Database (Denmark)

    Daugaard, Iben; Venø, Morten T.; Yan, Yan

    2017-01-01

    The majority of lung cancer deaths are caused by metastatic disease. MicroRNAs (miRNAs) are posttranscriptional regulators of gene expression and miRNA dysregulation can contribute to metastatic progression. Here, small RNA sequencing was used to profile the miRNA and piwi-interacting RNA (piRNA......) transcriptomes in relation to lung cancer metastasis. RNA-seq was performed using RNA extracted from formalin-fixed paraffin embedded (FFPE) lung adenocarcinomas (LAC) and brain metastases from 8 patients, and LACs from 8 patients without detectable metastatic disease. Impact on miRNA and piRNA transcriptomes...... was subtle with 9 miRNAs and 8 piRNAs demonstrating differential expression between metastasizing and non-metastasizing LACs. For piRNAs, decreased expression of piR-57125 was the most significantly associated with distant metastasis. Validation by RT-qPCR in a LAC cohort comprising 52 patients confirmed...

  4. DNApi: A De Novo Adapter Prediction Algorithm for Small RNA Sequencing Data.

    Science.gov (United States)

    Tsuji, Junko; Weng, Zhiping

    2016-01-01

    With the rapid accumulation of publicly available small RNA sequencing datasets, third-party meta-analysis across many datasets is becoming increasingly powerful. Although removing the 3´ adapter is an essential step for small RNA sequencing analysis, the adapter sequence information is not always available in the metadata. The information can be also erroneous even when it is available. In this study, we developed DNApi, a lightweight Python software package that predicts the 3´ adapter sequence de novo and provides the user with cleansed small RNA sequences ready for down stream analysis. Tested on 539 publicly available small RNA libraries accompanied with 3´ adapter sequences in their metadata, DNApi shows near-perfect accuracy (98.5%) with fast runtime (~2.85 seconds per library) and efficient memory usage (~43 MB on average). In addition to 3´ adapter prediction, it is also important to classify whether the input small RNA libraries were already processed, i.e. the 3´ adapters were removed. DNApi perfectly judged that given another batch of datasets, 192 publicly available processed libraries were "ready-to-map" small RNA sequence. DNApi is compatible with Python 2 and 3, and is available at https://github.com/jnktsj/DNApi. The 731 small RNA libraries used for DNApi evaluation were from human tissues and were carefully and manually collected. This study also provides readers with the curated datasets that can be integrated into their studies.

  5. A short autocomplementary sequence plays an essential role in avian sarcoma-leukosis virus RNA dimerization.

    Science.gov (United States)

    Fossé, P; Motté, N; Roumier, A; Gabus, C; Muriaux, D; Darlix, J L; Paoletti, J

    1996-12-24

    Retroviral genomes consist of two identical RNA molecules joined noncovalently near their 5'-ends. Recently, two models have been proposed for RNA dimer formation on the basis of results obtained in vitro with human immunodeficiency virus type 1 RNA and Moloney murine leukemia virus RNA. It was first proposed that viral RNA dimerizes by forming an interstrand quadruple helix with purine tetrads. The second model postulates that RNA dimerization is initiated by a loop-loop interaction between the two RNA molecules. In order to better characterize the dimerization process of retroviral genomic RNA, we analyzed the in vitro dimerization of avian sarcoma-leukosis virus (ASLV) RNA using different transcripts. We determined the requirements for heterodimer formation, the thermal dissociation of RNA dimers, and the influence of antisense DNA oligonucleotides on dimer formation. Our results strongly suggest that purine tetrads are not involved in dimer formation. Data show that an autocomplementary sequence located upstream from the splice donor site and within a major packaging signal plays a crucial role in ASLV RNA dimer formation in vitro. This sequence is able to form a stem-loop structure, and phylogenetic analysis reveals that it is conserved in 28 different avian sarcoma and leukosis viruses. These results suggest that dimerization of ASLV RNA is initiated by a loop-loop interaction between two RNA molecules and provide an additional argument for the ubiquity of the dimerization process via loop-loop interaction.

  6. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  7. Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses

    Directory of Open Access Journals (Sweden)

    Hironobu Yanagisawa

    2016-03-01

    Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

  8. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  9. 3' terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2013-09-21

    Post-transcriptional 3' end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3' RACE coupled with high-throughput sequencing to characterize the 3' terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. The 3' terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3' terminus of an in vitro transcribed MRP RNA control and the differing 3' terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). 3' RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3' terminal sequences of noncoding RNAs.

  10. 3′ terminal diversity of MRP RNA and other human noncoding RNAs revealed by deep sequencing

    Science.gov (United States)

    2013-01-01

    Background Post-transcriptional 3′ end processing is a key component of RNA regulation. The abundant and essential RNA subunit of RNase MRP has been proposed to function in three distinct cellular compartments and therefore may utilize this mode of regulation. Here we employ 3′ RACE coupled with high-throughput sequencing to characterize the 3′ terminal sequences of human MRP RNA and other noncoding RNAs that form RNP complexes. Results The 3′ terminal sequence of MRP RNA from HEK293T cells has a distinctive distribution of genomically encoded termini (including an assortment of U residues) with a portion of these selectively tagged by oligo(A) tails. This profile contrasts with the relatively homogenous 3′ terminus of an in vitro transcribed MRP RNA control and the differing 3′ terminal profiles of U3 snoRNA, RNase P RNA, and telomerase RNA (hTR). Conclusions 3′ RACE coupled with deep sequencing provides a valuable framework for the functional characterization of 3′ terminal sequences of noncoding RNAs. PMID:24053768

  11. miRBase: integrating microRNA annotation and deep-sequencing data.

    Science.gov (United States)

    Kozomara, Ana; Griffiths-Jones, Sam

    2011-01-01

    miRBase is the primary online repository for all microRNA sequences and annotation. The current release (miRBase 16) contains over 15,000 microRNA gene loci in over 140 species, and over 17,000 distinct mature microRNA sequences. Deep-sequencing technologies have delivered a sharp rise in the rate of novel microRNA discovery. We have mapped reads from short RNA deep-sequencing experiments to microRNAs in miRBase and developed web interfaces to view these mappings. The user can view all read data associated with a given microRNA annotation, filter reads by experiment and count, and search for microRNAs by tissue- and stage-specific expression. These data can be used as a proxy for relative expression levels of microRNA sequences, provide detailed evidence for microRNA annotations and alternative isoforms of mature microRNAs, and allow us to revisit previous annotations. miRBase is available online at: http://www.mirbase.org/.

  12. MicroRNA Expression Profile in Penile Cancer Revealed by Next-Generation Small RNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Penile cancer (PeCa is a relatively rare tumor entity but possesses higher morbidity and mortality rates especially in developing countries. To date, the concrete pathogenic signaling pathways and core machineries involved in tumorigenesis and progression of PeCa remain to be elucidated. Several studies suggested miRNAs, which modulate gene expression at posttranscriptional level, were frequently mis-regulated and aberrantly expressed in human cancers. However, the miRNA profile in human PeCa has not been reported before. In this present study, the miRNA profile was obtained from 10 fresh penile cancerous tissues and matched adjacent non-cancerous tissues via next-generation sequencing. As a result, a total of 751 and 806 annotated miRNAs were identified in normal and cancerous penile tissues, respectively. Among which, 56 miRNAs with significantly different expression levels between paired tissues were identified. Subsequently, several annotated miRNAs were selected randomly and validated using quantitative real-time PCR. Compared with the previous publications regarding to the altered miRNAs expression in various cancers and especially genitourinary (prostate, bladder, kidney, testis cancers, the most majority of deregulated miRNAs showed the similar expression pattern in penile cancer. Moreover, the bioinformatics analyses suggested that the putative target genes of differentially expressed miRNAs between cancerous and matched normal penile tissues were tightly associated with cell junction, proliferation, growth as well as genomic instability and so on, by modulating Wnt, MAPK, p53, PI3K-Akt, Notch and TGF-β signaling pathways, which were all well-established to participate in cancer initiation and progression. Our work presents a global view of the differentially expressed miRNAs and potentially regulatory networks of their target genes for clarifying the pathogenic transformation of normal penis to PeCa, which research resource also

  13. Informatics for RNA Sequencing: A Web Resource for Analysis on the Cloud.

    Directory of Open Access Journals (Sweden)

    Malachi Griffith

    2015-08-01

    Full Text Available Massively parallel RNA sequencing (RNA-seq has rapidly become the assay of choice for interrogating RNA transcript abundance and diversity. This article provides a detailed introduction to fundamental RNA-seq molecular biology and informatics concepts. We make available open-access RNA-seq tutorials that cover cloud computing, tool installation, relevant file formats, reference genomes, transcriptome annotations, quality-control strategies, expression, differential expression, and alternative splicing analysis methods. These tutorials and additional training resources are accompanied by complete analysis pipelines and test datasets made available without encumbrance at www.rnaseq.wiki.

  14. RNA sequencing atopic dermatitis transcriptome profiling provides insights into novel disease mechanisms with potential therapeutic implications

    DEFF Research Database (Denmark)

    Suárez-Fariñas, Mayte; Ungar, Benjamin; Correa da Rosa, Joel

    2015-01-01

    . These limitations might be lessened with next-generation RNA sequencing (RNA-seq). Objective: We sought to define the lesional AD transcriptome using RNA-seq and compare it using microarrays performed on the same cohort. Methods: RNA-seq and microarrays were performed to identify differentially expressed genes...... RNA-seq showed somewhat better agreement with RT-PCR (intraclass correlation coefficient, 0.57 and 0.70 for microarrays and RNA-seq vs RT-PCR, respectively), bias was not eliminated. Among genes uniquely identified by using RNA-seq were triggering receptor expressed on myeloid cells 1 (TREM-1......) signaling (eg, CCL2, CCL3, and single immunoglobulin domain IL1R1 related [SIGIRR]) and IL-36 isoform genes. TREM-1 is a surface receptor implicated in innate and adaptive immunity that amplifies infection-related inflammation. Conclusions: This is the first report of a lesional AD phenotype using RNA...

  15. MicroRNA sequence motifs reveal asymmetry between the stem arms

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.

    2006-01-01

    The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

  16. Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

    Science.gov (United States)

    Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

    2012-04-25

    A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

  17. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  18. Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . PRINCIPAL INVESTIGATOR...TITLE AND SUBTITLE Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer . 5a. CONTRACT NUMBER 5b. GRANT NUMBER GRANT11489...institutional, NIH-funded study of genetic and epigenetic alterations of pre-invasive DCIS that did or did not progress to invasive breast cancer , with an

  19. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

    OpenAIRE

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-01-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resoluti...

  20. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke

    2016-01-01

    AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was

  1. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  2. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  3. Sex chromosomes and germline transcriptomics explored by single-cell sequencing and RNA-tomography

    NARCIS (Netherlands)

    Vértesy, Ábel

    2018-01-01

    In our study of germ cell differentiation, we applied two recently developed technologies on the germline of various model organisms: single-cell mRNA sequencing and RNA-tomography. For the first time we could look at gene expression with such a high resolution, and this led us to discover the

  4. Body fluid identification of blood, saliva and semen using second generation sequencing of micro-RNA

    DEFF Research Database (Denmark)

    Petersen, Christel H.; Hjort, Benjamin Benn; Tvedebrink, Torben

    2013-01-01

    We report a new second generation sequencing method for identification micro-RNA (miRNA) that can be used to identify body fluids and tissues. Principal component analysis of 10 miRNAs with high expression in 16 samples of blood, saliva and semen showed clear differences in the expression of mi...

  5. Deep RNA Sequencing of the Skeletal Muscle Transcriptome in Swimming Fish

    NARCIS (Netherlands)

    Palstra, A.P.; Beltran, S.; Burgerhout, E.; Brittijn, S.A.; Magnoni, L.J.; Henkel, C.V.; Jansen, A.; Thillart, G.E.E.J.M.; Spaink, H.P.; Planas, J.V.

    2013-01-01

    Deep RNA sequencing (RNA-seq) was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss) with the specific objective to identify expressed genes and quantify the transcriptomic effects of

  6. Oasis: online analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Capece, Vincenzo; Garcia Vizcaino, Julio C; Vidal, Ramon; Rahman, Raza-Ur; Pena Centeno, Tonatiuh; Shomroni, Orr; Suberviola, Irantzu; Fischer, Andre; Bonn, Stefan

    2015-07-01

    Oasis is a web application that allows for the fast and flexible online analysis of small-RNA-seq (sRNA-seq) data. It was designed for the end user in the lab, providing an easy-to-use web frontend including video tutorials, demo data and best practice step-by-step guidelines on how to analyze sRNA-seq data. Oasis' exclusive selling points are a differential expression module that allows for the multivariate analysis of samples, a classification module for robust biomarker detection and an advanced programming interface that supports the batch submission of jobs. Both modules include the analysis of novel miRNAs, miRNA targets and functional analyses including GO and pathway enrichment. Oasis generates downloadable interactive web reports for easy visualization, exploration and analysis of data on a local system. Finally, Oasis' modular workflow enables for the rapid (re-) analysis of data. Oasis is implemented in Python, R, Java, PHP, C++ and JavaScript. It is freely available at http://oasis.dzne.de. stefan.bonn@dzne.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  7. Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.

    Science.gov (United States)

    Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

    2013-01-01

    To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.

  8. Accurate identification of RNA editing sites from primitive sequence with deep neural networks.

    Science.gov (United States)

    Ouyang, Zhangyi; Liu, Feng; Zhao, Chenghui; Ren, Chao; An, Gaole; Mei, Chuan; Bo, Xiaochen; Shu, Wenjie

    2018-04-16

    RNA editing is a post-transcriptional RNA sequence alteration. Current methods have identified editing sites and facilitated research but require sufficient genomic annotations and prior-knowledge-based filtering steps, resulting in a cumbersome, time-consuming identification process. Moreover, these methods have limited generalizability and applicability in species with insufficient genomic annotations or in conditions of limited prior knowledge. We developed DeepRed, a deep learning-based method that identifies RNA editing from primitive RNA sequences without prior-knowledge-based filtering steps or genomic annotations. DeepRed achieved 98.1% and 97.9% area under the curve (AUC) in training and test sets, respectively. We further validated DeepRed using experimentally verified U87 cell RNA-seq data, achieving 97.9% positive predictive value (PPV). We demonstrated that DeepRed offers better prediction accuracy and computational efficiency than current methods with large-scale, mass RNA-seq data. We used DeepRed to assess the impact of multiple factors on editing identification with RNA-seq data from the Association of Biomolecular Resource Facilities and Sequencing Quality Control projects. We explored developmental RNA editing pattern changes during human early embryogenesis and evolutionary patterns in Drosophila species and the primate lineage using DeepRed. Our work illustrates DeepRed's state-of-the-art performance; it may decipher the hidden principles behind RNA editing, making editing detection convenient and effective.

  9. A tale of two sequences: microRNA-target chimeric reads.

    Science.gov (United States)

    Broughton, James P; Pasquinelli, Amy E

    2016-04-04

    In animals, a functional interaction between a microRNA (miRNA) and its target RNA requires only partial base pairing. The limited number of base pair interactions required for miRNA targeting provides miRNAs with broad regulatory potential and also makes target prediction challenging. Computational approaches to target prediction have focused on identifying miRNA target sites based on known sequence features that are important for canonical targeting and may miss non-canonical targets. Current state-of-the-art experimental approaches, such as CLIP-seq (cross-linking immunoprecipitation with sequencing), PAR-CLIP (photoactivatable-ribonucleoside-enhanced CLIP), and iCLIP (individual-nucleotide resolution CLIP), require inference of which miRNA is bound at each site. Recently, the development of methods to ligate miRNAs to their target RNAs during the preparation of sequencing libraries has provided a new tool for the identification of miRNA target sites. The chimeric, or hybrid, miRNA-target reads that are produced by these methods unambiguously identify the miRNA bound at a specific target site. The information provided by these chimeric reads has revealed extensive non-canonical interactions between miRNAs and their target mRNAs, and identified many novel interactions between miRNAs and noncoding RNAs.

  10. Unusual loop-sequence flexibility of the proximal RNA replication element in EMCV.

    Directory of Open Access Journals (Sweden)

    Jan Zoll

    Full Text Available Picornaviruses contain stable RNA structures at the 5' and 3' ends of the RNA genome, OriL and OriR involved in viral RNA replication. The OriL RNA element found at the 5' end of the enterovirus genome folds into a cloverleaf-like configuration. In vivo SELEX experiments revealed that functioning of the poliovirus cloverleaf depends on a specific structure in this RNA element. Little is known about the OriL of cardioviruses. Here, we investigated structural aspects and requirements of the apical loop of proximal stem-loop SL-A of mengovirus, a strain of EMCV. Using NMR spectroscopy, we showed that the mengovirus SL-A apical loop consists of an octaloop. In vivo SELEX experiments demonstrated that a large number of random sequences are tolerated in the apical octaloop that support virus replication. Mutants in which the SL-A loop size and the length of the upper part of the stem were varied showed that both stem-length and stability of the octaloop are important determinants for viral RNA replication and virus reproduction. Together, these data show that stem-loop A plays an important role in virus replication. The high degree of sequence flexibility and the lack of selective pressure on the octaloop argue against a role in sequence specific RNA-protein or RNA-RNA interactions in which octaloop nucleotides are involved.

  11. "Transcriptomics": molecular diagnosis of inborn errors of metabolism via RNA-sequencing.

    Science.gov (United States)

    Kremer, Laura S; Wortmann, Saskia B; Prokisch, Holger

    2018-01-25

    Exome wide sequencing techniques have revolutionized molecular diagnostics in patients with suspected inborn errors of metabolism or neuromuscular disorders. However, the diagnostic yield of 25-60% still leaves a large fraction of individuals without a diagnosis. This indicates a causative role for non-exonic regulatory variants not covered by whole exome sequencing. Here we review how systematic RNA-sequencing analysis (RNA-seq, "transcriptomics") lead to a molecular diagnosis in 10-35% of patients in whom whole exome sequencing failed to do so. Importantly, RNA-sequencing based discoveries cannot only guide molecular diagnosis but might also unravel therapeutic intervention points such as antisense oligonucleotide treatment for splicing defects as recently reported for spinal muscular atrophy.

  12. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    Science.gov (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-07

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)

    Unknown

    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  14. Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.

    Directory of Open Access Journals (Sweden)

    Birgit Piater

    Full Text Available The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF. Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX. CLN64 and a previously described single-stranded DNA (ssDNA aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding.

  15. Methods To Identify Aptamers against Cell Surface Biomarkers

    Directory of Open Access Journals (Sweden)

    Frédéric Ducongé

    2011-09-01

    Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.

  16. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  17. Next Generation Sequencing Analysis of Human Platelet PolyA+ mRNAs and rRNA-Depleted Total RNA

    Science.gov (United States)

    Kissopoulou, Antheia; Jonasson, Jon; Lindahl, Tomas L.; Osman, Abdimajid

    2013-01-01

    Background Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. Materials and Methods We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT) isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. Results Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. Conclusion The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components compared with other cell and

  18. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    OpenAIRE

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

  19. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    Science.gov (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  20. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform.

    Directory of Open Access Journals (Sweden)

    Hideyuki Tamaki

    Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.

  1. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    Science.gov (United States)

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  3. ISVASE: identification of sequence variant associated with splicing event using RNA-seq data.

    Science.gov (United States)

    Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Yu, Jun; Hu, Songnian

    2017-06-28

    Exon recognition and splicing precisely and efficiently by spliceosome is the key to generate mature mRNAs. About one third or a half of disease-related mutations affect RNA splicing. Software PVAAS has been developed to identify variants associated with aberrant splicing by directly using RNA-seq data. However, it bases on the assumption that annotated splicing site is normal splicing, which is not true in fact. We develop the ISVASE, a tool for specifically identifying sequence variants associated with splicing events (SVASE) by using RNA-seq data. Comparing with PVAAS, our tool has several advantages, such as multi-pass stringent rule-dependent filters and statistical filters, only using split-reads, independent sequence variant identification in each part of splicing (junction), sequence variant detection for both of known and novel splicing event, additional exon-exon junction shift event detection if known splicing events provided, splicing signal evaluation, known DNA mutation and/or RNA editing data supported, higher precision and consistency, and short running time. Using a realistic RNA-seq dataset, we performed a case study to illustrate the functionality and effectiveness of our method. Moreover, the output of SVASEs can be used for downstream analysis such as splicing regulatory element study and sequence variant functional analysis. ISVASE is useful for researchers interested in sequence variants (DNA mutation and/or RNA editing) associated with splicing events. The package is freely available at https://sourceforge.net/projects/isvase/ .

  4. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  5. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    Science.gov (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  6. StarScan: a web server for scanning small RNA targets from degradome sequencing data.

    Science.gov (United States)

    Liu, Shun; Li, Jun-Hao; Wu, Jie; Zhou, Ke-Ren; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu

    2015-07-01

    Endogenous small non-coding RNAs (sRNAs), including microRNAs, PIWI-interacting RNAs and small interfering RNAs, play important gene regulatory roles in animals and plants by pairing to the protein-coding and non-coding transcripts. However, computationally assigning these various sRNAs to their regulatory target genes remains technically challenging. Recently, a high-throughput degradome sequencing method was applied to identify biologically relevant sRNA cleavage sites. In this study, an integrated web-based tool, StarScan (sRNA target Scan), was developed for scanning sRNA targets using degradome sequencing data from 20 species. Given a sRNA sequence from plants or animals, our web server performs an ultrafast and exhaustive search for potential sRNA-target interactions in annotated and unannotated genomic regions. The interactions between small RNAs and target transcripts were further evaluated using a novel tool, alignScore. A novel tool, degradomeBinomTest, was developed to quantify the abundance of degradome fragments located at the 9-11th nucleotide from the sRNA 5' end. This is the first web server for discovering potential sRNA-mediated RNA cleavage events in plants and animals, which affords mechanistic insights into the regulatory roles of sRNAs. The StarScan web server is available at http://mirlab.sysu.edu.cn/starscan/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

    Science.gov (United States)

    Watters, Kyle E; Lucks, Julius B

    2016-01-01

    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  8. The PETfold and PETcofold web servers for intra- and intermolecular structures of multiple RNA sequences

    DEFF Research Database (Denmark)

    Seemann, Ernst Stefan; Menzel, Karl Peter; Backofen, Rolf

    2011-01-01

    gene. We present web servers to analyze multiple RNA sequences for common RNA structure and for RNA interaction sites. The web servers are based on the recent PET (Probabilistic Evolutionary and Thermodynamic) models PETfold and PETcofold, but add user friendly features ranging from a graphical layer...... to interactive usage of the predictors. Additionally, the web servers provide direct access to annotated RNA alignments, such as the Rfam 10.0 database and multiple alignments of 16 vertebrate genomes with human. The web servers are freely available at: http://rth.dk/resources/petfold/...

  9. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  10. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    Science.gov (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Systems genetics of complex diseases using RNA-sequencing methods

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kogelman, Lisette; Suravajhala, Prashanth

    2015-01-01

    Next generation sequencing technologies have enabled the generation of huge quantities of biological data, and nowadays extensive datasets at different ‘omics levels have been generated. Systems genetics is a powerful approach that allows to integrate different ‘omics level and understand the bio...

  12. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  13. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  14. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Science.gov (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  15. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    Science.gov (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  16. Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus.

    Science.gov (United States)

    Cao, Xiaoxiao; Li, Shaohua; Chen, Liucun; Ding, Hongmei; Xu, Hua; Huang, Yanping; Li, Jie; Liu, Nongle; Cao, Weihong; Zhu, Yanjun; Shen, Beifen; Shao, Ningsheng

    2009-08-01

    In this article, a panel of ssDNA aptamers specific to Staphylococcus aureus was obtained by a whole bacterium-based SELEX procedure and applied to probing S. aureus. After several rounds of selection with S. aureus as the target and Streptococcus and S. epidermidis as counter targets, the highly enriched oligonucleic acid pool was sequenced and then grouped under different families on the basis of the homology of the primary sequence and the similarity of the secondary structure. Eleven sequences from different families were selected for further characterization by confocal imaging and flow cytometry analysis. Results showed that five aptamers demonstrated high specificity and affinity to S. aureus individually. The five aptamers recognize different molecular targets by competitive experiment. Combining these five aptamers had a much better effect than the individual aptamer in the recognition of different S. aureus strains. In addition, the combined aptamers can probe single S. aureus in pyogenic fluids. Our work demonstrates that a set of aptamers specific to one bacterium can be used in combination for the identification of the bacterium instead of a single aptamer.

  17. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  18. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    Full Text Available A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  19. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    Science.gov (United States)

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  20. (1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection.

    Science.gov (United States)

    de Sousa Lacerda, Camila Maria; Ferreira, Iêda Mendes; Dos Santos, Sara Roberta; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro

    2017-03-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n=6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17±0.22 for seq6 and 2.66±0.10 for seq30. These ratios were statistically higher than the value (1.54±0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53±0.03, 1.64±0.12 and 1.08±0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. (1 → 3)-β-D-glucan aptamers labeled with technetium-99 m: Biodistribution and imaging in experimental models of bacterial and fungal infection

    International Nuclear Information System (INIS)

    Sousa Lacerda, Camila Maria de; Ferreira, Iêda Mendes; Santos, Sara Roberta dos; Barros, André Luís Branco de; Fernandes, Simone Odília

    2017-01-01

    Introduction: Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1 → 3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1 → 3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Methods: Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n = 6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Results: There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17 ± 0.22 for seq6 and 2.66 ± 0.10 for seq30. These ratios were statistically higher than the value (1.54 ± 0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53 ± 0.03, 1.64 ± 0.12 and 1.08 ± 0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Conclusions: Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored.

  2. Comparison of a PreQ1 Riboswitch Aptamer in Metabolite-bound and Free States with Implications for Gene Regulation*

    OpenAIRE

    Jenkins, Jermaine L.; Krucinska, Jolanta; McCarty, Reid M.; Bandarian, Vahe; Wedekind, Joseph E.

    2011-01-01

    Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters...

  3. Genetic diagnosis of Mendelian disorders via RNA sequencing.

    Science.gov (United States)

    Kremer, Laura S; Bader, Daniel M; Mertes, Christian; Kopajtich, Robert; Pichler, Garwin; Iuso, Arcangela; Haack, Tobias B; Graf, Elisabeth; Schwarzmayr, Thomas; Terrile, Caterina; Koňaříková, Eliška; Repp, Birgit; Kastenmüller, Gabi; Adamski, Jerzy; Lichtner, Peter; Leonhardt, Christoph; Funalot, Benoit; Donati, Alice; Tiranti, Valeria; Lombes, Anne; Jardel, Claude; Gläser, Dieter; Taylor, Robert W; Ghezzi, Daniele; Mayr, Johannes A; Rötig, Agnes; Freisinger, Peter; Distelmaier, Felix; Strom, Tim M; Meitinger, Thomas; Gagneur, Julien; Prokisch, Holger

    2017-06-12

    Across a variety of Mendelian disorders, ∼50-75% of patients do not receive a genetic diagnosis by exome sequencing indicating disease-causing variants in non-coding regions. Although genome sequencing in principle reveals all genetic variants, their sizeable number and poorer annotation make prioritization challenging. Here, we demonstrate the power of transcriptome sequencing to molecularly diagnose 10% (5 of 48) of mitochondriopathy patients and identify candidate genes for the remainder. We find a median of one aberrantly expressed gene, five aberrant splicing events and six mono-allelically expressed rare variants in patient-derived fibroblasts and establish disease-causing roles for each kind. Private exons often arise from cryptic splice sites providing an important clue for variant prioritization. One such event is found in the complex I assembly factor TIMMDC1 establishing a novel disease-associated gene. In conclusion, our study expands the diagnostic tools for detecting non-exonic variants and provides examples of intronic loss-of-function variants with pathological relevance.

  4. Customized workflow development and data modularization concepts for RNA-Sequencing and metatranscriptome experiments.

    Science.gov (United States)

    Lott, Steffen C; Wolfien, Markus; Riege, Konstantin; Bagnacani, Andrea; Wolkenhauer, Olaf; Hoffmann, Steve; Hess, Wolfgang R

    2017-11-10

    RNA-Sequencing (RNA-Seq) has become a widely used approach to study quantitative and qualitative aspects of transcriptome data. The variety of RNA-Seq protocols, experimental study designs and the characteristic properties of the organisms under investigation greatly affect downstream and comparative analyses. In this review, we aim to explain the impact of structured pre-selection, classification and integration of best-performing tools within modularized data analysis workflows and ready-to-use computing infrastructures towards experimental data analyses. We highlight examples for workflows and use cases that are presented for pro-, eukaryotic and mixed dual RNA-Seq (meta-transcriptomics) experiments. In addition, we are summarizing the expertise of the laboratories participating in the project consortium "Structured Analysis and Integration of RNA-Seq experiments" (de.STAIR) and its integration with the Galaxy-workbench of the RNA Bioinformatics Center (RBC). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Ligand-regulated peptide aptamers.

    Science.gov (United States)

    Miller, Russell A

    2009-01-01

    The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.

  6. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    , directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection......Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...

  7. CPSS: a computational platform for the analysis of small RNA deep sequencing data.

    Science.gov (United States)

    Zhang, Yuanwei; Xu, Bo; Yang, Yifan; Ban, Rongjun; Zhang, Huan; Jiang, Xiaohua; Cooke, Howard J; Xue, Yu; Shi, Qinghua

    2012-07-15

    Next generation sequencing (NGS) techniques have been widely used to document the small ribonucleic acids (RNAs) implicated in a variety of biological, physiological and pathological processes. An integrated computational tool is needed for handling and analysing the enormous datasets from small RNA deep sequencing approach. Herein, we present a novel web server, CPSS (a computational platform for the analysis of small RNA deep sequencing data), designed to completely annotate and functionally analyse microRNAs (miRNAs) from NGS data on one platform with a single data submission. Small RNA NGS data can be submitted to this server with analysis results being returned in two parts: (i) annotation analysis, which provides the most comprehensive analysis for small RNA transcriptome, including length distribution and genome mapping of sequencing reads, small RNA quantification, prediction of novel miRNAs, identification of differentially expressed miRNAs, piwi-interacting RNAs and other non-coding small RNAs between paired samples and detection of miRNA editing and modifications and (ii) functional analysis, including prediction of miRNA targeted genes by multiple tools, enrichment of gene ontology terms, signalling pathway involvement and protein-protein interaction analysis for the predicted genes. CPSS, a ready-to-use web server that integrates most functions of currently available bioinformatics tools, provides all the information wanted by the majority of users from small RNA deep sequencing datasets. CPSS is implemented in PHP/PERL+MySQL+R and can be freely accessed at http://mcg.ustc.edu.cn/db/cpss/index.html or http://mcg.ustc.edu.cn/sdap1/cpss/index.html.

  8. RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

    Science.gov (United States)

    Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

    1990-07-01

    The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

  9. Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation

    International Nuclear Information System (INIS)

    Lacerda, Camila Maria de Sousa

    2016-01-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target

  10. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  11. Study design requirements for RNA sequencing-based breast cancer diagnostics.

    Science.gov (United States)

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias

    2016-02-01

    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  12. RNA Sequencing and Bioinformatics Analysis Implicate the Regulatory Role of a Long Noncoding RNA-mRNA Network in Hepatic Stellate Cell Activation.

    Science.gov (United States)

    Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong

    2017-01-01

    To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.

  13. Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

    Science.gov (United States)

    Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

    2018-01-09

    Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Quantitative miRNA expression analysis: comparing microarrays with next-generation sequencing

    DEFF Research Database (Denmark)

    Willenbrock, Hanni; Salomon, Jesper; Søkilde, Rolf

    2009-01-01

    Recently, next-generation sequencing has been introduced as a promising, new platform for assessing the copy number of transcripts, while the existing microarray technology is considered less reliable for absolute, quantitative expression measurements. Nonetheless, so far, results from the two...... technologies have only been compared based on biological data, leading to the conclusion that, although they are somewhat correlated, expression values differ significantly. Here, we use synthetic RNA samples, resembling human microRNA samples, to find that microarray expression measures actually correlate...... better with sample RNA content than expression measures obtained from sequencing data. In addition, microarrays appear highly sensitive and perform equivalently to next-generation sequencing in terms of reproducibility and relative ratio quantification....

  15. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  16. Efficient RNA extraction protocol for the wood mangrove species Laguncularia racemosa suited for next-generation RNA sequencing

    International Nuclear Information System (INIS)

    Wilwerth, M. W.; Rossetto, P.

    2016-01-01

    Mangrove flora and habitat have immeasurable importance in marine and coastal ecology as well as in the economy. Despite their importance, they are constantly threatened by oil spill accidents and environmental contamination; therefore, it is crucial to understand the changes in gene expression to better predict toxicity in these plants. Among the species of Atlantic coast mangrove (Americas and Africa), Laguncularia racemosa, or white mangrove, is a conspicuous species. The wide distribution of L. racemosa in areas where marine oil exploration is rapidly increasing make it a candidate mangrove species model to uncover the impact of oil spills at the molecular level with the use of massive transcriptome sequencing. However, for this purpose, the RNA extraction protocol should ensure low levels of contaminants and structure integrity. In this study, eight RNA extraction methods were tested and analysed using downstream applications. The InviTrap Spin Plant RNA Mini Kit performed best with regard to purity and integrity. Moreover, the obtained RNA was submitted to cDNA synthesis and RT-PCR, successfully generating amplification products of the expected size. These Results show the applicability of the RNA obtained here for downstream methodologies, such as the construction of cDNA libraries for the Illumina Hi-seq platform. (author)

  17. DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.

    Science.gov (United States)

    Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A

    2011-09-01

    A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.

  18. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  19. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Directory of Open Access Journals (Sweden)

    Masfique Mehedi

    Full Text Available Ebolavirus (EBOV, the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  20. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    Science.gov (United States)

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  1. mESAdb: microRNA expression and sequence analysis database.

    Science.gov (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  2. incaRNAfbinv: a web server for the fragment-based design of RNA sequences

    Science.gov (United States)

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny

    2016-01-01

    Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at http://www.cs.bgu.ac.il/incaRNAfbinv. PMID:27185893

  3. Next generation sequencing analysis of human platelet PolyA+ mRNAs and rRNA-depleted total RNA.

    Directory of Open Access Journals (Sweden)

    Antheia Kissopoulou

    Full Text Available BACKGROUND: Platelets are small anucleate cells circulating in the blood vessels where they play a key role in hemostasis and thrombosis. Here, we compared platelet RNA-Seq results obtained from polyA+ mRNA and rRNA-depleted total RNA. MATERIALS AND METHODS: We used purified, CD45 depleted, human blood platelets collected by apheresis from three male and one female healthy blood donors. The Illumina HiSeq 2000 platform was employed to sequence cDNA converted either from oligo(dT isolated polyA+ RNA or from rRNA-depleted total RNA. The reads were aligned to the GRCh37 reference assembly with the TopHat/Cufflinks alignment package using Ensembl annotations. A de novo assembly of the platelet transcriptome using the Trinity software package and RSEM was also performed. The bioinformatic tools HTSeq and DESeq from Bioconductor were employed for further statistical analyses of read counts. RESULTS: Consistent with previous findings our data suggests that mitochondrially expressed genes comprise a substantial fraction of the platelet transcriptome. We also identified high transcript levels for protein coding genes related to the cytoskeleton function, chemokine signaling, cell adhesion, aggregation, as well as receptor interaction between cells. Certain transcripts were particularly abundant in platelets compared with other cell and tissue types represented by RNA-Seq data from the Illumina Human Body Map 2.0 project. Irrespective of the different library preparation and sequencing protocols, there was good agreement between samples from the 4 individuals. Eighteen differentially expressed genes were identified in the two sexes at 10% false discovery rate using DESeq. CONCLUSION: The present data suggests that platelets may have a unique transcriptome profile characterized by a relative over-expression of mitochondrially encoded genes and also of genomic transcripts related to the cytoskeleton function, chemokine signaling and surface components

  4. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3' UTRs and coding sequences.

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M; Robins, Harlan S; Vaníček, Jiří

    2015-07-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3' untranslated regions (3' UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3' UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA-mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA-mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne

    2010-01-01

    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  6. 3' end labelling of RNA with /sup 32/P suitable for rapid gel sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Winter, G; Brownlee, G G [Medical Research Council, Cambridge (UK)

    1978-09-01

    A new general method of labelling the 2', 3'-diol end of RNA with /sup 32/P has been devised suitable for gel sequencing. Poly(A) polymerase (E.coli) is incubated with the RNA and limiting amounts of ..cap alpha..-/sup 32/P-ATP. The mono-addition product is then cleaved with periodate and ..beta..-eliminated with aniline, leaving the RNA terminally labelled with 3'/sup 32/P-phosphate. When applied to a model compound, tRNAsup(Phe) from E. coli, over 28 residues could be read from the 3' end.

  7. RNA-Sequencing of Primary Retinoblastoma Tumors Provides New Insights and Challenges Into Tumor Development

    Directory of Open Access Journals (Sweden)

    Sailaja V. Elchuri

    2018-05-01

    Full Text Available Retinoblastoma is rare tumor of the retina caused by the homozygous loss of the Retinoblastoma 1 tumor suppressor gene (RB1. Loss of the RB1 protein, pRB, results in de-regulated activity of the E2F transcription factors, chromatin changes and developmental defects leading to tumor development. Extensive microarray profiles of these tumors have enabled the identification of genes sensitive to pRB disruption, however, this technology has a number of limitations in the RNA profiles that they generate. The advent of RNA-sequencing has enabled the global profiling of all of the RNA within the cell including both coding and non-coding features and the detection of aberrant RNA processing events. In this perspective, we focus on discussing how RNA-sequencing of rare Retinoblastoma tumors will build on existing data and open up new area’s to improve our understanding of the biology of these tumors. In particular, we discuss how the RB-research field may be to use this data to determine how RB1 loss results in the expression of; non-coding RNAs, causes aberrant RNA processing events and how a deeper analysis of metabolic RNA changes can be utilized to model tumor specific shifts in metabolism. Each section discusses new opportunities and challenges associated with these types of analyses and aims to provide an honest assessment of how understanding these different processes may contribute to the treatment of Retinoblastoma.

  8. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  9. Modeling bias and variation in the stochastic processes of small RNA sequencing.

    Science.gov (United States)

    Argyropoulos, Christos; Etheridge, Alton; Sakhanenko, Nikita; Galas, David

    2017-06-20

    The use of RNA-seq as the preferred method for the discovery and validation of small RNA biomarkers has been hindered by high quantitative variability and biased sequence counts. In this paper we develop a statistical model for sequence counts that accounts for ligase bias and stochastic variation in sequence counts. This model implies a linear quadratic relation between the mean and variance of sequence counts. Using a large number of sequencing datasets, we demonstrate how one can use the generalized additive models for location, scale and shape (GAMLSS) distributional regression framework to calculate and apply empirical correction factors for ligase bias. Bias correction could remove more than 40% of the bias for miRNAs. Empirical bias correction factors appear to be nearly constant over at least one and up to four orders of magnitude of total RNA input and independent of sample composition. Using synthetic mixes of known composition, we show that the GAMLSS approach can analyze differential expression with greater accuracy, higher sensitivity and specificity than six existing algorithms (DESeq2, edgeR, EBSeq, limma, DSS, voom) for the analysis of small RNA-seq data. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.

    Science.gov (United States)

    Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed

    2017-12-18

    The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this

  11. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  12. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav

    2011-04-01

    Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

  13. Combined sequencing of mRNA and DNA from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Florian Mertes

    2016-06-01

    Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.

  14. The role of upstream sequences in selecting the reading frame on tmRNA

    Directory of Open Access Journals (Sweden)

    Dewey Jonathan D

    2008-06-01

    Full Text Available Abstract Background tmRNA acts first as a tRNA and then as an mRNA to rescue stalled ribosomes in eubacteria. Two unanswered questions about tmRNA function remain: how does tmRNA, lacking an anticodon, bypass the decoding machinery and enter the ribosome? Secondly, how does the ribosome choose the proper codon to resume translation on tmRNA? According to the -1 triplet hypothesis, the answer to both questions lies in the unique properties of the three nucleotides upstream of the first tmRNA codon. These nucleotides assume an A-form conformation that mimics the codon-anticodon interaction, leading to recognition by the decoding center and choice of the reading frame. The -1 triplet hypothesis is important because it is the most credible model in which direct binding and recognition by the ribosome sets the reading frame on tmRNA. Results Conformational analysis predicts that 18 triplets cannot form the correct structure to function as the -1 triplet of tmRNA. We tested the tmRNA activity of all possible -1 triplet mutants using a genetic assay in Escherichia coli. While many mutants displayed reduced activity, our findings do not match the predictions of this model. Additional mutagenesis identified sequences further upstream that are required for tmRNA function. An immunoblot assay for translation of the tmRNA tag revealed that certain mutations in U85, A86, and the -1 triplet sequence result in improper selection of the first codon and translation in the wrong frame (-1 or +1 in vivo. Conclusion Our findings disprove the -1 triplet hypothesis. The -1 triplet is not required for accommodation of tmRNA into the ribosome, although it plays a minor role in frame selection. Our results strongly disfavor direct ribosomal recognition of the upstream sequence, instead supporting a model in which the binding of a separate ligand to A86 is primarily responsible for frame selection.

  15. Comparison of classifications of aptamers against Vibrio ...

    African Journals Online (AJOL)

    As a novel method to detect the pathogen Vibrio alginolyticus, 45 aptamers were previously selected and tested. In order to better understand the properties of these aptamers, it was essential to classify these aptamers based on appropriate criteria. The primary structure of 45 aptamers against V. alginolyticus was analyzed ...

  16. Labeling RNAs in Live Cells Using Malachite Green Aptamer Scaffolds as Fluorescent Probes.

    Science.gov (United States)

    Yerramilli, V Siddartha; Kim, Kyung Hyuk

    2018-03-16

    RNAs mediate many different processes that are central to cellular function. The ability to quantify or image RNAs in live cells is very useful in elucidating such functions of RNA. RNA aptamer-fluorogen systems have been increasingly used in labeling RNAs in live cells. Here, we use the malachite green aptamer (MGA), an RNA aptamer that can specifically bind to malachite green (MG) dye and induces it to emit far-red fluorescence signals. Previous studies on MGA showed a potential for the use of MGA for genetically tagging other RNA molecules in live cells. However, these studies also exhibited low fluorescence signals and high background noise. Here we constructed and tested RNA scaffolds containing multiple tandem repeats of MGA as a strategy to increase the brightness of the MGA aptamer-fluorogen system as well as to make the system fluoresce when tagging various RNA molecules, in live cells. We demonstrate that our MGA scaffolds can induce fluorescence signals by up to ∼20-fold compared to the basal level as a genetic tag for other RNA molecules. We also show that our scaffolds function reliably as genetically encoded fluorescent tags for mRNAs of fluorescent proteins and other RNA aptamers.

  17. RNA deep sequencing reveals differential microRNA expression during development of sea urchin and sea star.

    Directory of Open Access Journals (Sweden)

    Sabah Kadri

    Full Text Available microRNAs (miRNAs are small (20-23 nt, non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin and Patiria miniata (sea star are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc. to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads. Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common. We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html.

  18. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    Science.gov (United States)

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  19. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  20. Aptamers in Diagnostics and Treatment of Viral Infections

    Directory of Open Access Journals (Sweden)

    Tomasz Wandtke

    2015-02-01

    Full Text Available Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment. It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus, HBV (Hepatitis B Virus, HCV (Hepatitis C Virus, SARS (Severe Acute Respiratory Syndrome, H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases.

  1. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  2. Aptamers as radiopharmaceuticals for nuclear imaging and therapy

    International Nuclear Information System (INIS)

    Gijs, Marlies; Aerts, An; Impens, Nathalie; Baatout, Sarah; Luxen, André

    2016-01-01

    Today, radiopharmaceuticals belong to the standard instrumentation of nuclear medicine, both in the context of diagnosis and therapy. The majority of radiopharmaceuticals consist of targeting biomolecules which are designed to interact with a disease-related molecular target. A plethora of targeting biomolecules of radiopharmaceuticals exists, including antibodies, antibody fragments, proteins, peptides and nucleic acids. Nucleic acids have some significant advantages relative to proteinaceous biomolecules in terms of size, production, modifications, possible targets and immunogenicity. In particular, aptamers (non-coding, synthetic, single-stranded DNA or RNA oligonucleotides) are of interest because they can bind a molecular target with high affinity and specificity. At present, few aptamers have been investigated preclinically for imaging and therapeutic applications. In this review, we describe the use of aptamers as targeting biomolecules of radiopharmaceuticals. We also discuss the chemical modifications which are needed to turn aptamers into valuable (radio-)pharmaceuticals, as well as the different radiolabeling strategies that can be used to radiolabel oligonucleotides and, in particular, aptamers.

  3. Selection of LNA-containing DNA aptamers against recombinant human CD73

    DEFF Research Database (Denmark)

    Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G

    2015-01-01

    tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences......LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX...... with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several...

  4. Protein Detection with Aptamer Biosensors

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    2008-07-01

    Full Text Available Aptamers have been developed for different applications. Their use as new biological recognition elements in biosensors promises progress for fast and easy detection of proteins. This new generation of biosensor (aptasensors will be more stable and well adapted to the conditions of real samples because of the specific properties of aptamers.

  5. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Robert C. Edgar

    2018-04-01

    Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

  6. RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

    Science.gov (United States)

    Brule, C E; Dean, K M; Grayhack, E J

    2016-01-01

    The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

  7. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  8. Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

    Science.gov (United States)

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

    2017-01-25

    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  9. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  10. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  11. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  12. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  13. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  14. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  15. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  16. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

    Science.gov (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

    2014-03-05

    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

  17. Discovery and validation of Barrett's esophagus microRNA transcriptome by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Ajay Bansal

    Full Text Available Barrett's esophagus (BE is transition from squamous to columnar mucosa as a result of gastroesophageal reflux disease (GERD. The role of microRNA during this transition has not been systematically studied.For initial screening, total RNA from 5 GERD and 6 BE patients was size fractionated. RNA <70 nucleotides was subjected to SOLiD 3 library preparation and next generation sequencing (NGS. Bioinformatics analysis was performed using R package "DEseq". A p value<0.05 adjusted for a false discovery rate of 5% was considered significant. NGS-identified miRNA were validated using qRT-PCR in an independent group of 40 GERD and 27 BE patients. MicroRNA expression of human BE tissues was also compared with three BE cell lines.NGS detected 19.6 million raw reads per sample. 53.1% of filtered reads mapped to miRBase version 18. NGS analysis followed by qRT-PCR validation found 10 differentially expressed miRNA; several are novel (-708-5p, -944, -224-5p and -3065-5p. Up- or down- regulation predicted by NGS was matched by qRT-PCR in every case. Human BE tissues and BE cell lines showed a high degree of concordance (70-80% in miRNA expression. Prediction analysis identified targets that mapped to developmental signaling pathways such as TGFβ and Notch and inflammatory pathways such as toll-like receptor signaling and TGFβ. Cluster analysis found similarly regulated (up or down miRNA to share common targets suggesting coordination between miRNA.Using highly sensitive next-generation sequencing, we have performed a comprehensive genome wide analysis of microRNA in BE and GERD patients. Differentially expressed miRNA between BE and GERD have been further validated. Expression of miRNA between BE human tissues and BE cell lines are highly correlated. These miRNA should be studied in biological models to further understand BE development.

  18. Targeting tumor cell invasion and dissemination in vivo by an aptamer that inhibits urokinase-type plasminogen activator through a novel multifunctional mechanism

    DEFF Research Database (Denmark)

    Botkjaer, Kenneth A; Deryugina, Elena I; Dupont, Daniel Miotto

    2012-01-01

    , because the topology of the proteases' active sites are highly similar. In an effort to generate highly specific uPA inhibitors with new inhibitory modalities, we isolated uPA-binding RNA aptamers by screening a library of 35 nucleotides long 2'-fluoro-pyrimidine RNA molecules using a version of human pro......-uPA lacking the epidermal growth factor-like and kringle domains as bait. One pro-uPA-binding aptamer sequence, referred to as upanap-126, proved to be highly specific for human uPA. Upanap-126 delayed the proteolytic conversion of human pro-uPA to active uPA, but did not inhibit plasminogen activation...... catalyzed by two-chain uPA. The aptamer also inhibited the binding of pro-uPA to uPAR and the binding of vitronectin to the preformed pro-uPA/uPAR complex, both in cell-free systems and on cell surfaces. Furthermore, upanap-126 inhibited human tumor cell invasion in vitro in the Matrigel assay and in vivo...

  19. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  20. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  1. Full Genome Sequence and sfRNA Interferon Antagonist Activity of Zika Virus from Recife, Brazil.

    Directory of Open Access Journals (Sweden)

    Claire L Donald

    2016-10-01

    Full Text Available The outbreak of Zika virus (ZIKV in the Americas has transformed a previously obscure mosquito-transmitted arbovirus of the Flaviviridae family into a major public health concern. Little is currently known about the evolution and biology of ZIKV and the factors that contribute to the associated pathogenesis. Determining genomic sequences of clinical viral isolates and characterization of elements within these are an important prerequisite to advance our understanding of viral replicative processes and virus-host interactions.We obtained a ZIKV isolate from a patient who presented with classical ZIKV-associated symptoms, and used high throughput sequencing and other molecular biology approaches to determine its full genome sequence, including non-coding regions. Genome regions were characterized and compared to the sequences of other isolates where available. Furthermore, we identified a subgenomic flavivirus RNA (sfRNA in ZIKV-infected cells that has antagonist activity against RIG-I induced type I interferon induction, with a lesser effect on MDA-5 mediated action.The full-length genome sequence including non-coding regions of a South American ZIKV isolate from a patient with classical symptoms will support efforts to develop genetic tools for this virus. Detection of sfRNA that counteracts interferon responses is likely to be important for further understanding of pathogenesis and virus-host interactions.

  2. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Science.gov (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  3. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  4. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  5. DNA aptamers against the Lup an 1 food allergen.

    Directory of Open Access Journals (Sweden)

    Pedro Nadal

    Full Text Available Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX. Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs.

  6. RNA shotgun metagenomic sequencing of northern California (USA mosquitoes uncovers viruses, bacteria, and fungi

    Directory of Open Access Journals (Sweden)

    James Angus eChandler

    2015-03-01

    Full Text Available Mosquitoes, most often recognized for the microbial agents of disease they may carry, harbor diverse microbial communities that include viruses, bacteria, and fungi, collectively called the microbiota. The composition of the microbiota can directly and indirectly affect disease transmission through microbial interactions that could be revealed by its characterization in natural populations of mosquitoes. Furthermore, the use of shotgun metagenomic sequencing (SMS approaches could allow the discovery of unknown members of the microbiota. In this study, we use RNA SMS to characterize the microbiota of seven individual mosquitoes (species include Culex pipiens, Culiseta incidens, and Ochlerotatus sierrensis collected from a variety of habitats in California, USA. Sequencing was performed on the Illumina HiSeq platform and the resulting sequences were quality-checked and assembled into contigs using the A5 pipeline. Sequences related to single stranded RNA viruses of the Bunyaviridae and Rhabdoviridae were uncovered, along with an unclassified genus of double-stranded RNA viruses. Phylogenetic analysis finds that in all three cases, the closest relatives of the identified viral sequences are other mosquito-associated viruses, suggesting widespread host-group specificity among disparate viral taxa. Interestingly, we identified a Narnavirus of fungi, also reported elsewhere in mosquitoes, that potentially demonstrates a nested host-parasite association between virus, fungi, and mosquito. Sequences related to 8 bacterial families and 13 fungal families were found across the seven samples. Bacillus and Escherichia/Shigella were identified in all samples and Wolbachia was identified in all Cx. pipiens samples, while no single fungal genus was found in more than two samples. This study exemplifies the utility of RNA SMS in the characterization of the natural microbiota of mosquitoes and, in particular, the value of identifying all microbes associated with

  7. Novel approaches for bioinformatic analysis of salivary RNA sequencing data for development.

    Science.gov (United States)

    Kaczor-Urbanowicz, Karolina Elzbieta; Kim, Yong; Li, Feng; Galeev, Timur; Kitchen, Rob R; Gerstein, Mark; Koyano, Kikuye; Jeong, Sung-Hee; Wang, Xiaoyan; Elashoff, David; Kang, So Young; Kim, Su Mi; Kim, Kyoung; Kim, Sung; Chia, David; Xiao, Xinshu; Rozowsky, Joel; Wong, David T W

    2018-01-01

    Analysis of RNA sequencing (RNA-Seq) data in human saliva is challenging. Lack of standardization and unification of the bioinformatic procedures undermines saliva's diagnostic potential. Thus, it motivated us to perform this study. We applied principal pipelines for bioinformatic analysis of small RNA-Seq data of saliva of 98 healthy Korean volunteers including either direct or indirect mapping of the reads to the human genome using Bowtie1. Analysis of alignments to exogenous genomes by another pipeline revealed that almost all of the reads map to bacterial genomes. Thus, salivary exRNA has fundamental properties that warrant the design of unique additional steps while performing the bioinformatic analysis. Our pipelines can serve as potential guidelines for processing of RNA-Seq data of human saliva. Processing and analysis results of the experimental data generated by the exceRpt (v4.6.3) small RNA-seq pipeline (github.gersteinlab.org/exceRpt) are available from exRNA atlas (exrna-atlas.org). Alignment to exogenous genomes and their quantification results were used in this paper for the analyses of small RNAs of exogenous origin. dtww@ucla.edu. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  8. Accounting for technical noise in differential expression analysis of single-cell RNA sequencing data.

    Science.gov (United States)

    Jia, Cheng; Hu, Yu; Kelly, Derek; Kim, Junhyong; Li, Mingyao; Zhang, Nancy R

    2017-11-02

    Recent technological breakthroughs have made it possible to measure RNA expression at the single-cell level, thus paving the way for exploring expression heterogeneity among individual cells. Current single-cell RNA sequencing (scRNA-seq) protocols are complex and introduce technical biases that vary across cells, which can bias downstream analysis without proper adjustment. To account for cell-to-cell technical differences, we propose a statistical framework, TASC (Toolkit for Analysis of Single Cell RNA-seq), an empirical Bayes approach to reliably model the cell-specific dropout rates and amplification bias by use of external RNA spike-ins. TASC incorporates the technical parameters, which reflect cell-to-cell batch effects, into a hierarchical mixture model to estimate the biological variance of a gene and detect differentially expressed genes. More importantly, TASC is able to adjust for covariates to further eliminate confounding that may originate from cell size and cell cycle differences. In simulation and real scRNA-seq data, TASC achieves accurate Type I error control and displays competitive sensitivity and improved robustness to batch effects in differential expression analysis, compared to existing methods. TASC is programmed to be computationally efficient, taking advantage of multi-threaded parallelization. We believe that TASC will provide a robust platform for researchers to leverage the power of scRNA-seq. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  10. PACCMIT/PACCMIT-CDS: identifying microRNA targets in 3′ UTRs and coding sequences

    Science.gov (United States)

    Šulc, Miroslav; Marín, Ray M.; Robins, Harlan S.; Vaníček, Jiří

    2015-01-01

    The purpose of the proposed web server, publicly available at http://paccmit.epfl.ch, is to provide a user-friendly interface to two algorithms for predicting messenger RNA (mRNA) molecules regulated by microRNAs: (i) PACCMIT (Prediction of ACcessible and/or Conserved MIcroRNA Targets), which identifies primarily mRNA transcripts targeted in their 3′ untranslated regions (3′ UTRs), and (ii) PACCMIT-CDS, designed to find mRNAs targeted within their coding sequences (CDSs). While PACCMIT belongs among the accurate algorithms for predicting conserved microRNA targets in the 3′ UTRs, the main contribution of the web server is 2-fold: PACCMIT provides an accurate tool for predicting targets also of weakly conserved or non-conserved microRNAs, whereas PACCMIT-CDS addresses the lack of similar portals adapted specifically for targets in CDS. The web server asks the user for microRNAs and mRNAs to be analyzed, accesses the precomputed P-values for all microRNA–mRNA pairs from a database for all mRNAs and microRNAs in a given species, ranks the predicted microRNA–mRNA pairs, evaluates their significance according to the false discovery rate and finally displays the predictions in a tabular form. The results are also available for download in several standard formats. PMID:25948580

  11. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

    Science.gov (United States)

    Reinhard, Sören; Wagner, Ernst

    2017-01-01

    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Calling genotypes from public RNA-sequencing data enables identification of genetic variants that affect gene-expression levels

    NARCIS (Netherlands)

    Deelen, Patrick; Zhernakova, Daria V.; de Haan, Mark; van der Sijde, Marijke; Bonder, Marc Jan; Karjalainen, Juha; van der Velde, K. Joeri; Abbott, Kristin M.; Fu, Jingyuan; Wijmenga, Cisca; Sinke, Richard J.; Swertz, Morris A.; Franke, Lude

    2015-01-01

    Background: RNA-sequencing (RNA-seq) is a powerful technique for the identification of genetic variants that affect gene-expression levels, either through expression quantitative trait locus (eQTL) mapping or through allele-specific expression (ASE) analysis. Given increasing numbers of RNA-seq

  13. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

    Science.gov (United States)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

    2018-05-01

    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  14. GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

    Directory of Open Access Journals (Sweden)

    Steffen C. Lott

    2018-04-01

    Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

  15. MicroRNA of the fifth-instar posterior silk gland of silkworm identified by Solexa sequencing

    Directory of Open Access Journals (Sweden)

    Jisheng Li

    2014-12-01

    Full Text Available No special studies have been focused on the microRNA (miRNA in the fifth-instar posterior silk gland of Bombyx mori. Here, using next-generation sequencing, we acquired 93.2 million processed reads from 10 small RNA libraries. In this paper, we tried to thoroughly describe how our dataset generated from deep sequencing which was recently published in BMC genomics. Results showed that our findings are largely enriched silkworm miRNA depository and may benefit us to reveal the miRNA functions in the process of silk production.

  16. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    Science.gov (United States)

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  17. On the optimal trimming of high-throughput mRNA sequence data

    Directory of Open Access Journals (Sweden)

    Matthew D MacManes

    2014-01-01

    Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

  18. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  19. Enhancing potency of siRNA targeting fusion genes by optimization outside of target sequence.

    Science.gov (United States)

    Gavrilov, Kseniya; Seo, Young-Eun; Tietjen, Gregory T; Cui, Jiajia; Cheng, Christopher J; Saltzman, W Mark

    2015-12-01

    Canonical siRNA design algorithms have become remarkably effective at predicting favorable binding regions within a target mRNA, but in some cases (e.g., a fusion junction site) region choice is restricted. In these instances, alternative approaches are necessary to obtain a highly potent silencing molecule. Here we focus on strategies for rational optimization of two siRNAs that target the junction sites of fusion oncogenes BCR-ABL and TMPRSS2-ERG. We demonstrate that modifying the termini of these siRNAs with a terminal G-U wobble pair or a carefully selected pair of terminal asymmetry-enhancing mismatches can result in an increase in potency at low doses. Importantly, we observed that improvements in silencing at the mRNA level do not necessarily translate to reductions in protein level and/or cell death. Decline in protein level is also heavily influenced by targeted protein half-life, and delivery vehicle toxicity can confound measures of cell death due to silencing. Therefore, for BCR-ABL, which has a long protein half-life that is difficult to overcome using siRNA, we also developed a nontoxic transfection vector: poly(lactic-coglycolic acid) nanoparticles that release siRNA over many days. We show that this system can achieve effective killing of leukemic cells. These findings provide insights into the implications of siRNA sequence for potency and suggest strategies for the design of more effective therapeutic siRNA molecules. Furthermore, this work points to the importance of integrating studies of siRNA design and delivery, while heeding and addressing potential limitations such as restricted targetable mRNA regions, long protein half-lives, and nonspecific toxicities.

  20. A novel RNA sequencing data analysis method for cell line authentication.

    Directory of Open Access Journals (Sweden)

    Erik Fasterius

    Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.

  1. Effect of chronic uremia on the transcriptional profile of the calcified aorta analyzed by RNA sequencing

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Gravesen, Eva; Mace, Maria L.

    2016-01-01

    The development of vascular calcification (VC) in chronic uremia (CU) is a tightly regulated process controlled by factors promoting and inhibiting mineralization. Next-generation high-throughput RNA sequencing (RNA-seq) is a powerful and sensitive tool for quantitative gene expression profiling...... with an expression level of >1 reads/kilobase transcript/million mapped reads, 2,663 genes were differentially expressed with 47% upregulated genes and 53% downregulated genes in uremic rats. Significantly deregulated genes were enriched for ontologies related to the extracellular matrix, response to wounding...

  2. Sequence-based heuristics for faster annotation of non-coding RNA families.

    Science.gov (United States)

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  3. visnormsc: A Graphical User Interface to Normalize Single-cell RNA Sequencing Data.

    Science.gov (United States)

    Tang, Lijun; Zhou, Nan

    2017-12-26

    Single-cell RNA sequencing (RNA-seq) allows the analysis of gene expression with high resolution. The intrinsic defects of this promising technology imports technical noise into the single-cell RNA-seq data, increasing the difficulty of accurate downstream inference. Normalization is a crucial step in single-cell RNA-seq data pre-processing. SCnorm is an accurate and efficient method that can be used for this purpose. An R implementation of this method is currently available. On one hand, the R package possesses many excellent features from R. On the other hand, R programming ability is required, which prevents the biologists who lack the skills from learning to use it quickly. To make this method more user-friendly, we developed a graphical user interface, visnormsc, for normalization of single-cell RNA-seq data. It is implemented in Python and is freely available at https://github.com/solo7773/visnormsc . Although visnormsc is based on the existing method, it contributes to this field by offering a user-friendly alternative. The out-of-the-box and cross-platform features make visnormsc easy to learn and to use. It is expected to serve biologists by simplifying single-cell RNA-seq normalization.

  4. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    Science.gov (United States)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  5. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  6. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  7. Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers.

    Science.gov (United States)

    Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun

    2015-04-15

    Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.

  8. Comparison of Whole-Cell SELEX Methods for the Identification of Staphylococcus Aureus-Specific DNA Aptamers

    Directory of Open Access Journals (Sweden)

    Jihea Moon

    2015-04-01

    Full Text Available Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.

  9. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  10. UCLA1, a synthetic derivative of a gp120 RNA aptamer, inhibits entry of human immunodeficiency virus type 1 subtype C

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2012-05-01

    Full Text Available such as South Africa (47), where this study was conducted, we assessed the sensitivity of a large panel of subtype C isolates derived from adult and pediatric patients at different stages of HIV-1 infection against UCLA1. We examined its neutralization..., 34). These were derived from the CAPRISA 002 acute infection study cohort (18), subtype C reference panel (31), pediatric and AIDS patients? isolates (9, 17), and a subtype C consensus sequence clone (ConC) (26). The subtype C pseudoviruses were...

  11. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    International Nuclear Information System (INIS)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S.; Arbuthnot, Patrick

    2009-01-01

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  12. Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

    Energy Technology Data Exchange (ETDEWEB)

    Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie; Weinberg, Marc S. [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa); Arbuthnot, Patrick, E-mail: Patrick.Arbuthnot@wits.ac.za [Antiviral Gene Therapy Research Unit, University of the Witwatersrand (South Africa)

    2009-11-20

    RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR) shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.

  13. Charomers-Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery.

    Science.gov (United States)

    Hahn, Ulrich

    2017-12-06

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2'-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers-in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

  14. Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

    Science.gov (United States)

    2017-01-01

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld. PMID:29211023

  15. A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

    Directory of Open Access Journals (Sweden)

    John G. Bruno

    2013-03-01

    Full Text Available The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies.

  16. Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Ulrich Hahn

    2017-12-01

    Full Text Available Interleukin-6 (IL-6 is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT. Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

  17. Single-cell RNA sequencing reveals metallothionein heterogeneity during hESC differentiation to definitive endoderm

    Directory of Open Access Journals (Sweden)

    Junjie Lu

    2018-04-01

    Full Text Available Differentiation of human pluripotent stem cells towards definitive endoderm (DE is the critical first step for generating cells comprising organs such as the gut, liver, pancreas and lung. This in-vitro differentiation process generates a heterogeneous population with a proportion of cells failing to differentiate properly and maintaining expression of pluripotency factors such as Oct4. RNA sequencing of single cells collected at four time points during a 4-day DE differentiation identified high expression of metallothionein genes in the residual Oct4-positive cells that failed to differentiate to DE. Using X-ray fluorescence microscopy and multi-isotope mass spectrometry, we discovered that high intracellular zinc level corresponds with persistent Oct4 expression and failure to differentiate. This study improves our understanding of the cellular heterogeneity during in-vitro directed differentiation and provides a valuable resource to improve DE differentiation efficiency. Keywords: hPSC, Differentiation, Definitive endoderm, Heterogeneity, Single cell, RNA sequencing

  18. MicroRNA Profiling in Aqueous Humor of Individual Human Eyes by Next-Generation Sequencing.

    Science.gov (United States)

    Wecker, Thomas; Hoffmeier, Klaus; Plötner, Anne; Grüning, Björn Andreas; Horres, Ralf; Backofen, Rolf; Reinhard, Thomas; Schlunck, Günther

    2016-04-01

    Extracellular microRNAs (miRNAs) in aqueous humor were suggested to have a role in transcellular signaling and may serve as disease biomarkers. The authors adopted next-generation sequencing (NGS) techniques to further characterize the miRNA profile in single samples of 60 to 80 μL human aqueous humor. Samples were obtained at the outset of cataract surgery in nine independent, otherwise healthy eyes. Four samples were used to extract RNA and generate sequencing libraries, followed by an adapter-driven amplification step, electrophoretic size selection, sequencing, and data analysis. Five samples were used for quantitative PCR (qPCR) validation of NGS results. Published NGS data on circulating miRNAs in blood were analyzed in comparison. One hundred fifty-eight miRNAs were consistently detected by NGS in all four samples; an additional 59 miRNAs were present in at least three samples. The aqueous humor miRNA profile shows some overlap with published NGS-derived inventories of circulating miRNAs in blood plasma with high prevalence of human miR-451a, -21, and -16. In contrast to blood, miR-184, -4448, -30a, -29a, -29c, -19a, -30d, -205, -24, -22, and -3074 were detected among the 20 most prevalent miRNAs in aqueous humor. Relative expression patterns of miR-451a, -202, and -144 suggested by NGS were confirmed by qPCR. Our data illustrate the feasibility of miRNA analysis by NGS in small individual aqueous humor samples. Intraocular cells as well as blood plasma contribute to the extracellular aqueous humor miRNome. The data suggest possible roles of miRNA in intraocular cell adhesion and signaling by TGF-β and Wnt, which are important in intraocular pressure regulation and glaucoma.

  19. Glutamate Receptor Aptamers and ALS

    National Research Council Canada - National Science Library

    Niu, Li

    2008-01-01

    .... An aptamer is a single-stranded nucleic acid that directly inhibits a protein's function by folding into a specific tertiary structure that dictates high-affinity binding to the target protein...

  20. Quantifying alternative splicing from paired-end RNA-sequencing data

    OpenAIRE

    Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond

    2014-01-01

    RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely...

  1. Screening for sequence-specific RNA-BPs by comprehensive UV crosslinking

    Directory of Open Access Journals (Sweden)

    Le Meuth-Metzinger Valerie

    2002-06-01

    Full Text Available Abstract Background Specific cis-elements and the associated trans-acting factors have been implicated in the post-transcriptional regulation of gene expression. In the era of genome wide analyses identifying novel trans-acting factors and cis-regulatory elements is a step towards understanding coordinated gene expression. UV-crosslink analysis is a standard method used to identify RNA-binding proteins. Uridine is traditionally used to radiolabel substrate RNAs, however, proteins binding to cis-elments particularly uridine poor will be weakly or not detected. We evaluate here the possibility of using UV-crosslinking with RNA substrates radiolabeled with each of the four ribonucleotides as an approach for screening for novel sequence specific RNA-binding proteins. Results The radiolabeled RNA substrates were derived from the 3'UTRs of the cloned Eg and c-mos Xenopus laevis maternal mRNAs. Specific, but not identical, uv-crosslinking signals were obtained, some of which corresponded to already identified proteins. A signal for a novel 90 kDa protein was observed with the c-mos 3'UTR radiolabeled with both CTP and GTP but not with UTP. The binding site of the 90 kDa RNA-binding protein was localised to a 59-nucleotide portion of the c-mos 3'UTR. Conclusion That the 90 kDa signal was detected with RNAs radiolabeled with CTP or GTP but not UTP illustrates the advantage of radiolabeling all four nucleotides in a UV-crosslink based screen. This method can be used for both long and short RNAs and does not require knowledge of the cis-acting sequence. It should be amenable to high throughput screening for RNA binding proteins.

  2. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  3. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  4. Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

    Science.gov (United States)

    Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

    2010-08-01

    Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

  5. Rtools: a web server for various secondary structural analyses on single RNA sequences.

    Science.gov (United States)

    Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi

    2016-07-08

    The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. CoverageAnalyzer (CAn: A Tool for Inspection of Modification Signatures in RNA Sequencing Profiles

    Directory of Open Access Journals (Sweden)

    Ralf Hauenschild

    2016-11-01

    Full Text Available Combination of reverse transcription (RT and deep sequencing has emerged as a powerful instrument for the detection of RNA modifications, a field that has seen a recent surge in activity because of its importance in gene regulation. Recent studies yielded high-resolution RT signatures of modified ribonucleotides relying on both sequence-dependent mismatch patterns and reverse transcription arrests. Common alignment viewers lack specialized functionality, such as filtering, tailored visualization, image export and differential analysis. Consequently, the community will profit from a platform seamlessly connecting detailed visual inspection of RT signatures and automated screening for modification candidates. CoverageAnalyzer (CAn was developed in response to the demand for a powerful inspection tool. It is freely available for all three main operating systems. With SAM file format as standard input, CAn is an intuitive and user-friendly tool that is generally applicable to the large community of biomedical users, starting from simple visualization of RNA sequencing (RNA-Seq data, up to sophisticated modification analysis with significance-based modification candidate calling.

  7. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  8. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  9. MicroRNA and piRNA profiles in normal human testis detected by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Qingling Yang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are the class of small endogenous RNAs that play an important regulatory role in cells by negatively affecting gene expression at transcriptional and post-transcriptional levels. There have been extensive studies aiming to discover miRNAs and to analyze their functions in the cells from a variety of species. However, there are no published studies of miRNA profiles in human testis using next generation sequencing (NGS technology. RESULTS: We employed Solexa sequencing technology to profile miRNAs in normal human testis. Total 770 known and 5 novel human miRNAs, and 20121 piRNAs were detected, indicating that the human testis has a complex population of small RNAs. The expression of 15 known and 5 novel detected miRNAs was validated by qRT-PCR. We have also predicted the potential target genes of the abundant known and novel miRNAs, and subjected them to GO and pathway analysis, revealing the involvement of miRNAs in many important biological phenomenon including meiosis and p53-related pathways that are implicated in the regulation of spermatogenesis. CONCLUSIONS: This study reports the first genome-wide miRNA profiles in human testis using a NGS approach. The presence of large number of miRNAs and the nature of their target genes suggested that miRNAs play important roles in spermatogenesis. Here we provide a useful resource for further elucidation of the regulatory role of miRNAs and piRNAs in the spermatogenesis. It may also facilitate the development of prophylactic strategies for male infertility.

  10. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Science.gov (United States)

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  11. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Ma Lei

    2012-08-01

    Full Text Available Abstract Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs.

  12. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    Science.gov (United States)

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright

  13. Aptamer-based impedimetric sensor for bacterial typing.

    Science.gov (United States)

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-10-02

    The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform.

  14. RNA Sequencing Reveals that Kaposi Sarcoma-Associated Herpesvirus Infection Mimics Hypoxia Gene Expression Signature

    Science.gov (United States)

    Viollet, Coralie; Davis, David A.; Tekeste, Shewit S.; Reczko, Martin; Pezzella, Francesco; Ragoussis, Jiannis

    2017-01-01

    Kaposi sarcoma-associated herpesvirus (KSHV) causes several tumors and hyperproliferative disorders. Hypoxia and hypoxia-inducible factors (HIFs) activate latent and lytic KSHV genes, and several KSHV proteins increase the cellular levels of HIF. Here, we used RNA sequencing, qRT-PCR, Taqman assays, and pathway analysis to explore the miRNA and mRNA response of uninfected and KSHV-infected cells to hypoxia, to compare this with the genetic changes seen in chronic latent KSHV infection, and to explore the degree to which hypoxia and KSHV infection interact in modulating mRNA and miRNA expression. We found that the gene expression signatures for KSHV infection and hypoxia have a 34% overlap. Moreover, there were considerable similarities between the genes up-regulated by hypoxia in uninfected (SLK) and in KSHV-infected (SLKK) cells. hsa-miR-210, a HIF-target known to have pro-angiogenic and anti-apoptotic properties, was significantly up-regulated by both KSHV infection and hypoxia using Taqman assays. Interestingly, expression of KSHV-encoded miRNAs was not affected by hypoxia. These results demonstrate that KSHV harnesses a part of the hypoxic cellular response and that a substantial portion of hypoxia-induced changes in cellular gene expression are induced by KSHV infection. Therefore, targeting hypoxic pathways may be a useful way to develop therapeutic strategies for KSHV-related diseases. PMID:28046107

  15. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

  16. Application of small RNA sequencing to identify microRNAs in acute kidney injury and fibrosis

    Energy Technology Data Exchange (ETDEWEB)

    Pellegrini, Kathryn L. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gerlach, Cory V. [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States); Craciun, Florin L.; Ramachandran, Krithika [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Bijol, Vanesa [Department of Pathology, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Kissick, Haydn T. [Department of Surgery, Urology Division, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA (United States); Vaidya, Vishal S., E-mail: vvaidya@bwh.harvard.edu [Department of Medicine, Renal Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Department of Environmental Health, Harvard T.H. Chan School of Public Health, Boston, MA (United States); Laboratory of Systems Pharmacology, Harvard Program in Therapeutic Sciences, Harvard Medical School, Boston, MA (United States)

    2016-12-01

    Establishing a microRNA (miRNA) expression profile in affected tissues provides an important foundation for the discovery of miRNAs involved in the development or progression of pathologic conditions. We conducted small RNA sequencing to generate a temporal profile of miRNA expression in the kidneys using a mouse model of folic acid-induced (250 mg/kg i.p.) kidney injury and fibrosis. From the 103 miRNAs that were differentially expressed over the time course (> 2-fold, p < 0.05), we chose to further investigate miR-18a-5p, which is expressed during the acute stage of the injury; miR-132-3p, which is upregulated during transition between acute and fibrotic injury; and miR-146b-5p, which is highly expressed at the peak of fibrosis. Using qRT-PCR, we confirmed the increased expression of these candidate miRNAs in the folic acid model as well as in other established mouse models of acute injury (ischemia/reperfusion injury) and fibrosis (unilateral ureteral obstruction). In situ hybridization confirmed high expression of miR-18a-5p, miR-132-3p and miR-146b-5p throughout the kidney cortex in mice and humans with severe kidney injury or fibrosis. When primary human proximal tubular epithelial cells were treated with model nephrotoxicants such as cadmium chloride (CdCl{sub 2}), arsenic trioxide, aristolochic acid (AA), potassium dichromate (K{sub 2}Cr{sub 2}O{sub 7}) and cisplatin, miRNA-132-3p was upregulated 4.3-fold after AA treatment and 1.5-fold after K{sub 2}Cr{sub 2}O{sub 7} and CdCl{sub 2} treatment. These results demonstrate the application of temporal small RNA sequencing to identify miR-18a, miR-132 and miR-146b as differentially expressed miRNAs during distinct phases of kidney injury and fibrosis progression. - Highlights: • We used small RNA sequencing to identify differentially expressed miRNAs in kidney. • Distinct patterns were found for acute injury and fibrotic stages in the kidney. • Upregulation of miR-18a, -132 and -146b was confirmed in mice

  17. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  18. Practical Application of Aptamer-Based Biosensors in Detection of Low Molecular Weight Pollutants in Water Sources

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2018-02-01

    Full Text Available Water pollution has become one of the leading causes of human health problems. Low molecular weight pollutants, even at trace concentrations in water sources, have aroused global attention due to their toxicity after long-time exposure. There is an increased demand for appropriate methods to detect these pollutants in aquatic systems. Aptamers, single-stranded DNA or RNA, have high affinity and specificity to each of their target molecule, similar to antigen-antibody interaction. Aptamers can be selected using a method called Systematic Evolution of Ligands by EXponential enrichment (SELEX. Recent years we have witnessed great progress in developing aptamer selection and aptamer-based sensors for low molecular weight pollutants in water sources, such as tap water, seawater, lake water, river water, as well as wastewater and its effluents. This review provides an overview of aptamer-based methods as a novel approach for detecting low molecular weight pollutants in water sources.

  19. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  20. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    DEFF Research Database (Denmark)

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per

    2015-01-01

    the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  1. Generating Aptamers by Cell-SELEX for Applications in Molecular Medicine

    Directory of Open Access Journals (Sweden)

    Huixia Liu

    2012-03-01

    Full Text Available Aptamers are single-stranded oligonucleotides of DNA or RNA that bind to target molecules with high affinity and specificity. Typically, aptamers are generated by an iterative selection process, called systematic evolution of ligands by exponential enrichment (SELEX. Recent advancements in SELEX technology have extended aptamer selection from comparatively simple mixtures of purified proteins to whole living cells, and now cell-based SELEX (or cell-SELEX can isolate aptamers that bind to specific target cells. Combined with nanotechnology, microchips, microfluidic devices, RNAi and other advanced technologies, cell-SELEX represents an integrated platform providing ultrasensitive and highly specific tools for clinical medicine. In this review, we describe the recent progress made in the application of cell-SELEX for diagnosis, therapy and biomarker discovery.

  2. Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

    International Nuclear Information System (INIS)

    Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya

    2006-01-01

    Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25

  3. An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.

    Science.gov (United States)

    Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit

    2016-05-26

    Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

  4. Unraveling Prion Protein Interactions with Aptamers and Other PrP-Binding Nucleic Acids.

    Science.gov (United States)

    Macedo, Bruno; Cordeiro, Yraima

    2017-05-17

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative disorders that affect humans and other mammals. The etiologic agents common to these diseases are misfolded conformations of the prion protein (PrP). The molecular mechanisms that trigger the structural conversion of the normal cellular PrP (PrP C ) into the pathogenic conformer (PrP Sc ) are still poorly understood. It is proposed that a molecular cofactor would act as a catalyst, lowering the activation energy of the conversion process, therefore favoring the transition of PrP C to PrP Sc . Several in vitro studies have described physical interactions between PrP and different classes of molecules, which might play a role in either PrP physiology or pathology. Among these molecules, nucleic acids (NAs) are highlighted as potential PrP molecular partners. In this context, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology has proven extremely valuable to investigate PrP-NA interactions, due to its ability to select small nucleic acids, also termed aptamers, that bind PrP with high affinity and specificity. Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into a wide range of structures (from harpins to G-quadruplexes). They are selected from a nucleic acid pool containing a large number (10 14 -10 16 ) of random sequences of the same size (~20-100 bases). Aptamers stand out because of their potential ability to bind with different affinities to distinct conformations of the same protein target. Therefore, the identification of high-affinity and selective PrP ligands may aid the development of new therapies and diagnostic tools for TSEs. This review will focus on the selection of aptamers targeted against either full-length or truncated forms of PrP, discussing the implications that result from interactions of PrP with NAs, and their potential advances in the studies of prions. We will also provide a critical evaluation

  5. Deep sequencing of Salmonella RNA associated with heterologous Hfq proteins in vivo reveals small RNAs as a major target class and identifies RNA processing phenotypes.

    Science.gov (United States)

    Sittka, Alexandra; Sharma, Cynthia M; Rolle, Katarzyna; Vogel, Jörg

    2009-01-01

    The bacterial Sm-like protein, Hfq, is a key factor for the stability and function of small non-coding RNAs (sRNAs) in Escherichia coli. Homologues of this protein have been predicted in many distantly related organisms yet their functional conservation as sRNA-binding proteins has not entirely been clear. To address this, we expressed in Salmonella the Hfq proteins of two eubacteria (Neisseria meningitides, Aquifex aeolicus) and an archaeon (Methanocaldococcus jannaschii), and analyzed the associated RNA by deep sequencing. This in vivo approach identified endogenous Salmonella sRNAs as a major target of the foreign Hfq proteins. New Salmonella sRNA species were also identified, and some of these accumulated specifically in the presence of a foreign Hfq protein. In addition, we observed specific RNA processing defects, e.g., suppression of precursor processing of SraH sRNA by Methanocaldococcus Hfq, or aberrant accumulation of extracytoplasmic target mRNAs of the Salmonella GcvB, MicA or RybB sRNAs. Taken together, our study provides evidence of a conserved inherent sRNA-binding property of Hfq, which may facilitate the lateral transmission of regulatory sRNAs among distantly related species. It also suggests that the expression of heterologous RNA-binding proteins combined with deep sequencing analysis of RNA ligands can be used as a molecular tool to dissect individual steps of RNA metabolism in vivo.

  6. Deep RNA sequencing of the skeletal muscle transcriptome in swimming fish.

    Directory of Open Access Journals (Sweden)

    Arjan P Palstra

    Full Text Available Deep RNA sequencing (RNA-seq was performed to provide an in-depth view of the transcriptome of red and white skeletal muscle of exercised and non-exercised rainbow trout (Oncorhynchus mykiss with the specific objective to identify expressed genes and quantify the transcriptomic effects of swimming-induced exercise. Pubertal autumn-spawning seawater-raised female rainbow trout were rested (n = 10 or swum (n = 10 for 1176 km at 0.75 body-lengths per second in a 6,000-L swim-flume under reproductive conditions for 40 days. Red and white muscle RNA of exercised and non-exercised fish (4 lanes was sequenced and resulted in 15-17 million reads per lane that, after de novo assembly, yielded 149,159 red and 118,572 white muscle contigs. Most contigs were annotated using an iterative homology search strategy against salmonid ESTs, the zebrafish Danio rerio genome and general Metazoan genes. When selecting for large contigs (>500 nucleotides, a number of novel rainbow trout gene sequences were identified in this study: 1,085 and 1,228 novel gene sequences for red and white muscle, respectively, which included a number of important molecules for skeletal muscle function. Transcriptomic analysis revealed that sustained swimming increased transcriptional activity in skeletal muscle and specifically an up-regulation of genes involved in muscle growth and developmental processes in white muscle. The unique collection of transcripts will contribute to our understanding of red and white muscle physiology, specifically during the long-term reproductive migration of salmonids.

  7. The Pseudomonas aeruginosa transcriptome in planktonic cultures and static biofilms using RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Andreas Dötsch

    Full Text Available In this study, we evaluated how gene expression differs in mature Pseudomonas aeruginosa biofilms as opposed to planktonic cells by the use of RNA sequencing technology that gives rise to both quantitative and qualitative information on the transcriptome. Although a large proportion of genes were consistently regulated in both the stationary phase and biofilm cultures as opposed to the late exponential growth phase cultures, the global biofilm gene expression pattern was clearly distinct indicating that biofilms are not just surface attached cells in stationary phase. A large amount of the genes found to be biofilm specific were involved in adaptation to microaerophilic growth conditions, repression of type three secretion and production of extracellular matrix components. Additionally, we found many small RNAs to be differentially regulated most of them similarly in stationary phase cultures and biofilms. A qualitative analysis of the RNA-seq data revealed more than 3000 putative transcriptional start sites (TSS. By the use of rapid amplification of cDNA ends (5'-RACE we confirmed the presence of three different TSS associated with the pqsABCDE operon, two in the promoter of pqsA and one upstream of the second gene, pqsB. Taken together, this study reports the first transcriptome study on P. aeruginosa that employs RNA sequencing technology and provides insights into the quantitative and qualitative transcriptome including the expression of small RNAs in P. aeruginosa biofilms.

  8. Transcriptomic characterization of soybean (Glycine max) roots in response to rhizobium infection by RNA sequencing

    International Nuclear Information System (INIS)

    He, Q.; Li, Z.; Wang, S.; Huang, S.; Yang, H.

    2018-01-01

    Legumes interacting with rhizobium to convert N2 into ammonia for plant use has attracted worldwide interest. However, the plant basal nitrogen fixation mechanisms induced in response to Rhizobium, giving differential gene expression of plants, have not yet been fully realized. The differential expressed genes of soybean between inoculated and mock-inoculated were analyzed by a RNA-Seq. The results of the sequencing were aligned against the Williams 82 genome sequence, which contain 55787 transcripts; 280 and 316 transcripts were found to be up- and down-regulated, respectively, for inoculated and mock-inoculated soybean roots at stage V1. Gene ontology (GO) analyses detected 104, 182 and 178 genes associated with the cell component category, molecular function category and biological process category, respectively. Pathway analysis revealed that 98 differentially expressed genes (115 transcripts) were involved in 169 biological pathways. We selected 19 differentially expressed genes and analyzed their expressions in mock-inoculated, inoculated USDA110 and CCBAU45436 using qRT-PCR. The results were in accordance with those obtained from rhizobia infected RNA-Seq data. These showed that the results of RNA-Seq had reliability and universality. Additionally, this study showed some novel genes associated with the nitrogen fixation process in comparison to previously identified QTLs. (author)

  9. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.

    Science.gov (United States)

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong

    2012-01-01

    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  10. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

    Science.gov (United States)

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

  11. Goodness-of-fit tests and model diagnostics for negative binomial regression of RNA sequencing data.

    Science.gov (United States)

    Mi, Gu; Di, Yanming; Schafer, Daniel W

    2015-01-01

    This work is about assessing model adequacy for negative binomial (NB) regression, particularly (1) assessing the adequacy of the NB assumption, and (2) assessing the appropriateness of models for NB dispersion parameters. Tools for the first are appropriate for NB regression generally; those for the second are primarily intended for RNA sequencing (RNA-Seq) data analysis. The typically small number of biological samples and large number of genes in RNA-Seq analysis motivate us to address the trade-offs between robustness and statistical power using NB regression models. One widely-used power-saving strategy, for example, is to assume some commonalities of NB dispersion parameters across genes via simple models relating them to mean expression rates, and many such models have been proposed. As RNA-Seq analysis is becoming ever more popular, it is appropriate to make more thorough investigations into power and robustness of the resulting methods, and into practical tools for model assessment. In this article, we propose simulation-based statistical tests and diagnostic graphics to address model adequacy. We provide simulated and real data examples to illustrate that our proposed methods are effective for detecting the misspecification of the NB mean-variance relationship as well as judging the adequacy of fit of several NB dispersion models.

  12. A powerful and flexible approach to the analysis of RNA sequence count data.

    Science.gov (United States)

    Zhou, Yi-Hui; Xia, Kai; Wright, Fred A

    2011-10-01

    A number of penalization and shrinkage approaches have been proposed for the analysis of microarray gene expression data. Similar techniques are now routinely applied to RNA sequence transcriptional count data, although the value of such shrinkage has not been conclusively established. If penalization is desired, the explicit modeling of mean-variance relationships provides a flexible testing regimen that 'borrows' information across genes, while easily incorporating design effects and additional covariates. We describe BBSeq, which incorporates two approaches: (i) a simple beta-binomial generalized linear model, which has not been extensively tested for RNA-Seq data and (ii) an extension of an expression mean-variance modeling approach to RNA-Seq data, involving modeling of the overdispersion as a function of the mean. Our approaches are flexible, allowing for general handling of discrete experimental factors and continuous covariates. We report comparisons with other alternate methods to handle RNA-Seq data. Although penalized methods have advantages for very small sample sizes, the beta-binomial generalized linear model, combined with simple outlier detection and testing approaches, appears to have favorable characteristics in power and flexibility. An R package containing examples and sample datasets is available at http://www.bios.unc.edu/research/genomic_software/BBSeq yzhou@bios.unc.edu; fwright@bios.unc.edu Supplementary data are available at Bioinformatics online.

  13. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  14. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  15. MicroRNA repertoire for functional genome research in tilapia identified by deep sequencing.

    Science.gov (United States)

    Yan, Biao; Wang, Zhen-Hua; Zhu, Chang-Dong; Guo, Jin-Tao; Zhao, Jin-Liang

    2014-08-01

    The Nile tilapia (Oreochromis niloticus; Cichlidae) is an economically important species in aquaculture and occupies a prominent position in the aquaculture industry. MicroRNAs (miRNAs) are a class of noncoding RNAs that post-transcriptionally regulate gene expression involved in diverse biological and metabolic processes. To increase the repertoire of miRNAs characterized in tilapia, we used the Illumina/Solexa sequencing technology to sequence a small RNA library using pooled RNA sample isolated from the different developmental stages of tilapia. Bioinformatic analyses suggest that 197 conserved and 27 novel miRNAs are expressed in tilapia. Sequence alignments indicate that all tested miRNAs and miRNAs* are highly conserved across many species. In addition, we characterized the tissue expression patterns of five miRNAs using real-time quantitative PCR. We found that miR-1/206, miR-7/9, and miR-122 is abundantly expressed in muscle, brain, and liver, respectively, implying a potential role in the regulation of tissue differentiation or the maintenance of tissue identity. Overall, our results expand the number of tilapia miRNAs, and the discovery of miRNAs in tilapia genome contributes to a better understanding the role of miRNAs in regulating diverse biological processes.

  16. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  17. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

    Science.gov (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-06-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Iain C. Macaulay

    2016-02-01

    Full Text Available The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment.

  19. High throughput sequencing of small RNA component of leaves and inflorescence revealed conserved and novel miRNAs as well as phasiRNA loci in chickpea.

    Science.gov (United States)

    Srivastava, Sangeeta; Zheng, Yun; Kudapa, Himabindu; Jagadeeswaran, Guru; Hivrale, Vandana; Varshney, Rajeev K; Sunkar, Ramanjulu

    2015-06-01

    Among legumes, chickpea (Cicer arietinum L.) is the second most important crop after soybean. MicroRNAs (miRNAs) play important roles by regulating target gene expression important for plant development and tolerance to stress conditions. Additionally, recently discovered phased siRNAs (phasiRNAs), a new class of small RNAs, are abundantly produced in legumes. Nevertheless, little is known about these regulatory molecules in chickpea. The small RNA population was sequenced from leaves and flowers of chickpea to identify conserved and novel miRNAs as well as phasiRNAs/phasiRNA loci. Bioinformatics analysis revealed 157 miRNA loci for the 96 highly conserved and known miRNA homologs belonging to 38 miRNA families in chickpea. Furthermore, 20 novel miRNAs belonging to 17 miRNA families were identified. Sequence analysis revealed approximately 60 phasiRNA loci. Potential target genes likely to be regulated by these miRNAs were predicted and some were confirmed by modified 5' RACE assay. Predicted targets are mostly transcription factors that might be important for developmental processes, and others include superoxide dismutases, plantacyanin, laccases and F-box proteins that could participate in stress responses and protein degradation. Overall, this study provides an inventory of miRNA-target gene interactions for chickpea, useful for the comparative analysis of small RNAs among legumes. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  20. Novel sequence variations in LAMA2 and SGCG genes modulating cis-acting regulatory elements and RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Olfa Siala

    2010-01-01

    Full Text Available In this study, we detected new sequence variations in LAMA2 and SGCG genes in 5 ethnic populations, and analysed their effect on enhancer composition and mRNA structure. PCR amplification and DNA sequencing were performed and followed by bioinformatics analyses using ESEfinder as well as MFOLD software. We found 3 novel sequence variations in the LAMA2 (c.3174+22_23insAT and c.6085 +12delA and SGCG (c.*102A/C genes. These variations were present in 210 tested healthy controls from Tunisian, Moroccan, Algerian, Lebanese and French populations suggesting that they represent novel polymorphisms within LAMA2 and SGCG genes sequences. ESEfinder showed that the c.*102A/C substitution created a new exon splicing enhancer in the 3'UTR of SGCG genes, whereas the c.6085 +12delA deletion was situated in the base pairing region between LAMA2 mRNA and the U1snRNA spliceosomal components. The RNA structure analyses showed that both variations modulated RNA secondary structure. Our results are suggestive of correlations between mRNA folding and the recruitment of spliceosomal components mediating splicing, including SR proteins. The contribution of common sequence variations to mRNA structural and functional diversity will contribute to a better study of gene expression.

  1. RNAPattMatch: a web server for RNA sequence/structure motif detection based on pattern matching with flexible gaps

    Science.gov (United States)

    Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny

    2015-01-01

    Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619

  2. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  3. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Gonzalo H Villarino

    Full Text Available Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  4. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Science.gov (United States)

    Villarino, Gonzalo H; Bombarely, Aureliano; Giovannoni, James J; Scanlon, Michael J; Mattson, Neil S

    2014-01-01

    Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl) disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN) http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  5. A general excimer signaling approach for aptamer sensors.

    Science.gov (United States)

    Wu, Cuichen; Yan, Ling; Wang, Chunming; Lin, Haoxue; Wang, Chi; Chen, Xi; Yang, Chaoyong James

    2010-06-15

    Simple, fast and direct analysis or monitoring of significant molecules in complex biological samples is important for many biological study, clinical diagnosis and forensic investigations. Herein we highlight a general method to tailor aptamer sequence into functional subunits to design target-induced light-switching excimer sensors for rapid, sensitive and selective detection of important molecules in complex biological fluids. Our approach is to split one single strand aptamer into two pieces and each terminally labeled with a pyrene molecule while maintaining their binding affinity to target molecules. In the presence of target molecules, two aptamer fragments are induced to self-assemble to form aptamer-target complex and bring two pyrene molecules into a close proximity to form an excimer, resulting in fluorescent switching from approximately 400 nm to 485 nm. With an anti-cocaine sensor, as low as 1 microM of cocaine can be detected using steady-state fluorescence assays and more importantly low picomole level of target can be directly visualized with naked eyes. Because the excimer has a long fluorescence lifetime, time-resolved measurements were used to directly detect as low as 5 microM cocaine in urine samples quantitatively without any sample pretreatment. Copyright 2010 Elsevier B.V. All rights reserved.

  6. Aptamer-based viability impedimetric sensor for bacteria.

    Science.gov (United States)

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-11-06

    The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform.

  7. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  8. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    communities, and in this study activated sludge sampled from 32 Wastewater Treatment Plants (WWTPs) around the world was described and compared. The top abundant bacteria in the global activated sludge ecosystem were found and the core population shared by multiple samples was investigated. The results......Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  9. MicroRNA discovery and analysis of pinewood nematode Bursaphelenchus xylophilus by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Qi-Xing Huang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are considered to be very important in regulating the growth, development, behavior and stress response in animals and plants in post-transcriptional gene regulation. Pinewood nematode, Bursaphelenchus xylophilus, is an important invasive plant parasitic nematode in Asia. To have a comprehensive knowledge about miRNAs of the nematode is necessary for further in-depth study on roles of miRNAs in the ecological adaptation of the invasive species. METHODS AND FINDINGS: Five small RNA libraries were constructed and sequenced by Illumina/Solexa deep-sequencing technology. A total of 810 miRNA candidates (49 conserved and 761 novel were predicted by a computational pipeline, of which 57 miRNAs (20 conserved and 37 novel encoded by 53 miRNA precursors were identified by experimental methods. Ten novel miRNAs were considered to be species-specific miRNAs of B. xylophilus. Comparison of expression profiles of miRNAs in the five small RNA libraries showed that many miRNAs exhibited obviously different expression levels in the third-stage dispersal juvenile and at a cold-stressed status. Most of the miRNAs exhibited obviously down-regulated expression in the dispersal stage. But differences among the three geographic libraries were not prominent. A total of 979 genes were predicted to be targets of these authentic miRNAs. Among them, seven heat shock protein genes were targeted by 14 miRNAs, and six FMRFamide-like neuropeptides genes were targeted by 17 miRNAs. A real-time quantitative polymerase chain reaction was used to quantify the mRNA expression levels of target genes. CONCLUSIONS: Basing on the fact that a negative correlation existed between the expression profiles of miRNAs and the mRNA expression profiles of their target genes (hsp, flp by comparing those of the nematodes at a cold stressed status and a normal status, we suggested that miRNAs might participate in ecological adaptation and behavior regulation of the

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  12. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  13. Screening and Identification of ssDNA Aptamer for Human GP73

    Directory of Open Access Journals (Sweden)

    Jingchun Du

    2015-01-01

    Full Text Available As one tumor marker of HCC, Golgi Protein 73 (GP73 is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens.

  14. Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches.

    Science.gov (United States)

    Feng, Xinyu; Zhou, Xiaojian; Zhou, Shuisen; Wang, Jingwen; Hu, Wei

    2018-03-12

    microRNAs (miRNAs) are small non-coding RNAs widely identified in many mosquitoes. They are reported to play important roles in development, differentiation and innate immunity. However, miRNAs in Anopheles sinensis, one of the Chinese malaria mosquitoes, remain largely unknown. We investigated the global miRNA expression profile of An. sinensis using Illumina Hiseq 2000 sequencing. Meanwhile, we applied a bioinformatic approach to identify potential miRNAs in An. sinensis. The identified miRNA profiles were compared and analyzed by two approaches. The selected miRNAs from the sequencing result and the bioinformatic approach were confirmed with qRT-PCR. Moreover, target prediction, GO annotation and pathway analysis were carried out to understand the role of miRNAs in An. sinensis. We identified 49 conserved miRNAs and 12 novel miRNAs by next-generation high-throughput sequencing technology. In contrast, 43 miRNAs were predicted by the bioinformatic approach, of which two were assigned as novel. Comparative analysis of miRNA profiles by two approaches showed that 21 miRNAs were shared between them. Twelve novel miRNAs did not match any known miRNAs of any organism, indicating that they are possibly species-specific. Forty miRNAs were found in many mosquito species, indicating that these miRNAs are evolutionally conserved and may have critical roles in the process of life. Both the selected known and novel miRNAs (asi-miR-281, asi-miR-184, asi-miR-14, asi-miR-nov5, asi-miR-nov4, asi-miR-9383, and asi-miR-2a) could be detected by quantitative real-time PCR (qRT-PCR) in the sequenced sample, and the expression patterns of these miRNAs measured by qRT-PCR were in concordance with the original miRNA sequencing data. The predicted targets for the known and the novel miRNAs covered many important biological roles and pathways indicating the diversity of miRNA functions. We also found 21 conserved miRNAs and eight counterparts of target immune pathway genes in An. sinensis

  15. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

    Science.gov (United States)

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

    2013-01-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  16. RNA signal amplifier circuit with integrated fluorescence output.

    Science.gov (United States)

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  17. Cofactors in the RNA World

    Science.gov (United States)

    Ditzler, Mark A.

    2014-01-01

    RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

  18. DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin.

    Science.gov (United States)

    Vivekananda, Jeevalatha; Salgado, Christi; Millenbaugh, Nancy J

    2014-02-14

    Staphylococcus aureus is a versatile pathogen capable of causing a broad spectrum of diseases ranging from superficial skin infections to life threatening conditions such as endocarditis, septicemia, pneumonia and toxic shock syndrome. In vitro and in vivo studies identified an exotoxin, α-toxin, as a major cause of S. aureus toxicity. Because S. aureus has rapidly evolved resistance to a number of antibiotics, including methicillin, it is important to identify new therapeutic strategies, other than antibiotics, for inhibiting the harmful effects of this pathogen. Aptamers are single-stranded DNA or RNA oligonucleotides with three-dimensional folded conformations that bind with high affinity and selectivity to targets and modulate their biological functions. The goal of this study was to isolate DNA aptamers that specifically inhibit the cytotoxic activity of α-toxin. After 10 rounds of Systematic Evolution of Ligands by EXponential Enrichment (SELEX), 49 potential anti-α-toxin aptamers were identified. In vitro neutralization assays demonstrated that 4 of these 49 aptamers, AT-27, AT-33, AT-36, and AT-49, significantly inhibited α-toxin-mediated cell death in Jurkat T cells. Furthermore, RT-PCR analysis revealed that α-toxin increased the transcription of the inflammatory cytokines TNF-α and IL-17 and that anti-α-toxin aptamers AT-33 and AT-36 inhibited the upregulation of these genes. Collectively, the data suggest the feasibility of generating functionally effective aptamers against α-toxin for treatment of S. aureus infections. Published by Elsevier Inc.

  19. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments

    Science.gov (United States)

    Amplification and sequencing of the complete M- and S-RNA segments of Tomato spotted wilt virus and Impatiens necrotic spot virus as a single fragment is useful for whole genome sequencing of tospoviruses co-infecting a single host plant. It avoids issues associated with overlapping amplicon-based ...

  20. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to

  1. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  2. RNAcontext: a new method for learning the sequence and structure binding preferences of RNA-binding proteins.

    Directory of Open Access Journals (Sweden)

    Hilal Kazan

    2010-07-01

    Full Text Available Metazoan genomes encode hundreds of RNA-binding proteins (RBPs. These proteins regulate post-transcriptional gene expression and have critical roles in numerous cellular processes including mRNA splicing, export, stability and translation. Despite their ubiquity and importance, the binding preferences for most RBPs are not well characterized. In vitro and in vivo studies, using affinity selection-based approaches, have successfully identified RNA sequence associated with specific RBPs; however, it is difficult to infer RBP sequence and structural preferences without specifically designed motif finding methods. In this study, we introduce a new motif-finding method, RNAcontext, designed to elucidate RBP-specific sequence and structural preferences with greater accuracy than existing approaches. We evaluated RNAcontext on recently published in vitro and in vivo RNA affinity selected data and demonstrate that RNAcontext identifies known binding preferences for several control proteins including HuR, PTB, and Vts1p and predicts new RNA structure preferences for SF2/ASF, RBM4, FUSIP1 and SLM2. The predicted preferences for SF2/ASF are consistent with its recently reported in vivo binding sites. RNAcontext is an accurate and efficient motif finding method ideally suited for using large-scale RNA-binding affinity datasets to determine the relative binding preferences of RBPs for a wide range of RNA sequences and structures.

  3. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  5. Transcriptome analysis of the model protozoan, Tetrahymena thermophila, using Deep RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Jie Xiong

    Full Text Available BACKGROUND: The ciliated protozoan Tetrahymena thermophila is a well-studied single-celled eukaryote model organism for cellular and molecular biology. However, the lack of extensive T. thermophila cDNA libraries or a large expressed sequence tag (EST database limited the quality of the original genome annotation. METHODOLOGY/PRINCIPAL FINDINGS: This RNA-seq study describes the first deep sequencing analysis of the T. thermophila transcriptome during the three major stages of the life cycle: growth, starvation and conjugation. Uniquely mapped reads covered more than 96% of the 24,725 predicted gene models in the somatic genome. More than 1,000 new transcribed regions were identified. The great dynamic range of RNA-seq allowed detection of a nearly six order-of-magnitude range of measurable gene expression orchestrated by this cell. RNA-seq also allowed the first prediction of transcript untranslated regions (UTRs and an updated (larger size estimate of the T. thermophila transcriptome: 57 Mb, or about 55% of the somatic genome. Our study identified nearly 1,500 alternative splicing (AS events distributed over 5.2% of T. thermophila genes. This percentage represents a two order-of-magnitude increase over previous EST-based estimates in Tetrahymena. Evidence of stage-specific regulation of alternative splicing was also obtained. Finally, our study allowed us to completely confirm about 26.8% of the genes originally predicted by the gene finder, to correct coding sequence boundaries and intron-exon junctions for about a third, and to reassign microarray probes and correct earlier microarray data. CONCLUSIONS/SIGNIFICANCE: RNA-seq data significantly improve the genome annotation and provide a fully comprehensive view of the global transcriptome of T. thermophila. To our knowledge, 5.2% of T. thermophila genes with AS is the highest percentage of genes showing AS reported in a unicellular eukaryote. Tetrahymena thus becomes an excellent unicellular

  6. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  7. Small RNA and transcriptome deep sequencing proffers insight into floral gene regulation in Rosa cultivars

    Directory of Open Access Journals (Sweden)

    Kim Jungeun

    2012-11-01

    Full Text Available Abstract Background Roses (Rosa sp., which belong to the family Rosaceae, are the most economically important ornamental plants—making up 30% of the floriculture market. However, given high demand for roses, rose breeding programs are limited in molecular resources which can greatly enhance and speed breeding efforts. A better understanding of important genes that contribute to important floral development and desired phenotypes will lead to improved rose cultivars. For this study, we analyzed rose miRNAs and the rose flower transcriptome in order to generate a database to expound upon current knowledge regarding regulation of important floral characteristics. A rose genetic database will enable comprehensive analysis of gene expression and regulation via miRNA among different Rosa cultivars. Results We produced more than 0.5 million reads from expressed sequences, totalling more than 110 million bp. From these, we generated 35,657, 31,434, 34,725, and 39,722 flower unigenes from Rosa hybrid: ‘Vital’, ‘Maroussia’, and ‘Sympathy’ and Rosa rugosa Thunb. , respectively. The unigenes were assigned functional annotations, domains, metabolic pathways, Gene Ontology (GO terms, Plant Ontology (PO terms, and MIPS Functional Catalogue (FunCat terms. Rose flower transcripts were compared with genes from whole genome sequences of Rosaceae members (apple, strawberry, and peach and grape. We also produced approximately 40 million small RNA reads from flower tissue for Rosa, representing 267 unique miRNA tags. Among identified miRNAs, 25 of them were novel and 242 of them were conserved miRNAs. Statistical analyses of miRNA profiles revealed both shared and species-specific miRNAs, which presumably effect flower development and phenotypes. Conclusions In this study, we constructed a Rose miRNA and transcriptome database, and we analyzed the miRNAs and transcriptome generated from the flower tissues of four Rosa cultivars. The database provides a

  8. Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Heather P McLaughlin

    Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

  9. Molecular Mechanisms of Mild and Severe Pneumonia: Insights from RNA Sequencing.

    Science.gov (United States)

    Huang, Sai; Feng, Cong; Chen, Li; Huang, Zhi; Zhou, Xuan; Li, Bei; Wang, Li-Li; Chen, Wei; Lv, Fa-Qin; Li, Tan-Shi

    2017-04-06

    BACKGROUND This study aimed to uncover the molecular mechanisms underlying mild and severe pneumonia by use of mRNA sequencing (RNA-seq). MATERIAL AND METHODS RNA was extracted from the peripheral blood of patients with mild pneumonia, severe pneumonia, and healthy controls. Sequencing was performed on the HiSeq4000 platform. After filtering, clean reads were mapped to the human reference genome hg19. Differentially expressed genes (DEGs) were identified between the control group and the mild or severe group. A transcription factor-gene network was constructed for each group. Biological process (BP) terms enriched by DEGs in the network were analyzed and these genes were also mapped to the Connectivity map to search for small-molecule drugs. RESULTS A total of 199 and 560 DEGs were identified from the mild group and severe group, respectively. A transcription factor-gene network consisting of 215 nodes and another network consisting of 451 nodes were constructed in the mild group and severe group, respectively, and 54 DEGs (e.g., S100A9 and S100A12) were found to be common, with consistent differential expression changes in the 2 groups. Genes in the transcription factor-gene network for the mild group were mainly enriched in 13 BP terms, especially defense and inflammatory response (e.g., S100A8) and spermatogenesis, while the top BP terms enriched by genes in the severe group include response to oxidative stress (CCL5), wound healing, and regulation of cell differentiation (CCL5), and of the cellular protein metabolic process. CONCLUSIONS S100A9 and S100A12 may have a role in the pathogenesis of pneumonia: S100A9 and CXCL1 may contribute solely in mild pneumonia, and CCL5 and CXCL11 may contribute in severe pneumonia.

  10. Comprehensive microRNA profiling in B-cells of human centenarians by massively parallel sequencing

    Directory of Open Access Journals (Sweden)

    Gombar Saurabh

    2012-07-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small, non-coding RNAs that regulate gene expression and play a critical role in development, homeostasis, and disease. Despite their demonstrated roles in age-associated pathologies, little is known about the role of miRNAs in human aging and longevity. Results We employed massively parallel sequencing technology to identify miRNAs expressed in B-cells from Ashkenazi Jewish centenarians, i.e., those living to a hundred and a human model of exceptional longevity, and younger controls without a family history of longevity. With data from 26.7 million reads comprising 9.4 × 108 bp from 3 centenarian and 3 control individuals, we discovered a total of 276 known miRNAs and 8 unknown miRNAs ranging several orders of magnitude in expression levels, a typical characteristics of saturated miRNA-sequencing. A total of 22 miRNAs were found to be significantly upregulated, with only 2 miRNAs downregulated, in centenarians as compared to controls. Gene Ontology analysis of the predicted and validated targets of the 24 differentially expressed miRNAs indicated enrichment of functional pathways involved in cell metabolism, cell cycle, cell signaling, and cell differentiation. A cross sectional expression analysis of the differentially expressed miRNAs in B-cells from Ashkenazi Jewish individuals between the 50th and 100th years of age indicated that expression levels of miR-363* declined significantly with age. Centenarians, however, maintained the youthful expression level. This result suggests that miR-363* may be a candidate longevity-associated miRNA. Conclusion Our comprehensive miRNA data provide a resource for further studies to identify genetic pathways associated with aging and longevity in humans.

  11. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Science.gov (United States)

    Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom

    2010-12-07

    The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  12. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Directory of Open Access Journals (Sweden)

    Larry Gold

    2010-12-01

    Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  13. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  14. Colorimetric detection with aptamer–gold nanoparticle conjugates: effect of aptamer length on response

    International Nuclear Information System (INIS)

    Chávez, Jorge L.; MacCuspie, Robert I.; Stone, Morley O.; Kelley-Loughnane, Nancy

    2012-01-01

    A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA–AuNP conjugates (RBA–AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA–AuNPs’ stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5′ end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA–AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA–AuNPs’ stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer–AuNPs conjugates and their sensing response.

  15. Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

    Science.gov (United States)

    Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

    2016-03-01

    RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

  16. Structural insights into the osteopontin-aptamer complex y molecular dynamics simulations

    Science.gov (United States)

    La Penna, Giovanni; Chelli, Riccardo

    2018-01-01

    Osteopontin is an intrinsically disordered protein involved in tissue remodeling. As a biomarker for pathological hypertrophy and fibrosis, the protein is targeted by an RNA aptamer. In this work, we model the interactions between osteopontin and its aptamer, including mono- (Na+) and divalent (Mg2+) cations. The molecular dynamics simulations suggest that the presence of divalent cations forces the N-terminus of osteopontin to bind the shell of divalent cations adsorbed over the surface of its RNA aptamer, the latter exposing a high negative charge density. The osteopontin plasticity as a function of the local concentration of Mg is discussed in the frame of the proposed strategies for osteopontin targeting as biomarker and in theranostic.

  17. Nucleic Acid Aptamers Against Biotoxins: A New Paradigm Toward the Treatment and Diagnostic Approach

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Veedu, Rakesh N.

    2012-01-01

    Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody-based therape......Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody......-based therapeutic and diagnostic approach currently employed against biotoxins pose major limitations such as the requirement of a live animal for the in vivo enrichment of the antibody species, decreased stability, high production cost, and side effects. Aptamer technology is a viable alternative that can be used...

  18. Elucidating the Small Regulatory RNA Repertoire of the Sea Anemone Anemonia viridis Based on Whole Genome and Small RNA Sequencing.

    Science.gov (United States)

    Urbarova, Ilona; Patel, Hardip; Forêt, Sylvain; Karlsen, Bård Ove; Jørgensen, Tor Erik; Hall-Spencer, Jason M; Johansen, Steinar D

    2018-02-01

    Cnidarians harbor a variety of small regulatory RNAs that include microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs), but detailed information is limited. Here, we report the identification and expression of novel miRNAs and putative piRNAs, as well as their genomic loci, in the symbiotic sea anemone Anemonia viridis. We generated a draft assembly of the A. viridis genome with putative size of 313 Mb that appeared to be composed of about 36% repeats, including known transposable elements. We detected approximately equal fractions of DNA transposons and retrotransposons. Deep sequencing of small RNA libraries constructed from A. viridis adults sampled at a natural CO2 gradient off Vulcano Island, Italy, identified 70 distinct miRNAs. Eight were homologous to previously reported miRNAs in cnidarians, whereas 62 appeared novel. Nine miRNAs were recognized as differentially expressed along the natural seawater pH gradient. We found a highly abundant and diverse population of piRNAs, with a substantial fraction showing ping-pong signatures. We identified nearly 22% putative piRNAs potentially targeting transposable elements within the A. viridis genome. The A. viridis genome appeared similar in size to that of other hexacorals with a very high divergence of transposable elements resembling that of the sea anemone genus Exaiptasia. The genome encodes and expresses a high number of small regulatory RNAs, which include novel miRNAs and piRNAs. Differentially expressed small RNAs along the seawater pH gradient indicated regulatory gene responses to environmental stressors. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  20. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

    Science.gov (United States)

    Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

    2014-01-13

    Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

  1. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  2. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  3. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    Science.gov (United States)

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available

  4. RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

    Science.gov (United States)

    Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

    2016-06-15

    Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by

  5. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang, Jin, E-mail: jinxxwang@263.net [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); Huang, Nan [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)

    2016-11-15

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  7. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    International Nuclear Information System (INIS)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-01-01

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  8. Isolation of HL-60 cancer cells from the human serum sample using MnO2-PEI/Ni/Au/aptamer as a novel nanomotor and electrochemical determination of thereof by aptamer/gold nanoparticles-poly(3,4-ethylene dioxythiophene) modified GC electrode.

    Science.gov (United States)

    Amouzadeh Tabrizi, Mahmoud; Shamsipur, Mojtaba; Saber, Reza; Sarkar, Saeed

    2018-07-01

    Herein, aptamer-modified self-propelled nanomotors were used for transportation of human promyelocytic leukemia cells (HL-60) from a human serum sample. For this purpose, the fabricated manganese oxide nanosheets-polyethyleneimine decorated with nickel/gold nanoparticles (MnO 2 -PEI/Ni/Au) as nanomotors were added to a vial containing thiolated aptamer KH1C12 solution as a capture aptamer to attach to the gold nanoparticles on the surface of nanomotors covalently. The aptamer-modified self-propelled nanomotors (aptamer KH1C12 /nanomotors) were then separated by placing the vial in a magnetic stand. The aptamer-modified self-propelled nanomotors were rinsed three times with water to remove the non-attached aptamers. Then, the resulting aptamer KH1C12 /nanomotors were applied for the on-the-fly" transporting of HL-60 cancer cell from a human serum sample. To release of the captured HL-60 cancer cells, the complementary nucleotide sequences of KH1C12 aptamer solution (releasing aptamer) that has a with capture aptamer was added to phosphate buffer solution (1 M, pH 7.4) containing HL-60/aptamer KH1C12 /nanomotors. Because of the high affinity of capture aptamer to complementary nucleotide sequences of aptamer KH1C12 , the HL-60 cancer cells released on the surface of aptamer KH1C12 /nanomotors into the solution. The second goal of the present work was determining the concentration of HL-60 cancer cell in the human serum samples. The electrochemical impedance spectroscopy technique (EIS) was used for the determination of HL-60 cancer cell. The concentration of separated cancer cell was determined by aptamer/gold nanoparticles-poly(3,4-ethylene dioxythiophene) modified GC electrode (GC/PEDOT-Au nano /aptamer KH1C12 ). The proposed aptasensor exhibited a good response to the concentration of HL-60 cancer cells in the range of 2.5 × 10 1 to 5 × 10 5 cells mL -1 with a low limit of detection of 250 cells mL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  10. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  11. From Ugly Duckling to Swan: Unexpected Identification from Cell-SELEX of an Anti-Annexin A2 Aptamer Targeting Tumors

    Science.gov (United States)

    Cibiel, Agnes; Nguyen Quang, Nam; Gombert, Karine; Thézé, Benoit; Garofalakis, Anikitos; Ducongé, Frédéric

    2014-01-01

    Background Cell-SELEX is now widely used for the selection of aptamers against cell surface biomarkers. However, despite negative selection steps using mock cells, this method sometimes results in aptamers against undesirable targets that are expressed both on mock and targeted cells. Studying these junk aptamers might be useful for further applications than those originally envisaged. Methodology/Principal Findings Cell-SELEX was performed to identify aptamers against CHO-K1 cells expressing human Endothelin type B receptor (ETBR). CHO-K1 cells were used for negative selection of aptamers. Several aptamers were identified but no one could discriminate between both cell lines. We decided to study one of these aptamers, named ACE4, and we identified that it binds to the Annexin A2, a protein overexpressed in many cancers. Radioactive binding assays and flow cytometry demonstrated that the aptamer was able to bind several cancer cell lines from different origins, particularly the MCF-7 cells. Fluorescence microscopy revealed it could be completely internalized in cells in 2 hours. Finally, the tumor targeting of the aptamer was evaluated in vivo in nude mice xenograft with MCF-7 cells using fluorescence diffuse optical tomography (fDOT) imaging. Three hours after intravenous injection, the aptamer demonstrated a significantly higher uptake in the tumor compared to a scramble sequence. Conclusions/Significance Although aptamers could be selected during cell-SELEX against other targets than those initially intended, they represent a potential source of ligands for basic research, diagnoses and therapy. Here, studying such aptamers, we identify one with high affinity for Annexin A2 that could be a promising tool for biomedical application. PMID:24489826

  12. Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography.

    Science.gov (United States)

    Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali

    2016-09-01

    Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd  = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Transcriptome Analysis of Ceriops tagal in Saline Environments Using RNA-Sequencing.

    Directory of Open Access Journals (Sweden)

    Xiaorong Xiao

    Full Text Available Identification of genes involved in mangrove species' adaptation to salt stress can provide valuable information for developing salt-tolerant crops and understanding the molecular evolution of salt tolerance in halophiles. Ceriops tagal is a salt-tolerant mangrove tree growing in mudflats and marshes in tropical and subtropical areas, without any prior genome information. In this study, we assessed the biochemical and transcriptional responses of C. tagal to high salt treatment (500 mmol/L NaCl by hydroponic experiments and RNA-seq. In C. tagal root tissues under salt stress, proline accumulated strongly from 3 to 12 h of treatment; meanwhile, malondialdehyde content progressively increased from 0 to 9 h, then dropped to lower than control levels by 24 h. These implied that C. tagal plants could survive salt stress through biochemical modification. Using the Illumina sequencing platform, approximately 27.39 million RNA-seq reads were obtained from three salt-treated and control (untreated root samples. These reads were assembled into 47,111 transcripts with an average length of 514 bp and an N50 of 632 bp. Approximately 78% of the transcripts were annotated, and a total of 437 genes were putative transcription factors. Digital gene expression analysis was conducted by comparing transcripts from the untreated control to the three salt treated samples, and 7,330 differentially expressed transcripts were identified. Using k-means clustering, these transcripts were divided into six clusters that differed in their expression patterns across four treatment time points. The genes identified as being up- or downregulated are involved in salt stress responses, signal transduction, and DNA repair. Our study shows the main adaptive pathway of C. tagal in saline environments, under short-term and long-term treatments of salt stress. This provides vital clues as to which genes may be candidates for breeding salt-tolerant crops and clarifying molecular

  14. Sequence-engineered mRNA Without Chemical Nucleoside Modifications Enables an Effective Protein Therapy in Large Animals

    Science.gov (United States)

    Thess, Andreas; Grund, Stefanie; Mui, Barbara L; Hope, Michael J; Baumhof, Patrick; Fotin-Mleczek, Mariola; Schlake, Thomas

    2015-01-01

    Being a transient carrier of genetic information, mRNA could be a versatile, flexible, and safe means for protein therapies. While recent findings highlight the enormous therapeutic potential of mRNA, evidence that mRNA-based protein therapies are feasible beyond small animals such as mice is still lacking. Previous studies imply that mRNA therapeutics require chemical nucleoside modifications to obtain sufficient protein expression and avoid activation of the innate immune system. Here we show that chemically unmodified mRNA can achieve those goals as well by applying sequence-engineered molecules. Using erythropoietin (EPO) driven production of red blood cells as the biological model, engineered Epo mRNA elicited meaningful physiological responses from mice to nonhuman primates. Even in pigs of about 20 kg in weight, a single adequate dose of engineered mRNA encapsulated in lipid nanoparticles (LNPs) induced high systemic Epo levels and strong physiological effects. Our results demonstrate that sequence-engineered mRNA has the potential to revolutionize human protein therapies. PMID:26050989

  15. Translation of the flavivirus kunjin NS3 gene in cis but not its RNA sequence or secondary structure is essential for efficient RNA packaging.

    Science.gov (United States)

    Pijlman, Gorben P; Kondratieva, Natasha; Khromykh, Alexander A

    2006-11-01

    Our previous studies using trans-complementation analysis of Kunjin virus (KUN) full-length cDNA clones harboring in-frame deletions in the NS3 gene demonstrated the inability of these defective complemented RNAs to be packaged into virus particles (W. J. Liu, P. L. Sedlak, N. Kondratieva, and A. A. Khromykh, J. Virol. 76:10766-10775). In this study we aimed to establish whether this requirement for NS3 in RNA packaging is determined by the secondary RNA structure of the NS3 gene or by the essential role of the translated NS3 gene product. Multiple silent mutations of three computer-predicted stable RNA structures in the NS3 coding region of KUN replicon RNA aimed at disrupting RNA secondary structure without affecting amino acid sequence did not affect RNA replication and packaging into virus-like particles in the packaging cell line, thus demonstrating that the predicted conserved RNA structures in the NS3 gene do not play a role in RNA replication and/or packaging. In contrast, double frameshift mutations in the NS3 coding region of full-length KUN RNA, producing scrambled NS3 protein but retaining secondary RNA structure, resulted in the loss of ability of these defective RNAs to be packaged into virus particles in complementation experiments in KUN replicon-expressing cells. Furthermore, the more robust complementation-packaging system based on established stable cell lines producing large amounts of complemented replicating NS3-deficient replicon RNAs and infection with KUN virus to provide structural proteins also failed to detect any secreted virus-like particles containing packaged NS3-deficient replicon RNAs. These results have now firmly established the requirement of KUN NS3 protein translated in cis for genome packaging into virus particles.

  16. FRET-Aptamer Assays for Bone Marker Assessment, C-Telopeptide, Creatinine, and Vitamin D

    Science.gov (United States)

    Bruno, John G.

    2013-01-01

    called a "lights on" FRET response. The vitamin D aptamer beacon gives a "lights off" or inversely proportional fluorescence response to the amount of vitamin D present in diluted serum. These FRET-aptamer assays are rapid (<30 minutes), sensitive (low ng/mL detection limits), and quite easy to carry out (add sample, mix, and detect in the handheld reader). Benefits include the speed of the assays as well as the small amount of space taken up by the handheld reader and cuvette assays. The aptamer DNA sequences represent novel additional features of the existing (patent-pending) FRET-aptamer assay platform.

  17. Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing.

    Science.gov (United States)

    Hochgerner, Hannah; Zeisel, Amit; Lönnerberg, Peter; Linnarsson, Sten

    2018-02-01

    The dentate gyrus of the hippocampus is a brain region in which neurogenesis persists into adulthood; however, the relationship between developmental and adult dentate gyrus neurogenesis has not been examined in detail. Here we used single-cell RNA sequencing to reveal the molecular dynamics and diversity of dentate gyrus cell types in perinatal, juvenile, and adult mice. We found distinct quiescent and proliferating progenitor cell types, linked by transient intermediate states to neuroblast stages and fully mature granule cells. We observed shifts in the molecular identity of quiescent and proliferating radial glia and granule cells during the postnatal period that were then maintained through adult stages. In contrast, intermediate progenitor cells, neuroblasts, and immature granule cells were nearly indistinguishable at all ages. These findings demonstrate the fundamental similarity of postnatal and adult neurogenesis in the hippocampus and pinpoint the early postnatal transformation of radial glia from embryonic progenitors to adult quiescent stem cells.

  18. Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases.

    Science.gov (United States)

    Citorik, Robert J; Mimee, Mark; Lu, Timothy K

    2014-11-01

    Current antibiotics tend to be broad spectrum, leading to indiscriminate killing of commensal bacteria and accelerated evolution of drug resistance. Here, we use CRISPR-Cas technology to create antimicrobials whose spectrum of activity is chosen by design. RNA-guided nucleases (RGNs) targeting specific DNA sequences are delivered efficiently to microbial populations using bacteriophage or bacteria carrying plasmids transmissible by conjugation. The DNA targets of RGNs can be undesirable genes or polymorphisms, including antibiotic resistance and virulence determinants in carbapenem-resistant Enterobacteriaceae and enterohemorrhagic Escherichia coli. Delivery of RGNs significantly improves survival in a Galleria mellonella infection model. We also show that RGNs enable modulation of complex bacterial populations by selective knockdown of targeted strains based on genetic signatures. RGNs constitute a class of highly discriminatory, customizable antimicrobials that enact selective pressure at the DNA level to reduce the prevalence of undesired genes, minimize off-target effects and enable programmable remodeling of microbiota.

  19. Expression profiles of mRNA and long noncoding RNA in the ovaries of letrozole-induced polycystic ovary syndrome rat model through deep sequencing.

    Science.gov (United States)

    Fu, Lu-Lu; Xu, Ying; Li, Dan-Dan; Dai, Xiao-Wei; Xu, Xin; Zhang, Jing-Shun; Ming, Hao; Zhang, Xue-Ying; Zhang, Guo-Qing; Ma, Ya-Lan; Zheng, Lian-Wen

    2018-05-30

    Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in reproductive-aged women. However, the exact pathophysiology of PCOS remains largely unclear. We performed deep sequencing to investigate the mRNA and long noncoding RNA (lncRNA) expression profiles in the ovarian tissues of letrozole-induced PCOS rat model and control rats. A total of 2147 mRNAs and 158 lncRNAs were differentially expressed between the PCOS models and control. Gene ontology analysis indicated that differentially expressed mRNAs were associated with biological adhesion, reproduction, and metabolic process. Pathway analysis results indicated that these aberrantly expressed mRNAs were related to several specific signaling pathways, including insulin resistance, steroid hormone biosynthesis, PPAR signaling pathway, cell adhesion molecules, autoimmune thyroid disease, and AMPK signaling pathway. The relative expression levels of mRNAs and lncRNAs were validated through qRT-PCR. LncRNA-miRNA-mRNA network was constructed to explore ceRNAs involved in the PCOS model and were also verified by qRTPCR experiment. These findings may provide insight into the pathogenesis of PCOS and clues to find key diagnostic and therapeutic roles of lncRNA in PCOS. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components.

    Science.gov (United States)

    Ramlal, Shylaja; Mondal, Bhairab; Lavu, Padma Sudharani; N, Bhavanashri; Kingston, Joseph

    2018-01-16

    In the present study, a high throughput whole cell SELEX method has been applied successfully in selecting specific aptamers against whole cells of Staphylococcus aureus, a potent food poisoning bacterium. A total ten rounds of SELEX and three rounds of intermittent counter SELEX, was performed to obtain specific aptamers. Obtained oligonucleotide pool were cloned, sequenced and then grouped into different families based on their primary sequence homology and secondary structure similarity. FITC labeled sequences from different families were selected for further characterization via flow cytometry analysis. The dissociation constant (K d ) values of specific and higher binders ranged from 34 to 128nM. Binding assays to assess the selectivity of aptamer RAB10, RAB 20, RAB 28 and RAB 35 demonstrated high affinity against S. aureus and low binding affinity for other bacteria. To demonstrate the potential use of the aptamer a sensitive dual labeled sandwich detection system was developed using aptamer RAB10 and RAB 35 with a detection limit of 10 2 CFU/mL. Furthermore detection from mixed cell population and spiked sample emphasized the robustness as well as applicability of the developed method. Altogether, the established assay could be a reliable detection tool for the routine investigation of Staphylococcus aureus in samples from food and clinical sources. Copyright © 2017. Published by Elsevier B.V.

  1. Physiological and Pathological Transcriptional Activation of Endogenous Retroelements Assessed by RNA-Sequencing of B Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jan Attig

    2017-12-01

    Full Text Available In addition to evolutionarily-accrued sequence mutation or deletion, endogenous retroelements (EREs in eukaryotic genomes are subject to epigenetic silencing, preventing or reducing their transcription, particularly in the germplasm. Nevertheless, transcriptional activation of EREs, including endogenous retroviruses (ERVs and long interspersed nuclear elements (LINEs, is observed in somatic cells, variably upon cellular differentiation and frequently upon cellular transformation. ERE transcription is modulated during physiological and pathological immune cell activation, as well as in immune cell cancers. However, our understanding of the potential consequences of such modulation remains incomplete, partly due to the relative scarcity of information regarding genome-wide ERE transcriptional patterns in immune cells. Here, we describe a methodology that allows probing RNA-sequencing (RNA-seq data for genome-wide expression of EREs in murine and human cells. Our analysis of B cells reveals that their transcriptional response during immune activation is dominated by induction of gene transcription, and that EREs respond to a much lesser extent. The transcriptional activity of the majority of EREs is either unaffected or reduced by B cell activation both in mice and humans, albeit LINEs appear considerably more responsive in the latter host. Nevertheless, a small number of highly distinct ERVs are strongly and consistently induced during B cell activation. Importantly, this pattern contrasts starkly with B cell transformation, which exhibits widespread induction of EREs, including ERVs that minimally overlap with those responsive to immune stimulation. The distinctive patterns of ERE induction suggest different underlying mechanisms and will help separate physiological from pathological expression.

  2. Optimizing a massive parallel sequencing workflow for quantitative miRNA expression analysis.

    Directory of Open Access Journals (Sweden)

    Francesca Cordero

    Full Text Available BACKGROUND: Massive Parallel Sequencing methods (MPS can extend and improve the knowledge obtained by conventional microarray technology, both for mRNAs and short non-coding RNAs, e.g. miRNAs. The processing methods used to extract and interpret the information are an important aspect of dealing with the vast amounts of data generated from short read sequencing. Although the number of computational tools for MPS data analysis is constantly growing, their strengths and weaknesses as part of a complex analytical pipe-line have not yet been well investigated. PRIMARY FINDINGS: A benchmark MPS miRNA dataset, resembling a situation in which miRNAs are spiked in biological replication experiments was assembled by merging a publicly available MPS spike-in miRNAs data set with MPS data derived from healthy donor peripheral blood mononuclear cells. Using this data set we observed that short reads counts estimation is strongly under estimated in case of duplicates miRNAs, if whole genome is used as reference. Furthermore, the sensitivity of miRNAs detection is strongly dependent by the primary tool used in the analysis. Within the six aligners tested, specifically devoted to miRNA detection, SHRiMP and MicroRazerS show the highest sensitivity. Differential expression estimation is quite efficient. Within the five tools investigated, two of them (DESseq, baySeq show a very good specificity and sensitivity in the detection of differential expression. CONCLUSIONS: The results provided by our analysis allow the definition of a clear and simple analytical optimized workflow for miRNAs digital quantitative analysis.

  3. Optimizing a massive parallel sequencing workflow for quantitative miRNA expression analysis.

    Science.gov (United States)

    Cordero, Francesca; Beccuti, Marco; Arigoni, Maddalena; Donatelli, Susanna; Calogero, Raffaele A

    2012-01-01

    Massive Parallel Sequencing methods (MPS) can extend and improve the knowledge obtained by conventional microarray technology, both for mRNAs and short non-coding RNAs, e.g. miRNAs. The processing methods used to extract and interpret the information are an important aspect of dealing with the vast amounts of data generated from short read sequencing. Although the number of computational tools for MPS data analysis is constantly growing, their strengths and weaknesses as part of a complex analytical pipe-line have not yet been well investigated. A benchmark MPS miRNA dataset, resembling a situation in which miRNAs are spiked in biological replication experiments was assembled by merging a publicly available MPS spike-in miRNAs data set with MPS data derived from healthy donor peripheral blood mononuclear cells. Using this data set we observed that short reads counts estimation is strongly under estimated in case of duplicates miRNAs, if whole genome is used as reference. Furthermore, the sensitivity of miRNAs detection is strongly dependent by the primary tool used in the analysis. Within the six aligners tested, specifically devoted to miRNA detection, SHRiMP and MicroRazerS show the highest sensitivity. Differential expression estimation is quite efficient. Within the five tools investigated, two of them (DESseq, baySeq) show a very good specificity and sensitivity in the detection of differential expression. The results provided by our analysis allow the definition of a clear and simple analytical optimized workflow for miRNAs digital quantitative analysis.

  4. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  5. High-throughput sequencing of plasma microRNA in chronic fatigue syndrome/myalgic encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Ekua W Brenu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are known to regulate many biological processes and their dysregulation has been associated with a variety of diseases including Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME. The recent discovery of stable and reproducible miRNA in plasma has raised the possibility that circulating miRNAs may serve as novel diagnostic markers. The objective of this study was to determine the role of plasma miRNA in CFS/ME. RESULTS: Using Illumina high-throughput sequencing we identified 19 miRNAs that were differentially expressed in the plasma of CFS/ME patients in comparison to non-fatigued controls. Following RT-qPCR analysis, we were able to confirm the significant up-regulation of three miRNAs (hsa-miR-127-3p, hsa-miR-142-5p and hsa-miR-143-3p in the CFS/ME patients. CONCLUSION: Our study is the first to identify circulating miRNAs from CFS/ME patients and also to confirm three differentially expressed circulating miRNAs in CFS/ME patients, providing a basis for further study to find useful CFS/ME biomarkers.

  6. High-Throughput Sequencing of Plasma MicroRNA in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis

    Science.gov (United States)

    Brenu, Ekua W.; Ashton, Kevin J.; Batovska, Jana; Staines, Donald R.; Marshall-Gradisnik, Sonya M.

    2014-01-01

    Background MicroRNAs (miRNAs) are known to regulate many biological processes and their dysregulation has been associated with a variety of diseases including Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME). The recent discovery of stable and reproducible miRNA in plasma has raised the possibility that circulating miRNAs may serve as novel diagnostic markers. The objective of this study was to determine the role of plasma miRNA in CFS/ME. Results Using Illumina high-throughput sequencing we identified 19 miRNAs that were differentially expressed in the plasma of CFS/ME patients in comparison to non-fatigued controls. Following RT-qPCR analysis, we were able to confirm the significant up-regulation of three miRNAs (hsa-miR-127-3p, hsa-miR-142-5p and hsa-miR-143-3p) in the CFS/ME patients. Conclusion Our study is the first to identify circulating miRNAs from CFS/ME patients and also to confirm three differentially expressed circulating miRNAs in CFS/ME patients, providing a basis for further study to find useful CFS/ME biomarkers. PMID:25238588

  7. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  8. Evolutionary patterns in the sequence and structure of transfer RNA: early origins of archaea and viruses.

    Directory of Open Access Journals (Sweden)

    Feng-Jie Sun

    2008-03-01

    Full Text Available Transfer RNAs (tRNAs are ancient molecules that are central to translation. Since they probably carry evolutionary signatures that were left behind when the living world diversified, we reconstructed phylogenies directly from the sequence and structure of tRNA using well-established phylogenetic methods. The trees placed tRNAs with long variable arms charging Sec, Tyr, Ser, and Leu consistently at the base of the rooted phylogenies, but failed to reveal groupings that would indicate clear evolutionary links to organismal origin or molecular functions. In order to uncover evolutionary patterns in the trees, we forced tRNAs into monophyletic groups using constraint analyses to generate timelines of organismal diversification and test competing evolutionary hypotheses. Remarkably, organismal timelines showed Archaea was the most ancestral superkingdom, followed by viruses, then superkingdoms Eukarya and Bacteria, in that order, supporting conclusions from recent phylogenomic studies of protein architecture. Strikingly, constraint analyses showed that the origin of viruses was not only ancient, but was linked to Archaea. Our findings have important implications. They support the notion that the archaeal lineage was very ancient, resulted in the first organismal divide, and predated diversification of tRNA function and specificity. Results are also consistent with the concept that viruses contributed to the development of the DNA replication machinery during the early diversification of the living world.

  9. Identification of Novel Equine (Equus caballus Tendon Markers Using RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Jan M. Kuemmerle

    2016-11-01

    Full Text Available Although several tendon-selective genes exist, they are also expressed in other musculoskeletal tissues. As cell and tissue engineering is reliant on specific molecular markers to discriminate between cell types, tendon-specific genes need to be identified. In order to accomplish this, we have used RNA sequencing (RNA-seq to compare gene expression between tendon, bone, cartilage and ligament from horses. We identified several tendon-selective gene markers, and established eyes absent homolog 2 (EYA2 and a G-protein regulated inducer of neurite outgrowth 3 (GPRIN3 as specific tendon markers using RT-qPCR. Equine tendon cells cultured as three-dimensional spheroids expressed significantly greater levels of EYA2 than GPRIN3, and stained positively for EYA2 using immunohistochemistry. EYA2 was also found in fibroblast-like cells within the tendon tissue matrix and in cells localized to the vascular endothelium. In summary, we have identified EYA2 and GPRIN3 as specific molecular markers of equine tendon as compared to bone, cartilage and ligament, and provide evidence for the use of EYA2 as an additional marker for tendon cells in vitro.

  10. Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

    Directory of Open Access Journals (Sweden)

    Ricardo eFlores

    2012-06-01

    Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

  11. LncRNA Expression Profile of Human Thoracic Aortic Dissection by High-Throughput Sequencing.

    Science.gov (United States)

    Sun, Jie; Chen, Guojun; Jing, Yuanwen; He, Xiang; Dong, Jianting; Zheng, Junmeng; Zou, Meisheng; Li, Hairui; Wang, Shifei; Sun, Yili; Liao, Wangjun; Liao, Yulin; Feng, Li; Bin, Jianping

    2018-01-01

    In this study, the long non-coding RNA (lncRNA) expression profile in human thoracic aortic dissection (TAD), a highly lethal cardiovascular disease, was investigated. Human TAD (n=3) and normal aortic tissues (NA) (n=3) were examined by high-throughput sequencing. Bioinformatics analyses were performed to predict the roles of aberrantly expressed lncRNAs. Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to validate the results. A total of 269 lncRNAs (159 up-regulated and 110 down-regulated) and 2, 255 mRNAs (1 294 up-regulated and 961 down-regulated) were aberrantly expressed in human TAD (fold-change> 1.5, PTAD than in NA. The predicted binding motifs of three up-regulated lncRNAs (ENSG00000248508, ENSG00000226530, and EG00000259719) were correlated with up-regulated RUNX1 (R=0.982, PTAD. These findings suggest that lncRNAs are novel potential therapeutic targets for human TAD. © 2018 The Author(s). Published by S. Karger AG, Basel.

  12. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy; Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Schembri, Mark A.; Sweet, Matthew J.

    2016-01-01

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  13. Co-transcriptomic Analysis by RNA Sequencing to Simultaneously Measure Regulated Gene Expression in Host and Bacterial Pathogen

    KAUST Repository

    Ravasi, Timothy

    2016-01-24

    Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.

  14. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  15. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Il Chung [Iowa State Univ., Ames, IA (United States)

    2011-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  16. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ilchung [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  17. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  18. Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation; Aptameros anti-(1→3)-β-D-glucana marcados com Tecnecio-99m: biodistribuicao e imageamento em modelos experimentais de infeccao e inflamacao

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Camila Maria de Sousa

    2016-07-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with {sup 32}P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with {sup 99m}Tc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A {sup 99m}Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with {sup 99m}Tc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the {sup 99m}Tc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the

  19. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    Science.gov (United States)

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific