WorldWideScience

Sample records for rna aptamer impairs

  1. Targeted inhibition of αvβ3 integrin with an RNA aptamer impairs endothelial cell growth and survival

    International Nuclear Information System (INIS)

    Mi Jing; Zhang Xiuwu; Giangrande, Paloma H.; McNamara, James O.; Nimjee, Shahid M.; Sarraf-Yazdi, Shiva; Sullenger, Bruce A.; Clary, Bryan M.

    2005-01-01

    αvβ3 integrin is a crucial factor involved in a variety of physiological processes, such as cell growth and migration, tumor invasion and metastasis, angiogenesis, and wound healing. αvβ3 integrin exerts its effect by regulating endothelial cell (EC) migration, proliferation, and survival. Inhibiting the function of αvβ3 integrin, therefore, represents a potential anti-cancer, anti-thrombotic, and anti-inflammatory strategy. In this study, we tested an RNA aptamer, Apt-αvβ3 that binds recombinant αvβ3 integrin, for its ability to bind endogenous αvβ3 integrin on the surface of cells in culture and to subsequently affect cellular response. Our data illustrate that Apt-αvβ3 binds αvβ3 integrin expressed on the surface of live HUVECs. This interaction significantly decreases both basal and PDGF-induced cell proliferation as well as inhibition of cell adhesion. Apt-αvβ3 can also reduce PDGF-stimulated tube formation and increase HUVEC apoptosis through inhibition of FAK phosphorylation pathway. Our results demonstrate that by binding to its target, Apt-αvβ3 can efficiently inhibit human EC proliferation and survival, resulting in reduced angiogenesis. It predicts that Apt-αvβ3 could become useful in both tumor imaging and the treatment of tumor growth, atherosclerosis, thrombosis, and inflammation

  2. In vitro selection of RNA aptamer specific to Salmonella typhimurium.

    Science.gov (United States)

    Han, Seung Ryul; Lee, Seong-Wook

    2013-06-28

    Salmonella is a major foodborne pathogen that causes a variety of human diseases. Development of ligands directly and specifically binding to the Salmonella will be crucial for the rapid detection of, and thus for efficient protection from, the virulent bacteria. In this study, we identified a RNA aptamer-based ligand that can specifically recognize Salmonella Typhimurium through SELEX technology. To this end, we isolated and characterized an RNase-resistant RNA aptamer that bound to the OmpC protein of Salmonella Typhimurium with high specificity and affinity (Kd ~ 20 nM). Of note, the selected aptamer was found to specifically bind to Salmonella Typhimurium, but neither to Gram-positive bacteria (Staphylococcus aureus) nor to other Gram-negative bacteria (Escherichia coli O157:H7). This was evinced by aptamer-immobilized ELISA and aptamer-linked precipitation experiments. This Salmonella species-specific aptamer could be useful as a diagnostic ligand against pathogen-caused foodborne sickness.

  3. Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.

    Science.gov (United States)

    Park, Yoojin; Nim-Anussornkul, Duangrat; Vilaivan, Tirayut; Morii, Takashi; Kim, Byeang Hyean

    2018-01-15

    We have developed RNA-based quencher-free molecular aptamer beacons (RNA-based QF-MABs) for the detection of ATP, taking advantage of the conformational changes associated with ATP binding to the ATP-binding RNA aptamer. The RNA aptamer, with its well-defined structure, was readily converted to the fluorescence sensors by incorporating a fluorophore into the loop region of the hairpin structure. These RNA-based QF-MABs exhibited fluorescence signals in the presence of ATP relative to their low background signals in the absence of ATP. The fluorescence emission intensity increased upon formation of a RNA-based QF-MAB·ATP complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition

    Directory of Open Access Journals (Sweden)

    Alexey Berezhnoy

    2012-01-01

    Full Text Available Oligonucleotide aptamer-mediated in vivo cell targeting of small interfering RNAs (siRNAs is emerging as a useful approach to enhance the efficacy and reduce the adverse effects resulting from siRNA-mediated genetic interference. A current main impediment in aptamer-mediated siRNA targeting is that the activity of the siRNA is often compromised when conjugated to an aptamer, often requiring labor intensive and time consuming design and testing of multiple configurations to identify a conjugate in which the siRNA activity has not been significantly reduced. Here, we show that the thermal stability of the siRNA is an important parameter of siRNA activity in its conjugated form, and that siRNAs with lower melting temperature (Tm are not or are minimally affected when conjugated to the 3′ end of 2′F-pyrimidine-modified aptamers. In addition, the configuration of the aptamer-siRNA conjugate retains activity comparable with the free siRNA duplex when the passenger strand is co-transcribed with the aptamer and 3′ overhangs on the passenger strand are removed. The approach described in this paper significantly reduces the time and effort necessary to screening siRNA sequences that retain biological activity upon aptamer conjugation, facilitating the process of identifying candidate aptamer-siRNA conjugates suitable for in vivo testing.

  6. Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Iwao Waga

    2010-08-01

    Full Text Available Sphingosylphosphorylcholine (SPC is a lysosphingolipid that exerts multiple functions, including acting as a spasmogen, as a mitogenic factor for various types of cells, and sometimes as an inflammatory mediator. Currently, liquid chromatography/tandem mass spectrometry (LC/MS/MS is used for the quantitation of SPC. However, because of the complicated procedures required it may not be cost effective, hampering its regular usage in a routine practical SPC monitoring. In this report, we have generated RNA aptamers that bind to SPC with high affinity using an in vitro selection procedure and developed an enzyme-linked aptamer assay system using the minimized SPC aptamer that can successfully distinguish SPC from the structurally related sphingosine 1-phosphate (S1P. This is the first case of the Systematic Evolution of Ligands by EXponential enrichment (SELEX process being performed with a lysosphingolipid. The SPC aptamers would be valuable tools for the development of aptamer-based medical diagnosis and for elucidating the biological role of SPC.

  7. Regulation of photosensitisation processes by an RNA aptamer

    Science.gov (United States)

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  8. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection

    International Nuclear Information System (INIS)

    Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H

    2012-01-01

    We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.

  9. A Capture-SELEX Strategy for Multiplexed Selection of RNA Aptamers Against Small Molecules

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Doessing, Holger B.; Long, Katherine S.

    2018-01-01

    -SELEX, a selection strategy that uses an RNA library to yield ligand-responsive RNA aptamers targeting small organic molecules in solution. To demonstrate the power of this method we selected several aptamers with specificity towards either the natural sweetener rebaudioside A or the food-coloring agent carminic...

  10. An improved radiolabelled RNA aptamer molecule for HER2 imaging in cancers.

    Science.gov (United States)

    Varmira, Kambiz; Hosseinimehr, Seyed Jalal; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2014-02-01

    Human epidermal growth factor receptor 2 (HER2) expression has been shown to be increased in several types of human tumours. In this study, for the imaging of HER2-related tumours, a modified RNA aptamer with HER2-specific targeting was labelled with (99m)Tc, by using hydrazino nicotinamide (HYNIC) as the chelator in the presence of tricine or ethylenediamine-N,N'-diacetic acid (EDDA) as the co-ligand. Stability testing of the radiolabelled aptamers in the serum was performed through SDS-PAGE. The aptamer-radionuclide conjugate was evaluated for its cellular HER2-specific binding in ovarian cancer cells (SKOV-3), and its biodistribution properties were assessed in normal and SKOV-3 tumour-bearing mice. In the presence of either tricine or EDDA, the HYNIC-RNA aptamers were labelled with (99m)Tc at a high yield and radiochemical purity. Cellular experiments confirmed the specific binding of the RNA aptamer to the HER2 receptor. In the animal biodistribution study, uptake of the EDDA-co-liganded (99m)Tc-HYNIC-RNA aptamer by the liver and spleen was remarkably lower than that of the aptamer with tricine. Tumours also showed a higher accumulation of radioactivity with the EDDA-co-liganded aptamer complex. This study demonstrated EDDA to be better than tricine for use as a co-ligand with the RNA aptamer, which can be a potential tool for the molecular imaging of HER2-overexpressing cancers.

  11. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Young Ju [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of); Lee, Seong-Wook, E-mail: SWL0208@dankook.ac.kr [Department of Molecular Biology, Institute of Nanosensor and Biotechnology, Dankook University, Yongin 448-701 (Korea, Republic of)

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Identification of RNA aptamer specific to AFP with high affinity. Black-Right-Pointing-Pointer Specific induction of HCC proliferation by AFP. Black-Right-Pointing-Pointer Efficient increase in oncogene expression by AFP. Black-Right-Pointing-Pointer Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. Black-Right-Pointing-Pointer Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K{sub D} of {approx}33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  12. Regression of hepatocarcinoma cells using RNA aptamer specific to alpha-fetoprotein

    International Nuclear Information System (INIS)

    Lee, Young Ju; Lee, Seong-Wook

    2012-01-01

    Highlights: ► Identification of RNA aptamer specific to AFP with high affinity. ► Specific induction of HCC proliferation by AFP. ► Efficient increase in oncogene expression by AFP. ► Efficient inhibition of AFP-mediated HCC proliferation by the aptamer. ► Efficient suppression of AFP-induced oncogene expression of by the aptamer. -- Abstract: Alpha-fetoprotein (AFP) is a cancer-associated fetal protein and has long been utilized as a serum fetal defect/tumor marker to monitor distress/disease progression. In addition, AFP is closely associated with the proliferation of hepatocellular carcinoma. Thus, direct targeting of AFP has been recommended for a therapeutic strategy against hepatocellular carcinoma. In this study, we developed and characterized an RNA aptamer that specifically bound to the alpha-fetoprotein using SELEX technology. The aptamer interacted with the AFP with a K D of ∼33 nM. Importantly, the identified aptamer specifically and efficiently inhibited the AFP-mediated proliferation of hepatocarcinoma cells in a dose dependent manner. Moreover, the aptamer efficiently down-regulated AFP-induced expression of oncogenes in the cells. These results indicate that an AFP-specific RNA aptamer could be a useful therapeutic and diagnostic agent against AFP-related hepatocellular carcinoma.

  13. Rapid detection of food pathogens using RNA aptamers-immobilized slide.

    Science.gov (United States)

    Maeng, Jin-Soo; Kim, Namsoo; Kim, Chong-Tai; Han, Seung Ryul; Lee, Young Ju; Lee, Seong-Wook; Lee, Myung-Hyun; Cho, Yong-Jin

    2012-07-01

    The purpose of this study was to develop a simple and rapid detection system for foodborne bacteria, which consisted of an optical microscope and its slide chip with artificial antibodies, or RNA aptamers. From an RNA pool, three each RNA aptamers were built by the method of SELEX (systematic evolution of ligands by exponential enrichment) for components of cell wall, LPS (lipopolysaccharide) from E. coli O157:H7, teichoic acid from Staphylococcus aureus and a cell membrane protein of OmpC from Salmonella typhimurium, respectively. These aptamers were hybridized with thiol-conjugated 16 dT-linker molecules in order to be immobilized on silver surface which was, in advance, fabricated on glass slide, using a spin-coating method. To confirm that each aptamers retained its specific binding activities to their antigenic live bacteria, microscopic view of bound cells immobilized on silver film were observed. Furthermore, we observed the fluorescence-emitting bacteria-aptamer complex immobilized on silver film after adding RNA aptamers hybridized with fluorophore, FAM-conjugated 16 dT-linker molecules. As a result, the RNA aptamers-immobilized slide system developed in this study was a useful new tool to rapidly monitor individual food pathogens.

  14. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  15. Structural basis of RNA folding and recognition in an AMP-RNA aptamer complex.

    Science.gov (United States)

    Jiang, F; Kumar, R A; Jones, R A; Patel, D J

    1996-07-11

    The catalytic properties of RNA and its well known role in gene expression and regulation are the consequence of its unique solution structures. Identification of the structural determinants of ligand recognition by RNA molecules is of fundamental importance for understanding the biological functions of RNA, as well as for the rational design of RNA Sequences with specific catalytic activities. Towards this latter end, Szostak et al. used in vitro selection techniques to isolate RNA sequences ('aptamers') containing a high-affinity binding site for ATP, the universal currency of cellular energy, and then used this motif to engineer ribozymes with polynucleotide kinase activity. Here we present the solution structure, as determined by multidimensional NMR spectroscopy and molecular dynamics calculations, of both uniformly and specifically 13C-, 15N-labelled 40-mer RNA containing the ATP-binding motif complexed with AMP. The aptamer adopts an L-shaped structure with two nearly orthogonal stems, each capped proximally by a G x G mismatch pair, binding the AMP ligand at their junction in a GNRA-like motif.

  16. Computational Selection of RNA Aptamer against Angiopoietin-2 and Experimental Evaluation

    Directory of Open Access Journals (Sweden)

    Wen-Pin Hu

    2015-01-01

    Full Text Available Angiogenesis plays a decisive role in the growth and spread of cancer and angiopoietin-2 (Ang2 is in the spotlight of studies for its unique role in modulating angiogenesis. The aim of this study was to introduce a computational simulation approach to screen aptamers with high binding ability for Ang2. We carried out computational simulations of aptamer-protein interactions by using ZDOCK and ZRANK functions in Discovery Studio 3.5 starting from the available information of aptamers generated through the systematic evolution of ligands by exponential enrichment (SELEX in the literature. From the best of three aptamers on the basis of ZRANK scores, 189 sequences with two-point mutations were created and simulated with Ang2. Then, we used a surface plasmon resonance (SPR biosensor to test 3 mutant sequences of high ZRANK scores along with a high and a low affinity binding sequence as reported in the literature. We found a selected RNA aptamer has a higher binding affinity and SPR response than a reported sequence with the highest affinity. This is the first study of in silico selection of aptamers against Ang2 by using the ZRANK scoring function, which should help to increase the efficiency of selecting aptamers with high target-binding ability.

  17. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites.

    Directory of Open Access Journals (Sweden)

    Daniel M Dupont

    Full Text Available Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126 with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA. We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A controlling uPA activities. One of the aptamers (upanap-126 binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12 binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site.

  18. Highly Stable Aptamers Selected from a 2′-Fully Modified fGmH RNA Library for Targeting Biomaterials

    Science.gov (United States)

    Friedman, Adam D.; Kim, Dongwook; Liu, Rihe

    2014-01-01

    When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2′ modification. This study aims to develop a novel class of highly stable, 2′-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2′-F-dG, 2′-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2′-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and further deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials. PMID:25443790

  19. Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials.

    Science.gov (United States)

    Friedman, Adam D; Kim, Dongwook; Liu, Rihe

    2015-01-01

    When developed as targeting ligands for the in vivo delivery of biomaterials to biological systems, RNA aptamers immediately face numerous obstacles, in particular nuclease degradation and post-selection 2' modification. This study aims to develop a novel class of highly stable, 2'-fully modified RNA aptamers that are ideal for the targeted delivery of biomaterials. We demonstrated the facile transcription of a fGmH (2'-F-dG, 2'-OMe-dA/dC/dU) RNA library with unexpected hydrophobicity, the direct selection of aptamers from a fGmH RNA library that bind Staphylococcus aureus Protein A (SpA) as a model target, and the superior nuclease and serum stability of these aptamers compared to 2'-partially modified RNA variants. Characterizations of fGmH RNA aptamers binding to purified SpA and to endogenous SpA present on the surface of S. aureus cells demonstrate fGmH RNA aptamer selectivity and stability. Significantly, fGmH RNA aptamers were able to functionalize, stabilize, and specifically deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus with SpA-dependent antimicrobial effects. This study describes a novel aptamer class with considerable potential to improve the in vivo applicability of nucleic acid-based affinity molecules to biomaterials.

  20. Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1

    Science.gov (United States)

    Zhou, Jiehua; Lazar, Daniel; Li, Haitang; Xia, Xin; Satheesan, Sangeetha; Charlins, Paige; O'Mealy, Denis; Akkina, Ramesh; Saayman, Sheena; Weinberg, Marc S.; Rossi, John J.; Morris, Kevin V.

    2018-01-01

    Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. Methods: We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. Results: We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates in vivo, HIV-1-infected humanized NOD/SCID/IL2 rγnull mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Principle conclusions: Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1. PMID:29556342

  1. RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine

    DEFF Research Database (Denmark)

    Farjami, Elahe; Campos, Rui; Nielsen, Jesper Sejrup

    2013-01-01

    , including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine......, norepinephrine, 3,4-dihydroxy-phenylalanine (l-DOPA), 3,4-dihydroxyphenylacetic acid (DOPAC), methyldopamine, and tyramine, which gave negligible signals under conditions of experiments (electroanalysis at 0.185 V vs Ag/AgCl). The interference from ascorbic and uric acids was eliminated by application...... as a general strategy not to restrict the conformational freedom and binding properties of surface-bound aptamers and, thus, be applicable for the development of other aptasensors...

  2. Isolation and characterization of 20'-F-RNA aptamers against whole HIV-1 subtype C envelope pseudovirus

    CSIR Research Space (South Africa)

    London, GM

    2015-01-01

    Full Text Available Aptamers, which are artificial nucleic acid ligands akin to antibodies in function, represent a new class of molecules that can prevent HIV infection. In this study, we isolated RNA aptamers against whole HV-1CAP45 enveloped pseudotyped virus...

  3. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    Directory of Open Access Journals (Sweden)

    Seyedeh Alia Moosavian

    2015-06-01

    Full Text Available Objective(s: Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2 is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX. Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy.

  4. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells.

    Science.gov (United States)

    Autour, Alexis; C Y Jeng, Sunny; D Cawte, Adam; Abdolahzadeh, Amir; Galli, Angela; Panchapakesan, Shanker S S; Rueda, David; Ryckelynck, Michael; Unrau, Peter J

    2018-02-13

    Despite having many key roles in cellular biology, directly imaging biologically important RNAs has been hindered by a lack of fluorescent tools equivalent to the fluorescent proteins available to study cellular proteins. Ideal RNA labelling systems must preserve biological function, have photophysical properties similar to existing fluorescent proteins, and be compatible with established live and fixed cell protein labelling strategies. Here, we report a microfluidics-based selection of three new high-affinity RNA Mango fluorogenic aptamers. Two of these are as bright or brighter than enhanced GFP when bound to TO1-Biotin. Furthermore, we show that the new Mangos can accurately image the subcellular localization of three small non-coding RNAs (5S, U6, and a box C/D scaRNA) in fixed and live mammalian cells. These new aptamers have many potential applications to study RNA function and dynamics both in vitro and in mammalian cells.

  5. Organic additives stabilize RNA aptamer binding of malachite green.

    Science.gov (United States)

    Zhou, Yubin; Chi, Hong; Wu, Yuanyuan; Marks, Robert S; Steele, Terry W J

    2016-11-01

    Aptamer-ligand binding has been utilized for biological applications due to its specific binding and synthetic nature. However, the applications will be limited if the binding or the ligand is unstable. Malachite green aptamer (MGA) and its labile ligand malachite green (MG) were found to have increasing apparent dissociation constants (Kd) as determined through the first order rate loss of emission intensity of the MGA-MG fluorescent complex. The fluorescent intensity loss was hypothesized to be from the hydrolysis of MG into malachite green carbinol base (MGOH). Random screening organic additives were found to reduce or retain the fluorescence emission and the calculated apparent Kd of MGA-MG binding. The protective effect became more apparent as the percentage of organic additives increased up to 10% v/v. The mechanism behind the organic additive protective effects was primarily from a ~5X increase in first order rate kinetics of MGOH→MG (kMGOH→MG), which significantly changed the equilibrium constant (Keq), favoring the generation of MG, versus MGOH without organic additives. A simple way has been developed to stabilize the apparent Kd of MGA-MG binding over 24h, which may be beneficial in stabilizing other triphenylmethane or carbocation ligand-aptamer interactions that are susceptible to SN1 hydrolysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Assignment methodology for larger RNA oligonucleotides: Application to an ATP-binding RNA aptamer

    International Nuclear Information System (INIS)

    Dieckmann, Thorsten; Feigon, Juli

    1997-01-01

    The use of uniform 13C, 15N labeling in the NMR spectroscopic study of RNA structures has greatly facilitated the assignment process in small RNA oligonucleotides. For ribose spinsystem assignments, exploitation of these labels has followed previously developed methods for the study of proteins. However, for sequential assignment of the exchangeable and nonexchangeable protons of the nucleotides, it has been necessary to develop a variety of new NMR experiments. Even these are of limited utility in the unambiguous assignment of larger RNAs due to the short carbon relaxation times and extensive spectral overlap for all nuclei.These problems can largely be overcome by the additional use of base-type selectively 13C, 15N-labeled RNA in combination with a judicious use of related RNAs with base substitutions. We report the application of this approach to a 36-nucleotide ATP-binding RNA aptamer in complex with AMP. Complete sequential 1H assignments, as well as the majority of 13C and 15N assignments, were obtained

  7. [Effects of Aptamer-siRNA Nucleic Acid Compound on Growth and Apoptosis in Myeloid Leukemia Cell Line K562].

    Science.gov (United States)

    Ping, Juan; Shen, Zhi-Hui; Wang, Bao-Quan; Zhao, Na; Li, Rui; Li, Mian; Pang, Xiao-Bin; Chen, Chuan-Bo

    2015-04-01

    To explore the effects of aptamer-siRNA nucleic acid compound on growth and apoptosis in myeloid leukemia cell line K562. the changes of cellular morphology and structure were observed by using fluorescence microscope, laser confocal microscope, JEM-4000EX transmission electron microscopy; MTT assay were performed to evaluate the sensibility of K562 cells to aptamer-siRNA compound, the apoptosis was detected by DNA gel electro-phoresis. The remarkably changes of morphology and structure of K562 cells treated with 200 µmol/L aptamer-siRNA were observed under fluorescence microscopy and electromicroscopy. As compared with control, the aptamer-siRNA compound showed more inhibitory effect on K562 cells and there was significant difference (Pcompound for K562 cells was 150 µmol/L. According to agarose gel electrophoresis observation, when the aptamer-siRNA compound showed effect on K562 cells, the typical DNA lader could be observed. The aptamer-siRNA compound can significantly induce K562 cell apoptosis, and provide reference for gene therapy of patients with chronic myelocytic lenkemia.

  8. A SELEX-screened aptamer of human hepatitis B virus RNA encapsidation signal suppresses viral replication.

    Directory of Open Access Journals (Sweden)

    Hui Feng

    Full Text Available BACKGROUND: The specific interaction between hepatitis B virus (HBV polymerase (P protein and the ε RNA stem-loop on pregenomic (pg RNA is crucial for viral replication. It triggers both pgRNA packaging and reverse transcription and thus represents an attractive antiviral target. RNA decoys mimicking ε in P protein binding but not supporting replication might represent novel HBV inhibitors. However, because generation of recombinant enzymatically active HBV polymerase is notoriously difficult, such decoys have as yet not been identified. METHODOLOGY/PRINCIPAL FINDINGS: Here we used a SELEX approach, based on a new in vitro reconstitution system exploiting a recombinant truncated HBV P protein (miniP, to identify potential ε decoys in two large ε RNA pools with randomized upper stem. Selection of strongly P protein binding RNAs correlated with an unexpected strong enrichment of A residues. Two aptamers, S6 and S9, displayed particularly high affinity and specificity for miniP in vitro, yet did not support viral replication when part of a complete HBV genome. Introducing S9 RNA into transiently HBV producing HepG2 cells strongly suppressed pgRNA packaging and DNA synthesis, indicating the S9 RNA can indeed act as an ε decoy that competitively inhibits P protein binding to the authentic ε signal on pgRNA. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the first successful identification of human HBV ε aptamers by an in vitro SELEX approach. Effective suppression of HBV replication by the S9 aptamer provides proof-of-principle for the ability of ε decoy RNAs to interfere with viral P-ε complex formation and suggests that S9-like RNAs may further be developed into useful therapeutics against chronic hepatitis B.

  9. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    John C. Leach

    2016-03-01

    Full Text Available The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA, was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells.

  10. RNA aptamer probes as optical imaging agents for the detection of amyloid plaques.

    Directory of Open Access Journals (Sweden)

    Christian T Farrar

    Full Text Available Optical imaging using multiphoton microscopy and whole body near infrared imaging has become a routine part of biomedical research. However, optical imaging methods rely on the availability of either small molecule reporters or genetically encoded fluorescent proteins, which are challenging and time consuming to develop. While directly labeled antibodies can also be used as imaging agents, antibodies are species specific, can typically not be tagged with multiple fluorescent reporters without interfering with target binding, and are bioactive, almost always eliciting a biological response and thereby influencing the process that is being studied. We examined the possibility of developing highly specific and sensitive optical imaging agents using aptamer technology. We developed a fluorescently tagged anti-Aβ RNA aptamer, β55, which binds amyloid plaques in both ex vivo human Alzheimer's disease brain tissue and in vivo APP/PS1 transgenic mice. Diffuse β55 positive halos, attributed to oligomeric Aβ, were observed surrounding the methoxy-XO4 positive plaque cores. Dot blots of synthetic Aβ aggregates provide further evidence that β55 binds both fibrillar and non-fibrillar Aβ. The high binding affinity, the ease of probe development, and the ability to incorporate multiple and multimodal imaging reporters suggest that RNA aptamers may have complementary and perhaps advantageous properties compared to conventional optical imaging probes and reporters.

  11. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  12. Solution structure of a DNA mimicking motif of an RNA aptamer against transcription factor AML1 Runt domain.

    Science.gov (United States)

    Nomura, Yusuke; Tanaka, Yoichiro; Fukunaga, Jun-ichi; Fujiwara, Kazuya; Chiba, Manabu; Iibuchi, Hiroaki; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Kozu, Tomoko; Sakamoto, Taiichi

    2013-12-01

    AML1/RUNX1 is an essential transcription factor involved in the differentiation of hematopoietic cells. AML1 binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. In a previous study, we obtained RNA aptamers against the AML1 Runt domain by systematic evolution of ligands by exponential enrichment and revealed that RNA aptamers exhibit higher affinity for the Runt domain than that for RDE and possess the 5'-GCGMGNN-3' and 5'-N'N'CCAC-3' conserved motif (M: A or C; N and N' form Watson-Crick base pairs) that is important for Runt domain binding. In this study, to understand the structural basis of recognition of the Runt domain by the aptamer motif, the solution structure of a 22-mer RNA was determined using nuclear magnetic resonance. The motif contains the AH(+)-C mismatch and base triple and adopts an unusual backbone structure. Structural analysis of the aptamer motif indicated that the aptamer binds to the Runt domain by mimicking the RDE sequence and structure. Our data should enhance the understanding of the structural basis of DNA mimicry by RNA molecules.

  13. Thermodynamics of Ligand Binding to a Heterogeneous RNA Population in the Malachite Green Aptamer

    Science.gov (United States)

    Sokoloski, Joshua E.; Dombrowski, Sarah E.; Bevilacqua, Philip C.

    2011-01-01

    The malachite green aptamer binds two closely related ligands, malachite green (MG) and tetramethylrosamine (TMR), with near equal affinity. The MG ligand consists of three phenyl rings emanating from a central carbon, while TMR has two of the three rings connected by an ether linkage. The binding pockets for MG and TMR in the aptamer, known from high-resolution structure, differ only in the conformation of a few nucleotides. Herein, we applied isothermal titration calorimetry (ITC) to compare the thermodynamics for binding of MG and TMR to the aptamer. Binding heat capacities were obtained from ITC titrations over the temperature range of 15 to 60 °C. Two temperature regimes were found for MG binding: one from 15 to 45 °C where MG bound with a large negative heat capacity and an apparent stoichiometry (n) of ~0.4, and another from 50 to 60 °C where MG bound with positive heat capacity and n~1.1. The binding of TMR, on the other hand, revealed only one temperature regime for binding, with a more modest negative heat capacity and n~1.2. The large difference in heat capacity between the two ligands suggests that significantly more conformational rearrangement occurs upon the binding of MG than TMR, which is consistent with differences in solvent accessible surface area calculated for available ligand-bound structures. Lastly, we note that binding stoichiometry of MG was improved not only by raising the temperature, but also by lowering the concentration of Mg2+ or increasing the time between ITC injections. These studies suggest that binding of a dynamical ligand to a functional RNA requires the RNA itself to have significant dynamics. PMID:22192051

  14. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites

    DEFF Research Database (Denmark)

    Dupont, Daniel Miotto; Thuesen, Cathrine K; Bøtkjær, Kenneth A

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless...

  15. A Universal Aptamer Chimera for the Delivery of Functional microRNA-126.

    Science.gov (United States)

    Rohde, Jan-H; Weigand, Julia E; Suess, Beatrix; Dimmeler, Stefanie

    2015-06-01

    microRNAs (miRs) regulate vascular diseases such as atherosclerosis and cancer. miR-126 is important for endothelial cell signaling and promotes angiogenesis, protects against atherosclerosis, and reduces breast cancer cell growth and metastasis. The overexpression of miR-126, therefore, may be an attractive therapeutic strategy for the treatment of cardiovascular disease or cancer. Here we report a novel strategy to deliver miR-126 to endothelial and breast cancer cells. We tested three different strategies to deliver miR-126 by linking the miR to an aptamer for the ubiquitously expressed transferrin receptor (transferrin receptor aptamer, TRA). Linking the precursor of miR-126 (pre-miR-126) to the TRA by annealing of a complementary stick led to efficient uptake and processing of miR-126, resulting in the delivery of 1.6×10(6)±0.3×10(6) copies miR-126-3p per ng RNA in human endothelial cells and 7.4×10(5)±2×10(5) copies miR-126-3p per ng in MCF7 breast cancer cells. The functionality of the active TRA-miR-126 chimera was further demonstrated by showing that the chimera represses the known miR-126 target VCAM-1 and improved endothelial cell sprouting in a spheroid assay. Moreover, the TRA-miR-126 chimera reduced proliferation and paracrine endothelial cell recruitment of breast cancer cells to a similar extent as miR-126-3p mimics introduced by conventional liposome-based transfection. Together, this data demonstrates that pre-miR-126 can be delivered by a non-specific aptamer to exert biological functions in two different cell models. The use of the TRA-miR-126 chimera or the combination of the delivery strategy with other endothelial or tumor specific aptamers may provide an interesting therapeutic option to treat vascular disease or cancers.

  16. In vivo SELEX for Identification of Brain-penetrating Aptamers

    Directory of Open Access Journals (Sweden)

    Congsheng Cheng

    2013-01-01

    Full Text Available The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain.

  17. An RNA aptamer specific to Hsp70-ATP conformation inhibits its ATPase activity independent of Hsp40.

    Science.gov (United States)

    Thirunavukarasu, Deepak; Shi, Hua

    2015-04-01

    The highly conserved and ubiquitous molecular chaperone heat shock protein 70 (Hsp70) plays a critical role in protein homeostasis (proteostasis). Controlled by its ATPase activity, Hsp70 cycles between two conformations, Hsp70-ATP and Hsp70-ADP, to bind and release its substrate. Chemical tools with distinct modes of action, especially those capable of modulating the ATPase activity of Hsp70, are being actively sought after in the mechanistic dissection of this system. Here, we report a conformation-specific RNA aptamer that binds only to Hsp70-ATP but not to Hsp70-ADP. We have refined this aptamer and demonstrated its inhibitory effect on Hsp70's ATPase activity. We have also shown that this inhibitory effect on Hsp70 is independent of its interaction with the Hsp40 co-chaperone. As Hsp70 is increasingly being recognized as a drug target in a number of age related diseases such as neurodegenerative, protein misfolding diseases and cancer, this aptamer is potentially useful in therapeutic applications. Moreover, this work also demonstrates the feasibility of using aptamers to target ATPase activity as a general therapeutic strategy.

  18. Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL

    Directory of Open Access Journals (Sweden)

    Margherita Iaboni

    2016-01-01

    Full Text Available TNF-related apoptosis-inducing ligand (TRAIL is a promising antitumor agent for its remarkable ability to selectively induce apoptosis in cancer cells, without affecting the viability of healthy bystander cells. The TRAIL tumor suppressor pathway is deregulated in many human malignancies including lung cancer. In human non-small cell lung cancer (NSCLC cells, sensitization to TRAIL therapy can be restored by increasing the expression levels of the tumor suppressor microRNA-212 (miR-212 leading to inhibition of the anti-apoptotic protein PED/PEA-15 implicated in treatment resistance. In this study, we exploited a previously described RNA aptamer inhibitor of the tyrosine kinase receptor Axl (GL21.T expressed on lung cancer cells, as a means to deliver miR-212 into human NSCLC cells expressing Axl. We demonstrate efficient delivery of miR-212 following conjugation of the miR to GL21.T (GL21.T-miR212 chimera. We show that the chimera downregulates PED and restores TRAIL-mediate cytotoxicity in cancer cells. Importantly, treatment of Axl+ lung cancer cells with the chimera resulted in (i an increase in caspase activation and (ii a reduction of cell viability in combination with TRAIL therapy. In conclusion, we demonstrate that the GL21.T-miR212 chimera can be employed as an adjuvant to TRAIL therapy for the treatment of lung cancer.

  19. Inhibition of HIV transmission in human cervicovaginal explants and humanized mice using CD4 aptamer-siRNA chimeras

    Science.gov (United States)

    Wheeler, Lee Adam; Trifonova, Radiana; Vrbanac, Vladimir; Basar, Emre; McKernan, Shannon; Xu, Zhan; Seung, Edward; Deruaz, Maud; Dudek, Tim; Einarsson, Jon Ivar; Yang, Linda; Allen, Todd M.; Luster, Andrew D.; Tager, Andrew M.; Dykxhoorn, Derek M.; Lieberman, Judy

    2011-01-01

    The continued spread of the HIV epidemic underscores the need to interrupt transmission. One attractive strategy is a topical vaginal microbicide. Sexual transmission of herpes simplex virus type 2 (HSV-2) in mice can be inhibited by intravaginal siRNA application. To overcome the challenges of knocking down gene expression in immune cells susceptible to HIV infection, we used chimeric RNAs composed of an aptamer fused to an siRNA for targeted gene knockdown in cells bearing an aptamer-binding receptor. Here, we showed that CD4 aptamer-siRNA chimeras (CD4-AsiCs) specifically suppress gene expression in CD4+ T cells and macrophages in vitro, in polarized cervicovaginal tissue explants, and in the female genital tract of humanized mice. CD4-AsiCs do not activate lymphocytes or stimulate innate immunity. CD4-AsiCs that knock down HIV genes and/or CCR5 inhibited HIV infection in vitro and in tissue explants. When applied intravaginally to humanized mice, CD4-AsiCs protected against HIV vaginal transmission. Thus, CD4-AsiCs could be used as the active ingredient of a microbicide to prevent HIV sexual transmission. PMID:21576818

  20. Selection of RNA Aptamers Against Botulinum Neurotoxin Type A Light Chain Through a Non-Radioactive Approach.

    Science.gov (United States)

    Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Cai, Shuowei

    2016-09-01

    Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive-based systematic evolution of ligands by exponential enrichment (SELEX) process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nanomolar range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting that they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that the 2'-fluorine-pyrimidine-modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for SELEX, by using regular nucleotide during SELEX, and 2'-fluorine-pyrimidine-modified nucleotide for final application to enhance their RNase-resistance.

  1. Crystallization and preliminary X-ray diffraction studies of an RNA aptamer in complex with the human IgG Fc fragment

    International Nuclear Information System (INIS)

    Sugiyama, Shigeru; Nomura, Yusuke; Sakamoto, Taiichi; Kitatani, Tomoya; Kobayashi, Asako; Miyakawa, Shin; Takahashi, Yoshinori; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Nakamura, Yoshikazu; Matsumura, Hiroyoshi

    2008-01-01

    An RNA aptamer in complex with the human IgG Fc fragment have been crystallized. The stirring technique with a rotary shaker was used to improve the crystals and to ensure that they were of high quality and single, resulting in crystals that diffracted to 2.2 Å resolution. Aptamers, which are folded DNA or RNA molecules, bind to target molecules with high affinity and specificity. An RNA aptamer specific for the Fc fragment of human immunoglobulin G (IgG) has recently been identified and it has been demonstrated that an optimized 24-nucleotide RNA aptamer binds to the Fc fragment of human IgG and not to other species. In order to clarify the structural basis of the high specificity of the RNA aptamer, it was crystallized in complex with the Fc fragment of human IgG1. Preliminary X-ray diffraction studies revealed that the crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 83.7, b = 107.2, c = 79.0 Å. A data set has been collected to 2.2 Å resolution

  2. Nanomechanical microcantilever operated in vibration modes with use of RNA aptamer as receptor molecules for label-free detection of HCV helicase.

    Science.gov (United States)

    Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song

    2007-11-30

    We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.

  3. An Aptamer Bio-barCode (ABC) assay using SPR, RNase H, and probes with RNA and gold-nanorods for anti-cancer drug screening.

    Science.gov (United States)

    Loo, Jacky Fong-Chuen; Yang, Chengbin; Tsang, Hing Lun; Lau, Pui Man; Yong, Ken-Tye; Ho, Ho Pui; Kong, Siu Kai

    2017-10-07

    With modifications to an ultra-sensitive bio-barcode (BBC) assay, we have developed a next generation aptamer-based bio-barcode (ABC) assay to detect cytochrome-c (Cyto-c), a cell death marker released from cancer cells, for anti-cancer drug screening. An aptamer is a short single-stranded DNA selected from a synthetic DNA library that is capable of binding to its target with high affinity and specificity based on its unique DNA sequence and 3D structure after folding. Similar to the BBC assay, Cyto-c is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Ab) and an aptamer specifically against Cyto-c to form sandwich structures ([MMP-Ab]-[Cyto-c]-[Aptamer]). After washing and melting, our aptamers, acting as a DNA bio-barcode, are released from the sandwiches and hybridized with the probes specially designed for RNase H for surface plasmon resonance (SPR) sensing. In an aptamer-probe duplex, RNase H digests the RNA in the probe and releases the intact aptamer for another round of hybridization and digestion. With signal enhancement effects from gold-nanorods (Au-NRs) on probes for SPR sensing, the detection limit was found to be 1 nM for the aptamer and 80 pM for Cyto-c. Without the time-consuming DNA amplification steps by PCR, the detection process of this new ABC assay can be completed within three hours. As a proof-of-concept, phenylarsine oxide was found to be a potent agent to kill liver cancer cells with multi-drug resistance at the nano-molar level. This approach thus provides a fast, sensitive and robust tool for anti-cancer drug screening.

  4. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state.

    Directory of Open Access Journals (Sweden)

    Becka M Warfield

    Full Text Available RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are

  5. RNA aptamers targeted for human αA-crystallin do not bind αB-crystallin, and spare the α-crystallin domain.

    Science.gov (United States)

    Mallik, Prabhat K; Shi, Hua; Pande, Jayanti

    2017-09-16

    The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

    International Nuclear Information System (INIS)

    Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

    2006-01-01

    Locked nucleic acid (LNA) nucleotides are RNA analogues with a useful additional conformational constraint; the current investigation will provide the first crystallographic view of an all-LNA duplex. The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°

  7. Tissue-type plasminogen activator-binding RNA aptamers inhibiting low-density lipoprotein receptor family-mediated internalisation.

    Science.gov (United States)

    Bjerregaard, Nils; Bøtkjær, Kenneth A; Helsen, Nicky; Andreasen, Peter A; Dupont, Daniel M

    2015-07-01

    Recombinant tissue-type plasminogen activator (tPA, trade name Alteplase), currently the only drug approved by the US Food and Drug Administration and the European Medicines Agency for the treatment of cerebral ischaemic stroke, has been implicated in a number of adverse effects reportedly mediated by interactions with the low-density lipoprotein (LDL) family receptors, including neuronal cell death and an increased risk of cerebral haemorrhage. The tissue-type plasminogen activator is the principal initiator of thrombolysis in human physiology, an effect that is mediated directly via localised activation of the plasmin zymogen plasminogen at the surface of fibrin clots in the vascular lumen. Here, we sought to identify a ligand to tPA capable of inhibiting the relevant LDL family receptors without interfering with the fibrinolytic activity of tPA. Systematic evolution of ligands by exponential enrichment (SELEX) was employed to isolate tPA-binding RNA aptamers, which were characterised in biochemical assays of tPA association to low density lipoprotein receptor-related protein-1 (LRP-1, an LDL receptor family member); tPA-mediated in vitro and ex vivo clot lysis; and tPA-mediated plasminogen activation in the absence and presence of a stimulating soluble fibrin fragment. Two aptamers, K18 and K32, had minimal effects on clot lysis, but were able to efficiently inhibit tPA-LRP-1 association and LDL receptor family-mediated endocytosis in human vascular endothelial cells and astrocytes. These observations suggest that coadministration alongside tPA may be a viable strategy to improve the safety of thrombolytic treatment of cerebral ischaemic stroke by restricting tPA activity to the vascular lumen.

  8. Use of a Fluorescent Aptamer RNA as an Exonic Sequence to Analyze Self-Splicing Ability of a Group I Intron from Structured RNAs

    Directory of Open Access Journals (Sweden)

    Airi Furukawa

    2016-11-01

    Full Text Available Group I self-splicing intron constitutes an important class of functional RNA molecules that can promote chemical transformation. Although the fundamental mechanism of the auto-excision from its precursor RNA has been established, convenient assay systems for its splicing activity are still useful for a further understanding of its detailed mechanism and of its application. Because some host RNA sequences, to which group I introns inserted form stable three-dimensional (3D structures, the effects of the 3D structures of exonic elements on the splicing efficiency of group I introns are important but not a fully investigated issue. We developed an assay system for group I intron self-splicing by employing a fluorescent aptamer RNA (spinach RNA as a model exonic sequence inserted by the Tetrahymena group I intron. We investigated self-splicing of the intron from spinach RNA, serving as a model exonic sequence with a 3D structure.

  9. The Subcellular Localisation of the Human Papillomavirus (HPV 16 E7 Protein in Cervical Cancer Cells and Its Perturbation by RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Özlem Cesur

    2015-06-01

    Full Text Available Human papillomavirus (HPV is the most common viral infection of the reproductive tract, affecting both men and women. High-risk oncogenic types are responsible for almost 90% of anogenital and oropharyngeal cancers including cervical cancer. Some of the HPV “early” genes, particularly E6 and E7, are known to act as oncogenes that promote tumour growth and malignant transformation. Most notably, HPV-16 E7 interacts with the tumour suppressor protein pRb, promoting its degradation, leading to cell cycle dysregulation in infected cells. We have previously shown that an RNA aptamer (termed A2 selectively binds to HPV16 E7 and is able to induce apoptosis in HPV16-transformed cervical carcinoma cell lines (SiHa through reduction of E7 levels. In this study, we investigated the effects of the A2 aptamer on E7 localisation in order to define its effects on E7 activity. We demonstrate for the first time that E7 localised to the plasma membrane. In addition, we show that A2 enhanced E7 localisation in the ER and that the A2-mediated reduction of E7 was not associated with proteasomal degradation. These data suggest that A2 perturbs normal E7 trafficking through promoting E7 ER retention.

  10. Construction of an Aptamer-SiRNA Chimera-Modified Tissue-Engineered Blood Vessel for Cell-Type-Specific Capture and Delivery.

    Science.gov (United States)

    Chen, Wen; Zeng, Wen; Sun, Jiansen; Yang, Mingcan; Li, Li; Zhou, Jingting; Wu, Yangxiao; Sun, Jun; Liu, Ge; Tang, Rui; Tan, Ju; Zhu, Chuhong

    2015-06-23

    The application of tissue-engineered blood vessels (TEBVs) is the main developmental direction of vascular replacement therapy. Due to few and/or dysfunctional endothelial progenitor cells (EPCs), it is difficult to successfully construct EPC capture TEBVs in diabetes. RNA has a potential application in cell protection and diabetes treatment, but poor specificity and low efficiency of RNA transfection in vivo limit the application of RNA. On the basis of an acellular vascular matrix, we propose an aptamer-siRNA chimera-modified TEBV that can maintain a satisfactory patency in diabetes. This TEBV consists of two parts, CD133-adenosine kinase (ADK) chimeras and a TEBV scaffold. Our results showed that CD133-ADK chimeras could selectively capture the CD133-positive cells in vivo, and then captured cells can internalize the bound chimeras to achieve RNA self-transfection. Subsequently, CD133-ADK chimeras were cut into ADK siRNA by a dicer, resulting in depletion of ADK. An ADK-deficient cell may act as a bioreactor that sustainably releases adenosine. To reduce nonspecific RNA transfection, we increased the proportion of HAuCl4 during the material preparation, through which the transfection capacity of polyethylenimine (PEI)/polyethylene glycol (PEG)-capped gold nanoparticles (PEI/PEG-AuNPs) was significantly decreased and the ability of TEBV to resist tensile and liquid shear stress was greatly enhanced. PEG and 2'-O-methyl modification was used to enhance the in vivo stability of RNA chimeras. At day 30 postgrafting, the patency rate of CD133-ADK chimera-modified TEBVs reached 90% in diabetic rats and good endothelialization was observed.

  11. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hongguang Sun

    2014-01-01

    Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

  12. Using Aptamers for Cancer Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Yun Min Chang

    2013-01-01

    Full Text Available Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment SELEX and cell-based SELEX (cell-SELEX. Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics.

  13. DNA-Aptamers Binding Aminoglycoside Antibiotics

    Directory of Open Access Journals (Sweden)

    Nadia Nikolaus

    2014-02-01

    Full Text Available Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  14. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    DEFF Research Database (Denmark)

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...

  15. Recent Advances in Aptamers Targeting Immune System.

    Science.gov (United States)

    Hu, Piao-Ping

    2017-02-01

    The immune system plays important role in protecting the organism by recognizing non-self molecules from pathogen such as bacteria, parasitic worms, and viruses. When the balance of the host defense system is disturbed, immunodeficiency, autoimmunity, and inflammation occur. Nucleic acid aptamers are short single-stranded DNA (ssDNA) or RNA ligands that interact with complementary molecules with high specificity and affinity. Aptamers that target the molecules involved in immune system to modulate their function have great potential to be explored as new diagnostic and therapeutic agents for immune disorders. This review summarizes recent advances in the development of aptamers targeting immune system. The selection of aptamers with superior chemical and biological characteristics will facilitate their application in the diagnosis and treatment of immune disorders.

  16. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

    International Nuclear Information System (INIS)

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-01-01

    The RNA-binding protein Hfq from B. subtilis was crystallized using the hanging-drop vapour-diffusion method in two crystal forms that belonged to space groups I422 and F222; diffraction data were collected to 2.2 Å resolution from both forms. The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis

  17. Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

    Science.gov (United States)

    Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

    2010-05-01

    The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

  18. Recent Progress in Aptamer-Based Functional Probes for Bioanalysis and Biomedicine.

    Science.gov (United States)

    Zhang, Huimin; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong

    2016-07-11

    Nucleic acid aptamers are short synthetic DNA or RNA sequences that can bind to a wide range of targets with high affinity and specificity. In recent years, aptamers have attracted increasing research interest due to their unique features of high binding affinity and specificity, small size, excellent chemical stability, easy chemical synthesis, facile modification, and minimal immunogenicity. These properties make aptamers ideal recognition ligands for bioanalysis, disease diagnosis, and cancer therapy. This review highlights the recent progress in aptamer selection and the latest applications of aptamer-based functional probes in the fields of bioanalysis and biomedicine. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    International Nuclear Information System (INIS)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-01-01

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

  20. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  1. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  2. Computational Methods for Modeling Aptamers and Designing Riboswitches

    Directory of Open Access Journals (Sweden)

    Sha Gong

    2017-11-01

    Full Text Available Riboswitches, which are located within certain noncoding RNA region perform functions as genetic “switches”, regulating when and where genes are expressed in response to certain ligands. Understanding the numerous functions of riboswitches requires computation models to predict structures and structural changes of the aptamer domains. Although aptamers often form a complex structure, computational approaches, such as RNAComposer and Rosetta, have already been applied to model the tertiary (three-dimensional (3D structure for several aptamers. As structural changes in aptamers must be achieved within the certain time window for effective regulation, kinetics is another key point for understanding aptamer function in riboswitch-mediated gene regulation. The coarse-grained self-organized polymer (SOP model using Langevin dynamics simulation has been successfully developed to investigate folding kinetics of aptamers, while their co-transcriptional folding kinetics can be modeled by the helix-based computational method and BarMap approach. Based on the known aptamers, the web server Riboswitch Calculator and other theoretical methods provide a new tool to design synthetic riboswitches. This review will represent an overview of these computational methods for modeling structure and kinetics of riboswitch aptamers and for designing riboswitches.

  3. Aptamer and its applications in neurodegenerative diseases.

    Science.gov (United States)

    Qu, Jing; Yu, Shuqing; Zheng, Yuan; Zheng, Yan; Yang, Hui; Zhang, Jianliang

    2017-02-01

    Aptamers are small single-stranded DNA or RNA oligonucleotide fragments or small peptides, which can bind to targets by high affinity and specificity. Because aptamers are specific, non-immunogenic and non-toxic, they are ideal materials for clinical applications. Neurodegenerative disorders are ravaging the lives of patients. Even though the mechanism of these diseases is still elusive, they are mainly characterized by the accumulation of misfolded proteins in the central nervous system. So it is essential to develop potential measures to slow down or prevent the onset of these diseases. With the advancements of the technologies, aptamers have opened up new areas in this research field. Aptamers could bind with these related target proteins to interrupt their accumulation, subsequently blocking or preventing the process of neurodegenerative diseases. This review presents recent advances in the aptamer generation and its merits and limitations, with emphasis on its applications in neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, transmissible spongiform encephalopathy, Huntington's disease and multiple sclerosis.

  4. The use of oligonucleotide aptamers in cancer therapy

    Directory of Open Access Journals (Sweden)

    Adrian Odrzywolski

    2016-05-01

    Full Text Available Aptamers are a new class of molecules which originated in the 1990s. They are usually RNA or DNA oligonucleotides, the length of which ranges between 20 and 80 nt. They are produced using the SELEX method that allows one to obtain aptamers that bind to virtually any molecule of interest, providing a high specificity. Aptamers are an alternative to antibodies because on the one hand, their sensitivity is at a similar or sometimes even higher level, while on the other hand they do not show immunogenicity, and may be synthesized in vitro. To date, a broad range of different applications of aptamers has been described: as components of biosensors, or use in various laboratory techniques, such as microarrays or chromatography. One of the most important is the use of aptamers in medicine, especially in the fight against cancer. They can be used both for diagnosis and for the eradication of cancers – particularly through the delivery of drugs. Currently, most transport-related research is devoted to the delivery of chemotherapeutic drugs, such as doxorubicin. This was used in research on liver cancer cells, prostate, and acute lymphoblastic leukemia blast cells. Another possibility is to use aptamers to deliver siRNAs. In this way inhibition of the quality control process of the mRNA in tumor cells is possible. An aptamer complex with the drug allows for direct delivery of the active substance in a particular cell type, substantially eliminating the non-specific effect of the drug.

  5. CELL-SELEX: Novel Perspectives of Aptamer-Based Therapeutics

    Directory of Open Access Journals (Sweden)

    Hans P. Wendel

    2008-04-01

    Full Text Available Aptamers, single stranded DNA or RNA molecules, generated by a method called SELEX (systematic evolution of ligands by exponential enrichment have been widely used in various biomedical applications. The newly developed Cell-SELEX (cell based-SELEX targeting whole living cells has raised great expectations for cancer biology, -therapy and regenerative medicine. Combining nanobiotechnology with aptamers, this technology opens the way to more sophisticated applications in molecular diagnosis. This paper gives a review of recent developments in SELEX technologies and new applications of aptamers.

  6. In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R., E-mail: crisrcorrea@gmail.com, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de Ciencias Biologicas. Dept. de Imunologia e Bioquimica

    2013-07-01

    Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were {sup 32}P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)

  7. In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis

    International Nuclear Information System (INIS)

    Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R.; Goes, A.M.

    2013-01-01

    Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were 32 P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)

  8. Aptamer selection and applications for breast cancer diagnostics and therapy

    Directory of Open Access Journals (Sweden)

    Mei Liu

    2017-11-01

    Full Text Available Abstract Aptamers are short non-coding, single-stranded oligonucleotides (RNA or DNA developed through Systematic Evolution of Ligands by Exponential enrichment (SELEX in vitro. Similar to antibodies, aptamers can bind to specific targets with high affinity, and are considered promising therapeutic agents as they have several advantages over antibodies, including high specificity, stability, and non-immunogenicity. Furthermore, aptamers can be produced at a low cost and easily modified, and are, therefore, called “chemical antibodies”. In the past years, a variety of aptamers specifically bound to both breast cancer biomarkers and cells had been selected. Besides, taking advantage of nanomaterials, there were a number of aptamer-nanomaterial conjugates been developed and widely investigated for diagnostics and targeted therapy of breast cancer. In this short review, we first present a systematical review of various aptamer selection methods. Then, various aptamer-based diagnostic and therapeutic strategies of breast cancer were provided. Finally, the current problems, challenges, and future perspectives in the field were thoroughly discussed.

  9. Aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.

    Science.gov (United States)

    Reinemann, Christine; Strehlitz, Beate

    2014-01-06

    Aptamers are single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) oligonucleotides, which are able to bind their target with high selectivity and affinity. Owing to their multiple talents, aptamers combined with nanoparticles are nanosystems well qualified for the development of new biomedical devices for analytical, imaging, drug delivery and many other medical applications. Because of their target affinity, aptamers can direct the transport of aptamer-nanoparticle conjugates. The binding of the aptamers to the target "anchors" the nanoparticle-aptamer conjugates at their site of action. In this way, nanoparticle-based bioimaging and smart drug delivery are enabled, especially by use of systematically developed aptamers for cancer-associated biomarkers. This review article gives a brief overview of recent relevant research into aptamers and trends in their use in cancer diagnostics and therapy. A concise description of aptamers, their development and functionalities relating to nanoparticle modification is given. The main part of the article is dedicated to current developments of aptamer-modified nanoparticles and their use in cancer diagnostics and treatment.

  10. Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2011-06-01

    Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

  11. Aggregation of ALS-linked FUS mutant sequesters RNA binding proteins and impairs RNA granules formation

    Energy Technology Data Exchange (ETDEWEB)

    Takanashi, Keisuke; Yamaguchi, Atsushi, E-mail: atsyama@restaff.chiba-u.jp

    2014-09-26

    Highlights: • Aggregation of ALS-linked FUS mutant sequesters ALS-associated RNA-binding proteins (FUS wt, hnRNP A1, and hnRNP A2). • Aggregation of ALS-linked FUS mutant sequesters SMN1 in the detergent-insoluble fraction. • Aggregation of ALS-linked FUS mutant reduced the number of speckles in the nucleus. • Overproduced ALS-linked FUS mutant reduced the number of processing-bodies (PBs). - Abstract: Protein aggregate/inclusion is one of hallmarks for neurodegenerative disorders including amyotrophic lateral sclerosis (ALS). FUS/TLS, one of causative genes for familial ALS, encodes a multifunctional DNA/RNA binding protein predominantly localized in the nucleus. C-terminal mutations in FUS/TLS cause the retention and the inclusion of FUS/TLS mutants in the cytoplasm. In the present study, we examined the effects of ALS-linked FUS mutants on ALS-associated RNA binding proteins and RNA granules. FUS C-terminal mutants were diffusely mislocalized in the cytoplasm as small granules in transiently transfected SH-SY5Y cells, whereas large aggregates were spontaneously formed in ∼10% of those cells. hnRNP A1, hnRNP A2, and SMN1 as well as FUS wild type were assembled into stress granules under stress conditions, and these were also recruited to FUS mutant-derived spontaneous aggregates in the cytoplasm. These aggregates stalled poly(A) mRNAs and sequestered SMN1 in the detergent insoluble fraction, which also reduced the number of nuclear oligo(dT)-positive foci (speckles) in FISH (fluorescence in situ hybridization) assay. In addition, the number of P-bodies was decreased in cells harboring cytoplasmic granules of FUS P525L. These findings raise the possibility that ALS-linked C-terminal FUS mutants could sequester a variety of RNA binding proteins and mRNAs in the cytoplasmic aggregates, which could disrupt various aspects of RNA equilibrium and biogenesis.

  12. Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.

    Directory of Open Access Journals (Sweden)

    Birgit Piater

    Full Text Available The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF. Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX. CLN64 and a previously described single-stranded DNA (ssDNA aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding.

  13. Methods To Identify Aptamers against Cell Surface Biomarkers

    Directory of Open Access Journals (Sweden)

    Frédéric Ducongé

    2011-09-01

    Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.

  14. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    Directory of Open Access Journals (Sweden)

    William H Thiel

    2016-01-01

    Full Text Available Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment. High-throughput sequencing (HTS revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.

  15. Impairment of FOS mRNA stabilization following translation arrest in granulocytes from myelodysplastic syndrome patients.

    Science.gov (United States)

    Feng, Xiaomin; Shikama, Yayoi; Shichishima, Tsutomu; Noji, Hideyoshi; Ikeda, Kazuhiko; Ogawa, Kazuei; Kimura, Hideo; Takeishi, Yasuchika; Kimura, Junko

    2013-01-01

    Although quantitative and qualitative granulocyte defects have been described in myelodysplastic syndromes (MDS), the underlying molecular basis of granulocyte dysfunction in MDS is largely unknown. We recently found that FOS mRNA elevation under translation-inhibiting stimuli was significantly smaller in granulocytes from MDS patients than in healthy individuals. The aim of this study is to clarify the cause of the impaired FOS induction in MDS. We first examined the mechanisms of FOS mRNA elevation using granulocytes from healthy donors cultured with the translation inhibitor emetine. Emetine increased both transcription and mRNA stability of FOS. p38 MAPK inhibition abolished the emetine-induced increase of FOS transcription but did not affect FOS mRNA stabilization. The binding of an AU-rich element (ARE)-binding protein HuR to FOS mRNA containing an ARE in 3'UTR was increased by emetine, and the knockdown of HuR reduced the FOS mRNA stabilizing effect of emetine. We next compared the emetine-induced transcription and mRNA stabilization of FOS between MDS patients and healthy controls. Increased rates of FOS transcription by emetine were similar in MDS and controls. In the absence of emetine, FOS mRNA decayed to nearly 17% of initial levels in 45 min in both groups. In the presence of emetine, however, 76.7±19.8% of FOS mRNA remained after 45 min in healthy controls, versus 37.9±25.5% in MDS (Pknowledge, this is the first report demonstrating attenuation of stress-induced FOS mRNA stabilization in MDS granulocytes.

  16. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    Science.gov (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Peptide aptamers as new tools to modulate clathrin-mediated internalisation — inhibition of MT1-MMP internalisation

    Directory of Open Access Journals (Sweden)

    Ferrigno Paul

    2010-07-01

    Full Text Available Abstract Background Peptide aptamers are combinatorial protein reagents that bind to targets with a high specificity and a strong affinity thus providing a molecular tool kit for modulating the function of their targets in vivo. Results Here we report the isolation of a peptide aptamer named swiggle that interacts with the very short (21 amino acid long intracellular domain of membrane type 1-metalloproteinase (MT1-MMP, a key cell surface protease involved in numerous and crucial physiological and pathological cellular events. Expression of swiggle in mammalian cells was found to increase the cell surface expression of MT1-MMP by impairing its internalisation. Swiggle interacts with the LLY573 internalisation motif of MT1-MMP intracellular domain, thus disrupting the interaction with the μ2 subunit of the AP-2 internalisation complex required for endocytosis of the protease. Interestingly, swiggle-mediated inhibition of MT1-MMP clathrin-mediated internalisation was also found to promote MT1-MMP-mediated cell migration. Conclusions Taken together, our results provide further evidence that peptide aptamers can be used to dissect molecular events mediated by individual protein domains, in contrast to the pleiotropic effects of RNA interference techniques.

  18. Peptide aptamers as new tools to modulate clathrin-mediated internalisation--inhibition of MT1-MMP internalisation.

    Science.gov (United States)

    Wickramasinghe, Rochana D; Ko Ferrigno, Paul; Roghi, Christian

    2010-07-23

    Peptide aptamers are combinatorial protein reagents that bind to targets with a high specificity and a strong affinity thus providing a molecular tool kit for modulating the function of their targets in vivo. Here we report the isolation of a peptide aptamer named swiggle that interacts with the very short (21 amino acid long) intracellular domain of membrane type 1-metalloproteinase (MT1-MMP), a key cell surface protease involved in numerous and crucial physiological and pathological cellular events. Expression of swiggle in mammalian cells was found to increase the cell surface expression of MT1-MMP by impairing its internalisation. Swiggle interacts with the LLY573 internalisation motif of MT1-MMP intracellular domain, thus disrupting the interaction with the mu2 subunit of the AP-2 internalisation complex required for endocytosis of the protease. Interestingly, swiggle-mediated inhibition of MT1-MMP clathrin-mediated internalisation was also found to promote MT1-MMP-mediated cell migration. Taken together, our results provide further evidence that peptide aptamers can be used to dissect molecular events mediated by individual protein domains, in contrast to the pleiotropic effects of RNA interference techniques.

  19. Comparison of a PreQ1 Riboswitch Aptamer in Metabolite-bound and Free States with Implications for Gene Regulation*

    OpenAIRE

    Jenkins, Jermaine L.; Krucinska, Jolanta; McCarty, Reid M.; Bandarian, Vahe; Wedekind, Joseph E.

    2011-01-01

    Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters...

  20. Ligand-regulated peptide aptamers.

    Science.gov (United States)

    Miller, Russell A

    2009-01-01

    The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.

  1. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    , directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection......Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... small molecule protease inhibitors of sufficient specificity has proved a daunting task. Aptamers seem to represent a promising alternative. In our review, we concentrate on biochemical mechanisms of aptamer selection, proteinaptamer recognition, protease inhibition, and advantages of aptamers...

  2. Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

    Science.gov (United States)

    Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

    2018-01-09

    Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Comparison of classifications of aptamers against Vibrio ...

    African Journals Online (AJOL)

    As a novel method to detect the pathogen Vibrio alginolyticus, 45 aptamers were previously selected and tested. In order to better understand the properties of these aptamers, it was essential to classify these aptamers based on appropriate criteria. The primary structure of 45 aptamers against V. alginolyticus was analyzed ...

  4. Labeling RNAs in Live Cells Using Malachite Green Aptamer Scaffolds as Fluorescent Probes.

    Science.gov (United States)

    Yerramilli, V Siddartha; Kim, Kyung Hyuk

    2018-03-16

    RNAs mediate many different processes that are central to cellular function. The ability to quantify or image RNAs in live cells is very useful in elucidating such functions of RNA. RNA aptamer-fluorogen systems have been increasingly used in labeling RNAs in live cells. Here, we use the malachite green aptamer (MGA), an RNA aptamer that can specifically bind to malachite green (MG) dye and induces it to emit far-red fluorescence signals. Previous studies on MGA showed a potential for the use of MGA for genetically tagging other RNA molecules in live cells. However, these studies also exhibited low fluorescence signals and high background noise. Here we constructed and tested RNA scaffolds containing multiple tandem repeats of MGA as a strategy to increase the brightness of the MGA aptamer-fluorogen system as well as to make the system fluoresce when tagging various RNA molecules, in live cells. We demonstrate that our MGA scaffolds can induce fluorescence signals by up to ∼20-fold compared to the basal level as a genetic tag for other RNA molecules. We also show that our scaffolds function reliably as genetically encoded fluorescent tags for mRNAs of fluorescent proteins and other RNA aptamers.

  5. Aptamer-Based Technologies in Foodborne Pathogen Detection.

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.

  6. Aptamers in Diagnostics and Treatment of Viral Infections

    Directory of Open Access Journals (Sweden)

    Tomasz Wandtke

    2015-02-01

    Full Text Available Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment. It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus, HBV (Hepatitis B Virus, HCV (Hepatitis C Virus, SARS (Severe Acute Respiratory Syndrome, H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases.

  7. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  8. Aptamers as radiopharmaceuticals for nuclear imaging and therapy

    International Nuclear Information System (INIS)

    Gijs, Marlies; Aerts, An; Impens, Nathalie; Baatout, Sarah; Luxen, André

    2016-01-01

    Today, radiopharmaceuticals belong to the standard instrumentation of nuclear medicine, both in the context of diagnosis and therapy. The majority of radiopharmaceuticals consist of targeting biomolecules which are designed to interact with a disease-related molecular target. A plethora of targeting biomolecules of radiopharmaceuticals exists, including antibodies, antibody fragments, proteins, peptides and nucleic acids. Nucleic acids have some significant advantages relative to proteinaceous biomolecules in terms of size, production, modifications, possible targets and immunogenicity. In particular, aptamers (non-coding, synthetic, single-stranded DNA or RNA oligonucleotides) are of interest because they can bind a molecular target with high affinity and specificity. At present, few aptamers have been investigated preclinically for imaging and therapeutic applications. In this review, we describe the use of aptamers as targeting biomolecules of radiopharmaceuticals. We also discuss the chemical modifications which are needed to turn aptamers into valuable (radio-)pharmaceuticals, as well as the different radiolabeling strategies that can be used to radiolabel oligonucleotides and, in particular, aptamers.

  9. Protein Detection with Aptamer Biosensors

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    2008-07-01

    Full Text Available Aptamers have been developed for different applications. Their use as new biological recognition elements in biosensors promises progress for fast and easy detection of proteins. This new generation of biosensor (aptasensors will be more stable and well adapted to the conditions of real samples because of the specific properties of aptamers.

  10. MicroRNA-22 impairs anti-tumor ability of dendritic cells by targeting p38.

    Directory of Open Access Journals (Sweden)

    Xue Liang

    Full Text Available Dendritic cells (DCs play a critical role in triggering anti-tumor immune responses. Their intracellular p38 signaling is of great importance in controlling DC activity. In this study, we identified microRNA-22 (miR-22 as a microRNA inhibiting p38 protein expression by directly binding to the 3' untranslated region (3'UTR of its mRNA. The p38 down-regulation further interfered with the synthesis of DC-derived IL-6 and the differentiation of DC-driven Th17 cells. Moreover, overexpression of miR-22 in DCs impaired their tumor-suppressing ability while miR-22 inhibitor could reverse this phenomenon and improve the curative effect of DC-based immunotherapy. Thus, our results highlight a suppressive role for miR-22 in the process of DC-invoked anti-tumor immunity and that blocking this microRNA provides a new strategy for generating potent DC vaccines for patients with cancer.

  11. Intranasal siRNA administration reveals IGF2 deficiency contributes to impaired cognition in Fragile X syndrome mice.

    Science.gov (United States)

    Pardo, Marta; Cheng, Yuyan; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Martinez, Ana; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore

    2017-03-23

    Molecular mechanisms underlying learning and memory remain imprecisely understood, and restorative interventions are lacking. We report that intranasal administration of siRNAs can be used to identify targets important in cognitive processes and to improve genetically impaired learning and memory. In mice modeling the intellectual deficiency of Fragile X syndrome, intranasally administered siRNA targeting glycogen synthase kinase-3β (GSK3β), histone deacetylase-1 (HDAC1), HDAC2, or HDAC3 diminished cognitive impairments. In WT mice, intranasally administered brain-derived neurotrophic factor (BDNF) siRNA or HDAC4 siRNA impaired learning and memory, which was partially due to reduced insulin-like growth factor-2 (IGF2) levels because the BDNF siRNA- or HDAC4 siRNA-induced cognitive impairments were ameliorated by intranasal IGF2 administration. In Fmr1 -/- mice, hippocampal IGF2 was deficient, and learning and memory impairments were ameliorated by IGF2 intranasal administration. Therefore intranasal siRNA administration is an effective means to identify mechanisms regulating cognition and to modulate therapeutic targets.

  12. Aging-induced dysregulation of dicer1-dependent microRNA expression impairs angiogenic capacity of rat cerebromicrovascular endothelial cells.

    Science.gov (United States)

    Ungvari, Zoltan; Tucsek, Zsuzsanna; Sosnowska, Danuta; Toth, Peter; Gautam, Tripti; Podlutsky, Andrej; Csiszar, Agnes; Losonczy, Gyorgy; Valcarcel-Ares, M Noa; Sonntag, William E; Csiszar, Anna

    2013-08-01

    Age-related impairment of angiogenesis is likely to play a central role in cerebromicrovascular rarefaction and development of vascular cognitive impairment, but the underlying mechanisms remain elusive. To test the hypothesis that dysregulation of Dicer1 (ribonuclease III, a key enzyme of the microRNA [miRNA] machinery) impairs endothelial angiogenic capacity in aging, primary cerebromicrovascular endothelial cells (CMVECs) were isolated from young (3 months old) and aged (24 months old) Fischer 344 × Brown Norway rats. We found an age-related downregulation of Dicer1 expression both in CMVECs and in small cerebral vessels isolated from aged rats. In aged CMVECs, Dicer1 expression was increased by treatment with polyethylene glycol-catalase. Compared with young cells, aged CMVECs exhibited altered miRNA expression profile, which was associated with impaired proliferation, adhesion to vitronectin, collagen and fibronectin, cellular migration (measured by a wound-healing assay using electric cell-substrate impedance sensing technology), and impaired ability to form capillary-like structures. Overexpression of Dicer1 in aged CMVECs partially restored miRNA expression profile and significantly improved angiogenic processes. In young CMVECs, downregulation of Dicer1 (siRNA) resulted in altered miRNA expression profile associated with impaired proliferation, adhesion, migration, and tube formation, mimicking the aging phenotype. Collectively, we found that Dicer1 is essential for normal endothelial angiogenic processes, suggesting that age-related dysregulation of Dicer1-dependent miRNA expression may be a potential mechanism underlying impaired angiogenesis and cerebromicrovascular rarefaction in aging.

  13. Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

    Science.gov (United States)

    Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

    2014-06-10

    Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

  14. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  15. Construction of a Bivalent Thrombin Binding Aptamer and Its Antidote with Improved Properties

    Directory of Open Access Journals (Sweden)

    Quintin W. Hughes

    2017-10-01

    Full Text Available Aptamers are short synthetic DNA or RNA oligonucleotides that adopt secondary and tertiary conformations based on Watson–Crick base-pairing interactions and can be used to target a range of different molecules. Two aptamers, HD1 and HD22, that bind to exosites I and II of the human thrombin molecule, respectively, have been extensively studied due to their anticoagulant potentials. However, a fundamental issue preventing the clinical translation of many aptamers is degradation by nucleases and reduced pharmacokinetic properties requiring higher dosing regimens more often. In this study, we have chemically modified the design of previously described thrombin binding aptamers targeting exosites I, HD1, and exosite II, HD22. The individual aptamers were first modified with an inverted deoxythymidine nucleotide, and then constructed bivalent aptamers by connecting the HD1 and HD22 aptamers either through a triethylene glycol (TEG linkage or four consecutive deoxythymidines together with an inverted deoxythymidine nucleotide at the 3′-end. The anticoagulation potential, the reversal of coagulation with different antidote sequences, and the nuclease stability of the aptamers were then investigated. The results showed that a bivalent aptamer RNV220 containing an inverted deoxythymidine and a TEG linkage chemistry significantly enhanced the anticoagulation properties in blood plasma and nuclease stability compared to the existing aptamer designs. Furthermore, a bivalent antidote sequence RNV220AD efficiently reversed the anticoagulation effect of RNV220 in blood plasma. Based on our results, we believe that RNV220 could be developed as a potential anticoagulant therapeutic molecule.

  16. Charomers-Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery.

    Science.gov (United States)

    Hahn, Ulrich

    2017-12-06

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2'-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers-in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

  17. Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

    Science.gov (United States)

    2017-01-01

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld. PMID:29211023

  18. A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

    Directory of Open Access Journals (Sweden)

    John G. Bruno

    2013-03-01

    Full Text Available The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies.

  19. Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Ulrich Hahn

    2017-12-01

    Full Text Available Interleukin-6 (IL-6 is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT. Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

  20. Glutamate Receptor Aptamers and ALS

    National Research Council Canada - National Science Library

    Niu, Li

    2008-01-01

    .... An aptamer is a single-stranded nucleic acid that directly inhibits a protein's function by folding into a specific tertiary structure that dictates high-affinity binding to the target protein...

  1. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  2. Practical Application of Aptamer-Based Biosensors in Detection of Low Molecular Weight Pollutants in Water Sources

    Directory of Open Access Journals (Sweden)

    Wei Zhang

    2018-02-01

    Full Text Available Water pollution has become one of the leading causes of human health problems. Low molecular weight pollutants, even at trace concentrations in water sources, have aroused global attention due to their toxicity after long-time exposure. There is an increased demand for appropriate methods to detect these pollutants in aquatic systems. Aptamers, single-stranded DNA or RNA, have high affinity and specificity to each of their target molecule, similar to antigen-antibody interaction. Aptamers can be selected using a method called Systematic Evolution of Ligands by EXponential enrichment (SELEX. Recent years we have witnessed great progress in developing aptamer selection and aptamer-based sensors for low molecular weight pollutants in water sources, such as tap water, seawater, lake water, river water, as well as wastewater and its effluents. This review provides an overview of aptamer-based methods as a novel approach for detecting low molecular weight pollutants in water sources.

  3. Generating Aptamers by Cell-SELEX for Applications in Molecular Medicine

    Directory of Open Access Journals (Sweden)

    Huixia Liu

    2012-03-01

    Full Text Available Aptamers are single-stranded oligonucleotides of DNA or RNA that bind to target molecules with high affinity and specificity. Typically, aptamers are generated by an iterative selection process, called systematic evolution of ligands by exponential enrichment (SELEX. Recent advancements in SELEX technology have extended aptamer selection from comparatively simple mixtures of purified proteins to whole living cells, and now cell-based SELEX (or cell-SELEX can isolate aptamers that bind to specific target cells. Combined with nanotechnology, microchips, microfluidic devices, RNAi and other advanced technologies, cell-SELEX represents an integrated platform providing ultrasensitive and highly specific tools for clinical medicine. In this review, we describe the recent progress made in the application of cell-SELEX for diagnosis, therapy and biomarker discovery.

  4. Knockdown of E2f1 by RNA interference impairs proliferation of rat cells in vitro

    Directory of Open Access Journals (Sweden)

    Luciana dos Reis Vasques

    2010-01-01

    Full Text Available E2F1 plays a key role in cell-cycle regulation in mammals, since its transcription factor activity controls genes required for DNA synthesis and apoptosis. E2F1 deregulation is a common feature among different tumor types and can be a major cause of cell proliferation. Thus, blocking E2F1 expression by RNA interference represents a promising therapeutic approach. In this study, the introduction of specific short hairpin RNAs (shRNAs reduced E2f1 expression by up to 77%, and impaired rat glioma cell proliferation by approximately 70%, as compared to control cells. Furthermore, we investigated the expression of E2f1 target genes, Cyclin A and Cyclin E. Cyclin A was found to be down-regulated, whereas Cyclin E had similar expression to control cells, indicating that gene(s other than E2f1 control its transcription. Other E2f family members, E2f2 and E2f3, which have been classified in the same subgroup of transcriptional activators, were also analyzed. Expression of both E2f2 and E2f3 was similar to control cells, showing no cross-inactivation or up-regulation to compensate for the absence of E2f1. Nevertheless, their expression was insufficient to maintain the initial proliferation potential. Taken together, our results suggest that shE2f1 is a promising therapy to control tumor cell proliferation.

  5. RNA signal amplifier circuit with integrated fluorescence output.

    Science.gov (United States)

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  6. DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin.

    Science.gov (United States)

    Vivekananda, Jeevalatha; Salgado, Christi; Millenbaugh, Nancy J

    2014-02-14

    Staphylococcus aureus is a versatile pathogen capable of causing a broad spectrum of diseases ranging from superficial skin infections to life threatening conditions such as endocarditis, septicemia, pneumonia and toxic shock syndrome. In vitro and in vivo studies identified an exotoxin, α-toxin, as a major cause of S. aureus toxicity. Because S. aureus has rapidly evolved resistance to a number of antibiotics, including methicillin, it is important to identify new therapeutic strategies, other than antibiotics, for inhibiting the harmful effects of this pathogen. Aptamers are single-stranded DNA or RNA oligonucleotides with three-dimensional folded conformations that bind with high affinity and selectivity to targets and modulate their biological functions. The goal of this study was to isolate DNA aptamers that specifically inhibit the cytotoxic activity of α-toxin. After 10 rounds of Systematic Evolution of Ligands by EXponential Enrichment (SELEX), 49 potential anti-α-toxin aptamers were identified. In vitro neutralization assays demonstrated that 4 of these 49 aptamers, AT-27, AT-33, AT-36, and AT-49, significantly inhibited α-toxin-mediated cell death in Jurkat T cells. Furthermore, RT-PCR analysis revealed that α-toxin increased the transcription of the inflammatory cytokines TNF-α and IL-17 and that anti-α-toxin aptamers AT-33 and AT-36 inhibited the upregulation of these genes. Collectively, the data suggest the feasibility of generating functionally effective aptamers against α-toxin for treatment of S. aureus infections. Published by Elsevier Inc.

  7. Structural insights into the osteopontin-aptamer complex y molecular dynamics simulations

    Science.gov (United States)

    La Penna, Giovanni; Chelli, Riccardo

    2018-01-01

    Osteopontin is an intrinsically disordered protein involved in tissue remodeling. As a biomarker for pathological hypertrophy and fibrosis, the protein is targeted by an RNA aptamer. In this work, we model the interactions between osteopontin and its aptamer, including mono- (Na+) and divalent (Mg2+) cations. The molecular dynamics simulations suggest that the presence of divalent cations forces the N-terminus of osteopontin to bind the shell of divalent cations adsorbed over the surface of its RNA aptamer, the latter exposing a high negative charge density. The osteopontin plasticity as a function of the local concentration of Mg is discussed in the frame of the proposed strategies for osteopontin targeting as biomarker and in theranostic.

  8. Nucleic Acid Aptamers Against Biotoxins: A New Paradigm Toward the Treatment and Diagnostic Approach

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Veedu, Rakesh N.

    2012-01-01

    Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody-based therape......Nucleic acid aptamers are short single-stranded DNA or RNA oligonucleotides that can bind to their targets with very high affinity and specificity, and are generally selected by a process referred to as systematic evolution of ligands by exponential enrichment. Conventional antibody......-based therapeutic and diagnostic approach currently employed against biotoxins pose major limitations such as the requirement of a live animal for the in vivo enrichment of the antibody species, decreased stability, high production cost, and side effects. Aptamer technology is a viable alternative that can be used...

  9. Axonal Transport of TDP-43 mRNA Granules Is Impaired by ALS-Causing Mutations

    OpenAIRE

    Alami, Nael H.; Smith, Rebecca B.; Carrasco, Monica A.; Williams, Luis A.; Winborn, Christina S.; Han, Steve S.W.; Kiskinis, Evangelos; Winborn, Brett; Freibaum, Brian D.; Kanagaraj, Anderson; Clare, Alison J.; Badders, Nisha M.; Bilican, Bilada; Chaum, Edward; Chandran, Siddharthan

    2014-01-01

    The RNA binding protein TDP-43 regulates RNA metabolism at multiple levels, including transcription, RNA splicing, and mRNA stability. TDP-43 is a major component of the cytoplasmic inclusions characteristic of amyotrophic lateral sclerosis and some types of frontotemporal lobar degeneration. The importance of TDP-43 in disease is underscored by the fact that dominant missense mutations are sufficient to cause disease, although the role of TDP-43 in pathogenesis is unknown. ...

  10. Axonal transport of TDP-43 mRNA granules in neurons is impaired by ALS-causing mutations

    Science.gov (United States)

    Carrasco, Monica A.; Williams, Luis A.; Winborn, Christina S.; Han, Steve S. W.; Kiskinis, Evangelos; Winborn, Brett; Freibaum, Brian D.; Kanagaraj, Anderson; Clare, Alison J.; Badders, Nisha M.; Bilican, Bilada; Chaum, Edward; Chandran, Siddharthan; Shaw, Christopher E.; Eggan, Kevin C.; Maniatis, Tom; Taylor, J. Paul

    2014-01-01

    Summary The RNA binding protein TDP-43 regulates RNA metabolism at multiple levels, including transcription, RNA splicing, and mRNA stability. TDP-43 is a major component of the cytoplasmic inclusions characteristic of amyotrophic lateral sclerosis and some types of frontotemporal lobar degeneration. The importance of TDP-43 in disease is underscored by the fact that dominant missense mutations are sufficient to cause disease, although the role of TDP-43 in pathogenesis is unknown. Here we show that TDP-43 forms cytoplasmic mRNP granules that undergo bidirectional, microtubule-dependent transport in neurons in vitro and in vivo and facilitate delivery of target mRNA to distal neuronal compartments. TDP-43 mutations impair this mRNA transport function in vivo and in vitro, including in stem cell-derived motor neurons from ALS patients bearing any one of three different TDP-43 ALS-causing mutations. Thus, TDP43 mutations that cause ALS lead to partial loss of a novel cytoplasmic function of TDP-43. PMID:24507191

  11. Maternal separation induces hippocampal changes in cadherin-1 (CDH-1) mRNA and recognition memory impairment in adolescent mice.

    Science.gov (United States)

    de Azeredo, Lucas Araújo; Wearick-Silva, Luis Eduardo; Viola, Thiago Wendt; Tractenberg, Saulo Gantes; Centeno-Silva, Anderson; Orso, Rodrigo; Schröder, Nadja; Bredy, Timothy William; Grassi-Oliveira, Rodrigo

    2017-05-01

    In rodents, disruption of mother-infant attachment induced by maternal separation (MS) is associated with recognition memory impairment and long-term neurobiological consequences. Particularly stress-induced modifications have been associated to disruption of cadherin (CDH) adhesion function, which plays an important role in remodeling of neuronal connection and synaptic plasticity. This study investigated the sex-dependent effect of MS on recognition memory and mRNA levels of classical type I and type II CDH and the related β -catenin (β -Cat) in the hippocampus and prefrontal cortex of late adolescent mice. We provided evidence that the BALB/c mice exposed to MS present deficit in recognition memory, especially females. Postnatal MS induced higher hippocampal CDH-2 and CDH-8 mRNA levels, as well as an upregulation of CDH-1 in the prefrontal cortex in both males and females. MS-reared female mice presented lower CDH-1 mRNA levels in the hippocampus. In addition, hippocampal CDH-1 mRNA levels were positively correlated with recognition memory performance in females. MS-reared male mice exhibited higher β -Cat mRNA levels in the hippocampus. Considering sex-specific effects on CDH mRNA levels, it has been demonstrated mRNA changes in CDH-1, β -Cat, and CDH-6 in the hippocampus, as well as CDH-1, CDH-8 and CDH-11 in the prefrontal cortex. Overall, these findings suggest a complex interplay among MS, CDH mRNA expression, and sex differences in the PFC and hippocampus of adolescent mice. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  13. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Il Chung [Iowa State Univ., Ames, IA (United States)

    2011-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  14. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ilchung [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  15. Nuclei of aged myofibres undergo structural and functional changes suggesting impairment in RNA processing

    Directory of Open Access Journals (Sweden)

    C Pellicciari

    2009-06-01

    Full Text Available Advancing adult age is associated with a progressive decrease in skeletal muscle mass, strength and quality known as sarcopenia. The mechanisms underlying age-related skeletal muscle wasting and weakness are manifold and still remain to be fully elucidated. Despite the increasing evidence that the progress of muscle diseases leading to muscle atrophy/dystrophy may be related to defective RNA processing, no data on the morpho-functional features of skeletal muscle nuclei in sarcopenia are available at present. In this view, we have investigated, by combining morphometry and immunocytochemistry at light and electron microscopy, the fine structure of myonuclei as well as the distribution and amount of RNA processing factors in skeletal myofibres of biceps brachii and quadriceps femoris from adult and old rats. Results demonstrate that the myonuclei of aged type II fibres show an increased amount of condensed chromatin and lower amounts of phosphorylated polymerase II and DNA/RNA hybrid molecules, clearly indicating a decrease in pre-mRNA transcription rate compared to adult animals. In addition, myonuclei of aged fibres show decreased amounts of nucleoplasmic splicing factors and an accumulation of cleavage factors, polyadenilated RNA and perichromatin granules, suggesting a reduction in the processing and transport rate of premRNA. During ageing, it seems therefore that in rat myonuclei the entire production chain of mRNA, from synthesis to cytoplasmic export, is less efficient. This failure likely contributes to the reduced responsiveness of muscle cells to anabolic stimuli in the elderly.

  16. A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

    Science.gov (United States)

    Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

    2014-12-01

    RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Sensitivity and Selectivity on Aptamer-Based Assay: The Determination of Tetracycline Residue in Bovine Milk

    Directory of Open Access Journals (Sweden)

    Sohee Jeong

    2012-01-01

    Full Text Available A competitive enzyme-linked aptamer assay (ELAA to detect tetracycline in milk was performed by using two different aptamers individually; one is 76 mer-DNA aptamer and the other is 57 mer-RNA aptamer. The best optimum condition was obtained without monovalent ion, Na+ and also by adding no Mg2+ ion in the assay buffer, along with RT incubation. The optimized ELAA showed a good sensitivity (LOD of 2.10 × 10−8 M with a wide dynamic range (3.16 × 10−8 M ~ 3.16 × 10−4 M. In addition, the average R.S.D. across all data points of the curve was less than 2.5% with good recoveries (~101.8% from the milk media. Thus, this method provides a good tool to monitor tetracycline in milk from MRLs’ point of view. However, this ELAA method was not superior to the ELISA method in terms of specificity. This paper describes that it does not always give better sensitivity and specificity in assays even though aptamers have several advantages over antibodies and have been known to be good binders for binding assays.

  18. Selection and characterization of DNA aptamers

    NARCIS (Netherlands)

    Ruigrok, V.J.B.

    2013-01-01

    This thesis focusses on the selection and characterisation of DNA aptamers and the various aspects related to their selection from large pools of randomized oligonucleotides. Aptamers are affinity tools that can specifically recognize and bind predefined target molecules; this ability, however,

  19. Aptamer therapeutics: A review of current practice

    International Nuclear Information System (INIS)

    Perkins, A.C.; Missailidis, S.

    2007-01-01

    Full text: The development of nuclease resistant oligonucleotide agents known as aptamers, offers an alternative to antibodies as targeting, diagnostic and delivery agents. The production technique of specific receptor binding molecules based on defined nucleic acid sequences is known as systematic evolution of ligands by exponential enrichment (SELEX). Using this technique, aptamers can be produced rapidly and with high homogeneity. Furthermore, they are stable over long term storage at ambient room temperatures. A monomeric aptamer is small in size, with a molecular weight as low as 5 to 10 kDa. However, the aptamer molecule may be used as a building block for custom designed targeting agents, offering several advantages. Aptamers have been found to bind their targets with high specificity and with dissociation constants in the subnanomolar or picomolar range. The first pharmaceutical aptamer formulation, Macugen (pegaptanib sodium injection) was approved in the United States in December of 2004. This is an anti-VEGF aptamer formulation used for the treatment of Neovascular agerelated macular degeneration. Other possibilities in cardiovascular, neurodegenerative and tropical medicine are apparent. As tumour targeting agents, aptamers penetrate tissues readily, reach peak levels quickly and clear from the body rapidly, thus having properties of low toxicity and immunoreactivity. Work with radiolabelled aptamers is limited to pre-clinical studies, but the body of evidence is steadily growing and aptamers are emerging as valuable clinical products for diagnostic imaging and therapy. Peptide coupling reactions between amino and carboxylic groups offer the possibility of labelling the aptamers with a number of chelators that, coupled with appropriate radionuclides, would generate novel targeted radiopharmaceuticals for the diagnosis and therapy of disease. The unparalleled combinatorial chemical diversity, small size and modification ability of aptamers is expected to

  20. Aptamer-Modified Magnetic Beads in Biosensing

    Science.gov (United States)

    Scheper, Thomas; Walter, Johanna-Gabriela

    2018-01-01

    Magnetic beads (MBs) are versatile tools for the purification, detection, and quantitative analysis of analytes from complex matrices. The superparamagnetic property of magnetic beads qualifies them for various analytical applications. To provide specificity, MBs can be decorated with ligands like aptamers, antibodies and peptides. In this context, aptamers are emerging as particular promising ligands due to a number of advantages. Most importantly, the chemical synthesis of aptamers enables straightforward and controlled chemical modification with linker molecules and dyes. Moreover, aptamers facilitate novel sensing strategies based on their oligonucleotide nature that cannot be realized with conventional peptide-based ligands. Due to these benefits, the combination of aptamers and MBs was already used in various analytical applications which are summarized in this article. PMID:29601533

  1. Aptamer-based technology for food analysis.

    Science.gov (United States)

    Liu, Xiaofei; Zhang, Xuewu

    2015-01-01

    Aptamers are short and functional single-stranded oligonucleotide sequences selected from systematic evolution of ligands by exponential enrichment (SELEX) process, which have the capacity to recognize various classes of target molecules with high affinity and specificity. Various analytical aptamers acquired by SELEX are widely used in many research fields, such as medicine, biology, and chemistry. However, the application of this innovative and emerging technology to food safety is just in infant stage. Food safety plays a very important role in our daily lives because varieties of poisonous and harmful substances in food affect human health. Aptamer technique is promising, which can overcome many disadvantages of existing detection methods in food safety, such as long detection time, low sensitivity, difficult, and expensive antibody preparation. This review provides an overview of various aptamer screening technologies and summarizes the recent applications of aptamers in food safety, and future prospects are also discussed.

  2. MicroRNA and Transcriptomic Profiling Showed miRNA-Dependent Impairment of Systemic Regulation and Synthesis of Biomolecules in Rag2 KO Mice

    Directory of Open Access Journals (Sweden)

    Abu Musa Md Talimur Reza

    2018-02-01

    Full Text Available The Rag2 knockout (KO mouse is a well-established immune-compromised animal model for biomedical research. A comparative study identified the deregulated expression of microRNAs (miRNAs and messenger RNAs (mRNAs in Rag2 KO mice. However, the interaction between deregulated genes and miRNAs in the alteration of systemic (cardiac, renal, hepatic, nervous, and hematopoietic regulations and the synthesis of biomolecules (such as l-tryptophan, serotonin, melatonin, dopamine, alcohol, noradrenaline, putrescine, and acetate are unclear. In this study, we analyzed both miRNA and mRNA expression microarray data from Rag2 KO and wild type mice to investigate the possible role of miRNAs in systemic regulation and biomolecule synthesis. A notable finding obtained from this analysis is that the upregulation of several genes which are target molecules of the downregulated miRNAs in Rag2 KO mice, can potentially trigger the degradation of l-tryptophan, thereby leading to the systemic impairment and alteration of biomolecules synthesis as well as changes in behavioral patterns (such as stress and fear responses, and social recognition memory in Rag2 gene-depleted mice. These findings were either not observed or not explicitly described in other published Rag2 KO transcriptome analyses. In conclusion, we have provided an indication of miRNA-dependent regulations of clinical and pathological conditions in cardiac, renal, hepatic, nervous, and hematopoietic systems in Rag2 KO mice. These results may significantly contribute to the prediction of clinical disease caused by Rag2 deficiency.

  3. MicroRNA and Transcriptomic Profiling Showed miRNA-Dependent Impairment of Systemic Regulation and Synthesis of Biomolecules in Rag2 KO Mice.

    Science.gov (United States)

    Reza, Abu Musa Md Talimur; Choi, Yun-Jung; Kim, Jin-Hoi

    2018-02-27

    The Rag2 knockout (KO) mouse is a well-established immune-compromised animal model for biomedical research. A comparative study identified the deregulated expression of microRNAs (miRNAs) and messenger RNAs (mRNAs) in Rag2 KO mice. However, the interaction between deregulated genes and miRNAs in the alteration of systemic (cardiac, renal, hepatic, nervous, and hematopoietic) regulations and the synthesis of biomolecules (such as l-tryptophan, serotonin, melatonin, dopamine, alcohol, noradrenaline, putrescine, and acetate) are unclear. In this study, we analyzed both miRNA and mRNA expression microarray data from Rag2 KO and wild type mice to investigate the possible role of miRNAs in systemic regulation and biomolecule synthesis. A notable finding obtained from this analysis is that the upregulation of several genes which are target molecules of the downregulated miRNAs in Rag2 KO mice, can potentially trigger the degradation of l-tryptophan, thereby leading to the systemic impairment and alteration of biomolecules synthesis as well as changes in behavioral patterns (such as stress and fear responses, and social recognition memory) in Rag2 gene-depleted mice. These findings were either not observed or not explicitly described in other published Rag2 KO transcriptome analyses. In conclusion, we have provided an indication of miRNA-dependent regulations of clinical and pathological conditions in cardiac, renal, hepatic, nervous, and hematopoietic systems in Rag2 KO mice. These results may significantly contribute to the prediction of clinical disease caused by Rag2 deficiency.

  4. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  5. Development of radiopharmaceuticals based on aptamers: selection and characterization of DNA aptamers for CEA

    International Nuclear Information System (INIS)

    Correa, C.R.; Andrade, A.S.R.; Augusto-Pinto, L.; Goes, A.M.

    2011-01-01

    Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da

  6. Development of radiopharmaceuticals based on aptamers: selection and characterization of DNA aptamers for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Andrade, A.S.R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Augusto-Pinto, L. [BioAptus, Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Departamento de Imunologia e Bioquimica. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais. Belo Horizonte, MG (Brazil)

    2011-07-01

    Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da

  7. Pre-mRNA Processing Is Partially Impaired in Satellite Cell Nuclei from Aged Muscles

    Directory of Open Access Journals (Sweden)

    Manuela Malatesta

    2010-01-01

    Full Text Available Satellite cells are responsible for the capacity of mature mammalian skeletal muscles to repair and maintain mass. During aging, skeletal muscle mass as well as the muscle strength and endurance progressively decrease, leading to a condition termed sarcopenia. The causes of sarcopenia are manifold and remain to be completely elucidated. One of them could be the remarkable decline in the efficiency of muscle regeneration; this has been associated with decreasing amounts of satellite cells, but also to alterations in their activation, proliferation, and/or differentiation. In this study, we investigated the satellite cell nuclei of biceps and quadriceps muscles from adult and old rats; morphometry and immunocytochemistry at light and electron microscopy have been combined to assess the organization of the nuclear RNP structural constituents involved in different steps of mRNA formation. We demonstrated that in satellite cells the RNA pathways undergo alterations during aging, possibly hampering their responsiveness to muscle damage.

  8. MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

    Science.gov (United States)

    Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

    2016-10-25

    MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

  9. Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

    National Research Council Canada - National Science Library

    Fan, Maomian; Roper, Shelly; Andrews, Carrie; Allman, Amity; Bruno, John; Kiel, Jonathan

    2008-01-01

    ...). This process has been used to select aptamers against different types of targets (Bacillus anthracis spores, Bacillus thuringiensis spores, MS-2 bacteriophage, ovalbumin, and botulinum neurotoxin...

  10. Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells

    Directory of Open Access Journals (Sweden)

    David Porciani

    2015-01-01

    Full Text Available Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i target tumor cells via an antitransferrin receptor RNA aptamer and (ii perform selective codelivery of a chemotherapeutic drug (Doxorubicin and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment. Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells.

  11. Design Strategies for Aptamer-Based Biosensors

    Science.gov (United States)

    Han, Kun; Liang, Zhiqiang; Zhou, Nandi

    2010-01-01

    Aptamers have been widely used as recognition elements for biosensor construction, especially in the detection of proteins or small molecule targets, and regarded as promising alternatives for antibodies in bioassay areas. In this review, we present an overview of reported design strategies for the fabrication of biosensors and classify them into four basic modes: target-induced structure switching mode, sandwich or sandwich-like mode, target-induced dissociation/displacement mode and competitive replacement mode. In view of the unprecedented advantages brought about by aptamers and smart design strategies, aptamer-based biosensors are expected to be one of the most promising devices in bioassay related applications. PMID:22399891

  12. Impaired embryonic development in mice overexpressing the RNA-binding protein TIAR.

    Directory of Open Access Journals (Sweden)

    Yacine Kharraz

    Full Text Available BACKGROUND: TIA-1-related (TIAR protein is a shuttling RNA-binding protein involved in several steps of RNA metabolism. While in the nucleus TIAR participates to alternative splicing events, in the cytoplasm TIAR acts as a translational repressor on specific transcripts such as those containing AU-Rich Elements (AREs. Due to its ability to assemble abortive pre-initiation complexes coalescing into cytoplasmic granules called stress granules, TIAR is also involved in the general translational arrest observed in cells exposed to environmental stress. However, the in vivo role of this protein has not been studied so far mainly due to severe embryonic lethality upon tiar invalidation. METHODOLOGY/PRINCIPAL FINDINGS: To examine potential TIAR tissue-specificity in various cellular contexts, either embryonic or adult, we constructed a TIAR transgenic allele (loxPGFPloxPTIAR allowing the conditional expression of TIAR protein upon Cre recombinase activity. Here, we report the role of TIAR during mouse embryogenesis. We observed that early TIAR overexpression led to low transgene transmission associated with embryonic lethality starting at early post-implantation stages. Interestingly, while pre-implantation steps evolved correctly in utero, in vitro cultured embryos were very sensitive to culture medium. Control and transgenic embryos developed equally well in the G2 medium, whereas culture in M16 medium led to the phosphorylation of eIF2alpha that accumulated in cytoplasmic granules precluding transgenic blastocyst hatching. Our results thus reveal a differential TIAR-mediated embryonic response following artificial or natural growth environment. CONCLUSIONS/SIGNIFICANCE: This study reports the importance of the tightly balanced expression of the RNA-binding protein TIAR for normal embryonic development, thereby emphasizing the role of post-transcriptional regulations in early embryonic programming.

  13. Radiolabelled aptamers for tumour imaging and therapy

    International Nuclear Information System (INIS)

    Perkins, A.C.; Missailidis, S.

    2005-01-01

    Full text: The growth in biotechnology has led to new techniques for the design, selection and production of ligands capable of molecular recognition. One promising approach is the production of specific receptor binding molecules based on specific nucleic acid sequences that are capable of recognising a wide array of target molecules. These oligonuclide ligands are known as aptamers. The technology that allows production of aptamer molecules is known as systematic evolution of ligands by exponential enrichment (SELEX). We have used combinatorial chemistry techniques coupled with polymerase chain reaction (PCR) to rapidly select aptamers from degenerate libraries that bind with high affinity and specificity to the protein core of the MUC1 antigen, a tumour marker previously extensively used in tumour imaging and therapy. MUC1 is widely expressed by normal glandular epithelial cells, however this expression is dramatically increased when the cells become malignant. This has been well documented for breast and ovarian cancer, as well as some lung, pancreatic and prostate cancers. Recently it has also been shown that MUC1 is a valuable marker for bladder and has been used for the imaging and targeted therapy of bladder cancer. The aptamer selection process was performed on affinity chromatography matrices. After ten rounds of selection and amplification, aptamers were cloned and sequenced. Post SELEX amino modifications have been used to confer nuclease resistance and coupling potential. The aptamers bound to MUC1 antigen with a Kd of 5nm and high specificity, demonstrated by fluorescent microscopy on MUC1-expressing tumour cells. Using peptide coupling reactions, we have successfully attached chelators for Tc-99m radiolabelling. Two of the constructs tested were based on mono-aptamer chelator complexes, one with commercially available MAG3 and one with a novel designed cyclen-based chelator. The other two constructs were based on the use of multi-aptamer complexes

  14. Cell-Specific Aptamers as Emerging Therapeutics

    Directory of Open Access Journals (Sweden)

    Cindy Meyer

    2011-01-01

    Full Text Available Aptamers are short nucleic acids that bind to defined targets with high affinity and specificity. The first aptamers have been selected about two decades ago by an in vitro process named SELEX (systematic evolution of ligands by exponential enrichment. Since then, numerous aptamers with specificities for a variety of targets from small molecules to proteins or even whole cells have been selected. Their applications range from biosensing and diagnostics to therapy and target-oriented drug delivery. More recently, selections using complex targets such as live cells have become feasible. This paper summarizes progress in cell-SELEX techniques and highlights recent developments, particularly in the field of medically relevant aptamers with a focus on therapeutic and drug-delivery applications.

  15. Altered PIWI-LIKE 1 and PIWI-LIKE 2 mRNA expression in ejaculated spermatozoa of men with impaired sperm characteristics.

    Science.gov (United States)

    Giebler, Maria; Greither, Thomas; Müller, Lisa; Mösinger, Carina; Behre, Hermann M

    2018-01-01

    In about half the cases of involuntary childlessness, a male infertility factor is involved. The PIWI-LIKE genes, a subclade of the Argonaute protein family, are involved in RNA silencing and transposon control in the germline. Knockout of murine Piwi-like 1 and 2 homologs results in complete infertility in males. The aim of this study was to analyze whether the mRNA expression of human PIWI-LIKE 1-4 genes is altered in ejaculated spermatozoa of men with impaired sperm characteristics. Ninety male participants were included in the study, among which 47 were with normozoospermia, 36 with impaired semen characteristics according to the World Health Organization (WHO) manual, 5 th edition, and 7 with azoospermia serving as negative control for the PIWI-LIKE 1-4 mRNA expression in somatic cells in the ejaculate. PIWI-LIKE 1-4 mRNA expression in the ejaculated spermatozoa of the participants was measured by quantitative real-time PCR. In nonazoospermic men, PIWI-LIKE 1-4 mRNA was measurable in ejaculated spermatozoa in different proportions. PIWI-LIKE 1 (100.0%) and PIWI-LIKE 2 (49.4%) were more frequently expressed than PIWI-LIKE 3 (9.6%) and PIWI-LIKE 4 (15.7%). Furthermore, a decreased PIWI-LIKE 2 mRNA expression showed a significant correlation with a decreased sperm count (P = 0.022) and an increased PIWI-LIKE 1 mRNA expression with a decreased progressive motility (P = 0.048). PIWI-LIKE 1 and PIWI-LIKE 2 mRNA expression exhibited a significant association with impaired sperm characteristics and may be a useful candidate for the evaluation of the impact of PIWI-LIKE 1-4 mRNA expression on male infertility.

  16. From selection hits to clinical leads: progress in aptamer discovery

    Directory of Open Access Journals (Sweden)

    Keith E Maier

    2016-01-01

    Full Text Available Aptamers were discovered more than 25 years ago, yet only one has been approved by the US Food and Drug Administration to date. With some noteworthy advances in their chemical design and the enzymes we use to make them, aptamers and aptamer-based therapeutics have seen a resurgence in interest. New aptamer drugs are being approved for clinical evaluation, and it is certain that we will see increasingly more aptamers and aptamer-like drugs in the future. In this review, we will discuss the production of aptamers with an emphasis on the advances and modifications that enabled early aptamers to succeed in clinical trials as well as those that are likely to be important for future generations of these drugs.

  17. Aptamer-functionalized nano-biosensors.

    Science.gov (United States)

    Chiu, Tai-Chia; Huang, Chih-Ching

    2009-01-01

    Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs), metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs). We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused.

  18. Aptamer-Functionalized Nano-Biosensors

    Directory of Open Access Journals (Sweden)

    Tai-Chia Chiu

    2009-12-01

    Full Text Available Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs, metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs. We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused.

  19. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    Science.gov (United States)

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  20. Nucleic acid aptamers: an emerging frontier in cancer therapy.

    Science.gov (United States)

    Zhu, Guizhi; Ye, Mao; Donovan, Michael J; Song, Erqun; Zhao, Zilong; Tan, Weihong

    2012-11-04

    The last two decades have witnessed the development and application of nucleic acid aptamers in a variety of fields, including target analysis, disease therapy, and molecular and cellular engineering. The efficient and widely applicable aptamer selection, reproducible chemical synthesis and modification, generally impressive target binding selectivity and affinity, relatively rapid tissue penetration, low immunogenicity, and rapid systemic clearance make aptamers ideal recognition elements for use as therapeutics or for in vivo delivery of therapeutics. In this feature article, we discuss the development and biomedical application of nucleic acid aptamers, with emphasis on cancer cell aptamer isolation, targeted cancer therapy, oncology biomarker identification and drug discovery.

  1. Deciphering the details of RNA aminoglycoside interactions: from atomistic models to biotechnological applications

    Energy Technology Data Exchange (ETDEWEB)

    Ilgu, Muslum [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.

  2. Cisplatin binds to pre-miR-200b and impairs its processing to mature microRNA.

    Science.gov (United States)

    Mezencev, R; Wartell, R M

    2018-01-01

    Cisplatin is an important anticancer drug with a complex mode of action, a variety of possible targets, and numerous resistance mechanisms. While genomic DNA has traditionally been considered to be its most critical anticancer target, several lines of evidence suggest that various RNAs and other biomolecules may play a role in its anticancer mode of action. In this report we demonstrate that cisplatin modifies pre-miR-200b, impairs its processing to mature miRNA, and decreases miR-200b expression in ovarian cancer cells. Considering the role of miR-200b in epithelial-to-mesenchymal transition and cancer chemosensitivity, cisplatin-induced modification of pre-miR-200b and subsequent deregulation of mature miR-200b may, depending on cell context, limit anticancer activity of this important anticancer drug. More gener- ally, precursor miRNAs may be important targets of cisplatin and play a role in this drug's anticancer activity or modulate cell responses to this drug.

  3. Schizophrenia-Related Microdeletion Impairs Emotional Memory through MicroRNA-Dependent Disruption of Thalamic Inputs to the Amygdala

    Directory of Open Access Journals (Sweden)

    Tae-Yeon Eom

    2017-05-01

    Full Text Available Individuals with 22q11.2 deletion syndrome (22q11DS are at high risk of developing psychiatric diseases such as schizophrenia. Individuals with 22q11DS and schizophrenia are impaired in emotional memory, anticipating, recalling, and assigning a correct context to emotions. The neuronal circuits responsible for these emotional memory deficits are unknown. Here, we show that 22q11DS mouse models have disrupted synaptic transmission at thalamic inputs to the lateral amygdala (thalamo-LA projections. This synaptic deficit is caused by haploinsufficiency of the 22q11DS gene Dgcr8, which is involved in microRNA processing, and is mediated by the increased dopamine receptor Drd2 levels in the thalamus and by reduced probability of glutamate release from thalamic inputs. This deficit in thalamo-LA synaptic transmission is sufficient to cause fear memory deficits. Our results suggest that dysregulation of the Dgcr8–Drd2 mechanism at thalamic inputs to the amygdala underlies emotional memory deficits in 22q11DS.

  4. Schizophrenia-Related Microdeletion Impairs Emotional Memory through MicroRNA-Dependent Disruption of Thalamic Inputs to the Amygdala.

    Science.gov (United States)

    Eom, Tae-Yeon; Bayazitov, Ildar T; Anderson, Kara; Yu, Jing; Zakharenko, Stanislav S

    2017-05-23

    Individuals with 22q11.2 deletion syndrome (22q11DS) are at high risk of developing psychiatric diseases such as schizophrenia. Individuals with 22q11DS and schizophrenia are impaired in emotional memory, anticipating, recalling, and assigning a correct context to emotions. The neuronal circuits responsible for these emotional memory deficits are unknown. Here, we show that 22q11DS mouse models have disrupted synaptic transmission at thalamic inputs to the lateral amygdala (thalamo-LA projections). This synaptic deficit is caused by haploinsufficiency of the 22q11DS gene Dgcr8, which is involved in microRNA processing, and is mediated by the increased dopamine receptor Drd2 levels in the thalamus and by reduced probability of glutamate release from thalamic inputs. This deficit in thalamo-LA synaptic transmission is sufficient to cause fear memory deficits. Our results suggest that dysregulation of the Dgcr8-Drd2 mechanism at thalamic inputs to the amygdala underlies emotional memory deficits in 22q11DS. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Function and dynamics of aptamers: A case study on the malachite green aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Tianjiao [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH- is sterically excluded from the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD

  6. Development of an aptamer-based concentration method for the detection of Trypanosoma cruzi in blood.

    Directory of Open Access Journals (Sweden)

    Rana Nagarkatti

    Full Text Available Trypanosoma cruzi, a blood-borne parasite, is the etiological agent of Chagas disease. T. cruzi trypomastigotes, the infectious life cycle stage, can be detected in blood of infected individuals using PCR-based methods. However, soon after a natural infection, or during the chronic phase of Chagas disease, the number of parasites in blood may be very low and thus difficult to detect by PCR. To facilitate PCR-based detection methods, a parasite concentration approach was explored. A whole cell SELEX strategy was utilized to develop serum stable RNA aptamers that bind to live T. cruzi trypomastigotes. These aptamers bound to the parasite with high affinities (8-25 nM range. The highest affinity aptamer, Apt68, also demonstrated high specificity as it did not interact with the insect stage epimastigotes of T. cruzi nor with other related trypanosomatid parasites, L. donovani and T. brucei, suggesting that the target of Apt68 was expressed only on T. cruzi trypomastigotes. Biotinylated Apt68, immobilized on a solid phase, was able to capture live parasites. These captured parasites were visible microscopically, as large motile aggregates, formed when the aptamer coated paramagnetic beads bound to the surface of the trypomastigotes. Additionally, Apt68 was also able to capture and aggregate trypomastigotes from several isolates of the two major genotypes of the parasite. Using a magnet, these parasite-bead aggregates could be purified from parasite-spiked whole blood samples, even at concentrations as low as 5 parasites in 15 ml of whole blood, as detected by a real-time PCR assay. Our results show that aptamers can be used as pathogen specific ligands to capture and facilitate PCR-based detection of T. cruzi in blood.

  7. Recent progresses in biomedical applications of aptamer-functionalized systems.

    Science.gov (United States)

    Ding, Fei; Gao, Yangguang; He, Xianran

    2017-09-15

    Aptamers, known as "chemical antibodies" are screened via a combinational technology of systematic evolution of ligands by exponential enrichment (SELEX). Due to their specific targeting ability, high binding affinity, low immunogenicity and easy modification, aptamer-functionalized systems have been extensively applied in various fields and exhibit favorable results. However, there is still a long way for them to be commercialized, and few aptamer-functionalized systems have yet successfully entered clinical and industrial use. Thus, it is necessary to overview the recent research progresses of aptamer-functionalized systems for the researchers to improve or design novel and better aptamer-functionalized systems. In this review, we first introduce the recent progresses of aptamer-functionalized systems' applications in biosensing, targeted drug delivery, gene therapy and cancer cell imaging, followed by a discussion of the challenges faced with extensive applications of aptamer-functionalized systems and speculation of the future prospects of them. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation.

    Science.gov (United States)

    Lao, Yeh-Hsing; Phua, Kyle K L; Leong, Kam W

    2015-03-24

    Aptamer nanomedicine, including therapeutic aptamers and aptamer nanocomplexes, is beginning to fulfill its potential in both clinical trials and preclinical studies. Especially in oncology, aptamer nanomedicine may perform better than conventional or antibody-based chemotherapeutics due to specificity compared to the former and stability compared to the latter. Many proof-of-concept studies on applying aptamers to drug delivery, gene therapy, and cancer imaging have shown promising efficacy and impressive safety in vivo toward translation. Yet, there remains ample room for improvement and critical barriers to be addressed. In this review, we will first introduce the recent progress in clinical trials of aptamer nanomedicine, followed by a discussion of the barriers at the design and in vivo application stages. We will then highlight recent advances and engineering strategies proposed to tackle these barriers. Aptamer cancer nanomedicine has the potential to address one of the most important healthcare issues of the society.

  9. Aptamer Based Microsphere Biosensor for Thrombin Detection

    Directory of Open Access Journals (Sweden)

    Xudong Fan

    2006-08-01

    Full Text Available We have developed an optical microsphere resonator biosensor using aptamer asreceptor for the measurement of the important biomolecule thrombin. The sphere surface ismodified with anti-thrombin aptamer, which has excellent binding affinity and selectivityfor thrombin. Binding of the thrombin at the sphere surface is monitored by the spectralposition of the microsphere’s whispering gallery mode resonances. A detection limit on theorder of 1 NIH Unit/mL is demonstrated. Control experiments with non-aptameroligonucleotide and BSA are also carried out to confirm the specific binding betweenaptamer and thrombin. We expect that this demonstration will lead to the development ofhighly sensitive biomarker sensors based on aptamer with lower cost and higher throughputthan current technology.

  10. Development of aptamers against unpurified proteins.

    Science.gov (United States)

    Goto, Shinichi; Tsukakoshi, Kaori; Ikebukuro, Kazunori

    2017-12-01

    SELEX (Systematic Evolution of Ligands by EXponential enrichment) has been widely used for the generation of aptamers against target proteins. However, its requirement for pure target proteins remains a major problem in aptamer selection, as procedures for protein purification from crude bio-samples are not only complicated but also time and labor consuming. This is because native proteins can be found in a large number of diverse forms because of posttranslational modifications and their complicated molecular conformations. Moreover, several proteins are difficult to purify owing to their chemical fragility and/or rarity in native samples. An alternative route is the use of recombinant proteins for aptamer selection, because they are homogenous and easily purified. However, aptamers generated against recombinant proteins produced in prokaryotic cells may not interact with the same proteins expressed in eukaryotic cells because of posttranslational modifications. Moreover, to date recombinant proteins have been constructed for only a fraction of proteins expressed in the human body. Therefore, the demand for advanced SELEX methods not relying on complicated purification processes from native samples or recombinant proteins is growing. This review article describes several such techniques that allow researchers to directly develop an aptamer from various unpurified samples, such as whole cells, tissues, serum, and cell lysates. The key advantages of advanced SELEX are that it does not require a purification process from a crude bio-sample, maintains the functional states of target proteins, and facilitates the development of aptamers against unidentified and uncharacterized proteins in unpurified biological samples. © 2017 Wiley Periodicals, Inc.

  11. Thrombin–aptamer recognition: a revealed ambiguity

    OpenAIRE

    Russo Krauss, Irene; Merlino, Antonello; Giancola, Concetta; Randazzo, Antonio; Mazzarella, Lelio; Sica, Filomena

    2011-01-01

    Aptamers are structured oligonucleotides that recognize molecular targets and can function as direct protein inhibitors. The best-known example is the thrombin-binding aptamer, TBA, a single-stranded 15-mer DNA that inhibits the activity of thrombin, the key enzyme of coagulation cascade. TBA folds as a G-quadruplex structure, as proved by its NMR structure. The X-ray structure of the complex between TBA and human α-thrombin was solved at 2.9-Å resolution, but did not provide details of the a...

  12. Colorimetric detection with aptamer-gold nanoparticle conjugates: effect of aptamer length on response

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, Jorge L. [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States); MacCuspie, Robert I. [National Institute of Standards and Technology, Ceramics Division (United States); Stone, Morley O.; Kelley-Loughnane, Nancy, E-mail: Nancy.Kelley-Loughnane@wpafb.af.mil [Wright-Patterson Air Force Base, 711th Human Performance Wing, Human Effectiveness Directorate, Air Force Research Laboratory (United States)

    2012-10-15

    A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA-AuNP conjugates (RBA-AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA-AuNPs' stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5 Prime end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA-AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA-AuNPs' stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer-AuNPs conjugates and their sensing response.

  13. Dwarfism and impaired gut development in insulin-like growth factor II mRNA-binding protein 1-deficient mice

    DEFF Research Database (Denmark)

    Hansen, Thomas V O; Hammer, Niels A; Nielsen, Jacob

    2004-01-01

    Insulin-like growth factor II mRNA-binding protein 1 (IMP1) belongs to a family of RNA-binding proteins implicated in mRNA localization, turnover, and translational control. Mouse IMP1 is expressed during early development, and an increase in expression occurs around embryonic day 12.5 (E12.5). T...

  14. Structure and Sequence Search on Aptamer-Protein Docking

    Science.gov (United States)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  15. Rapid Complexation of Aptamers by Their Specific Antidotes

    Directory of Open Access Journals (Sweden)

    Heidi Stoll

    2017-06-01

    Full Text Available Nucleic acid ligands, aptamers, harbor the unique characteristics of small molecules and antibodies. The specificity and high affinity of aptamers enable their binding to different targets, such as small molecules, proteins, or cells. Chemical modifications of aptamers allow increased bioavailability. A further great benefit of aptamers is the antidote (AD-mediated controllability of their effect. In this study, the AD-mediated complexation and neutralization of the thrombin binding aptamer NU172 and Toll-like receptor 9 (TLR9 binding R10-60 aptamer were determined. Thereby, the required time for the generation of aptamer/AD-complexes was analyzed at 37 °C in human serum using gel electrophoresis. Afterwards, the blocking of aptamers’ effects was analyzed by determining the activated clotting time (ACT in the case of the NU172 aptamer, or the expression of immune activation related genes IFN-1β, IL-6, CXCL-10, and IL-1β in the case of the R10-60 aptamer. Gel electrophoresis analyses demonstrated the rapid complexation of the NU172 and R10-60 aptamers by complementary AD binding after just 2 min of incubation in human serum. A rapid neutralization of anticoagulant activity of NU172 was also demonstrated in fresh human whole blood 5 min after addition of AD. Furthermore, the TLR9-mediated activation of PMDC05 cells was interrupted after the addition of the R10-60 AD. Using these two different aptamers, the rapid antagonizability of the aptamers was demonstrated in different environments; whole blood containing numerous proteins, cells, and different small molecules, serum, or cell culture media. Thus, nucleic acid ADs are promising molecules, which offer several possibilities for different in vivo applications, such as antagonizing aptamer-based drugs, immobilization, or delivery of oligonucleotides to defined locations.

  16. Hierarchy and Assortativity as New Tools for Binding-Affinity Investigation: The Case of the TBA Aptamer-Ligand Complex.

    Science.gov (United States)

    Cataldo, Rosella; Alfinito, Eleonora; Reggiani, Lino

    2017-12-01

    Aptamers are single stranded DNA, RNA, or peptide sequences having the ability to bind several specific targets (proteins, molecules as well as ions). Therefore, aptamer production and selection for therapeutic and diagnostic applications is very challenging. Usually, they are generated in vitro, although computational approaches have been recently developed for the in silico production. Despite these efforts, the mechanism of aptamer-ligand formation is not completely clear, and producing high-affinity aptamers is still quite difficult. This paper aims to develop a computational model able to describe aptamer-ligand affinity. Topological tools, such as the conventional degree distribution, the rank-degree distribution (hierarchy), and the node assortativity are employed. In doing so, the macromolecules tertiary-structures are mapped into appropriate graphs. These graphs reproduce the main topological features of the macromolecules, by preserving the distances between amino acids (nucleotides). Calculations are applied to the thrombin binding aptamer (TBA), and the TBA-thrombin complex produced in the presence of Na + or K + . The topological analysis is able to detect several differences between complexes obtained in the presence of the two cations, as expected by previous investigations. These results support graph analysis as a novel computational tool for testing affinity. Otherwise, starting from the graphs, an electrical network can be obtained by using the specific electrical properties of amino acids and nucleobases. Therefore, a further analysis concerns with the electrical response, revealing that the resistance is sensitively affected by the presence of sodium or potassium, thus suggesting resistance as a useful physical parameter for testing binding affinity.

  17. Comparison of classifications of aptamers against Vibrio ...

    African Journals Online (AJOL)

    ELO

    2012-01-05

    Jan 5, 2012 ... research on selection of aptamers against pathogens. MATERIALS AND .... actually stem from the variations in the middle sequences, it is essential to ... loops that are connected by double strand DNA, so the two loops are in ...

  18. Diagnosis of active TB using aptamers

    CSIR Research Space (South Africa)

    Khati, M

    2013-08-01

    Full Text Available of the disease. We have shown in a proof-of-concept case-controlled study that the aptamer-based diagnostic tool was able to accurately detect all cases of active TB from sputum samples of patients, including smear-negative culture positive and samples from...

  19. MicroRNA-Mediated Rescue of Fear Extinction Memory by miR-144-3p in Extinction-Impaired Mice.

    Science.gov (United States)

    Murphy, Conor P; Li, Xiang; Maurer, Verena; Oberhauser, Michael; Gstir, Ronald; Wearick-Silva, Luis Eduardo; Viola, Thiago Wendt; Schafferer, Simon; Grassi-Oliveira, Rodrigo; Whittle, Nigel; Hüttenhofer, Alexander; Bredy, Timothy W; Singewald, Nicolas

    2017-06-15

    MicroRNA (miRNA)-mediated control of gene expression suggests that miRNAs are interesting targets and/or biomarkers in the treatment of anxiety- and trauma-related disorders, where often memory-associated gene expression is adversely affected. The role of miRNAs in the rescue of impaired fear extinction was assessed using the 129S1/SvlmJ (S1) mouse model of impaired fear extinction. miRNA microarray analysis, reverse transcription polymerase chain reaction, fluorescent in situ hybridization, lentiviral overexpression, and Luciferase reporter assays were used to gain insight into the mechanisms underlying miRNA-mediated normalization of deficient fear extinction. Rescuing impaired fear extinction via dietary zinc restriction was associated with differential expression of miRNAs in the amygdala. One candidate, miR-144-3p, robustly expressed in the basolateral amygdala, showed specific extinction-induced, but not fear-induced, increased expression in both extinction-rescued S1 mice and extinction-intact C57BL/6 (BL6) mice. miR-144-3p upregulation and effects on subsequent behavioral adaption was assessed in S1 and BL6 mice. miR-144-3p overexpression in the basolateral amygdala rescued impaired fear extinction in S1 mice, led to enhanced fear extinction acquisition in BL6 mice, and furthermore protected against fear renewal in BL6 mice. miR-144-3p targets a number of genes implicated in the control of plasticity-associated signaling cascades, including Pten, Spred1, and Notch1. In functional interaction studies, we revealed that the miR-144-3p target, PTEN, colocalized with miR-144-3p in the basolateral amygdala and showed functional downregulation following successful fear extinction in S1 mice. These findings identify a fundamental role of miR-144-3p in the rescue of impaired fear extinction and suggest this miRNA as a viable target in developing novel treatments for posttraumatic stress disorder and related disorders. Copyright © 2017 Society of Biological

  20. Knockdown of a HIF-2α promoter upstream long noncoding RNA impairs colorectal cancer stem cell properties in vitro through HIF-2α downregulation

    Directory of Open Access Journals (Sweden)

    Yao J

    2015-11-01

    Full Text Available Jie Yao,1,* Jianxiong Li,2,* Peiliang Geng,2,* Yi Li,3,* Hong Chen,3 Yunfeng Zhu2 1Department of Oncology, People’s Liberation Army No 161 Hospital, Wuhan, 2Cancer Center, Division of Internal Medicine, Chinese PLA General Hospital, Beijing, 3Department of Oncology, Kunming General Hospital of Chendu Military Command, Kunming, People’s Republic of China *These authors contributed equally to this work Abstract: Currently, various long noncoding RNAs (lncRNAs have been identified as key regulators of multiple cancers. However, cancer stem cell (CSC-related lncRNAs have rarely been reported. In this study, we found an lncRNA that is a promoter upstream transcript of hypoxia-inducible factor-2α (HIF-2α, and we named it “lncRNA-HIF2PUT”. The function of HIF-2α is closely connected with “stem cell-like” properties, and the function of PROMPTs is often associated with the adjacent protein-coding transcripts. Herein, we showed that the expression of lncRNA-HIF2PUT was significantly correlated with HIF-2α in colorectal cancer (CRC tissues. Knockdown of lncRNA-HIF2PUT blocked the HIF-2α expression and inhibited the CSC properties in CRC cell lines DLD-1 and HT29. LncRNA-HIF2PUTsmall interfering RNA transfection resulted in decreased stemness genes expression, impaired colony formation, and spheroid formation ability, retarded migration, and invasion of the cells. These data suggest that lncRNA-HIF2PUT may be a regulator of HIF-2α and a mediator of CSCs in CRC. Keywords: HIF-2α, long noncoding RNA, colorectal cancer, stem cell properties

  1. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Directory of Open Access Journals (Sweden)

    Annamaria eRuscito

    2016-05-01

    Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  2. DNA aptamer selection and aptamer-based fluorometric displacement assay for the hepatotoxin microcystin-RR

    International Nuclear Information System (INIS)

    Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile

    2016-01-01

    Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)

  3. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis

    Science.gov (United States)

    Guo, Hong; Cooper, Stacy; Friedman, Alan D.

    2016-01-01

    The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f);CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f);Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic-specific Cebpa expression, with enhancer deletion leading to impaired myelopoiesis and potentially preleukemic progenitor expansion. PMID:26937964

  4. Selection of a Novel Aptamer Against Vitronectin Using Capillary Electrophoresis and Next Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Christopher H Stuart

    2016-01-01

    Full Text Available Breast cancer (BC results in ≃40,000 deaths each year in the United States and even among survivors treatment of the disease may have devastating consequences, including increased risk for heart disease and cognitive impairment resulting from the toxic effects of chemotherapy. Aptamer-mediated drug delivery can contribute to improved treatment outcomes through the selective delivery of chemotherapy to BC cells, provided suitable cancer-specific antigens can be identified. We report here the use of capillary electrophoresis in conjunction with next generation sequencing to develop the first vitronectin (VN binding aptamer (VBA-01; Kd 405 nmol/l, the first aptamer to vitronectin (VN; Kd = 405 nmol/l, a protein that plays an important role in wound healing and that is present at elevated levels in BC tissue and in the blood of BC patients relative to the corresponding nonmalignant tissues. We used VBA-01 to develop DVBA-01, a dimeric aptamer complex, and conjugated doxorubicin (Dox to DVBA-01 (7:1 ratio using pH-sensitive, covalent linkages. Dox conjugation enhanced the thermal stability of the complex (60.2 versus 46.5°C and did not decrease affinity for the VN target. The resulting DVBA-01-Dox complex displayed increased cytotoxicity to MDA-MB-231 BC cells that were cultured on plasticware coated with VN (1.8 × 10−6mol/l relative to uncoated plates (2.4 × 10−6 mol/l, or plates coated with the related protein fibronectin (2.1 × 10−6 mol/l. The VBA-01 aptamer was evaluated for binding to human BC tissue using immunohistochemistry and displayed tissue specific binding and apparent association with BC cells. In contrast, a monoclonal antibody that preferentially binds to multimeric VN primarily stained extracellular matrix and vessel walls of BC tissue. Our results indicate a strong potential for using VN-targeting aptamers to improve drug delivery to treat BC.

  5. Crystallization and preliminary X-ray diffraction data of an LNA 7-mer duplex derived from a ricin aptamer

    International Nuclear Information System (INIS)

    Förster, Charlotte; Oberthuer, Dominik; Gao, Jiang; Eichert, André; Quast, Frederick G.; Betzel, Christian; Nitsche, Andreas; Erdmann, Volker A.; Fürste, Jens P.

    2009-01-01

    An all-LNA duplex was designed from the stem region of an RNA aptamer which has been generated against ricin. The LNA duplex was crystallized and preliminary X-ray diffraction analysis revealed diffraction to a resolution of up to 2.8 Å. Locked nucleic acids (LNAs) are modified nucleic acids which contain a modified sugar such as β-d-2′-O,4′-C methylene-bridged ribofuranose or other sugar derivatives in LNA analogues. The β-d-2′-O,4′-C methylene ribofuranose LNAs in particular possess high stability and melting temperatures, which makes them of interest for stabilizing the structure of different nucleic acids. Aptamers, which are DNAs or RNAs targeted against specific ligands, are candidates for substitution with LNAs in order to increase their stability. A 7-mer helix derived from the terminal part of an aptamer that was targeted against ricin was chosen. The ricin aptamer originally consisted of natural RNA building blocks and showed high affinity in ricin binding. For future stabilization of the aptamer, the terminal helix has been constructed as an ‘all-locked’ LNA and was successfully crystallized in order to investigate its structural properties. Optimization of crystal growth succeeded by the use of different metal salts as additives, such as CuCl 2 , MgCl 2 , MnCl 2 , CaCl 2 , CoCl 2 and ZnSO 4 . Preliminary X-ray diffraction data were collected and processed to 2.8 Å resolution. The LNA crystallized in space group P6 5 , with unit-cell parameters a = 50.11, b = 50.11, c = 40.72 Å. The crystals contained one LNA helix per asymmetric unit with a Matthews coefficient of 3.17 Å 3 Da −1 , which implies a solvent content of 70.15%

  6. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Directory of Open Access Journals (Sweden)

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  7. Multiple RNA processing defects and impaired chloroplast function in plants deficient in the organellar protein-only RNase P enzyme.

    Directory of Open Access Journals (Sweden)

    Wenbin Zhou

    Full Text Available Transfer RNA (tRNA precursors undergo endoribonucleolytic processing of their 5' and 3' ends. 5' cleavage of the precursor transcript is performed by ribonuclease P (RNase P. While in most organisms RNase P is a ribonucleoprotein that harbors a catalytically active RNA component, human mitochondria and the chloroplasts (plastids and mitochondria of seed plants possess protein-only RNase P enzymes (PRORPs. The plant organellar PRORP (PRORP1 has been characterized to some extent in vitro and by transient gene silencing, but the molecular, phenotypic and physiological consequences of its down-regulation in stable transgenic plants have not been assessed. Here we have addressed the function of the dually targeted organellar PRORP enzyme in vivo by generating stably transformed Arabidopsis plants in which expression of the PRORP1 gene was suppressed by RNA interference (RNAi. PRORP1 knock-down lines show defects in photosynthesis, while mitochondrial respiration is not appreciably affected. In both plastids and mitochondria, the effects of PRORP1 knock-down on the processing of individual tRNA species are highly variable. The drastic reduction in the levels of mature plastid tRNA-Phe(GAA and tRNA-Arg(ACG suggests that these two tRNA species limit plastid gene expression in the PRORP1 mutants and, hence, are causally responsible for the mutant phenotype.

  8. Capture, isolation and release of cancer cells with aptamer-functionalized glass bead array.

    Science.gov (United States)

    Wan, Yuan; Liu, Yaling; Allen, Peter B; Asghar, Waseem; Mahmood, M Arif Iftakher; Tan, Jifu; Duhon, Holli; Kim, Young-tae; Ellington, Andrew D; Iqbal, Samir M

    2012-11-21

    Early detection and isolation of circulating tumor cells (CTC) can enable better prognosis for cancer patients. A Hele-Shaw device with aptamer functionalized glass beads is designed, modeled, and fabricated to efficiently isolate cancer cells from a cellular mixture. The glass beads are functionalized with anti-epidermal growth factor receptor (EGFR) aptamer and sit in ordered array of pits in polydimethylsiloxane (PDMS) channel. A PDMS encapsulation is then used to cover the channel and to flow through cell solution. The beads capture cancer cells from flowing solution depicting high selectivity. The cell-bound glass beads are then re-suspended from the device surface followed by the release of 92% cells from glass beads using combination of soft shaking and anti-sense RNA. This approach ensures that the cells remain in native state and undisturbed during capture, isolation and elution for post-analysis. The use of highly selective anti-EGFR aptamer with the glass beads in an array and subsequent release of cells with antisense molecules provide multiple levels of binding and release opportunities that can help in defining new classes of CTC enumeration devices.

  9. Chlorin e6 Conjugated Interleukin-6 Receptor Aptamers Selectively Kill Target Cells Upon Irradiation

    Directory of Open Access Journals (Sweden)

    Sven Kruspe

    2014-01-01

    Full Text Available Photodynamic therapy (PDT uses the therapeutic properties of light in combination with certain chemicals, called photosensitizers, to successfully treat brain, breast, prostate, and skin cancers. To improve PDT, current research focuses on the development of photosensitizers to specifically target cancer cells. In the past few years, aptamers have been developed to directly deliver cargo molecules into target cells. We conjugated the photosensitizer chlorin e6 (ce6 with a human interleukin-6 receptor (IL-6R binding RNA aptamer, AIR-3A yielding AIR-3A-ce6 for application in high efficient PDT. AIR-3A-ce6 was rapidly and specifically internalized by IL-6R presenting (IL-6R+ cells. Upon light irradiation, targeted cells were selectively killed, while free ce6 did not show any toxic effect. Cells lacking the IL-6R were also not affected by AIR-3A-ce6. With this approach, we improved the target specificity of ce6-mediated PDT. In the future, other tumor-specific aptamers might be used to selectively localize photosensitizers into cells of interest and improve the efficacy and specificity of PDT in cancer and other diseases.

  10. Comparing human pancreatic cell secretomes by in vitro aptamer selection identifies cyclophilin B as a candidate pancreatic cancer biomarker.

    Science.gov (United States)

    Ray, Partha; Rialon-Guevara, Kristy L; Veras, Emanuela; Sullenger, Bruce A; White, Rebekah R

    2012-05-01

    Most cases of pancreatic cancer are not diagnosed until they are no longer curable with surgery. Therefore, it is critical to develop a sensitive, preferably noninvasive, method for detecting the disease at an earlier stage. In order to identify biomarkers for pancreatic cancer, we devised an in vitro positive/negative selection strategy to identify RNA ligands (aptamers) that could detect structural differences between the secretomes of pancreatic cancer and non-cancerous cells. Using this molecular recognition approach, we identified an aptamer (M9-5) that differentially bound conditioned media from cancerous and non-cancerous human pancreatic cell lines. This aptamer further discriminated between the sera of pancreatic cancer patients and healthy volunteers with high sensitivity and specificity. We utilized biochemical purification methods and mass-spectrometric analysis to identify the M9-5 target as cyclophilin B (CypB). This molecular recognition-based strategy simultaneously identified CypB as a serum biomarker and generated a new reagent to recognize it in body fluids. Moreover, this approach should be generalizable to other diseases and complementary to traditional approaches that focus on differences in expression level between samples. Finally, we suggest that the aptamer we identified has the potential to serve as a tool for the early detection of pancreatic cancer.

  11. Identification and expression of troponin T, a new marker on the surface of cultured tumor endothelial cells by aptamer ligand

    International Nuclear Information System (INIS)

    Ara, Mst Naznin; Hyodo, Mamoru; Ohga, Noritaka; Akiyama, Kosuke; Hida, Kyoko; Hida, Yasuhiro; Shinohara, Nobuo; Harashima, Hideyoshi

    2014-01-01

    The identification of a specific biomarker involves the development of new clinical diagnostic tools, and an in-depth understanding of the disease at the molecular level. When new blood vessels form in tumor cells, endothelial cell production is induced, a process that plays a key role in disease progression and metastasis to distinct organs for solid tumor types. The present study reports on the identification of a new biomarker on primary cultured mouse tumor endothelial cells (mTECs) using our recently developed high-affinity DNA aptamer AraHH001 (K d = 43 nmol/L) assisted proteomics approach. We applied a strategy involving aptamer-facilitated biomarker discovery. Biotin-tagged AraHH001 was incubated with lysates of mTECs and the aptamer-proteins were then conjugated with streptavidin magnetic beads. Finally, the bound proteins were separated by sodiumdodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with silver staining. We identified troponin T via matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, the molecular target of aptamer AraHH001, and its presence was confirmed by measuring mRNA, protein levels, western blot, immunostaining, a gel shift assay of AraHH001 with troponin T. We first report here on the discovery of troponin T on mTECs, a promising and interesting diagnostic tool in the development of antiangiogenic therapy techniques the involves the targeting of the tumor vasculature

  12. Prenatal Stress Impairs Spatial Learning and Memory Associated with Lower mRNA Level of the CAMKII and CREB in the Adult Female Rat Hippocampus.

    Science.gov (United States)

    Sun, Hongli; Wu, Haibin; Liu, Jianping; Wen, Jun; Zhu, Zhongliang; Li, Hui

    2017-05-01

    Prenatal stress (PS) results in various behavioral and emotional alterations observed in later life. In particular, PS impairs spatial learning and memory processes but the underlying mechanism involved in this pathogenesis still remains unknown. Here, we reported that PS lowered the body weight in offspring rats, particularly in female rats, and impaired spatial learning and memory of female offspring rats in the Morris water maze. Correspondingly, the decreased CaMKII and CREB mRNA in the hippocampus were detected in prenatally stressed female offspring, which partially explained the effect of PS on the spatial learning and memory. Our findings suggested that CaMKII and CREB may be involved in spatial learning and memory processes in the prenatally stressed adult female offspring.

  13. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target...

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. Aptamers as Both Drugs and Drug-Carriers

    Directory of Open Access Journals (Sweden)

    Md. Ashrafuzzaman

    2014-01-01

    Full Text Available Aptamers are short nucleic acid oligos. They may serve as both drugs and drug-carriers. Their use as diagnostic tools is also evident. They can be generated using various experimental, theoretical, and computational techniques. The systematic evolution of ligands by exponential enrichment which uses iterative screening of nucleic acid libraries is a popular experimental technique. Theory inspired methodology entropy-based seed-and-grow strategy that designs aptamer templates to bind specifically to targets is another one. Aptamers are predicted to be highly useful in producing general drugs and theranostic drugs occasionally for certain diseases like cancer, Alzheimer’s disease, and so on. They bind to various targets like lipids, nucleic acids, proteins, small organic compounds, and even entire organisms. Aptamers may also serve as drug-carriers or nanoparticles helping drugs to get released in specific target regions. Due to better target specific physical binding properties aptamers cause less off-target toxicity effects. Therefore, search for aptamer based drugs, drug-carriers, and even diagnostic tools is expanding fast. The biophysical properties in relation to the target specific binding phenomena of aptamers, energetics behind the aptamer transport of drugs, and the consequent biological implications will be discussed. This review will open up avenues leading to novel drug discovery and drug delivery.

  16. Synthesis of heterocycles: Indolo (2,1-a) isoquinolines, renewables, and aptamer ligands for cellular imaging

    Energy Technology Data Exchange (ETDEWEB)

    Beasley, Jonathan [Ames Laboratory (AMES), Ames, IA (United States)

    2013-01-01

    In this thesis, we explore both total syntheses and methodologies of several aromatic heterocyclic molecules. Extensions of the Kraus indole synthesis toward 2-substituted and 2,3-disubstituted indoles, as well as biologically attractive indolo[2,1-a]isoquinolines are described. Recent renewable efforts directed to commodity maleic acid and the first reported furan-based ionic liquids are described. Our total synthesis of mRNA aptamer ligand PDC-Gly, and its dye coupled forms, plus aminoglycoside dye coupled ligands used in molecular imaging, are described.

  17. Comparison of a preQ1 riboswitch aptamer in metabolite-bound and free states with implications for gene regulation.

    Science.gov (United States)

    Jenkins, Jermaine L; Krucinska, Jolanta; McCarty, Reid M; Bandarian, Vahe; Wedekind, Joseph E

    2011-07-15

    Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters expression signal accessibility. Here we present crystal structures of the preQ(1) riboswitch from Thermoanaerobacter tengcongensis in the preQ(1)-bound and free states. Although the mode of preQ(1) recognition is similar to that observed for preQ(0), surface plasmon resonance revealed an apparent K(D) of 2.1 ± 0.3 nm for preQ(1) but a value of 35.1 ± 6.1 nm for preQ(0). This difference can be accounted for by interactions between the preQ(1) methylamine and base G5 of the aptamer. To explore conformational states in the absence of metabolite, the free-state aptamer structure was determined. A14 from the ceiling of the ligand pocket shifts into the preQ(1)-binding site, resulting in "closed" access to the metabolite while simultaneously increasing exposure of the ribosome-binding site. Solution scattering data suggest that the free-state aptamer is compact, but the "closed" free-state crystal structure is inadequate to describe the solution scattering data. These observations are distinct from transcriptional preQ(1) riboswitches of the same class that exhibit strictly ligand-dependent folding. Implications for gene regulation are discussed.

  18. Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri.

    Science.gov (United States)

    Shin, Woo-Ri; Sekhon, Simranjeet Singh; Rhee, Sung-Keun; Ko, Jung Ho; Ahn, Ji-Young; Min, Jiho; Kim, Yang-Hoon

    2018-05-14

    Aptamer-based paper strip sensor for detecting Vibrio fischeri was developed. Our method was based on the aptamer sandwich assay between whole live cells, V. fischeri and DNA aptamer probes. Following 9 rounds of Cell-SELEX and one of the negative-SELEX, V. fischeri Cell Aptamer (VFCA)-02 and -03 were isolated, with the former showing approximately 10-fold greater avidity (in the subnanomolar range) for the target cells when arrayed on a surface. The colorimetric response of a paper sensor based on VFCA-02 was linear in the range of 4 × 10 1 to 4 × 10 5 CFU/mL of target cell by using scanning reader. The linear regression correlation coefficient ( R 2 ) was 0.9809. This system shows promise for use in aptamer-conjugated gold nanoparticle probes in paper strip format for in-field detection of marine bioindicating bacteria.

  19. High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces

    Directory of Open Access Journals (Sweden)

    Orada Chumphukam

    2014-04-01

    Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.

  20. Aptamer-assembled nanomaterials for fluorescent sensing and imaging

    Science.gov (United States)

    Lu, Danqing; He, Lei; Zhang, Ge; Lv, Aiping; Wang, Ruowen; Zhang, Xiaobing; Tan, Weihong

    2017-01-01

    Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX), represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.

  1. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity.

    Science.gov (United States)

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong

    2016-06-01

    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries. © The Author 2016. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Ex Vivo and In Vivo Imaging and Biodistribution of Aptamers Targeting the Human Matrix MetalloProtease-9 in Melanomas.

    Directory of Open Access Journals (Sweden)

    David Kryza

    Full Text Available The human Matrix MetalloProtease-9 (hMMP-9 is overexpressed in tumors where it promotes the release of cancer cells thus contributing to tumor metastasis. We raised aptamers against hMMP-9, which constitutes a validated marker of malignant tumors, in order to design probes for imaging tumors in human beings. A chemically modified RNA aptamer (F3B, fully resistant to nucleases was previously described. This compound was subsequently used for the preparation of F3B-Cy5, F3B-S-acetylmercaptoacetyltriglycine (MAG and F3B-DOTA. The binding properties of these derivatives were determined by surface plasmon resonance and electrophoretic mobility shift assay. Optical fluorescence imaging confirmed the binding to hMMP-9 in A375 melanoma bearing mice. Quantitative biodistribution studies were performed at 30 min, 1h and 2 h post injection of 99mTc-MAG-aptamer and 111In-DOTA-F3B. 99mTc radiolabeled aptamer specifically detected hMMP-9 in A375 melanoma tumors but accumulation in digestive tract was very high. Following i.v. injection of 111In-DOTA-F3B, high level of radioactivity was observed in kidneys and bladder but digestive tract uptake was very limited. Tumor uptake was significantly (student t test, p<0.05 higher for 111In-DOTA-F3B with 2.0%ID/g than for the 111In-DOTA-control oligonucleotide (0.7%ID/g with tumor to muscle ratio of 4.0. Such difference in tumor accumulation has been confirmed by ex vivo scintigraphic images performed at 1h post injection and by autoradiography, which revealed the overexpression of hMMP-9 in sections of human melanomas. These results demonstrate that F3B aptamer is of interest for detecting hMMP-9 in melanoma tumor.

  3. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF......) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly...... in one-step, technique is required for developing aptamers in limited time period. Principal Findings: Herein, we present a simple one-step selection of DNA aptamers against alpha-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed...

  4. Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry.

    Science.gov (United States)

    Bayraç, Ceren; Öktem, Hüseyin Avni

    2017-02-01

    To monitor the specificity of Staphylococcus aureus aptamer (SA-31) against its target cell, we used enzyme-linked aptamer assay. In the presence of target cell, horseradish peroxidase-conjugated streptavidin bound to biotin-labeled SA-31 showed specific binding to S  aureus among 3 different bacteria with limit of detection of 10 3 colony-forming unit per milliliter. The apparent K a was 1.39 μM -1  ± 0.3 μM -1 . The binding of SA-31 to membrane proteins extracted from cell surface was characterized using isothermal titration calorimetry, and the effect of changes in binding temperature and salt concentrations of binding buffer was evaluated based on thermodynamic parameters (K a , ΔH, and ΔG). Since binding of aptamer to its targets solely depends on its 3-dimensional structure under experimental conditions used in selection process, the change in temperature and ion concentration changed the affinity of SA-31 to its target on surface of bacteria. At 4°C, SA-31 did not show an affinity to its target with poor heat change upon injection of membrane fraction to aptamer solution. However, the apparent association constants of SA-31 slightly varied from K a  = 1.56 μM -1  ± 0.69 μM -1 at 25°C to K a  = 1.03 μM -1  ± 0.9 μM -1 at 37°C. At spontaneously occurring exothermic binding reactions, affinities of S aureus aptamer to its target were also 9.44 μM -1  ± 0.38 μM -1 at 50mM, 1.60 μM -1  ± 0.11 μM -1 at 137mM, and 3.28 μM -1  ± 0.46 μM -1 at 200 mM of salt concentration. In this study, it was demonstrated that enzyme-linked aptamer assay and isothermal titration calorimetry were useful tools for studying the fundamental binding mechanism between a DNA aptamer and its target on the outer surface of S aureus. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Impaired RNA splicing of 5'-regulatory sequences of the astroglial glutamate transporter EAAT2 in human astrocytoma

    NARCIS (Netherlands)

    Münch, C.; Penndorf, A.; Schwalenstöcker, B.; Troost, D.; Ludolph, A. C.; Ince, P.; Meyer, T.

    2001-01-01

    A loss of the glutamate transporter EAAT2 has been reported in the neoplastic transformation of astrocytic cells and astrocytoma. The RNA expression of EAAT2 and five 5'-regulatory splice variants was investigated to identify alterations of the post-transcriptional EAAT2 gene regulation in human

  6. Hyperthyroidism, but not hypertension, impairs PITX2 expression leading to Wnt-microRNA-ion channel remodeling.

    Directory of Open Access Journals (Sweden)

    Estefanía Lozano-Velasco

    Full Text Available PITX2 is a homeobox transcription factor involved in embryonic left/right signaling and more recently has been associated to cardiac arrhythmias. Genome wide association studies have pinpointed PITX2 as a major player underlying atrial fibrillation (AF. We have previously described that PITX2 expression is impaired in AF patients. Furthermore, distinct studies demonstrate that Pitx2 insufficiency leads to complex gene regulatory network remodeling, i.e. Wnt>microRNAs, leading to ion channel impairment and thus to arrhythmogenic events in mice. Whereas large body of evidences has been provided in recent years on PITX2 downstream signaling pathways, scarce information is available on upstream pathways influencing PITX2 in the context of AF. Multiple risk factors are associated to the onset of AF, such as e.g. hypertension (HTN, hyperthyroidism (HTD and redox homeostasis impairment. In this study we have analyzed whether HTN, HTD and/or redox homeostasis impact on PITX2 and its downstream signaling pathways. Using rat models for spontaneous HTN (SHR and experimentally-induced HTD we have observed that both cardiovascular risk factors lead to severe Pitx2 downregulation. Interesting HTD, but not SHR, leads to up-regulation of Wnt signaling as well as deregulation of multiple microRNAs and ion channels as previously described in Pitx2 insufficiency models. In addition, redox signaling is impaired in HTD but not SHR, in line with similar findings in atrial-specific Pitx2 deficient mice. In vitro cell culture analyses using gain- and loss-of-function strategies demonstrate that Pitx2, Zfhx3 and Wnt signaling influence redox homeostasis in cardiomyocytes. Thus, redox homeostasis seems to play a pivotal role in this setting, providing a regulatory feedback loop. Overall these data demonstrate that HTD, but not HTN, can impair Pitx2>>Wnt pathway providing thus a molecular link to AF.

  7. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  8. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    Directory of Open Access Journals (Sweden)

    Huseyin Avni Oktem

    2011-08-01

    Full Text Available Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  9. Development of aptamers for in vivo and in vitro biosensor applications

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm

    block chemicals are now being sustainably produced in bacterial cell-factories. The development of new bacterial cell-factories is a difficult and expensive process, in part due to time required to screen for and optimize productions strains. A new promising way of reducing the development time...... is generating new and faster ways of screening and optimizing using biosensors. In this thesis we develop new functional biological recognition modules for biosensors. These DNA- and RNA-based recognition modules are called aptamers and are developed to interact with targets of choice. Aptamers are developed...... application) and small molecule food additives (for optimization production in cell factories). Additionally, the characterization an all-polymer physicochemical biosensor is presented for the detection of antibiotics in food products. These results have lead to the ongoing development of a high...

  10. Optimizing Stem Length To Improve Ligand Selectivity in a Structure-Switching Cocaine-Binding Aptamer.

    Science.gov (United States)

    Neves, Miguel A D; Shoara, Aron A; Reinstein, Oren; Abbasi Borhani, Okty; Martin, Taylor R; Johnson, Philip E

    2017-10-27

    Understanding how aptamer structure and function are related is crucial in the design and development of aptamer-based biosensors. We have analyzed a series of cocaine-binding aptamers with different lengths of their stem 1 in order to understand the role that this stem plays in the ligand-induced structure-switching binding mechanism utilized in many of the sensor applications of this aptamer. In the cocaine-binding aptamer, the length of stem 1 controls whether the structure-switching binding mechanism for this aptamer occurs or not. We varied the length of stem 1 from being one to seven base pairs long and found that the structural transition from unfolded to folded in the unbound aptamer is when the aptamer elongates from 3 to 4 base pairs in stem 1. We then used this knowledge to achieve new binding selectivity of this aptamer for quinine over cocaine by using an aptamer with a stem 1 two base pairs long. This selectivity is achieved by means of the greater affinity quinine has for the aptamer compared with cocaine. Quinine provides enough free energy to both fold and bind the 2-base pair-long aptamer while cocaine does not. This tuning of binding selectivity of an aptamer by reducing its stability is likely a general mechanism that could be used to tune aptamer specificity for tighter binding ligands.

  11. Cockayne syndrome: report of a Brazilian family with confirmation of impaired RNA synthesis after UV-irradiation

    Directory of Open Access Journals (Sweden)

    Karam Simone M.

    2000-01-01

    Full Text Available Cockayne syndrome (CS is an autosomal recessive disorder characterized by dwarfism, growth deficiency, neurological deterioration, skin photosensitivity and a characteristic progressive facial appearance. In the present study we report the first Brazilian CS family in which diagnosis was confirmed by the demonstration of decreased RNA synthesis in cultured fibroblasts exposed to UV-C radiation. Despite the progressive course of the disease and the unavailability of an effective treatment, diagnosis may be very important for the benefits to be gained by the afflicted family from genetic counseling and/or prenatal diagnosis.

  12. Aptamer-Based Electrochemical Sensing of Lysozyme

    Directory of Open Access Journals (Sweden)

    Alina Vasilescu

    2016-06-01

    Full Text Available Protein analysis and quantification are required daily by thousands of laboratories worldwide for activities ranging from protein characterization to clinical diagnostics. Multiple factors have to be considered when selecting the best detection and quantification assay, including the amount of protein available, its concentration, the presence of interfering molecules, as well as costs and rapidity. This is also the case for lysozyme, a 14.3-kDa protein ubiquitously present in many organisms, that has been identified with a variety of functions: antibacterial activity, a biomarker of several serious medical conditions, a potential allergen in foods or a model of amyloid-type protein aggregation. Since the design of the first lysozyme aptamer in 2001, lysozyme became one of the most intensively-investigated biological target analytes for the design of novel biosensing concepts, particularly with regards to electrochemical aptasensors. In this review, we discuss the state of the art of aptamer-based electrochemical sensing of lysozyme, with emphasis on sensing in serum and real samples.

  13. A mutation in the glutamate-rich region of RNA-binding motif protein 20 causes dilated cardiomyopathy through missplicing of titin and impaired Frank-Starling mechanism

    DEFF Research Database (Denmark)

    Beqqali, Abdelaziz; Bollen, I. A. E.; Rasmussen, T. B.

    2016-01-01

    Mutations in the RS-domain of RNA-binding motif protein 20 (RBM20) have recently been identified to segregate with aggressive forms of familial dilated cardiomyopathy (DCM). Loss of RBM20 in rats results in missplicing of the sarcomeric gene titin (TTN). The functional and physiological consequen......Mutations in the RS-domain of RNA-binding motif protein 20 (RBM20) have recently been identified to segregate with aggressive forms of familial dilated cardiomyopathy (DCM). Loss of RBM20 in rats results in missplicing of the sarcomeric gene titin (TTN). The functional and physiological...... consequences of RBM20 mutations outside the mutational hotspot of RBM20 have not been explored to date. In this study, we investigated the pathomechanism of DCM caused by a novel RBM20 mutation in human cardiomyocytes. We identified a family with DCM carrying a mutation (RBM20(E913K/+)) in a glutamate...... to the early onset, and malignant course of DCM caused by RBM20 mutations. Altogether, our results demonstrate that heterozygous loss of RBM20 suffices to profoundly impair myocyte biomechanics by its disturbance of TTN splicing....

  14. The 5'-poly(A leader of poxvirus mRNA confers a translational advantage that can be achieved in cells with impaired cap-dependent translation.

    Directory of Open Access Journals (Sweden)

    Pragyesh Dhungel

    2017-08-01

    Full Text Available The poly(A leader at the 5'-untranslated region (5'-UTR is an unusually striking feature of all poxvirus mRNAs transcribed after viral DNA replication (post-replicative mRNAs. These poly(A leaders are non-templated and of heterogeneous lengths; and their function during poxvirus infection remains a long-standing question. Here, we discovered that a 5'-poly(A leader conferred a selective translational advantage to mRNA in poxvirus-infected cells. A constitutive and uninterrupted 5'-poly(A leader with 12 residues was optimal. Because the most frequent lengths of the 5'-poly(A leaders are 8-12 residues, the result suggests that the poly(A leader has been evolutionarily optimized to boost poxvirus protein production. A 5'-poly(A leader also could increase protein production in the bacteriophage T7 promoter-based expression system of vaccinia virus, the prototypic member of poxviruses. Interestingly, although vaccinia virus post-replicative mRNAs do have 5'- methylated guanosine caps and can use cap-dependent translation, in vaccinia virus-infected cells, mRNA with a 5'-poly(A leader could also be efficiently translated in cells with impaired cap-dependent translation. However, the translation was not mediated through an internal ribosome entry site (IRES. These results point to a fundamental mechanism poxvirus uses to efficiently translate its post-replicative mRNAs.

  15. [The administration of interleukin-1beta during early postnatal develop ment impairs FGF2, but not TIMP1, mRNA expression in brain structures of adult rats].

    Science.gov (United States)

    Trofimov, A N; Zubareva, O E; Shvarts, A P; Ishchenko, A M; Klimenko, V M

    2014-09-01

    According to the Neurodevelopmental hypothesis, the long-lasting cognitive deficit in schizophrenia and other types of neuropathology may occur by injurious factors, such as hypoxia, traumas, infections that take place during pre- and postnatal development, at least at early stages. These pathological conditions are often associated with the high production of pro-inflammatory cytokine interleukin-1B (IL-1B) by the cells of immune and nervous systems. We investigated the expression of genes involved in the neuroplastic regulation (Fgf2 and Timp2) in medial prefrontal cortex and dorsal and ventral regions of hippocampus of adult rats that were treated with IL-1beta between P15 and P21. The learning impairment in IL-1beta-treated rats is accompanied by lower FGF-2 mRNA levels in medial prefrontal cortex and ventral (not dorsal) hippocampus, but TIMP-1 was not affected. No differences in TIMP-1 and FGF-2 mRNA expressions were observed in untrained IL-1beta-treated when compared to control rats.

  16. Aptamer based electrochemical sensors for emerging environmental pollutants

    Directory of Open Access Journals (Sweden)

    Akhtar eHAYAT

    2014-06-01

    Full Text Available Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.

  17. Up-regulation of microRNA-1290 impairs cytokinesis and affects the reprogramming of colon cancer cells.

    Science.gov (United States)

    Wu, Jia; Ji, Xiaowei; Zhu, Linlin; Jiang, Qiaoli; Wen, Zhenzhen; Xu, Song; Shao, Wei; Cai, Jianting; Du, Qin; Zhu, Yongliang; Mao, Jianshan

    2013-02-28

    Abnormal cytokinesis increases the possibility of nuclear fusion in tumor cells. However, the role of microRNAs (miRNAs) in abnormal cytokinesis is unclear. Here, we found that miR-1290 was significantly up-regulated in clinical colon cancer tissues. Up-regulation of miR-1290 postponed cytokinesis and led to the formation of multinucleated cells. KIF13B was a target of miR-1290 that was involved in aberrant cytokinesis. Furthermore, enforced expression of miR-1290 activated the Wnt pathway and increased the reprogramming-related transcript factors c-Myc and Nanog. Our results suggest that up-regulation of miR-1290 in colon cancer cells impaired cytokinesis and affected reprogramming. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  18. Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

    Science.gov (United States)

    Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

    2014-11-01

    A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

  19. Probing the Structure of DNA Aptamers with a Classic Heterocycle.

    Directory of Open Access Journals (Sweden)

    G. Reid Bishop

    2004-02-01

    Full Text Available DNA aptamers are synthetic, single-stranded DNA oligonucleotides selectedby SELEX methods for their binding with specific ligands. Here we present ethidiumbinding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARGthat bind L-argininamide (L-Arm. The ligand bound form of each aptamer's structurehas been reported and each are found to be composed primarily of two domainsconsisting of a stem helical region and a loop domain that forms a binding pocket for thecognate ligand. Previous thermodynamic experiments demonstrated that the DNAaptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Herewe extend those linkage binding studies by examining the binding of the heterocyclicintercalator ethidium to each of the three aptamers by fluorescence and absorptionspectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with∆Go's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for eachaptamer and is quantitatively diminished in the presence of L-Arm as is the overallfluorescence intensity of ethidium. Together, these results demonstrate that a portion ofthe bound ethidium is excluded from the aptamer in the presence of a saturating amountof L-Arm. These results demonstrate the utility of ethidium and related compounds forthe probing of non-conventional DNA structures and reveal an interesting fundamentalthermodynamic linkage in DNA aptamers. Results are discussed in the context of thethermodynamic stability and structure of each of the aptamers examined.

  20. Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation

    International Nuclear Information System (INIS)

    Lacerda, Camila Maria de Sousa

    2016-01-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target

  1. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor

    2013-01-01

    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  2. Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications.

    Science.gov (United States)

    Wen, Lin; Qiu, Liping; Wu, Yongxiang; Hu, Xiaoxiao; Zhang, Xiaobing

    2017-07-28

    Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.

  3. Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications

    Directory of Open Access Journals (Sweden)

    Lin Wen

    2017-07-01

    Full Text Available Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.

  4. APTAMER-BASED SERRS SENSOR FOR THROMBIN DETECTION

    Energy Technology Data Exchange (ETDEWEB)

    Cho, H; Baker, B R; Wachsmann-Hogiu, S; Pagba, C V; Laurence, T A; Lane, S M; Lee, L P; Tok, J B

    2008-07-02

    We describe an aptamer-based Surface Enhanced Resonance Raman Scattering (SERRS) sensor with high sensitivity, specificity, and stability for the detection of a coagulation protein, human a-thrombin. The sensor achieves high sensitivity and a limit of detection of 100 pM by monitoring the SERRS signal change upon the single step of thrombin binding to immobilized thrombin binding aptamer. The selectivity of the sensor is demonstrated by the specific discrimination of thrombin from other protein analytes. The specific recognition and binding of thrombin by the thrombin binding aptamer is essential to the mechanism of the aptamer-based sensor, as shown through measurements using negative control oligonucleotides. In addition, the sensor can detect 1 nM thrombin in the presence of complex biofluids, such as 10% fetal calf serum, demonstrating that the immobilized, 5{prime}-capped, 3{prime}-capped aptamer is sufficiently robust for clinical diagnostic applications. Furthermore, the proposed sensor may be implemented for multiplexed detection using different aptamer-Raman probe complexes.

  5. (1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection.

    Science.gov (United States)

    de Sousa Lacerda, Camila Maria; Ferreira, Iêda Mendes; Dos Santos, Sara Roberta; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro

    2017-03-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n=6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17±0.22 for seq6 and 2.66±0.10 for seq30. These ratios were statistically higher than the value (1.54±0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53±0.03, 1.64±0.12 and 1.08±0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. (1 → 3)-β-D-glucan aptamers labeled with technetium-99 m: Biodistribution and imaging in experimental models of bacterial and fungal infection

    International Nuclear Information System (INIS)

    Sousa Lacerda, Camila Maria de; Ferreira, Iêda Mendes; Santos, Sara Roberta dos; Barros, André Luís Branco de; Fernandes, Simone Odília

    2017-01-01

    Introduction: Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1 → 3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1 → 3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Methods: Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n = 6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Results: There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17 ± 0.22 for seq6 and 2.66 ± 0.10 for seq30. These ratios were statistically higher than the value (1.54 ± 0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53 ± 0.03, 1.64 ± 0.12 and 1.08 ± 0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Conclusions: Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored.

  7. Molecule-binding dependent assembly of split aptamer and γ-cyclodextrin: A sensitive excimer signaling approach for aptamer biosensors

    International Nuclear Information System (INIS)

    Jin, Fen; Lian, Yan; Li, Jishan; Zheng, Jing; Hu, Yaping; Liu, Jinhua; Huang, Jin; Yang, Ronghua

    2013-01-01

    Graphical abstract: Adenosine-binding aptamer was splitted into two fragments P2 and P3 which labeled pyrene molecules, mainly produce monomer signal. γ-CD cavity brings P2 and P3 in close proximity, allowing for weak excimer emission. In the presence of target, P2 and P3 are expected to bind ATP and form an aptamer/target complex, leads to large increase of the pyrene excimer fluorescence. -- Highlights: •We assembled split aptamer and γ-cyclodextrin fluorescence biosensors for ATP detection. •The biosensor increased quantum yield and emission lifetime of the excimer. •Time-resolved fluorescence is effective for ATP assay in complicated environment. -- Abstract: A highly sensitive and selective fluorescence aptamer biosensors for the determination of adenosine triphosphate (ATP) was developed. Binding of a target with splitting aptamers labeled with pyrene molecules form stable pyrene dimer in the γ-cyclodextrin (γ-CD) cavity, yielding a strong excimer emission. We have found that inclusion of pyrene dimer in γ-cyclodextrin cavity not only exhibits additive increases in quantum yield and emission lifetime of the excimer, but also facilitates target-induced fusion of the splitting aptamers to form the aptamer/target complex. As proof-of-principle, the approach was applied to fluorescence detection of adenosine triphosphate. With an anti-ATP aptamer, the approach exhibits excimer fluorescence response toward ATP with a maximum signal-to-background ratio of 32.1 and remarkably low detection limit of 80 nM ATP in buffer solution. Moreover, due to the additive fluorescence lifetime of excimer induced by γ-cyclodextrin, time-resolved measurements could be conveniently used to detect as low as 0.5 μM ATP in blood serum quantitatively

  8. Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.

    Science.gov (United States)

    Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio

    2018-05-03

    RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.

  9. Development of Aptamer Beacons for Antemortem Diagnosis of Chronic Wasting Disease

    National Research Council Canada - National Science Library

    Clinkenbeard, Kenneth D

    2005-01-01

    .... Once selected, the CWD aptamers will be configured as aptamer beacons that can act as molecular switches to turn "on" a novel and highly sensitive diagnostic technology termed amplifying fluorescing polymer...

  10. Development of Aptamer Beacons for Antemortem Diagnosis of Chronic Wasting Disease

    National Research Council Canada - National Science Library

    Clinkenbeard, Kenneth

    2004-01-01

    .... Once selected, the CWD aptamers will be configured as aptamer beacons that can act as molecular switches to turn on a novel and highly sensitive diagnostic technology termed amplifying fluorescing polymer. Objective...

  11. A microfluidic surface enhanced Raman spectroscopic biosensor using aptamer functionalized nanopillars

    DEFF Research Database (Denmark)

    Yang, J.; Palla, M.; Bosco, F. G.

    2013-01-01

    This paper presents a microchip incorporating an aptamer-functionalized nanopillar substrate, enabling the specific detection of low-abundance biomolecules using surface enhanced Raman spectroscopy (SERS). In a temperature controlled microchamber, aptamers immobilized on the nanostructure surface...

  12. A decrease in hepatic microRNA-9 expression impairs gluconeogenesis by targeting FOXO1 in obese mice.

    Science.gov (United States)

    Yan, Caifeng; Chen, Jinfeng; Li, Min; Xuan, Wenying; Su, Dongming; You, Hui; Huang, Yujie; Chen, Nuoqi; Liang, Xiubin

    2016-07-01

    MicroRNA-9 (miR-9) is involved in the regulation of pancreatic beta cell function. However, its role in gluconeogenesis is still unclear. Our objective was to investigate the role of miR-9 in hepatic glucose production (HGP). MiR-9 expression was measured in livers of high-fat diet (HFD) mice and ob/ob mice. The methylation status of the miR-9-3 promoter regions in hepatocytes was determined by the methylation-specific PCR procedure. The binding activity of DNA methyltransferase (DNMT)1, DNMT3a and DNMT3b on the miR-9-3 promoter was detected by chromatin immunoprecipitation (ChIP) and quantitative real-time PCR assays. HGP was evaluated in vitro and in vivo. Glucose tolerance, insulin tolerance and pyruvate tolerance tests were also performed. Reduced miR-9 expression and hypermethylation of the miR-9-3 promoter were observed in the livers of obese mice. Further study showed that the binding of DNMT1, but not of DNMT3a and DNMT3b, to the miR-9-3 promoter was increased in hepatocytes from ob/ob mice. Knockdown of DNMT1 alleviated the decrease in hepatic miR-9 expression in vivo and in vitro. Overexpression of hepatic miR-9 improved insulin sensitivity in obese mice and inhibited HGP. In addition, deletion of hepatic miR-9 led to an increase in random and fasting blood glucose levels in lean mice. Importantly, silenced forkhead box O1 (FOXO1) expression reversed the gluconeogenesis and glucose production in hepatocytes induced by miR-9 deletion. Our observations suggest that the decrease in miR-9 expression contributes to an inappropriately activated gluconeogenesis in obese mice.

  13. Unraveling Prion Protein Interactions with Aptamers and Other PrP-Binding Nucleic Acids.

    Science.gov (United States)

    Macedo, Bruno; Cordeiro, Yraima

    2017-05-17

    Transmissible spongiform encephalopathies (TSEs) are a group of neurodegenerative disorders that affect humans and other mammals. The etiologic agents common to these diseases are misfolded conformations of the prion protein (PrP). The molecular mechanisms that trigger the structural conversion of the normal cellular PrP (PrP C ) into the pathogenic conformer (PrP Sc ) are still poorly understood. It is proposed that a molecular cofactor would act as a catalyst, lowering the activation energy of the conversion process, therefore favoring the transition of PrP C to PrP Sc . Several in vitro studies have described physical interactions between PrP and different classes of molecules, which might play a role in either PrP physiology or pathology. Among these molecules, nucleic acids (NAs) are highlighted as potential PrP molecular partners. In this context, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology has proven extremely valuable to investigate PrP-NA interactions, due to its ability to select small nucleic acids, also termed aptamers, that bind PrP with high affinity and specificity. Aptamers are single-stranded DNA or RNA oligonucleotides that can be folded into a wide range of structures (from harpins to G-quadruplexes). They are selected from a nucleic acid pool containing a large number (10 14 -10 16 ) of random sequences of the same size (~20-100 bases). Aptamers stand out because of their potential ability to bind with different affinities to distinct conformations of the same protein target. Therefore, the identification of high-affinity and selective PrP ligands may aid the development of new therapies and diagnostic tools for TSEs. This review will focus on the selection of aptamers targeted against either full-length or truncated forms of PrP, discussing the implications that result from interactions of PrP with NAs, and their potential advances in the studies of prions. We will also provide a critical evaluation

  14. Predicting the Uncertain Future of Aptamer-Based Diagnostics and Therapeutics.

    Science.gov (United States)

    Bruno, John G

    2015-04-16

    Despite the great promise of nucleic acid aptamers in the areas of diagnostics and therapeutics for their facile in vitro development, lack of immunogenicity and other desirable properties, few truly successful aptamer-based products exist in the clinical or other markets. Core reasons for these commercial deficiencies probably stem from industrial commitment to antibodies including a huge financial investment in humanized monoclonal antibodies and a general ignorance about aptamers and their performance among the research and development community. Given the early failures of some strong commercial efforts to gain government approval and bring aptamer-based products to market, it may seem that aptamers are doomed to take a backseat to antibodies forever. However, the key advantages of aptamers over antibodies coupled with niche market needs that only aptamers can fill and more recent published data still point to a bright commercial future for aptamers in areas such as infectious disease and cancer diagnostics and therapeutics. As more researchers and entrepreneurs become familiar with aptamers, it seems inevitable that aptamers will at least be considered for expanded roles in diagnostics and therapeutics. This review also examines new aptamer modifications and attempts to predict new aptamer applications that could revolutionize biomedical technology in the future and lead to marketed products.

  15. Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogens.

    Science.gov (United States)

    Kavruk, M; Celikbicak, O; Ozalp, V C; Borsa, B A; Hernandez, F J; Bayramoglu, G; Salih, B; Arica, M Y

    2015-05-18

    In this study, we designed aptamer-gated nanocapsules for the specific targeting of cargo to bacteria with controlled release of antibiotics based on aptamer-receptor interactions. Aptamer-gates caused a specific decrease in minimum inhibitory concentration (MIC) values of vancomycin for Staphylococcus aureus when mesoporous silica nanoparticles (MSNs) were used for bacteria-targeted delivery.

  16. Current advances in aptamer-assisted technologies for detecting bacterial and fungal toxins.

    Science.gov (United States)

    Alizadeh, N; Memar, M Y; Mehramuz, B; Abibiglou, S S; Hemmati, F; Samadi Kafil, H

    2018-03-01

    Infectious diseases are among the common leading causes of morbidity and mortality worldwide. Associated with the emergence of new infectious diseases, the increasing number of antimicrobial-resistant isolates presents a serious threat to public health and hospitalized patients. A microbial pathogen may elicit several host responses and use a variety of mechanisms to evade host defences. These methods and mechanisms include capsule, lipopolysaccharides or cell wall components, adhesions and toxins. Toxins inhibit phagocytosis, cause septic shock and host cell damages by binding to host surface receptors and invasion. Bacterial and fungal pathogens are able to apply many different toxin-dependent mechanisms to disturb signalling pathways and the structural integrity of host cells for establishing and maintaining infections Initial techniques for analysis of bacterial toxins were based on in vivo or in vitro assessments. There is a permanent demand for appropriate detection methods which are affordable, practical, careful, rapid, sensitive, efficient and economical. Aptamers are DNA or RNA oligonucleotides that are selected by systematic evolution of ligands using exponential enrichment (SELEX) methods and can be applied in diagnostic applications. This review provides an overview of aptamer-based methods as a novel approach for detecting toxins in bacterial and fungal pathogens. © 2017 The Society for Applied Microbiology.

  17. Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus.

    Science.gov (United States)

    Abbaspour, Abdolkarim; Norouz-Sarvestani, Fatemeh; Noori, Abolhassan; Soltani, Noushin

    2015-06-15

    Staphylococcus aureus (S. aureus) is one of the most important human pathogens and causes numerous illnesses. In this study, we report a sensitive and highly selective dual-aptamer-based sandwich immunosensor for the detection of S. aureus. In this bioassay system, a biotinylated primary anti-S.aureus aptamer was immobilized on streptavidin coated magnetic beads (MB), which serves as a capture probe. A secondary anti-S.aureus aptamer was conjugated to silver nanoparticles (Apt-AgNP) that sensitively reports the detection of the target. In the presence of target bacterium, an Apt/S.aureus/apt-AgNP sandwich complex is formed on the MB surface and the electrochemical signal of AgNPs followed through anodic stripping voltammetry. The proposed sandwich assay benefits from advantageous of a sandwich assay for increased specificity, MB as carriers of affinity ligands for solution-phase recognition and fast magnetic separation, AgNPs for signal amplification, and an electrochemical stripping voltammetry read-out as a simple and sensitive detection. The electrochemical immunosensor shows an extended dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL (S/N=3). Furthermore, the possible interference of other analog bacteria was studied. To assess the general applicability of this sensor, we investigated the quantification of S. aureus in real water samples. The results were compared to the experimental results obtained from a plate counting method, which demonstrated an acceptable consistency. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    Science.gov (United States)

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Global gene expression analysis of fission yeast mutants impaired in Ser-2 phosphorylation of the RNA pol II carboxy terminal domain.

    Directory of Open Access Journals (Sweden)

    Reza Saberianfar

    Full Text Available In Schizosaccharomyces pombe the nuclear-localized Lsk1p-Lsc1p cyclin dependent kinase complex promotes Ser-2 phosphorylation of the heptad repeats found within the RNA pol II carboxy terminal domain (CTD. Here, we first provide evidence supporting the existence of a third previously uncharacterized Ser-2 CTD kinase subunit, Lsg1p. As expected for a component of the complex, Lsg1p localizes to the nucleus, promotes Ser-2 phosphorylation of the CTD, and physically interacts with both Lsk1p and Lsc1p in vivo. Interestingly, we also demonstrate that lsg1Δ mutants--just like lsk1Δ and lsc1Δ strains--are compromised in their ability to faithfully and reliably complete cytokinesis. Next, to address whether kinase mediated alterations in CTD phosphorylation might selectively alter the expression of genes with roles in cytokinesis and/or the cytoskeleton, global gene expression profiles were analyzed. Mutants impaired in Ser-2 phosphorylation display little change with respect to the level of transcription of most genes. However, genes affecting cytokinesis--including the actin interacting protein gene, aip1--as well as genes with roles in meiosis, are included in a small subset that are differentially regulated. Significantly, genetic analysis of lsk1Δ aip1Δ double mutants is consistent with Lsk1p and Aip1p acting in a linear pathway with respect to the regulation of cytokinesis.

  20. Mutations in the β-Subunit of the RNA Polymerase Impair the Surface-Associated Motility and Virulence of Acinetobacter baumannii.

    Science.gov (United States)

    Pérez-Varela, María; Corral, Jordi; Vallejo, Juan Andrés; Rumbo-Feal, Soraya; Bou, Germán; Aranda, Jesús; Barbé, Jordi

    2017-08-01

    Acinetobacter baumannii is a major cause of antibiotic-resistant nosocomial infections worldwide. In this study, several rifampin-resistant spontaneous mutants obtained from the A. baumannii ATCC 17978 strain that differed in their point mutations in the rpoB gene, encoding the β-subunit of the RNA polymerase, were isolated. All the mutants harboring amino acid substitutions in position 522 or 540 of the RpoB protein were impaired in surface-associated motility and had attenuated virulence in the fertility model of Caenorhabditis elegans The transcriptional profile of these mutants included six downregulated genes encoding proteins homologous to transporters and metabolic enzymes widespread among A. baumannii clinical isolates. The construction of knockout mutants in each of the six downregulated genes revealed a significant reduction in the surface-associated motility and virulence of four of them in the A. baumannii ATCC 17978 strain, as well as in the virulent clinical isolate MAR002. Taken together, our results provide strong evidence of the connection between motility and virulence in this multiresistant nosocomial pathogen. Copyright © 2017 American Society for Microbiology.

  1. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.

    Science.gov (United States)

    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua

    2016-08-01

    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Osteomyelitis diagnosis by {sup 99m}Tc radiolabeled aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Santos, S.R.; Ferreira, I.M.; Andrade, A.S.R., E-mail: sararoberta7@hotmail.com, E-mail: imendesf@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, A.L.B.; Cardoso, V.N.; Diniz, O.F., E-mail: brancodebarros@yahoo.com.br, E-mail: valbertcardoso@yahoo.com.br, E-mail: simoneodilia@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas

    2015-07-01

    Osteomyelitis, which is characterized by progressive inflammatory destruction and new opposition of bone, is still a difficult infection to treat. The clinical diagnosis in late stages is achieved easily, but an early diagnosis is more challenging. Staphylococcus aureus is a common agent found in osteomyelitis and bone prostheses infection. Diagnosis by scintigraphy has advantages because it is a non-invasive procedure and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis since specific radiopharmaceuticals were developed. In this study, aptamers selected to Staphylococcus aureus were labeled with {sup 99m}Tc and used for bacteria identification in an osteomyelitis experimental model. The aptamers selected to S. aureus were directly labelled with {sup 99m}Tc and were evaluated by biodistribution studies. Wistar rats with intraosseous infection in the right paw were used. A random aptamer labelled with {sup 99m}Tc was as control. Six animals were used in each group. The aptamers labeled with {sup 99m}Tc were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 2,23 ± 0,20, after 3 h. The control group presented a target/non-target ratio 1,08 ± 0.23. The results indicated that the radiolabeled aptamers were able to identify specifically the infection foci and they should be further explored for infection diagnosis by scintigraphy. (author)

  3. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.

    Science.gov (United States)

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W

    2016-07-18

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.

  4. Aptamer-Targeted Plasmonic Photothermal Therapy of Cancer

    Directory of Open Access Journals (Sweden)

    Olga S. Kolovskaya

    2017-12-01

    Full Text Available Novel nanoscale bioconjugates combining unique plasmonic photothermal properties of gold nanoparticles (AuNPs with targeted delivery using cell-specific DNA aptamers have a tremendous potential for medical diagnostics and therapy of many cell-based diseases. In this study, we demonstrate the high anti-cancer activity of aptamer-conjugated, 37-nm spherical gold nanoparticles toward Ehrlich carcinoma in tumor-bearing mice after photothermal treatment. The synthetic anti-tumor aptamers bring the nanoparticles precisely to the desired cells and selectively eliminate cancer cells after the subsequent laser treatment. To prove tumor eradication, we used positron emission tomography (PET utilizing radioactive glucose and computer tomography, followed by histological analysis of cancer tissue. Three injections of aptamer-conjugated AuNPs and 5 min of laser irradiations are enough to make the tumor undetectable by PET. Histological analysis proves PET results and shows lower damage of healthy tissue in addition to a higher treatment efficiency and selectivity of the gold nanoparticles functionalized with aptamers in comparison to control experiments using free unconjugated nanoparticles.

  5. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing

    Directory of Open Access Journals (Sweden)

    Marcus Menger

    2016-07-01

    Full Text Available Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either “evolution in the test tube” of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs. The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the “biological” degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.

  6. Target binding improves relaxivity in aptamer-gadolinium conjugates.

    Science.gov (United States)

    Bernard, Elyse D; Beking, Michael A; Rajamanickam, Karunanithi; Tsai, Eve C; Derosa, Maria C

    2012-12-01

    MRI contrast agents (CA) have been heavily used over the past several decades to enhance the diagnostic value of the obtained images. From a design perspective, two avenues to improve the efficacy of contrast agents are readily evident: optimization of magnetic properties of the CA, and optimization of the pharmacokinetics and distribution of the CA in the patient. Contrast agents consisting of DNA aptamer-gadolinium(III) conjugates provide a single system in which these factors can be addressed simultaneously. In this proof-of-concept study, the 15mer thrombin aptamer was conjugated to diethylenetriaminepentaacetic (DTPA) dianhydride to form a monoamide derivative of the linear open-chain chelate present in the commonly used contrast agent Magnevist(®). The stability of the conjugated DNA aptamer-DTPA-Gd(III) chelate in a transmetallation study using Zn(II) was found to be similar to that reported for DTPA-Gd(III). Relaxivity enhancements of 35 ± 4 and 20 ± 1 % were observed in the presence of thrombin compared to a control protein at fields of 9.4 and 1.5 T, respectively. The inclusion of spacers between the aptamer and the DTPA to eliminate possible steric effects was also investigated but not found to improve the relaxation enhancement achieved in comparison to the unaltered aptamer conjugate.

  7. Osteomyelitis diagnosis by 99mTc radiolabeled aptamers

    International Nuclear Information System (INIS)

    Santos, S.R.; Ferreira, I.M.; Andrade, A.S.R.; Barros, A.L.B.; Cardoso, V.N.; Diniz, O.F.

    2015-01-01

    Osteomyelitis, which is characterized by progressive inflammatory destruction and new opposition of bone, is still a difficult infection to treat. The clinical diagnosis in late stages is achieved easily, but an early diagnosis is more challenging. Staphylococcus aureus is a common agent found in osteomyelitis and bone prostheses infection. Diagnosis by scintigraphy has advantages because it is a non-invasive procedure and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis since specific radiopharmaceuticals were developed. In this study, aptamers selected to Staphylococcus aureus were labeled with 99m Tc and used for bacteria identification in an osteomyelitis experimental model. The aptamers selected to S. aureus were directly labelled with 99m Tc and were evaluated by biodistribution studies. Wistar rats with intraosseous infection in the right paw were used. A random aptamer labelled with 99m Tc was as control. Six animals were used in each group. The aptamers labeled with 99m Tc were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 2,23 ± 0,20, after 3 h. The control group presented a target/non-target ratio 1,08 ± 0.23. The results indicated that the radiolabeled aptamers were able to identify specifically the infection foci and they should be further explored for infection diagnosis by scintigraphy. (author)

  8. Label free luminescence strategy for sensitive detection of ATP using aptamer-Ru(II) complexes

    Energy Technology Data Exchange (ETDEWEB)

    Babu, Eththilu [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Muthu Mareeswaran, Paulpandian [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Department of Industrial Chemistry, Alagappa Univesity, Karaikudi 630003, Tamil Nadu (India); Ramdass, Arumugam [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India); Research Department of Chemistry, Aditanar College of Arts and Science, Tiruchendur 628216, Tamil Nadu (India); Ramesh, Pandian [UCIBIO-REQUIMTE, Departmento de Química, Faculdade de Ciências e Tecnologia, Universidade NOVA de Lisboa, 2829-516 Caparica (Portugal); Rajagopal, Seenivasan, E-mail: rajagopalseenivasan@yahoo.com [Department of Physical Che mistry, School of Chemistry, Madurai Kamaraj University, Madurai 625021, Tamil Nadu (India)

    2016-07-15

    A simple and sensitive aptamer-based luminescence strategy for ATP detection is developed using Ru(II) complexes as probe molecule. It is based on the fact that Ru(II)-dppz complexes show the light switching behavior with DNA aptamers and found to show significant luminescence spectral change on the addition of ATP molecules. The binding efficiencies of aptamer with ATP, ADP and AMP are calculated and compared. The structural change of aptamer is also studied using circular dichroism (CD) spectral techniques. Moreover, the binding nature of aptamer with ATP, ADP and AMP is demonstrated by computational techniques. The proposed strategy was successfully applied to the detection of ATP.

  9. Label free luminescence strategy for sensitive detection of ATP using aptamer-Ru(II) complexes

    International Nuclear Information System (INIS)

    Babu, Eththilu; Muthu Mareeswaran, Paulpandian; Ramdass, Arumugam; Ramesh, Pandian; Rajagopal, Seenivasan

    2016-01-01

    A simple and sensitive aptamer-based luminescence strategy for ATP detection is developed using Ru(II) complexes as probe molecule. It is based on the fact that Ru(II)-dppz complexes show the light switching behavior with DNA aptamers and found to show significant luminescence spectral change on the addition of ATP molecules. The binding efficiencies of aptamer with ATP, ADP and AMP are calculated and compared. The structural change of aptamer is also studied using circular dichroism (CD) spectral techniques. Moreover, the binding nature of aptamer with ATP, ADP and AMP is demonstrated by computational techniques. The proposed strategy was successfully applied to the detection of ATP.

  10. Direct fluorescence anisotropy assay for cocaine using tetramethylrhodamine-labeled aptamer.

    Science.gov (United States)

    Liu, Yingxiong; Zhao, Qiang

    2017-06-01

    Development of simple, sensitive, and rapid method for cocaine detection is important in medicine and drug abuse monitoring. Taking advantage of fluorescence anisotropy and aptamer, this study reports a direct fluorescence anisotropy (FA) assay for cocaine by employing an aptamer probe with tetramethylrhodamine (TMR) labeled on a specific position. The binding of cocaine and the aptamer causes a structure change of the TMR-labeled aptamer, leading to changes of the interaction between labeled TMR and adjacent G bases in aptamer sequence, so FA of TMR varies with increasing of cocaine. After screening different labeling positions of the aptamer, including thymine (T) bases and terminals of the aptamer, we obtained a favorable aptamer probe with TMR labeled on the 25th base T in the sequence, which exhibited sensitive and significant FA-decreasing responses upon cocaine. Under optimized assay conditions, this TMR-labeled aptamer allowed for direct FA detection of cocaine as low as 5 μM. The maximum FA change reached about 0.086. This FA method also enabled the detection of cocaine spiked in diluted serum and urine samples, showing potential for applications. Graphical Abstract The binding of cocaine to the TMR-labeled aptamer causes conformation change and alteration of the intramolecular interaction between TMR and bases of aptamer, leading to variance of fluorescence anisotropy (FA) of TMR, so direct FA analyis of cocaine is achieved.

  11. Development of an aptamer-based affinity purification method for vascular endothelial growth factor

    Directory of Open Access Journals (Sweden)

    Maren Lönne

    2015-12-01

    Full Text Available Since aptamers bind their targets with high affinity and specificity, they are promising alternative ligands in protein affinity purification. As aptamers are chemically synthesized oligonucleotides, they can be easily produced in large quantities regarding GMP conditions allowing their application in protein production for therapeutic purposes. Several advantages of aptamers compared to antibodies are described in general within this paper. Here, an aptamer directed against the human Vascular Endothelial Growth Factor (VEGF was used as affinity ligand for establishing a purification platform for VEGF in small scale. The aptamer was covalently immobilized on magnetic beads in a controlled orientation resulting in a functional active affinity matrix. Target binding was optimized by introduction of spacer molecules and variation of aptamer density. Further, salt-induced target elution was demonstrated as well as VEGF purification from a complex protein mixture proving the specificity of protein-aptamer binding.

  12. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems

    Directory of Open Access Journals (Sweden)

    Feng Jiang

    2015-10-01

    Full Text Available Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX, are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems.

  13. Oligonucleotide aptamers against tyrosine kinase receptors: Prospect for anticancer applications.

    Science.gov (United States)

    Camorani, Simona; Crescenzi, Elvira; Fedele, Monica; Cerchia, Laura

    2018-04-01

    Transmembrane receptor tyrosine kinases (RTKs) play crucial roles in cancer cell proliferation, survival, migration and differentiation. Area of intense research is searching for effective anticancer therapies targeting these receptors and, to date, several monoclonal antibodies and small-molecule tyrosine kinase inhibitors have entered the clinic. However, some of these drugs show limited efficacy and give rise to acquired resistance. Emerging highly selective compounds for anticancer therapy are oligonucleotide aptamers that interact with their targets by recognizing a specific three-dimensional structure. Because of their nucleic acid nature, the rational design of advanced strategies to manipulate aptamers for both diagnostic and therapeutic applications is greatly simplified over antibodies. In this manuscript, we will provide a comprehensive overview of oligonucleotide aptamers as next generation strategies to efficiently target RTKs in human cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression

    Science.gov (United States)

    Pi, Fengmei; Binzel, Daniel W.; Lee, Tae Jin; Li, Zhefeng; Sun, Meiyan; Rychahou, Piotr; Li, Hui; Haque, Farzin; Wang, Shaoying; Croce, Carlo M.; Guo, Bin; Evers, B. Mark; Guo, Peixuan

    2018-01-01

    Nanotechnology offers many benefits, and here we report an advantage of applying RNA nanotechnology for directional control. The orientation of arrow-shaped RNA was altered to control ligand display on extracellular vesicle membranes for specific cell targeting, or to regulate intracellular trafficking of small interfering RNA (siRNA) or microRNA (miRNA). Placing membrane-anchoring cholesterol at the tail of the arrow results in display of RNA aptamer or folate on the outer surface of the extracellular vesicle. In contrast, placing the cholesterol at the arrowhead results in partial loading of RNA nanoparticles into the extracellular vesicles. Taking advantage of the RNA ligand for specific targeting and extracellular vesicles for efficient membrane fusion, the resulting ligand-displaying extracellular vesicles were capable of specific delivery of siRNA to cells, and efficiently blocked tumour growth in three cancer models. Extracellular vesicles displaying an aptamer that binds to prostate-specific membrane antigen, and loaded with survivin siRNA, inhibited prostate cancer xenograft. The same extracellular vesicle instead displaying epidermal growth-factor receptor aptamer inhibited orthotopic breast cancer models. Likewise, survivin siRNA-loaded and folate-displaying extracellular vesicles inhibited patient-derived colorectal cancer xenograft.

  15. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  16. Massively parallel interrogation of aptamer sequence, structure and function.

    Directory of Open Access Journals (Sweden)

    Nicholas O Fischer

    Full Text Available BACKGROUND: Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. METHODOLOGY/PRINCIPAL FINDINGS: High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and inter-chip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. CONCLUSION AND SIGNIFICANCE: The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  17. Periostin-Binding DNA Aptamer Treatment Ameliorates Peritoneal Dialysis-Induced Peritoneal Fibrosis

    Directory of Open Access Journals (Sweden)

    Bo Young Nam

    2017-06-01

    Full Text Available Peritoneal fibrosis is a major complication in peritoneal dialysis (PD patients, which leads to dialysis discontinuation. Periostin, increased by transforming growth factor β1 (TGF-β1 stimulation, induces the expression of extracellular matrix (ECM genes. Aberrant periostin expression has been demonstrated to be associated with PD-related peritoneal fibrosis. Therefore, the effect of periostin inhibition by an aptamer-based inhibitor on peritoneal fibrosis was evaluated. In vitro, TGF-β1 treatment upregulated periostin, fibronectin, α-smooth muscle actin (α-SMA, and Snail expression and reduced E-cadherin expression in human peritoneal mesothelial cells (HPMCs. Periostin small interfering RNA (siRNA treatment ameliorated the TGF-β1-induced periostin, fibronectin, α-SMA, and Snail expression and restored E-cadherin expression in HPMCs. Similarly, the periostin-binding DNA aptamer (PA also attenuated fibronectin, α-SMA, and Snail upregulation and E-cadherin downregulation in TGF-β1-stimulated HPMCs. In mice treated with PD solution for 4 weeks, the expression of periostin, fibronectin, α-SMA, and Snail was significantly increased in the peritoneum, whereas E-cadherin expression was significantly decreased. The thickness of the submesothelial layer and the intensity of Masson’s trichrome staining in the PD group were significantly increased compared to the untreated group. These changes were significantly abrogated by the intraperitoneal administration of PA. These findings suggest that PA can be a potential therapeutic strategy for peritoneal fibrosis in PD patients.

  18. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  19. Targeting tumor cell invasion and dissemination in vivo by an aptamer that inhibits urokinase-type plasminogen activator through a novel multifunctional mechanism

    DEFF Research Database (Denmark)

    Botkjaer, Kenneth A; Deryugina, Elena I; Dupont, Daniel Miotto

    2012-01-01

    , because the topology of the proteases' active sites are highly similar. In an effort to generate highly specific uPA inhibitors with new inhibitory modalities, we isolated uPA-binding RNA aptamers by screening a library of 35 nucleotides long 2'-fluoro-pyrimidine RNA molecules using a version of human pro......-uPA lacking the epidermal growth factor-like and kringle domains as bait. One pro-uPA-binding aptamer sequence, referred to as upanap-126, proved to be highly specific for human uPA. Upanap-126 delayed the proteolytic conversion of human pro-uPA to active uPA, but did not inhibit plasminogen activation...... catalyzed by two-chain uPA. The aptamer also inhibited the binding of pro-uPA to uPAR and the binding of vitronectin to the preformed pro-uPA/uPAR complex, both in cell-free systems and on cell surfaces. Furthermore, upanap-126 inhibited human tumor cell invasion in vitro in the Matrigel assay and in vivo...

  20. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    Directory of Open Access Journals (Sweden)

    Felipe Opazo

    2015-01-01

    Full Text Available Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma cells. We further optimized this aptamer to a highly versatile and stable minimized version. The minimized aptamer can be easily equipped with different functionalities like quantum dots, organic dyes, or even a second different aptamer domain yielding a bi-paratopic aptamer. Although the target molecule of the aptamer remains unknown, our microscopy and pharmacological studies revealed that the aptamer hijacks the clathrin-mediated endocytosis pathway for its cellular internalization. We conclude that this novel class of aptamers can be used as a modular tool to specifically deliver different cargoes into malignant cells. This work provides a thorough characterization of the aptamer and we expect that our strategy will pave the path for future therapeutic applications.

  1. Aptamers: cutting edge technology to combat HIV/AIDS

    CSIR Research Space (South Africa)

    Khati, M

    2007-09-27

    Full Text Available Time (seconds) CD4 Dey, Khati et al. (Nov 2005) J. Virol. 79 (21) Page 21 © CSIR 2006 www.csir.co.za Use aptamers for analysis and neutralization of endemic, South African strains of HIV-1 from adult and pediatric patients...

  2. A general excimer signaling approach for aptamer sensors.

    Science.gov (United States)

    Wu, Cuichen; Yan, Ling; Wang, Chunming; Lin, Haoxue; Wang, Chi; Chen, Xi; Yang, Chaoyong James

    2010-06-15

    Simple, fast and direct analysis or monitoring of significant molecules in complex biological samples is important for many biological study, clinical diagnosis and forensic investigations. Herein we highlight a general method to tailor aptamer sequence into functional subunits to design target-induced light-switching excimer sensors for rapid, sensitive and selective detection of important molecules in complex biological fluids. Our approach is to split one single strand aptamer into two pieces and each terminally labeled with a pyrene molecule while maintaining their binding affinity to target molecules. In the presence of target molecules, two aptamer fragments are induced to self-assemble to form aptamer-target complex and bring two pyrene molecules into a close proximity to form an excimer, resulting in fluorescent switching from approximately 400 nm to 485 nm. With an anti-cocaine sensor, as low as 1 microM of cocaine can be detected using steady-state fluorescence assays and more importantly low picomole level of target can be directly visualized with naked eyes. Because the excimer has a long fluorescence lifetime, time-resolved measurements were used to directly detect as low as 5 microM cocaine in urine samples quantitatively without any sample pretreatment. Copyright 2010 Elsevier B.V. All rights reserved.

  3. Development of aptamer based HIV-1 entry inhibitor prophylactic drugs

    CSIR Research Space (South Africa)

    London, G

    2013-08-01

    Full Text Available proliferation assay and mapped their epitopes on gp120 by site directed mutagenesis. UCLA1 and CSIR1.1 neutralized infectivity of 79 % and 84 % pseudotyped viruses, respectively. UCLA1, further inhibited > 60 % of clinical isolates. We noted that, aptamers...

  4. Aptamer-based viability impedimetric sensor for bacteria.

    Science.gov (United States)

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-11-06

    The development of an aptamer-based viability impedimetric sensor for bacteria (AptaVISens-B) is presented. Highly specific DNA aptamers to live Salmonella typhimurium were selected via the cell-systematic evolution of ligands by exponential enrichment (SELEX) technique. Twelve rounds of selection were performed; each comprises a positive selection step against viable S. typhimurium and a negative selection step against heat killed S. typhimurium and a mixture of related pathogens, including Salmonella enteritidis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species specificity of the selected aptamers. The DNA sequence showing the highest binding affinity to the bacteria was further integrated into an impedimetric sensor via self-assembly onto a gold nanoparticle-modified screen-printed carbon electrode (GNP-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. typhimurium down to 600 CFU mL(-1) (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based viability sensing of a variety of microorganisms, particularly viable but nonculturable (VBNC) bacteria, using a rapid, economic, and label-free electrochemical platform.

  5. Aptamer-based impedimetric sensor for bacterial typing.

    Science.gov (United States)

    Labib, Mahmoud; Zamay, Anna S; Kolovskaya, Olga S; Reshetneva, Irina T; Zamay, Galina S; Kibbee, Richard J; Sattar, Syed A; Zamay, Tatiana N; Berezovski, Maxim V

    2012-10-02

    The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Citrobacter freundii, to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S. enteritidis, a DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL(-1) (equivalent to 18 CFU in 30 μL assay volume) in 10 min and distinguish it from other Salmonella species, including S. typhimurium and S. choleraesuis. This report is envisaged to open a new venue for the aptamer-based typing of a variety of microorganisms using a rapid, economic, and label-free electrochemical platform.

  6. Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles.

    Science.gov (United States)

    Chang, Tianjun; Wang, Libo; Zhao, Kexu; Ge, Yu; He, Meng; Li, Gang

    2016-06-01

    Staphylococcus aureus is the top common pathogen causing infections and food poisoning. Identification of S. aureus is crucial for the disease diagnosis and regulation of food hygiene. Herein, we report an aptamer-AuNPs based method for duplex identification of S. aureus. Using AuNPs as an indicator, SA23, an aptamer against S. aureus, can well identify its target from Escherichia coli, Listeria monocytogenes and Pseudomonas aeruginosa. Furthermore, we find citrate-coated AuNPs can strongly bind to S. aureus, but not bind to Salmonella enterica and Proteus mirabilis, which leads to different color changes in salt solution. This colorimetric response is capable of distinguishing S. aureus from S. enteritidis and P. mirabilis. Thus, using the aptasensor and AuNPs together, S. aureus can be accurately identified from the common pathogens. This duplex identification system is a promising platform for simple visual identification of S. aureus. Additionally, in the aptasensing process, bacteria are incubated with aptamers and then be removed before the aptamers adding to AuNPs, which may avoid the interactions between bacteria and AuNPs. This strategy can be potentially applied in principle to detect other cells by AuNPs-based aptasensors.

  7. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  8. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Science.gov (United States)

    Gold, Larry; Ayers, Deborah; Bertino, Jennifer; Bock, Christopher; Bock, Ashley; Brody, Edward N; Carter, Jeff; Dalby, Andrew B; Eaton, Bruce E; Fitzwater, Tim; Flather, Dylan; Forbes, Ashley; Foreman, Trudi; Fowler, Cate; Gawande, Bharat; Goss, Meredith; Gunn, Magda; Gupta, Shashi; Halladay, Dennis; Heil, Jim; Heilig, Joe; Hicke, Brian; Husar, Gregory; Janjic, Nebojsa; Jarvis, Thale; Jennings, Susan; Katilius, Evaldas; Keeney, Tracy R; Kim, Nancy; Koch, Tad H; Kraemer, Stephan; Kroiss, Luke; Le, Ngan; Levine, Daniel; Lindsey, Wes; Lollo, Bridget; Mayfield, Wes; Mehan, Mike; Mehler, Robert; Nelson, Sally K; Nelson, Michele; Nieuwlandt, Dan; Nikrad, Malti; Ochsner, Urs; Ostroff, Rachel M; Otis, Matt; Parker, Thomas; Pietrasiewicz, Steve; Resnicow, Daniel I; Rohloff, John; Sanders, Glenn; Sattin, Sarah; Schneider, Daniel; Singer, Britta; Stanton, Martin; Sterkel, Alana; Stewart, Alex; Stratford, Suzanne; Vaught, Jonathan D; Vrkljan, Mike; Walker, Jeffrey J; Watrobka, Mike; Waugh, Sheela; Weiss, Allison; Wilcox, Sheri K; Wolfson, Alexey; Wolk, Steven K; Zhang, Chi; Zichi, Dom

    2010-12-07

    The interrogation of proteomes ("proteomics") in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma). Our current assay measures 813 proteins with low limits of detection (1 pM median), 7 logs of overall dynamic range (~100 fM-1 µM), and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD). We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  9. DNA aptamers against the Lup an 1 food allergen.

    Directory of Open Access Journals (Sweden)

    Pedro Nadal

    Full Text Available Using in vitro selection, high affinity DNA aptamers to the food allergen Lup an 1, ß-conglutin, were selected from a pool of DNA, 93 bases in length, containing a randomised sequence of 49 bases. ß-conglutin was purified from lupin flour and chemically crosslinked to carboxylated magnetic beads. Peptide mass fingerprinting was used to confirm the presence of the ß-conglutin. Single stranded DNA was generated from the randomised pool using T7 Gene 6 Exonuclease and was subsequently incubated with the magnetic beads and the captured DNA was released and amplified prior to a further round of Systematic Evolution of Ligands by Exponential Enrichment (SELEX. Evolution was monitored using enzyme linked oligonucleotide assay and surface plasmon resonance. Once a plateau in evolution was reached, the isolated DNA sequences were cloned and sequenced. The consensus motif was identified via alignment of the sequences and the affinities of these sequences for immobilised ß-conglutin were determined using surface plasmon resonance. The selected aptamer was demonstrated to be highly specific, showing no cross-reactivity with other flour ingredients or with other conglutin fractions of lupin. The secondary structures of the selected aptamers were predicted using m-fold. Finally, the functionality of the selected aptamers was demonstrated using a competitive assay for the quantitative detection of ß-conglutin. . Future work will focus on structure elucidation and truncation of the selected sequences to generate a smaller aptamer for application to the analysis of the Lup an 1 allergen in foodstuffs.

  10. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Directory of Open Access Journals (Sweden)

    Larry Gold

    2010-12-01

    Full Text Available The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine.We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states.We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next generation of evidence-based medicine.

  11. Actuation of chitosan-aptamer nanobrush borders for pathogen sensing.

    Science.gov (United States)

    Hills, Katherine D; Oliveira, Daniela A; Cavallaro, Nicholas D; Gomes, Carmen L; McLamore, Eric S

    2018-03-26

    We demonstrate a sensing mechanism for rapid detection of Listeria monocytogenes in food samples using the actuation of chitosan-aptamer nanobrush borders. The bio-inspired soft material and sensing strategy mimic natural symbiotic systems, where low levels of bacteria are selectively captured from complex matrices. To engineer this biomimetic system, we first develop reduced graphene oxide/nanoplatinum (rGO-nPt) electrodes, and characterize the fundamental electrochemical behavior in the presence and absence of chitosan nanobrushes during actuation (pH-stimulated osmotic swelling). We then characterize the electrochemical behavior of the nanobrush when receptors (antibodies or DNA aptamers) are conjugated to the surface. Finally, we test various techniques to determine the most efficient capture strategy based on nanobrush actuation, and then apply the biosensors in a food product. Maximum cell capture occurs when aptamers conjugated to the nanobrush bind cells in the extended conformation (pH 6). The aptamer-nanobrush hybrid material was more efficient than the antibody-nanobrush material, which was likely due to the relatively high adsorption capacity for aptamers. The biomimetic material was used to develop a rapid test (17 min) for selectively detecting L. monocytogenes at concentrations ranging from 9 to 107 CFU mL-1 with no pre-concentration, and in the presence of other Gram-positive cells (Listeria innocua and Staphylococcus aureus). Use of this bio-inspired material is among the most efficient for L. monocytogenes sensing to date, and does not require sample pretreatment, making nanobrush borders a promising new material for rapid pathogen detection in food.

  12. Targeting Extracellular Histones with Novel RNA Bio drugs for the Treatment of Acute Lung Injury

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-16-1-0179 TITLE: Targeting Extracellular Histones with Novel RNA Bio -drugs for the Treatment of Acute Lung Injury...4. TITLE AND SUBTITLE Targeting Extracellular Histones with Novel RNA Bio -drugs for the Treatment of Acute Lung Injury 5a. CONTRACT NUMBER 5b...and field situations. To accomplish this goal, we developed novel bio -reagents (RNA aptamers) that bind to those histones known to cause MODS/ARDS and

  13. Modeling the microscopic electrical properties of thrombin binding aptamer (TBA) for label-free biosensors

    Science.gov (United States)

    Alfinito, Eleonora; Reggiani, Lino; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele

    2017-02-01

    Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors (aptasensors), with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer aptamer (TBA), has been widely explored around the possibility of using it in aptasensors. This paper proposes a microscopic model of the electrical properties of TBA and of the aptamer-thrombin complex, combining information from both structure and function, following the issues addressed in an emerging branch of electronics known as proteotronics. The theoretical results are compared and validated with measurements reported in the literature. Finally, the model suggests resistance measurements as a novel tool for testing aptamer-target affinity.

  14. Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

    Science.gov (United States)

    Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

    2012-04-25

    A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

  15. Trends in the Design and Development of Specific Aptamers Against Peptides and Proteins.

    Science.gov (United States)

    Tabarzad, Maryam; Jafari, Marzieh

    2016-04-01

    Aptamers are single stranded oligonucleotides, comparable to monoclonal antibodies (mAbs) in selectivity and affinity and have significant strategic properties in design, development and applications more than mAbs. Ease of design and development, simple chemical modification and the attachment of functional groups, easily handling and more adaptability with analytical methods, small size and adaptation with nanostructures are the valuable characteristics of aptamers in comparison to large protein based ligands. Among a broad range of targets that their specific aptamers developed, proteins and peptides have significant position according to the number of related studies performed so far. Since proteins control many of important physiological and pathological incidents in the living organisms, particularly human beings and because of the benefits of aptamers in clinical and analytical applications, aptamer related technologies in the field of proteins and peptides are under progress, exclusively. Currently, there is only one FDA approved therapeutic aptamer in the pharmaceutical market, which is specific to vascular endothelial growth factor and is prescribed for age related macular degenerative disease. Additionally, there are several aptamers in the different phases of clinical trials. Almost all of these aptamers are specific to clinically important peptide or protein targets. In addition, the application of protein specific aptamers in the design and development of targeted drug delivery systems and diagnostic biosensors is another interesting field of aptamer technology. In this review, significant efforts related to development and applications of aptamer technologies in proteins and peptides sciences were considered to emphasis on the importance of aptamers in medicinal and clinical applications.

  16. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    Full Text Available A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  17. Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.

    Science.gov (United States)

    Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

    2013-01-01

    To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.

  18. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    Science.gov (United States)

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  19. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A

    OpenAIRE

    Stoltenburg, Regina; Schubert, Thomas; Strehlitz, Beate

    2015-01-01

    A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment) is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for moni...

  20. Selection of binding targets in parasites using phage-display and aptamer libraries in vivo and in vitro

    Directory of Open Access Journals (Sweden)

    Renata Rosito Tonelli

    2013-01-01

    Full Text Available Parasite infections are largely dependent on interactions between pathogen and different host cell populations to guarantee a successful infectious process. This is particularly true for obligatory intracellular parasites as Plasmodium, Toxoplasma, Leishmania, to name a few. Adhesion to and entry into the cell are essential steps requiring specific parasite and host cell molecules. The large amount of possible involved molecules poses additional difficulties for their identification by the classical biochemical approaches. In this respect, the search for alternative techniques should be pursued. Among them two powerful methodologies can be employed, both relying upon the construction of highly diverse combinatorial libraries of peptides or oligonucleotides that randomly bind with high affinity to targets on the cell surface and are selectively displaced by putative ligands. These are, respectively, the peptide-based phage display and the oligonucleotide-based aptamer techniques.The phage display technique has been extensively employed for the identification of novel ligands in vitro and in vivo in different areas such as cancer, vaccine development and epitope mapping. Particularly, phage display has been employed in the investigation of pathogen-host interactions. Although this methodology has been used for some parasites with encouraging results, in trypanosomatids its use is, as yet, scanty. RNA and DNA aptamers, developed by the SELEX process (Systematic Evolution of Ligands by Exponential Enrichment, were described over two decades ago and since then contributed to a large number of structured nucleic acids for diagnostic or therapeutic purposes or for the understanding of the cell biology. Similarly to the phage display technique scarce use of the SELEX process has been used in the probing of parasite-host interaction.In this review, an overall survey on the use of both phage display and aptamer technologies in different pathogenic

  1. Selection of binding targets in parasites using phage-display and aptamer libraries in vivo and in vitro.

    Science.gov (United States)

    Tonelli, R R; Colli, W; Alves, M J M

    2012-01-01

    Parasite infections are largely dependent on interactions between pathogen and different host cell populations to guarantee a successful infectious process. This is particularly true for obligatory intracellular parasites as Plasmodium, Toxoplasma, and Leishmania, to name a few. Adhesion to and entry into the cell are essential steps requiring specific parasite and host cell molecules. The large amount of possible involved molecules poses additional difficulties for their identification by the classical biochemical approaches. In this respect, the search for alternative techniques should be pursued. Among them two powerful methodologies can be employed, both relying upon the construction of highly diverse combinatorial libraries of peptides or oligonucleotides that randomly bind with high affinity to targets on the cell surface and are selectively displaced by putative ligands. These are, respectively, the peptide-based phage display and the oligonucleotide-based aptamer techniques. The phage display technique has been extensively employed for the identification of novel ligands in vitro and in vivo in different areas such as cancer, vaccine development, and epitope mapping. Particularly, phage display has been employed in the investigation of pathogen-host interactions. Although this methodology has been used for some parasites with encouraging results, in trypanosomatids its use is, as yet, scanty. RNA and DNA aptamers, developed by the SELEX process (Systematic Evolution of Ligands by Exponential Enrichment), were described over two decades ago and since then contributed to a large number of structured nucleic acids for diagnostic or therapeutic purposes or for the understanding of the cell biology. Similarly to the phage display technique scarce use of the SELEX process has been used in the probing of parasite-host interaction. In this review, an overall survey on the use of both phage display and aptamer technologies in different pathogenic organisms will be

  2. RNA/PNA Approach

    Indian Academy of Sciences (India)

    In this approach we want to develop structural analogue of the leader that might have higher affinity towards the Phosphoprotein, but would impair the dimerization process and viral leader RNA binding.

  3. Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

    Science.gov (United States)

    Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

    2016-07-01

    Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.

  4. Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization.

    Science.gov (United States)

    Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong

    2012-08-01

    Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.

  5. Cofactors in the RNA World

    Science.gov (United States)

    Ditzler, Mark A.

    2014-01-01

    RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

  6. A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hao; Suslov, Nikolai B.; Li, Nan-Sheng; Shelke, Sandip A.; Evans, Molly E.; Koldobskaya, Yelena; Rice, Phoebe A.; Piccirilli, Joseph A. [UC

    2014-08-21

    Spinach is an in vitro–selected RNA aptamer that binds a GFP-like ligand and activates its green fluorescence. Spinach is thus an RNA analog of GFP and has potentially widespread applications for in vivo labeling and imaging. We used antibody-assisted crystallography to determine the structures of Spinach both with and without bound fluorophore at 2.2-Å and 2.4-Å resolution, respectively. Spinach RNA has an elongated structure containing two helical domains separated by an internal bulge that folds into a G-quadruplex motif of unusual topology. The G-quadruplex motif and adjacent nucleotides comprise a partially preformed binding site for the fluorophore. The fluorophore binds in a planar conformation and makes extensive aromatic stacking and hydrogen bond interactions with the RNA. Our findings provide a foundation for structure-based engineering of new fluorophore-binding RNA aptamers.

  7. Comparison of Whole-Cell SELEX Methods for the Identification of Staphylococcus Aureus-Specific DNA Aptamers

    OpenAIRE

    Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun

    2015-01-01

    Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, s...

  8. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters

    KAUST Repository

    Akki, Spurti U.; Werth, Charles J.; Silverman, Scott K.

    2015-01-01

    © 2015 American Chemical Society. We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.

  9. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters

    KAUST Repository

    Akki, Spurti U.

    2015-08-18

    © 2015 American Chemical Society. We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.

  10. Detrimental ELAVL-1/HuR-dependent GSK3β mRNA stabilization impairs resolution in acute respiratory distress syndrome.

    Directory of Open Access Journals (Sweden)

    Olivia Hoffman

    Full Text Available A hallmark of acute respiratory distress syndrome (ARDS is accumulation of protein-rich edema in the distal airspaces and its removal is critical for patient survival. Previous studies have shown a detrimental role of Glycogen Synthase Kinase (GSK 3β during ARDS via inhibition of alveolar epithelial protein transport. We hypothesized that post-transcriptional regulation of GSK3β could play a functional role in ARDS resolution. To address this hypothesis, we performed an in silico analysis to identify regulatory genes whose expression correlation to GSK3β messenger RNA utilizing two lung cancer cell line array datasets. Among potential regulatory partners of GSK3β, these studies identified the RNA-binding protein ELAVL-1/HuR (Embryonic Lethal, Abnormal Vision, Drosophila-Like as a central component in a likely GSK3β signaling network. ELAVL-1/HuR is a RNA-binding protein that selectively binds to AU-rich elements of mRNA and enhances its stability thereby increasing target gene expression. Subsequent studies with siRNA suppression of ELAVL-1/HuR demonstrated deceased GSK3β mRNA and protein expression and improved clearance of FITC-albumin in A549 cells. Conversely, stabilization of ELAVL-1/HuR with the proteasome inhibitor MG-132 resulted in induction of GSK3β at mRNA and protein level and attenuated FITC-albumin clearance. Utilizing ventilator-induced lung injury or intra-tracheal installation of hydrochloric acid to induce ARDS in mice, we observed increased mRNA and protein expression of ELAVL-1/HuR and GSK3β. Together, our findings indicate a previously unknown interaction between GSK3β and ELAV-1 during ARDS, and suggest the inhibition of the ELAV-1- GSK3β pathways as a novel ARDS treatment approach.

  11. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    Science.gov (United States)

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright

  12. Aptamer-Phage Reporters for Ultrasensitive Lateral Flow Assays.

    Science.gov (United States)

    Adhikari, Meena; Strych, Ulrich; Kim, Jinsu; Goux, Heather; Dhamane, Sagar; Poongavanam, Mohan-Vivekanandan; Hagström, Anna E V; Kourentzi, Katerina; Conrad, Jacinta C; Willson, Richard C

    2015-12-01

    We introduce the modification of bacteriophage particles with aptamers for use as bioanalytical reporters, and demonstrate the use of these particles in ultrasensitive lateral flow assays. M13 phage displaying an in vivo biotinylatable peptide (AviTag) genetically fused to the phage tail protein pIII were used as reporter particle scaffolds, with biotinylated aptamers attached via avidin-biotin linkages, and horseradish peroxidase (HRP) reporter enzymes covalently attached to the pVIII coat protein. These modified viral nanoparticles were used in immunochromatographic sandwich assays for the direct detection of IgE and of the penicillin-binding protein from Staphylococcus aureus (PBP2a). We also developed an additional lateral flow assay for IgE, in which the analyte is sandwiched between immobilized anti-IgE antibodies and aptamer-bearing reporter phage modified with HRP. The limit of detection of this LFA was 0.13 ng/mL IgE, ∼100 times lower than those of previously reported IgE assays.

  13. Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

    Science.gov (United States)

    Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

    2015-05-15

    It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

  14. Binding kinetics of aptamers to gp120 derived from HIV-1 subtype C

    CSIR Research Space (South Africa)

    Millroy, L

    2011-02-01

    Full Text Available aptamers with specific and strong affinity to the HIV-1 envelope glycoprotein gp120 and act as novel HIV-1 entry inhibitor drugs or as targeted drug delivery systems to HIV-1 infected cells. Prior to any downstream applications, novel gp120 aptamers need...

  15. DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.

    Science.gov (United States)

    Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A

    2011-09-01

    A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.

  16. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    Science.gov (United States)

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  17. Combining aptamers and in silico interaction studies to decipher the function of hypothetical proteins

    DEFF Research Database (Denmark)

    Suravajhala, Prashanth; Burri, Harsha Vardhan Reddy; Heiskanen, Arto

    2014-01-01

    We present the potential role of aptamers in elucidating the function of hypothetical proteins, as well as the possibilities provided by bioinformatics for establishing a benchmark for aptamer-protein prediction methods. With these future perspectives, the role of hypothetical proteins as target ...... molecules for diagnostics and therapies could prove to be very useful in development of medical technology....

  18. Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus.

    Science.gov (United States)

    Cao, Xiaoxiao; Li, Shaohua; Chen, Liucun; Ding, Hongmei; Xu, Hua; Huang, Yanping; Li, Jie; Liu, Nongle; Cao, Weihong; Zhu, Yanjun; Shen, Beifen; Shao, Ningsheng

    2009-08-01

    In this article, a panel of ssDNA aptamers specific to Staphylococcus aureus was obtained by a whole bacterium-based SELEX procedure and applied to probing S. aureus. After several rounds of selection with S. aureus as the target and Streptococcus and S. epidermidis as counter targets, the highly enriched oligonucleic acid pool was sequenced and then grouped under different families on the basis of the homology of the primary sequence and the similarity of the secondary structure. Eleven sequences from different families were selected for further characterization by confocal imaging and flow cytometry analysis. Results showed that five aptamers demonstrated high specificity and affinity to S. aureus individually. The five aptamers recognize different molecular targets by competitive experiment. Combining these five aptamers had a much better effect than the individual aptamer in the recognition of different S. aureus strains. In addition, the combined aptamers can probe single S. aureus in pyogenic fluids. Our work demonstrates that a set of aptamers specific to one bacterium can be used in combination for the identification of the bacterium instead of a single aptamer.

  19. Selection of aptamers for Candida albicans by cell-SELEX

    International Nuclear Information System (INIS)

    Miranda, Alessandra Nunes Duarte

    2017-01-01

    The growing concern with invasive fungal infections, responsible for an alarming mortality rate of immunosuppressed patients and in Intensive Care Units, evidences the need for a fast and specific method for the Candida albicans detection, since this species is identified as one of the main causes of septicemia. Commonly, it is a challenge for clinicians to determine the primary infection foci, the dissemination degree, or whether the site of a particular surgery is involved. Although scintigraphic imaging represents a promising tool for infectious foci detection, it still lacks a methodology for C. albicans diagnosis due to the absence of specific radiotracers for this microorganism. Aptamers are molecules that have almost ideal properties for use as diagnostic radiopharmaceuticals, such as high specificity for their molecular targets, lack of immunogenicity and toxicity, high tissue penetration and rapid blood clearance. Aptamers can also be labeled with different radionuclides. This work aims to obtain aptamers for specific binding to C. albicans cells for future application as a radiopharmaceutical. It was used a variation of the SELEX (Systematic Evolution of Ligands by EXponential Enrichment) technique, termed cell-SELEX, in which cells are the targets for selection. A selection protocol was standardized using a random library of single-stranded oligonucleotides, each containing two fixed regions flanking a sequence of 40 random nucleotides. This library was incubated with C. albicans cells in the presence of competitors. Then, the binding sequences were separated by centrifugation, resuspended and amplified by PCR. The amplification was confirmed by agarose gel electrophoresis. After that, the ligands were purified to obtain a new pool of ssDNA, from which a new incubation was carried out. The selection parameters were gradually modified in order to increase stringency. This cycle was repeated 12 times to allow the selection of sequences with the maximum

  20. Using a Specific RNA-Protein Interaction To Quench the Fluorescent RNA Spinach.

    Science.gov (United States)

    Roszyk, Laura; Kollenda, Sebastian; Hennig, Sven

    2017-12-15

    RNAs are involved in interaction networks with other biomolecules and are crucial for proper cell function. Yet their biochemical analysis remains challenging. For Förster Resonance Energy Transfer (FRET), a common tool to study such interaction networks, two interacting molecules have to be fluorescently labeled. "Spinach" is a genetically encodable RNA aptamer that starts to fluoresce upon binding of an organic molecule. Therefore, it is a biological fluorophore tag for RNAs. However, spinach has never been used in a FRET assembly before. Here, we describe how spinach is quenched when close to acceptors. We used RNA-DNA hybridization to bring quenchers or red organic dyes in close proximity to spinach. Furthermore, we investigate RNA-protein interactions quantitatively on the example of Pseudomonas aeruginosa phage coat protein 7 (PP7) and its interacting pp7-RNA. We utilize spinach quenching as a fully genetically encodable system even under lysate conditions. Therefore, this work represents a direct method to analyze RNA-protein interactions by quenching the spinach aptamer.

  1. Nucleic acid aptamer-guided cancer therapeutics and diagnostics: the next generation of cancer medicine.

    Science.gov (United States)

    Xiang, Dongxi; Shigdar, Sarah; Qiao, Greg; Wang, Tao; Kouzani, Abbas Z; Zhou, Shu-Feng; Kong, Lingxue; Li, Yong; Pu, Chunwen; Duan, Wei

    2015-01-01

    Conventional anticancer therapies, such as chemo- and/or radio-therapy are often unable to completely eradicate cancers due to abnormal tumor microenvironment, as well as increased drug/radiation resistance. More effective therapeutic strategies for overcoming these obstacles are urgently in demand. Aptamers, as chemical antibodies that bind to targets with high affinity and specificity, are a promising new and novel agent for both cancer diagnostic and therapeutic applications. Aptamer-based cancer cell targeting facilitates the development of active targeting in which aptamer-mediated drug delivery could provide promising anticancer outcomes. This review is to update the current progress of aptamer-based cancer diagnosis and aptamer-mediated active targeting for cancer therapy in vivo, exploring the potential of this novel form of targeted cancer therapy.

  2. Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1.

    Science.gov (United States)

    Huang, Yukun; Chen, Xiujuan; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Wei, Xinlin; Wang, Yuanfeng

    2015-01-01

    Enterotoxins from pathogenic bacteria are known as the main reason that can cause the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in vitro by twelve rounds of selection based on magnetic separation technology, with a low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. Aptamer-based quantification of SEC1 in the food sample by a graphene oxide (GO)-based method was implemented to investigate the potential of the aptamer against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, biosensors using the selected SEC1 aptamers as new molecular recognition elements could be applied for innovative determinations of SEC1. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. A new mitochondrial point mutation in the transfer RNA(Lys) gene associated with progressive external ophthalmoplegia with impaired respiratory regulation.

    Science.gov (United States)

    Wolf, Joachim; Obermaier-Kusser, Bert; Jacobs, Martina; Milles, Cornelia; Mörl, Mario; von Pein, Harald D; Grau, Armin J; Bauer, Matthias F

    2012-05-15

    We report a novel heteroplasmic point mutation G8299A in the gene for mitochondrial tRNA(Lys) in a patient with progressive external ophthalmoplegia complicated by recurrent respiratory insufficiency. Biochemical analysis of respiratory chain complexes in muscle homogenate showed a combined complex I and IV deficiency. The transition does not represent a known neutral polymorphism and affects a position in the tRNA acceptor stem which is conserved in primates, leading to a destabilization of this functionally important domain. In vitro analysis of an essential maturation step of the tRNA transcript indicates the probable pathogenicity of this mutation. We hypothesize that there is a causal relationship between the novel G8299A transition and progressive external ophthalmoplegia with recurrent respiratory failure due to a depressed respiratory drive. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA

    OpenAIRE

    Stoltenburg, Regina; Kraf?ikov?, Petra; V?glask?, Viktor; Strehlitz, Beate

    2016-01-01

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting P...

  5. Deficiency of the Survival of Motor Neuron Protein Impairs mRNA Localization and Local Translation in the Growth Cone of Motor Neurons.

    Science.gov (United States)

    Fallini, Claudia; Donlin-Asp, Paul G; Rouanet, Jeremy P; Bassell, Gary J; Rossoll, Wilfried

    2016-03-30

    Spinal muscular atrophy (SMA) is a neurodegenerative disease primarily affecting spinal motor neurons. It is caused by reduced levels of the survival of motor neuron (SMN) protein, which plays an essential role in the biogenesis of spliceosomal small nuclear ribonucleoproteins in all tissues. The etiology of the specific defects in the motor circuitry in SMA is still unclear, but SMN has also been implicated in mediating the axonal localization of mRNA-protein complexes, which may contribute to the axonal degeneration observed in SMA. Here, we report that SMN deficiency severely disrupts local protein synthesis within neuronal growth cones. We also identify the cytoskeleton-associated growth-associated protein 43 (GAP43) mRNA as a new target of SMN and show that motor neurons from SMA mouse models have reduced levels ofGAP43mRNA and protein in axons and growth cones. Importantly, overexpression of two mRNA-binding proteins, HuD and IMP1, restoresGAP43mRNA and protein levels in growth cones and rescues axon outgrowth defects in SMA neurons. These findings demonstrate that SMN plays an important role in the localization and local translation of mRNAs with important axonal functions and suggest that disruption of this function may contribute to the axonal defects observed in SMA. The motor neuron disease spinal muscular atrophy (SMA) is caused by reduced levels of the survival of motor neuron (SMN) protein, which plays a key role in assembling RNA/protein complexes that are essential for mRNA splicing. It remains unclear whether defects in this well characterized housekeeping function cause the specific degeneration of spinal motor neurons observed in SMA. Here, we describe an additional role of SMN in regulating the axonal localization and local translation of the mRNA encoding growth-associated protein 43 (GAP43). This study supports a model whereby SMN deficiency impedes transport and local translation of mRNAs important for neurite outgrowth and stabilization

  6. Development of an aptamer beacon for detection of interferon-gamma.

    Science.gov (United States)

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  7. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Ardjomandi, N.; Huth, J. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Stamov, D.R. [JPK Instruments AG, Berlin (Germany); Henrich, A. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Klein, C. [Dental Practice Zahngesundheit Waiblingen, Waiblingen (Germany); Wendel, H.-P. [Department of Thoracic, Cardiac and Vascular Surgery, University Hospital, Tübingen (Germany); Reinert, S. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Alexander, D., E-mail: dorothea.alexander@med.uni-tuebingen.de [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany)

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. - Highlights: • Covalent binding of aptamer 74 on PLGA-coated β-tricalcium phosphate constructs. • AFM analysis of rupture forces between aptamer 74 and jaw periosteal cells. • Analysis of jaw periosteal cell functions on aptamer coated β-TCP constructs.

  8. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering

    International Nuclear Information System (INIS)

    Ardjomandi, N.; Huth, J.; Stamov, D.R.; Henrich, A.; Klein, C.; Wendel, H.-P.; Reinert, S.; Alexander, D.

    2016-01-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. - Highlights: • Covalent binding of aptamer 74 on PLGA-coated β-tricalcium phosphate constructs. • AFM analysis of rupture forces between aptamer 74 and jaw periosteal cells. • Analysis of jaw periosteal cell functions on aptamer coated β-TCP constructs.

  9. Aptamer conjugated paclitaxel and magnetic fluid loaded fluorescently tagged PLGA nanoparticles for targeted cancer therapy

    Energy Technology Data Exchange (ETDEWEB)

    Aravind, Athulya; Nair, Remya; Raveendran, Sreejith; Veeranarayanan, Srivani; Nagaoka, Yutaka; Fukuda, Takahiro; Hasumura, Takahashi; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Sakthi Kumar, D., E-mail: sakthi@toyo.jp

    2013-10-15

    Controlled and targeted drug delivery is an essential criterion in cancer therapy to reduce the side effects caused by non-specific drug release and toxicity. Targeted chemotherapy, sustained drug release and optical imaging have been achieved using a multifunctional nanocarrier constructed from poly (D, L-lactide-co-glycolide) nanoparticles (PLGA NPs), an anticancer drug paclitaxel (PTX), a fluorescent dye Nile red (NR), magnetic fluid (MF) and aptamers (Apt, AS1411, anti-nucleolin aptamer). The magnetic fluid and paclitaxel loaded fluorescently labeled PLGA NPs (MF-PTX-NR-PLGA NPs) were synthesized by a single-emulsion technique/solvent evaporation method using a chemical cross linker bis (sulfosuccinimidyl) suberate (BS3) to enable binding of aptamer on to the surface of the nanoparticles. Targeting aptamers were then introduced to the particles through the reaction with the cross linker to target the nucleolin receptors over expressed on the cancer cell surface. Specific binding and uptake of the aptamer conjugated magnetic fluid loaded fluorescently tagged PLGA NPs (Apt-MF-NR-PLGA NPs) to the target cancer cells induced by aptamers was observed using confocal microscopy. Cytotoxicity assay conducted in two cell lines (L929 and MCF-7) confirmed that targeted MCF-7 cancer cells were killed while control cells were unharmed. In addition, aptamer mediated delivery resulting in enhanced binding and uptake to the target cancer cells exhibited increased therapeutic effect of the drug. Moreover, these aptamer conjugated magnetic polymer vehicles apart from actively transporting drugs into specifically targeted tumor regions can also be used to induce hyperthermia or for facilitating magnetic guiding of particles to the tumor regions. - Highlights: • Aptamer escorted, theranostic biodegradable PLGA carriers were developed. • Can target cancer cells, control drug release, image and magnetically guide. • Highly specific to the targeted cancer cells thus delivering

  10. Fluorometric graphene oxide-based detection of Salmonella enteritis using a truncated DNA aptamer.

    Science.gov (United States)

    Chinnappan, Raja; AlAmer, Saleh; Eissa, Shimaa; Rahamn, Anas Abdel; Abu Salah, Khalid M; Zourob, Mohammed

    2017-12-18

    The work describes a fluorescence-based study for mapping the highest affinity truncated aptamer from the full length sequence and its integration in a graphene oxide platform for the detection of Salmonella enteriditis. To identify the best truncated sequence, molecular beacons and a displacement assay design are applied. In the fluorescence displacement assay, the truncated aptamer was hybridized with fluorescein and quencher-labeled complementary sequences to form a fluorescence/quencher pair. In the presence of S. enteritidis, the aptamer dissociates from the complementary labeled oligonucleotides and thus, the fluorescein/quencher pair becomes physically separated. This leads to an increase in fluorescence intensity. One of the truncated aptamers identified has a 2-fold lower dissociation constant (3.2 nM) compared to its full length aptamer (6.3 nM). The truncated aptamer selected in this process was used to develop a fluorometric graphene oxide (GO) based assay. If fluorescein-labeled aptamer is adsorbed on GO via π stacking interaction, fluorescence is quenched. However, in the presence of target (S. enteriditis), the labeled aptamers is released from surface to form a stable complex with the bacteria and fluorescence is restored, depending on the quantity of bacteria being present. The resulting assay has an unsurpassed detection limit of 25 cfu·mL -1 in the best case. The cross reactivity to Salmonella typhimurium, Staphylococcus aureus and Escherichia coli is negligible. The assay was applied to analyze doped milk samples for and gave good recovery. Thus, we believe that the truncated aptamer/graphene oxide platform is a potential tool for the detection of S. Enteritidis. Graphical abstract Fluorescently labelled aptamer against Salmonella enteritidis was adsorbed on the surface of graphene oxide by π-stacking interaction. This results in quenching of the fluorescence of the label. Addition of Salmonella enteritidis restores fluorescence, and this

  11. Analysis and Identification of Aptamer-Compound Interactions with a Maximum Relevance Minimum Redundancy and Nearest Neighbor Algorithm.

    Science.gov (United States)

    Wang, ShaoPeng; Zhang, Yu-Hang; Lu, Jing; Cui, Weiren; Hu, Jerry; Cai, Yu-Dong

    2016-01-01

    The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request.

  12. Site-selective conjugation of an anticoagulant aptamer to recombinant albumins and maintenance of neonatal Fc receptor binding

    DEFF Research Database (Denmark)

    Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia

    2017-01-01

    -linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer......-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment...... of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4...

  13. Identification of several circulating microRNAs from a genome-wide circulating microRNA expression profile as potential biomarkers for impaired glucose metabolism in polycystic ovarian syndrome.

    Science.gov (United States)

    Jiang, Linlin; Huang, Jia; Chen, Yaxiao; Yang, Yabo; Li, Ruiqi; Li, Yu; Chen, Xiaoli; Yang, Dongzi

    2016-07-01

    This study aimed to detect serum microRNAs (miRNAs) differentially expressed between polycystic ovary syndrome (PCOS) patients with impaired glucose metabolism (IGM), PCOS patients with normal glucose tolerance (NGT), and healthy controls. A TaqMan miRNA array explored serum miRNA profiles as a pilot study, then selected miRNAs were analyzed in a validation cohort consisting of 65 PCOS women with IGM, 65 PCOS women with NGT, and 45 healthy women The relative expression of miR-122, miR-193b, and miR-194 was up-regulated in PCOS patients compared with controls, whereas that of miR-199b-5p was down-regulated. Furthermore, miR-122, miR-193b, and miR-194 were increased in the PCOS-IGM group compared with the PCOS-NGT group. Multiple linear regression analyses revealed that miR-193b and body mass index contributed independently to explain 43.7 % (P ovarian follicle development pathways, including the insulin signaling pathway, the neurotrophin signaling pathway, the PI3K-AKT signaling pathway, and regulation of actin cytoskeleton. This study expands our knowledge of the serum miRNA expression profiles of PCOS patients with IGM and the predicted target signal pathways involved in disease pathophysiology.

  14. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  15. Mutation in WDR4 impairs tRNA m(7)G46 methylation and causes a distinct form of microcephalic primordial dwarfism.

    Science.gov (United States)

    Shaheen, Ranad; Abdel-Salam, Ghada M H; Guy, Michael P; Alomar, Rana; Abdel-Hamid, Mohamed S; Afifi, Hanan H; Ismail, Samira I; Emam, Bayoumi A; Phizicky, Eric M; Alkuraya, Fowzan S

    2015-09-28

    Primordial dwarfism is a state of extreme prenatal and postnatal growth deficiency, and is characterized by marked clinical and genetic heterogeneity. Two presumably unrelated consanguineous families presented with an apparently novel form of primordial dwarfism in which severe growth deficiency is accompanied by distinct facial dysmorphism, brain malformation (microcephaly, agenesis of corpus callosum, and simplified gyration), and severe encephalopathy with seizures. Combined autozygome/exome analysis revealed a novel missense mutation in WDR4 as the likely causal variant. WDR4 is the human ortholog of the yeast Trm82, an essential component of the Trm8/Trm82 holoenzyme that effects a highly conserved and specific (m(7)G46) methylation of tRNA. The human mutation and the corresponding yeast mutation result in a significant reduction of m(7)G46 methylation of specific tRNA species, which provides a potential mechanism for primordial dwarfism associated with this lesion, since reduced m(7)G46 modification causes a growth deficiency phenotype in yeast. Our study expands the number of biological pathways underlying primordial dwarfism and adds to a growing list of human diseases linked to abnormal tRNA modification.

  16. Increased expression of microRNA-221 inhibits PAK1 in endothelial progenitor cells and impairs its function via c-Raf/MEK/ERK pathway

    International Nuclear Information System (INIS)

    Zhang, Xiaoping; Mao, Haian; Chen, Jin-yuan; Wen, Shengjun; Li, Dan; Ye, Meng; Lv, Zhongwei

    2013-01-01

    Highlights: ► MicroRNA-221 is upregulated in the endothelial progenitor cells of atherosclerosis patients. ► PAK1 is a direct target of microRNA-221. ► MicroRNA-221 inhibits EPCs proliferation through c-Raf/MEK/ERK pathway. -- Abstract: Coronary artery disease (CAD) is associated with high mortality and occurs via endothelial injury. Endothelial progenitor cells (EPCs) restore the integrity of the endothelium and protect it from atherosclerosis. In this study, we compared the expression of microRNAs (miRNAs) in EPCs in atherosclerosis patients and normal controls. We found that miR-221 expression was significantly up-regulated in patients compared with controls. We predicted and identified p21/Cdc42/Rac1-activated kinase 1 (PAK1) as a novel target of miR-221 in EPCs. We also demonstrated that miR-221 targeted a putative binding site in the 3′UTR of PAK1, and absence of this site was inversely associated with miR-221 expression in EPCs. We confirmed this relationship using a luciferase reporter assay. Furthermore, overexpression of miR-221 in EPCs significantly decreased EPC proliferation, in accordance with the inhibitory effects induced by decreased PAK1. Overall, these findings demonstrate that miR-221 affects the MEK/ERK pathway by targeting PAK1 to inhibit the proliferation of EPCs

  17. Development of a fraction collection approach in capillary electrophoresis SELEX for aptamer selection.

    Science.gov (United States)

    Luo, Zhaofeng; Zhou, Hongmin; Jiang, Hao; Ou, Huichao; Li, Xin; Zhang, Liyun

    2015-04-21

    Aptamers have attracted much attention due to their ability to bind to target molecules with high affinity and specificity. The development of an approach capable of efficiently generating aptamers through systematic evolution of ligands by exponential enrichment (SELEX) is particularly challenging. Herein, a fraction collection approach in capillary electrophoresis SELEX (FCE-SELEX) for the partition of a bound DNA-target complex is developed. By integrating fraction collection with a facile oil seal method for avoiding contamination while amplifying the bound DNA-target complex, in a single round of selection, a streptavidin-binding aptamer (SBA) has been generated. The affinity of aptamer SBA-36 for streptavidin (SA) is determined as 30.8 nM by surface plasmon resonance (SPR). Selectivity and biotin competition experiments demonstrate that the SBA-36 aptamer selected by FCE-SELEX is as efficient as those from other methods. Based on the ability of fraction collection in partition and collection of the aptamer-target complex from the original DNA library, FCE-SELEX can be a universal tool for the development of aptamers.

  18. Evaluation of different strategies for magnetic particle functionalization with DNA aptamers.

    Science.gov (United States)

    Pérez-Ruiz, Elena; Lammertyn, Jeroen; Spasic, Dragana

    2016-12-25

    The optimal bio-functionalization of magnetic particles is essential for developing magnetic particle-based bioassays. Whereas functionalization with antibodies is generally well established, immobilization of DNA probes, such as aptamers, is not yet fully explored. In this work, four different types of commercially available magnetic particles, coated with streptavidin, maleimide or carboxyl groups, were evaluated for their surface coverage with aptamer bioreceptors, efficiency in capturing target protein and non-specific protein adsorption on their surface. A recently developed aptamer against the peanut allergen, Ara h 1 protein, was used as a model system. Conjugation of biotinylated Ara h 1 aptamer to the streptavidin particles led to the highest surface coverage, whereas the coverage of maleimide particles was 25% lower. Carboxylated particles appeared to be inadequate for DNA functionalization. Streptavidin particles also showed the greatest target capturing efficiency, comparable to the one of particles functionalized with anti-Ara h 1 antibody. The performance of streptavidin particles was additionally tested in a sandwich assay with the aptamer as a capture receptor on the particle surface. While the limit of detection obtained was comparable to the same assay system with antibody as capture receptor, it was superior to previously reported values using the same aptamer in similar assay schemes with different detection platforms. These results point to the promising application of the Ara h 1 aptamer-functionalized particles in bioassay development. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Aptamers: Novel Molecules as Diagnostic Markers in Bacterial and Viral Infections?

    Directory of Open Access Journals (Sweden)

    Flávia M. Zimbres

    2013-01-01

    Full Text Available Worldwide the entire human population is at risk of infectious diseases of which a high degree is caused by pathogenic protozoans, worms, bacteria, and virus infections. Moreover the current medications against pathogenic agents are losing their efficacy due to increasing and even further spreading drug resistance. Therefore, there is an urgent need to discover novel diagnostic as well as therapeutic tools against infectious agents. In view of that, the Systematic Evolution of Ligands by Exponential Enrichment (SELEX represents a powerful technology to target selectively pathogenic factors as well as entire bacteria or viruses. SELEX uses a large combinatorial oligonucleic acid library (DNA or RNA which is processed a by high-flux in vitro screen of iterative cycles. The selected ligands, termed aptamers, are characterized by high specificity and affinity to their target molecule, which are already exploited in diagnostic and therapeutic applications. In this minireview we will discuss the current status of the SELEX technique applied on bacterial and viral pathogens.

  20. Thermodynamic, Anticoagulant, and Antiproliferative Properties of Thrombin Binding Aptamer Containing Novel UNA Derivative

    Directory of Open Access Journals (Sweden)

    Weronika Kotkowiak

    2018-03-01

    Full Text Available Thrombin is a serine protease that plays a crucial role in hemostasis, fibrinolysis, cell proliferation, and migration. Thrombin binding aptamer (TBA is able to inhibit the activity of thrombin molecule via binding to its exosite I. This 15-nt DNA oligonucleotide forms an intramolecular, antiparallel G-quadruplex structure with a chair-like conformation. In this paper, we report on our investigations on the influence of certain modified nucleotide residues on thermodynamic stability, folding topology, and biological properties of TBA variants. In particular, the effect of single incorporation of a novel 4-thiouracil derivative of unlocked nucleic acid (UNA, as well as single incorporation of 4-thiouridine and all four canonical UNAs, was evaluated. The studies presented herein have shown that 4-thiouridine in RNA and UNA series, as well as all four canonical UNAs, can efficiently modulate G-quadruplex thermodynamic and biological stability, and that the effect is strongly position dependent. Interestingly, TBA variants containing the modified nucleotide residues are characterized by unchanged folding topology. Thrombin time assay revealed that incorporation of certain UNA residues may improve G-quadruplex anticoagulant properties. Noteworthy, some TBA variants, characterized by decreased ability to inhibit thrombin activity, possess significant antiproliferative properties reducing the viability of the HeLa cell line even by 95% at 10 μM concentration.

  1. Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).

    Science.gov (United States)

    Entzian, Clemens; Schubert, Thomas

    2016-03-15

    Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m

    International Nuclear Information System (INIS)

    Santos, Sara Roberta dos; Rodrigues Corrêa, Cristiane; Branco de Barros, André Luís; Serakides, Rogéria; Fernandes, Simone Odília

    2015-01-01

    Introduction: Aptamers are oligonucleotides that have high affinity and specificity for their molecular targets which are emerging as a new class of molecules for radiopharmaceuticals development. In this study, aptamers selected to Staphylococcus aureus were evaluated for bacterial infection identification. Methods: Anti S. aureus aptamers were labeled with 99m Tc by the direct method. The radiolabel yield and complex stability were assessed by thin-layer chromatography (TLC). Three groups of Swiss mice containing 6 animals each were used. The first group was infected intramuscularly in the right thigh with S. aureus. The second group was infected in the same way with C. albicans and the third group was injected with zymosan to induce aseptic inflammation. After 24 h, radiolabeled aptamers (22.2 MBq) were injected by the tail vein. The mice were euthanized 4 h post injection and tissue sample activities measured in a gamma counter. Results: The 99m Tc labeled aptamers were stable in saline, plasma and cystein excess. Radiolabeled aptamers showed increased uptake in the kidneys for all groups indicating a main renal excretion, which is consistent with the hydrophilic nature and small size of aptamers. The radiopharmaceutical showed rapid blood clearance indicated by a reduced dose (% ID/g) in the blood. The biodistribution showed that aptamers were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 4.0 ± 0.5. This ratio for mice infected with C. albicans was 2.0 ± 0.4 while for mice with aseptic inflammation was 1.2 ± 0.2. Histology confirmed the presence of infection in groups 1 and 2, and inflammation in group 3. Conclusions: The biodistibution study demonstrated a statistically higher uptake in the S. aureus foci relative to inflammation and C. albicans infected areas. These results highlight the potential of aptamers labeled directly with 99m Tc for bacterial infection diagnosis by scintigraphy

  3. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  4. Striatal modulation of BDNF expression using microRNA124a-expressing lentiviral vectors impairs ethanol-induced conditioned-place preference and voluntary alcohol consumption.

    Science.gov (United States)

    Bahi, Amine; Dreyer, Jean-Luc

    2013-07-01

    Alcohol abuse is a major health, economic and social concern in modern societies, but the exact molecular mechanisms underlying ethanol addiction remain elusive. Recent findings show that small non-coding microRNA (miRNA) signaling contributes to complex behavioral disorders including drug addiction. However, the role of miRNAs in ethanol-induced conditioned-place preference (CPP) and voluntary alcohol consumption has not yet been directly addressed. Here, we assessed the expression profile of miR124a in the dorsal striatum of rats upon ethanol intake. The results show that miR124a was downregulated in the dorso-lateral striatum (DLS) following alcohol drinking. Then, we identified brain-derived neurotrophic factor (BDNF) as a direct target of miR124a. In fact, BDNF mRNA was upregulated following ethanol drinking. We used lentiviral vector (LV) gene transfer technology to further address the role of miR124a and its direct target BDNF in ethanol-induced CPP and alcohol consumption. Results reveal that stereotaxic injection of LV-miR124a in the DLS enhances ethanol-induced CPP as well as voluntary alcohol consumption in a two-bottle choice drinking paradigm. Moreover, miR124a-silencer (LV-siR124a) as well as LV-BDNF infusion in the DLS attenuates ethanol-induced CPP as well as voluntary alcohol consumption. Importantly, LV-miR124a, LV-siR124a and LV-BDNF have no effect on saccharin and quinine intake. Our findings indicate that striatal miR124a and BDNF signaling have crucial roles in alcohol consumption and ethanol conditioned reward. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  5. Miniaturized Aptamer-Based Assays for Protein Detection

    Directory of Open Access Journals (Sweden)

    Alessandro Bosco

    2016-09-01

    Full Text Available The availability of devices for cancer biomarker detection at early stages of the disease is one of the most critical issues in biomedicine. Towards this goal, to increase the assay sensitivity, device miniaturization strategies empowered by the employment of high affinity protein binders constitute a valuable approach. In this work we propose two different surface-based miniaturized platforms for biomarker detection in body fluids: the first platform is an atomic force microscopy (AFM-based nanoarray, where AFM is used to generate functional nanoscale areas and to detect biorecognition through careful topographic measurements; the second platform consists of a miniaturized electrochemical cell to detect biomarkers through electrochemical impedance spectroscopy (EIS analysis. Both devices rely on robust and highly-specific protein binders as aptamers, and were tested for thrombin detection. An active layer of DNA-aptamer conjugates was immobilized via DNA directed immobilization on complementary single-stranded DNA self-assembled monolayers confined on a nano/micro area of a gold surface. Results obtained with these devices were compared with the output of surface plasmon resonance (SPR assays used as reference. We succeeded in capturing antigens in concentrations as low as a few nM. We put forward ideas to push the sensitivity further to the pM range, assuring low biosample volume (μL range assay conditions.

  6. Electrochemical Impedance Spectroscopic Sensing of Methamphetamine by a Specific Aptamer

    Directory of Open Access Journals (Sweden)

    Omid Mashinchian

    2012-05-01

    Full Text Available Introduction: Electrochemical impedance spectroscopy (EIS is a simple and highly sensitive technique that can be used for evaluation of the aptamer-target interaction even in a label-free approach. Methods: To pursue the effectiveness of EIS, in the current study, the folding properties of specific aptamer for methamphetamine (METH (i.e., aptaMETH were evaluated in the presence of METH and amphetamine (Amph. Folded and unfolded aptaMETH was mounted on the gold electrode surface and the electron charge transfer was measured by EIS. Results: The Ret of methamphetamine-aptaMETH was significantly increased in comparison with other folding conditions, indicating specific detection of METH by aptaMETH. Conclusion: Based on these findings, methamphetamine-aptaMETH on the gold electrode surface displayed the most interfacial electrode resistance and thus the most folding situation. This clearly indicates that the aptaMETH can profoundly and specifically pinpoint METH; as a result we suggest utilization of this methodology for fast and cost-effective identification of METH.

  7. Harnessing Aptamers to Overcome Challenges in Gluten Detection

    Directory of Open Access Journals (Sweden)

    Rebeca Miranda-Castro

    2016-04-01

    Full Text Available Celiac disease is a lifelong autoimmune disorder triggered by foods containing gluten, the storage protein in wheat, rye, and barley. The rapidly escalating number of patients diagnosed with this disease poses a great challenge to both food industry and authorities to guarantee food safety for all. Therefore, intensive efforts are being made to establish minimal disease-eliciting doses of gluten and consequently to improve gluten-free labeling. These efforts depend to a high degree on the availability of methods capable of detecting the protein in food samples at levels as low as possible. Current analytical approaches rely on the use of antibodies as selective recognition elements. With limited sensitivity, these methods exhibit some deficiencies that compromise the accuracy of the obtained results. Aptamers provide an ideal alternative for designing biosensors for fast and selective measurement of gluten in foods. This article highlights the challenges in gluten detection, the current status of the use of aptamers for solving this problem, and what remains to be done to move these systems into commercial applications.

  8. Screening and Initial Binding Assessment of Fumonisin B1 Aptamers

    Directory of Open Access Journals (Sweden)

    Maria C. DeRosa

    2010-11-01

    Full Text Available Fumonisins are mycotoxins produced by Fusarium verticillioides and F. proliferatum, fungi that are ubiquitous in corn (maize. Insect damage and some other environmental conditions result in the accumulation of fumonisins in corn-based products worldwide. Current methods of fumonisin detection rely on the use of immunoaffinity columns and high-performance liquid chromatography (HPLC. The use of aptamers offers a good alternative to the use of antibodies in fumonisin cleanup and detection due to lower costs and improved stability. Aptamers are single-stranded oligonucleotides that are selected using Systematic Evolution of Ligands by EXponential enrichment (SELEX for their ability to bind to targets with high affinity and specificity. Sequences obtained after 18 rounds of SELEX were screened for their ability to bind to fumonisin B1. Six unique sequences were obtained, each showing improved binding to fumonisin B1 compared to controls. Sequence FB1 39 binds to fumonisin with a dissociation constant of 100 ± 30 nM and shows potential for use in fumonisin biosensors and solid phase extraction columns.

  9. Osthole Stimulated Neural Stem Cells Differentiation into Neurons in an Alzheimer's Disease Cell Model via Upregulation of MicroRNA-9 and Rescued the Functional Impairment of Hippocampal Neurons in APP/PS1 Transgenic Mice

    Directory of Open Access Journals (Sweden)

    Shao-Heng Li

    2017-06-01

    Full Text Available Alzheimer's disease (AD is the most serious neurodegenerative disease worldwide and is characterized by progressive cognitive impairment and multiple neurological changes, including neuronal loss in the brain. However, there are no available drugs to delay or cure this disease. Consequently, neuronal replacement therapy may be a strategy to treat AD. Osthole (Ost, a natural coumarin derivative, crosses the blood-brain barrier and exerts strong neuroprotective effects against AD in vitro and in vivo. Recently, microRNAs (miRNAs have demonstrated a crucial role in pathological processes of AD, implying that targeting miRNAs could be a therapeutic approach to AD. In the present study, we investigated whether Ost could enhance cell viability and prevent cell death in amyloid precursor protein (APP-expressing neural stem cells (NSCs as well as promote APP-expressing NSCs differentiation into more neurons by upregulating microRNA (miR-9 and inhibiting the Notch signaling pathway in vitro. In addition, Ost treatment in APP/PS1 double transgenic (Tg mice markedly restored cognitive functions, reduced Aβ plague production and rescued functional impairment of hippocampal neurons. The results of the present study provides evidence of the neurogenesis effects and neurobiological mechanisms of Ost against AD, suggesting that Ost is a promising drug for treatment of AD or other neurodegenerative diseases.

  10. Global mRNA expression analysis in myosin II deficient strains of Saccharomyces cerevisiae reveals an impairment of cell integrity functions

    Directory of Open Access Journals (Sweden)

    Rivera-Molina Félix E

    2008-01-01

    Full Text Available Abstract Background The Saccharomyces cerevisiae MYO1 gene encodes the myosin II heavy chain (Myo1p, a protein required for normal cytokinesis in budding yeast. Myo1p deficiency in yeast (myo1Δ causes a cell separation defect characterized by the formation of attached cells, yet it also causes abnormal budding patterns, formation of enlarged and elongated cells, increased osmotic sensitivity, delocalized chitin deposition, increased chitin synthesis, and hypersensitivity to the chitin synthase III inhibitor Nikkomycin Z. To determine how differential expression of genes is related to these diverse cell wall phenotypes, we analyzed the global mRNA expression profile of myo1Δ strains. Results Global mRNA expression profiles of myo1Δ strains and their corresponding wild type controls were obtained by hybridization to yeast oligonucleotide microarrays. Results for selected genes were confirmed by real time RT-PCR. A total of 547 differentially expressed genes (p ≤ 0.01 were identified with 263 up regulated and 284 down regulated genes in the myo1Δ strains. Gene set enrichment analysis revealed the significant over-representation of genes in the protein biosynthesis and stress response categories. The SLT2/MPK1 gene was up regulated in the microarray, and a myo1Δslt2Δ double mutant was non-viable. Overexpression of ribosomal protein genes RPL30 and RPS31 suppressed the hypersensitivity to Nikkomycin Z and increased the levels of phosphorylated Slt2p in myo1Δ strains. Increased levels of phosphorylated Slt2p were also observed in wild type strains under these conditions. Conclusion Following this analysis of global mRNA expression in yeast myo1Δ strains, we conclude that 547 genes were differentially regulated in myo1Δ strains and that the stress response and protein biosynthesis gene categories were coordinately regulated in this mutant. The SLT2/MPK1 gene was confirmed to be essential for myo1Δ strain viability, supporting that the up

  11. Parasite load induces progressive spleen architecture breakage and impairs cytokine mRNA expression in Leishmania infantum-naturally infected dogs.

    Science.gov (United States)

    Cavalcanti, Amanda S; Ribeiro-Alves, Marcelo; Pereira, Luiza de O R; Mestre, Gustavo Leandro; Ferreira, Anna Beatriz Robottom; Morgado, Fernanda N; Boité, Mariana C; Cupolillo, Elisa; Moraes, Milton O; Porrozzi, Renato

    2015-01-01

    Canine Visceral Leishmaniasis (CVL) shares many aspects with the human disease and dogs are considered the main urban reservoir of L. infantum in zoonotic VL. Infected dogs develop progressive disease with a large clinical spectrum. A complex balance between the parasite and the genetic/immunological background of the host are decisive for infection evolution and clinical outcome. This study comprised 92 Leishmania infected mongrel dogs of various ages from Mato Grosso, Brazil. Spleen samples were collected for determining parasite load, humoral response, cytokine mRNA expression and histopathology alterations. By real-time PCR for the ssrRNA Leishmania gene, two groups were defined; a low (lowP, n = 46) and a high parasite load groups (highP, n = 42). When comparing these groups, results show variable individual humoral immune response with higher specific IgG production in infected animals but with a notable difference in CVL rapid test optical densities (DPP) between highP and lowP groups. Splenic architecture disruption was characterized by disorganization of white pulp, more evident in animals with high parasitism. All cytokine transcripts in spleen were less expressed in highP than lowP groups with a large heterogeneous variation in response. Individual correlation analysis between cytokine expression and parasite load revealed a negative correlation for both pro-inflammatory cytokines: IFNγ, IL-12, IL-6; and anti-inflammatory cytokines: IL-10 and TGFβ. TNF showed the best negative correlation (r2 = 0.231; pdogs with high parasite load associated with a structural modification in the splenic lymphoid micro-architecture. We also discuss the possible mechanism responsible for the uncontrolled parasite growth and clinical outcome.

  12. Impaired osteogenic differentiation associated with connexin43/microRNA-206 in steroid-induced avascular necrosis of the femoral head.

    Science.gov (United States)

    Liu, Gang; Luo, Gaobin; Bo, Zhandong; Liang, Xiaonan; Huang, Jie; Li, Donghui

    2016-08-01

    Connexin(Cx)43 and microRNA(miR)-206 play an important role in osteogenesis. However, their role in steroid-induced femoral head osteonecrosis (SANFH) is still ambiguous. The present study aimed to establish a rabbit model and investigate osteogenesis in steroid-induced femoral head osteonecrosis occurring via Cx43/miR-206 and the changes of Wnt/β-catenin signal pathway-related proteins. A total of 72 adult New Zealand white rabbits were divided randomly into a model group (Group A) and a control group (Group B) of 36 rabbits each. Group A was injected intravenously with lipopolysaccharide (10μg/kg body weight, once per day). After 48h, three injections of methylprednisolone (MPS; 20mg/kg body weight) were administered intramuscularly at 24-hour intervals. Group B were fed and housed under identical conditions but received saline injections. All animals were sacrificed at two, four, and eight weeks from the first MPS injection. Typical early osteonecrosis symptoms were observed in Group A. The expression of miR-206 in Group A was significantly higher than that of Group B. The mRNA and protein levels of Cx43, β-catenin, runt-related transcription factor 2, and alkaline phosphatase gradually decreased while Dickkopf-1 (Dkk-1) gradually increased in Group A compared with Group B. These findings indicated that Cx43/miR-206 is involved in the pathogenesis of early stage SANFH and may be associate with Wnt/β-catenin signal pathway. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Aptamer-based radiopharmaceuticals for diagnostic imaging and targeted radiotherapy of epithelial tumors

    International Nuclear Information System (INIS)

    Missailidis, Sotiris; Perkins, Alan; Santos-Filho, Sebastiao David; Fonseca, Adenilson de Souza da; Bernardo-Filho, Mario

    2008-01-01

    In the continuous search for earlier diagnosis and improved therapeutic modalities against cancer, based on our constantly increasing knowledge of cancer biology, aptamers hold the promise to expand on current antibody success, but overcoming some of the problems faced with antibodies as therapeutic or delivery agents in cancer. However, as the first aptamer reached the market as an inhibitor against angiogenesis for the treatment of macular degeneration, aptamers have found only limited applications or interest in oncology, and even less as radiopharmaceuticals for diagnostic imaging and targeted radiotherapy of tumours. Yet, the chemistry for the labelling of aptamers and the options to alter their pharmacokinetic properties, to make them suitable for use as radiopharmaceuticals is now available and recent advances in their development can demonstrate that these molecules would make them ideal delivery vehicles for the development of targeted radiopharmaceuticals that could deliver their radiation load with accuracy to the tumour site, offering improved therapeutic properties and reduced side effects. (author)

  14. Selection of LNA-containing DNA aptamers against recombinant human CD73

    DEFF Research Database (Denmark)

    Elle, Ida C; Karlsen, Kasper K; Terp, Mikkel G

    2015-01-01

    tested by surface plasmon resonance. Truncated variants of these aptamers and variants where the LNA nucleotides were substituted for the DNA equivalent also exhibited affinity for the recombinant CD73 in the low nanomolar range. In enzyme inhibition assays with recombinant CD73 the aptamer sequences......LNA-containing DNA aptamers against CD73 (human ecto-5'-nucleotidase), a protein frequently overexpressed in solid tumours, were isolated by SELEX. A pre-defined stem-loop library, containing LNA in the forward primer region, was enriched with CD73 binding sequences through six rounds of SELEX...... with recombinant his-tagged CD73 immobilised on anti-his plates. Enriched pools isolated from rounds one, three and six were subjected to next-generation sequencing and analysed for enrichment using custom bioinformatics software. The software identified aptamer sequences via the primers and then performed several...

  15. Aptamer-conjugated dendrimer-modified quantum dots for glioblastoma cells imaging

    International Nuclear Information System (INIS)

    Li Zhiming; Huang Peng; He Rong; Bao Chenchen; Cui Daxiang; Zhang Xiaomin; Ren Qiushi

    2009-01-01

    Targeted quantum dots have shown potential as a platform for development of cancer imaging. Aptamers have recently been demonstrated as ideal candidates for molecular targeting applications. In present work, polyamidoamine dendrimers were used to modify surface of quantum dots and improve their solubility in water solution. Then, dendrimer-modified quantum dots were conjugated with DNA aptamer, GBI-10, can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. The dendrimer-modified quantum dots exhibit water-soluble, high quantum yield, and good biocompatibility. Aptamer-conjugated quantum dots can specifically target U251 human glioblastoma cells. High-performance aptamer-conjugated dendrimers modified quantum dot-based nanoprobes have great potential in application such as cancer imaging.

  16. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie [Key Laboratory of Industrial Ecology and Environmental Engineering (Ministry of Education, China), School of Environmental Science and Technology, Dalian University of Technology, Dalian, 116024 (China)

    2013-07-15

    We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)

  17. Fluorescent assay for oxytetracycline based on a long-chain aptamer assembled onto reduced graphene oxide

    International Nuclear Information System (INIS)

    Zhao, Huimin; Gao, Sheng; Liu, Meng; Chang, Yangyang; Fan, Xinfei; Quan, Xie

    2013-01-01

    We report on a fluorescent assay for oxytetracycline (OTC) using a fluorescein-labeled long-chain aptamer assembled onto reduced graphene oxide (rGO). The π-π stacking interaction between aptamer and rGO causes the fluorescence of the label to be almost completely quenched via energy transfer so that the system has very low background fluorescence. The addition of OTC leads to the formation of G-quadruplex OTC complexes and prevents the adsorption of labeled aptamer on the surface of rGO. As a result, fluorescence is restored, and this effect allows for a quantitative assay of OTC over the 0.1–2 μM concentration range and with a detection limit of 10 nM. This method is simple, rapid, selective and sensitive. It may be applied to other small molecule analytes by applying appropriate aptamers. (author)

  18. Aptamer-based radiopharmaceuticals for diagnostic imaging and targeted radiotherapy of epithelial tumors

    Energy Technology Data Exchange (ETDEWEB)

    Missailidis, Sotiris [The Open University, Milton Keynes (United Kingdom). Dept. of Chemistry and Analytical Sciences]. E-mail: s.missailidis@open.ac.uk; Perkins, Alan [University of Nottingham (United Kingdom). Dept. of Medical Physics; Santos-Filho, Sebastiao David; Fonseca, Adenilson de Souza da; Bernardo-Filho, Mario [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Inst. de Biologia Roberto Alcantara Gomes. Dept. de Biofisica e Biometria

    2008-12-15

    In the continuous search for earlier diagnosis and improved therapeutic modalities against cancer, based on our constantly increasing knowledge of cancer biology, aptamers hold the promise to expand on current antibody success, but overcoming some of the problems faced with antibodies as therapeutic or delivery agents in cancer. However, as the first aptamer reached the market as an inhibitor against angiogenesis for the treatment of macular degeneration, aptamers have found only limited applications or interest in oncology, and even less as radiopharmaceuticals for diagnostic imaging and targeted radiotherapy of tumours. Yet, the chemistry for the labelling of aptamers and the options to alter their pharmacokinetic properties, to make them suitable for use as radiopharmaceuticals is now available and recent advances in their development can demonstrate that these molecules would make them ideal delivery vehicles for the development of targeted radiopharmaceuticals that could deliver their radiation load with accuracy to the tumour site, offering improved therapeutic properties and reduced side effects. (author)

  19. Biomimetic glass nanopores employing aptamer gates responsive to a small molecule†

    Science.gov (United States)

    Abelow, Alexis E.; Schepelina, Olga; White, Ryan J.; Vallée-Bélisle, Alexis

    2011-01-01

    We report the preparation of 20 and 65 nm radii glass nanopores whose surface is modified with DNA aptamers controlling the molecular transport through the nanopores in response to small molecule binding. PMID:20865192

  20. Aptamer and nanotechnology- based approaches for active targeted delivery of anti-tuberculosis drugs

    CSIR Research Space (South Africa)

    Ramalapa, B

    2012-10-01

    Full Text Available This presentation show how the formulation of multifunctional polymeric nanoparticles for encapsulation of ATD's with optimum physico-chemical properties has been achieved. Aptamers (against mannose receptors) can assist uptake of nanoparticles...

  1. A DNA aptamer recognising a malaria protein biomarker can function as part of a DNA origami assembly

    Science.gov (United States)

    Godonoga, Maia; Lin, Ting-Yu; Oshima, Azusa; Sumitomo, Koji; Tang, Marco S. L.; Cheung, Yee-Wai; Kinghorn, Andrew B.; Dirkzwager, Roderick M.; Zhou, Cunshan; Kuzuya, Akinori; Tanner, Julian A.; Heddle, Jonathan G.

    2016-01-01

    DNA aptamers have potential for disease diagnosis and as therapeutics, particularly when interfaced with programmable molecular technology. Here we have combined DNA aptamers specific for the malaria biomarker Plasmodium falciparum lactate dehydrogenase (PfLDH) with a DNA origami scaffold. Twelve aptamers that recognise PfLDH were integrated into a rectangular DNA origami and atomic force microscopy demonstrated that the incorporated aptamers preserve their ability to specifically bind target protein. Captured PfLDH retained enzymatic activity and protein-aptamer binding was observed dynamically using high-speed AFM. This work demonstrates the ability of DNA aptamers to recognise a malaria biomarker whilst being integrated within a supramolecular DNA scaffold, opening new possibilities for malaria diagnostic approaches based on DNA nanotechnology. PMID:26891622

  2. FRET-Aptamer Assays for Bone Marker Assessment, C-Telopeptide, Creatinine, and Vitamin D

    Science.gov (United States)

    Bruno, John G.

    2013-01-01

    Astronauts lose 1.0 to 1.5% of their bone mass per month on long-duration spaceflights. NASA wishes to monitor the bone loss onboard spacecraft to develop nutritional and exercise countermeasures, and make adjustments during long space missions. On Earth, the same technology could be used to monitor osteoporosis and its therapy. Aptamers bind to targets against which they are developed, much like antibodies. However, aptamers do not require animal hosts or cell culture and are therefore easier, faster, and less expensive to produce. In addition, aptamers sometimes exhibit greater affinity and specificity vs. comparable antibodies. In this work, fluorescent dyes and quenchers were added to the aptamers to enable pushbutton, one-step, bind-and-detect fluorescence resonance energy transfer (FRET) assays or tests that can be freeze-dried, rehydrated with body fluids, and used to quantitate bone loss of vitamin D levels with a handheld fluorometer in the spacecraft environment. This work generated specific, rapid, one-step FRET assays for the bone loss marker C-telopeptide (CTx) when extracted from urine, creatinine from urine, and vitamin D congeners in diluted serum. The assays were quantified in nanograms/mL using a handheld fluorometer connected to a laptop computer to convert the raw fluorescence values into concentrations of each analyte according to linear standard curves. DNA aptamers were selected and amplified for several rounds against a 26- amino acid form of CTx, creatinine, and vitamin D. The commonalities between loop structures were studied, and several common loop structures were converted into aptamer beacons with a fluorophore and quencher on each end. In theory, when the aptamer beacon binds its cognate target (CTx bone peptide, creatinine, or vitamin D), it is forced open and no longer quenched, so it gives off fluorescent light (when excited) in proportion to the amount of target present in a sample. This proportional increase in fluorescence is

  3. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang, Jin, E-mail: jinxxwang@263.net [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); Huang, Nan [Key Lab. of Advanced Technology for Materials of Education Ministry, Southwest Jiaotong University, Chengdu 610031 (China); School of Material Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)

    2016-11-15

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  4. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

    Science.gov (United States)

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

    2013-01-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  5. Aptamer-Mediated Polymeric Vehicles for Enhanced Cell-Targeted Drug Delivery.

    Science.gov (United States)

    Tan, Kei X; Danquah, Michael K; Sidhu, Amandeep; Yon, Lau Sie; Ongkudon, Clarence M

    2018-02-08

    The search for smart delivery systems for enhanced pre-clinical and clinical pharmaceutical delivery and cell targeting continues to be a major biomedical research endeavor owing to differences in the physicochemical characteristics and physiological effects of drug molecules, and this affects the delivery mechanisms to elicit maximum therapeutic effects. Targeted drug delivery is a smart evolution essential to address major challenges associated with conventional drug delivery systems. These challenges mostly result in poor pharmacokinetics due to the inability of the active pharmaceutical ingredients to specifically act on malignant cells thus, causing poor therapeutic index and toxicity to surrounding normal cells. Aptamers are oligonucleotides with engineered affinities to bind specifically to their cognate targets. Aptamers have gained significant interests as effective targeting elements for enhanced therapeutic delivery as they can be generated to specifically bind to wide range of targets including proteins, peptides, ions, cells and tissues. Notwithstanding, effective delivery of aptamers as therapeutic vehicles is challenged by cell membrane electrostatic repulsion, endonuclease degradation, low pH cleavage, and binding conformation stability. The application of molecularly engineered biodegradable and biocompatible polymeric particles with tunable features such as surface area and chemistry, particulate size distribution and toxicity creates opportunities to develop smart aptamer-mediated delivery systems for controlled drug release. This article discusses opportunities for particulate aptamer-drug formulations to advance current drug delivery modalities by navigating active ingredients through cellular and biomolecular traffic to target sites for sustained and controlled release at effective therapeutic dosages while minimizing systemic cytotoxic effects. A proposal for a novel drug-polymer-aptamer-polymer (DPAP) design of aptamer-drug formulation with

  6. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    International Nuclear Information System (INIS)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-01-01

    Highlights: • The dopamine/PEI film with controlled amine density was successfully prepared. • The DNA aptamer was assembled onto the film via electrostatic incorporation. • The A@DPfilmscanspecificallyandeffectivelycaptureEPCs. • The A@DP film can support the survival of ECs, control the hyperplasia of SMCs. • The dynamic/co-culture models are useful for studying cells competitive adhesion. - Abstract: Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  7. Aptamers anti-(1→3)-β-D-glucan labelled with Technetium-99m: biodistribution and imaging in experimental models of infection and inflammation; Aptameros anti-(1→3)-β-D-glucana marcados com Tecnecio-99m: biodistribuicao e imageamento em modelos experimentais de infeccao e inflamacao

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Camila Maria de Sousa

    2016-07-01

    Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with {sup 32}P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with {sup 99m}Tc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A {sup 99m}Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with {sup 99m}Tc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the {sup 99m}Tc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the

  8. Aptamer-mediated colorimetric method for rapid and sensitive detection of chloramphenicol in food.

    Science.gov (United States)

    Yan, Chao; Zhang, Jing; Yao, Li; Xue, Feng; Lu, Jianfeng; Li, Baoguang; Chen, Wei

    2018-09-15

    We report an aptamer-mediated colorimetric method for sensitive detection of chloramphenicol (CAP). The aptamer of CAP is immobilized by the hybridization with pre-immobilized capture probe in the microtiter plate. The horseradish peroxidase (HRP) is covalently attached to the aptamer by the biotin-streptavidin system for signal production. CAP will preferably bind with aptamer due to the high binding affinity, which attributes to the release of aptamer and HRP and thus, affects the optical signal intensity. Quantitative determination of CAP is successfully achieved in the wide range from 0.001 to 1000 ng/mL with detection limit of 0.0031 ng/mL, which is more sensitive than traditional immunoassays. This method is further validated by measuring the recovery of CAP spiked in two different food matrices (honey and fish). The aptamer-mediated colorimetric method can be a useful protocol for rapid and sensitive screening of CAP, and may be used as an alternative means for traditional immunoassays. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase.

    Science.gov (United States)

    Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander

    2017-12-26

    The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).

  10. Detection of Cryptosporidium parvum Oocysts on Fresh Produce Using DNA Aptamers.

    Directory of Open Access Journals (Sweden)

    Asma Iqbal

    Full Text Available There are currently no standard methods for the detection of Cryptosporidium spp., or other protozoan parasites, in foods, and existing methods are often inadequate, with low and variable recovery efficiencies. Food testing is difficult due to the low concentrations of parasites, the difficulty in eluting parasites from some foods, the lack of enrichment methods, and the presence of PCR inhibitors. The main objectives of the present study were to obtain DNA aptamers binding to the oocyst wall of C. parvum, and to use the aptamers to detect the presence of this parasite in foods. DNA aptamers were selected against C. parvum oocysts using SELEX (Systematic Evolution of Ligands by EXponential enrichment. Ten rounds of selection led to the discovery of 14 aptamer clones with high affinities for C. parvum oocysts. For detecting parasite-bound aptamers, a simple electrochemical sensor was employed, which used a gold nanoparticle-modified screen-printed carbon electrode. This aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and the anti- C. parvum aptamer. Square wave voltammetry was employed to quantitate C. parvum in the range of 150 to 800 oocysts, with a detection limit of approximately 100 oocysts. The high sensitivity and specificity of the developed aptasensor suggests that this novel method is very promising for the detection and identification of C. parvum oocysts on spiked fresh fruits, as compared to conventional methods such as microscopy and PCR.

  11. Aptamer from whole-bacterium SELEX as new therapeutic reagent against virulent Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Chen, Fan; Zhou, Jing; Luo, Fengling; Mohammed, Al-Bayati; Zhang, Xiao-Lian

    2007-01-01

    Worldwide, tuberculosis (TB) remains the most frequent and important infectious disease causing morbidity and death. One-third of the world's population is infected with Mycobacterium tuberculosis (MTB), the etiologic agent of TB. Because of the global health problems of TB, the development of potent new anti-TB drugs without cross-resistance with known antimycobacterial agents is urgently needed. In this study, we have applied a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process to identify a single aptamer (NK2) that binds to virulent strain M. tuberculosis (H37Rv) with high affinity and specificity. We have found that this aptamer improves CD4 + T cells to produce IFN-γ after binding to H37Rv. The different component between H37Rv and BCG was identified as some membrane protein. Moreover, the survival rates of mice challenged with i.v. H37Rv have been prolonged after treatment with single injection of aptamer NK2. The bacterial numbers were significantly lower in the spleen of mice treated with aptamer NK2. The histopathological examination of lung biopsy specimens showed lesser pulmonary alveolar fusion and swelling in the presence of the aptamer. These results suggest that aptamer NK2 has inhibitory effects on M. tuberculosis and can be used as antimycobacterial agent

  12. A Microfluidic Love-Wave Biosensing Device for PSA Detection Based on an Aptamer Beacon Probe.

    Science.gov (United States)

    Zhang, Feng; Li, Shuangming; Cao, Kang; Wang, Pengjuan; Su, Yan; Zhu, Xinhua; Wan, Ying

    2015-06-11

    A label-free and selective aptamer beacon-based Love-wave biosensing device was developed for prostate specific antigen (PSA) detection. The device consists of the following parts: LiTaO3 substrate with SiO2 film as wave guide layer, two set of inter-digital transducers (IDT), gold film for immobilization of the biorecongniton layer and a polydimethylsiloxane (PDMS) microfluidic channels. DNA aptamer, or "artificial antibody", was used as the specific biorecognition probe for PSA capture. Some nucleotides were added to the 3'-end of the aptamer to form a duplex with the 3'-end, turning the aptamer into an aptamer-beacon. Taking advantage of the selective target-induced assembly changes arising from the "aptamer beacon", highly selective and specific detection of PSA was achieved. Furthermore, PDMS microfluidic channels were designed and fabricated to realize automated quantitative sample injection. After optimization of the experimental conditions, the established device showed good performance for PSA detection between 10 ng/mL to 1 μg/mL, with a detection limit of 10 ng/mL. The proposed sensor might be a promising alternative for point of care diagnostics.

  13. Combinatorial selection of aptamers: new radioligands for in vivo molecular imaging

    International Nuclear Information System (INIS)

    Pestourie, C.

    2005-10-01

    Aptamers are oligonucleotide structures selected for their capacity to bind to a desired target. The first part of this work focuses on the selection of aptamers directed against the oncogenic form of the tyrosine kinase receptor Ret (RetC634Y). We compared different selection protocols: i) selection against the purified RetC634Y recombinant protein, ii) selection against whole living cells which express RetC634Y and iii) a crossover selection alternating between cells and recombinant protein. One aptamer, D4, was found to be able to inhibit Ret and to reverse the cell phenotype induced by the activation of the receptor. Then, we developed the in vivo use of the selected aptamers. Finally, we used the whole living cells selection protocol to develop aptamers against HLA-G. This protein is characterised by its function in immuno tolerance. Taken together, these studies should pave the way for the in vivo use of aptamers as new therapeutic and diagnostic agents for in vivo PET imaging. (author)

  14. Screening and Identification of ssDNA Aptamer for Human GP73

    Directory of Open Access Journals (Sweden)

    Jingchun Du

    2015-01-01

    Full Text Available As one tumor marker of HCC, Golgi Protein 73 (GP73 is given more promise in the early diagnosis of HCC, and aptamers have been developed to compete with antibodies as biorecognition probes in different detection system. In this study, we utilized GP73 to screen specific ssDNA aptamers by SELEX technique. First, GP73 proteins were expressed and purified by prokaryotic expression system and Nickle ion affinity chromatography, respectively. At the same time, the immunogenicity of purified GP73 was confirmed by Western blotting. The enriched ssDNA library with high binding capacity for GP73 was obtained after ten rounds of SELEX. Then, thirty ssDNA aptamers were sequenced, in which two ssDNA aptamers with identical DNA sequence were confirmed, based on the alignment results, and designated as A10-2. Furthermore, the specific antibody could block the binding of A10-2 to GP73, and the specific binding of A10-2 to GP73 was also supported by the observation that several tumor cell lines exhibited variable expression level of GP73. Significantly, the identified aptamer A10-2 could distinguish normal and cancerous liver tissues. So, our results indicate that the aptamer A10-2 might be developed into one molecular probe to detect HCC from normal liver specimens.

  15. Aptamer-based radioimmunotherapy. The feasibility and prospect in cancer therapy

    International Nuclear Information System (INIS)

    Li Li; Hui Wang; Shujie Liao; Wei Li; Weina Zhang; Dan Liu; Bo Cao; Shixuan Wang; Ding Ma; Wei Wang; Nanfang Hospital, Southern Medical University, Guangzhou; Xiangshang Xu; Keng Shen

    2011-01-01

    Radioimmunotherapy (RIT) has emerged as an attractive and promising strategy for the management of malignant diseases. It has been proven to be quite effective in the treatment of numerous tumors, such as non-Hodgkin lymphoma, metastatic prostate cancer, melanoma, thyroid cancer, colon cancer and so on. The RIT currently used is mainly based on monoclonal antibodies to recognize target antigens. As antibodies are large molecules, this method of RIT has some limitations in in vivo use, such as the immunogenicity, the high costs and low efficiency of production. Aptamer is discovered and selected by SELEX technology. As specific recognizers and binders, aptamers and antibodies have such a close similarity as to be interchangeable to some extent. But, aptamers have many advantages over antibodies: higher affinity and specificity, smaller molecular weight, more easily synthesized and modified, more rapidly penetrating into tumors, higher tumor-to-blood distribution ratio and more easily to be cleared. In addition, since aptamer has almost no immunogenicity in vivo, it can be repeatedly administered. Thus, we believe that aptamer-based RIT will be a feasible and promising way to treat human cancers, and it might display better results in cancer treatment than antibody-based RIT. In conclusion, aptamer-based RIT is hopeful to become a key therapeutics in cancer radiotherapy in the near future. (author)

  16. Inhibition of BACE1 Activity by a DNA Aptamer in an Alzheimer's Disease Cell Model.

    Directory of Open Access Journals (Sweden)

    Huiyu Liang

    Full Text Available An initial step in amyloid-β (Aβ production includes amyloid precursor protein (APP cleavage via β-Site amyloid precursor protein cleaving enzyme 1 (BACE1. Increased levels of brain Aβ have been implicated in the pathogenesis of Alzheimer's disease (AD. Thus, β-secretase represents a primary target for inhibitor drug development in AD. In this study, aptamers were obtained from combinatorial oligonucleotide libraries using a technology referred to as systematic evolution of ligands by exponential enrichment (SELEX. A purified human BACE1 extracellular domain was used as a target to conduct an in vitro selection process using SELEX. Two DNA aptamers were capable of binding to BACE1 with high affinity and good specificity, with Kd values in the nanomolar range. We subsequently confirmed that one aptamer, A1, exhibited a distinct inhibitory effect on BACE1 activity in an AD cell model. We detected the effects of M17-APPsw cells that stably expressed Swedish mutant APP after aptamer A1 treatment. Aβ40 and Aβ42 concentrations secreted by M17-APPsw cells decreased intracellularly and in culture media. Furthermore, Western blot analysis indicated that sAPPβ expression significantly decreased in the A1 treated versus control groups. These findings support the preliminary feasibility of an aptamer evolved from a SELEX strategy to function as a potential BACE1 inhibitor. To our knowledge, this is the first study to acquire a DNA aptamer that exhibited binding specificity to BACE1 and inhibited its activity.

  17. Aptamer-Conjugated Calcium Phosphate Nanoparticles for Reducing Diabetes Risk via Retinol Binding Protein 4 Inhibition.

    Science.gov (United States)

    Torabi, Raheleh; Ghourchian, Hedayatollah; Amanlou, Massoud; Pasalar, Parvin

    2017-06-01

    Inhibition of the binding of retinol to its carrier, retinol binding protein 4, is a new strategy for treating type 2 diabetes; for this purpose, we have provided an aptamer-functionalized multishell calcium phosphate nanoparticle. First, calcium phosphate nanoparticles were synthesized and conjugated to the aptamer. The cytotoxicity of nanoparticles releases the process of aptamer from nanoparticles and their inhibition function of binding retinol to retinol binding protein 4. After synthesizing and characterizing the multishell calcium phosphate nanoparticles and observing the noncytotoxicity of conjugate, the optimum time (48 hours) and the pH (7.4) for releasing the aptamer from the nanoparticles was determined. The half-maximum inhibitory concentration (IC 50 ) value for inhibition of retinol binding to retinol binding protein 4 was 210 femtomolar (fmol). The results revealed that the aptamer could prevent connection between retinol and retinol binding protein 4 at a very low IC 50 value (210 fmol) compared to other reported inhibitors. It seems that this aptamer could be used as an efficient candidate not only for decreasing the insulin resistance in type 2 diabetes, but also for inhibiting the other retinol binding protein 4-related diseases. Copyright © 2017 Diabetes Canada. Published by Elsevier Inc. All rights reserved.

  18. In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis.

    Science.gov (United States)

    Savory, Nasa; Lednor, Danielle; Tsukakoshi, Kaori; Abe, Koichi; Yoshida, Wataru; Ferri, Stefano; Jones, Brian V; Ikebukuro, Kazunori

    2013-10-01

    Proteus mirabilis is a prominent cause of catheter-associated urinary tract infections (CAUTIs) among patients undergoing long-term bladder catheterization. There are currently no effective means of preventing P. mirabilis infections, and strategies for prophylaxis and rapid early diagnosis are urgently required. Aptamers offer significant potential for development of countermeasures against P. mirabilis CAUTI and are an ideal class of molecules for the development of diagnostics and therapeutics. Here we demonstrate the application of Cell-SELEX to identify DNA aptamers that show high affinity for P. mirabilis. While the aptamers identified displayed high affinity for P. mirabilis cells in dot blotting assays, they also bound to other uropathogenic bacteria. To improve aptamer specificity for P. mirabilis, an in silico maturation (ISM) approach was employed. Two cycles of ISM allowed the identification of an aptamer showing 36% higher specificity, evaluated as a ratio of binding signal for P. mirabilis to that for Escherichia coli (also a cause of CAUTI and the most common urinary tract pathogen). Aptamers that specifically recognize P. mirabilis would have diagnostic and therapeutic values and constitute useful tools for studying membrane-associated proteins in this organism. Copyright © 2013 Wiley Periodicals, Inc.

  19. Use of Aptamers as Diagnostics Tools and Antiviral Agents for Human Viruses

    Directory of Open Access Journals (Sweden)

    Víctor M. González

    2016-12-01

    Full Text Available Appropriate diagnosis is the key factor for treatment of viral diseases. Time is the most important factor in rapidly developing and epidemiologically dangerous diseases, such as influenza, Ebola and SARS. Chronic viral diseases such as HIV-1 or HCV are asymptomatic or oligosymptomatic and the therapeutic success mainly depends on early detection of the infective agent. Over the last years, aptamer technology has been used in a wide range of diagnostic and therapeutic applications and, concretely, several strategies are currently being explored using aptamers against virus proteins. From a diagnostics point of view, aptamers are being designed as a bio-recognition element in diagnostic systems to detect viral proteins either in the blood (serum or plasma or into infected cells. Another potential use of aptamers is for therapeutics of viral infections, interfering in the interaction between the virus and the host using aptamers targeting host-cell matrix receptors, or attacking the virus intracellularly, targeting proteins implicated in the viral replication cycle. In this paper, we review how aptamers working against viral proteins are discovered, with a focus on recent advances that improve the aptamers’ properties as a real tool for viral infection detection and treatment.

  20. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  1. Selecting Molecular Recognition. What Can Existing Aptamers Tell Us about Their Inherent Recognition Capabilities and Modes of Interaction?

    Directory of Open Access Journals (Sweden)

    Ralf Landgraf

    2012-05-01

    Full Text Available The use of nucleic acid derived aptamers has rapidly expanded since the introduction of SELEX in 1990. Nucleic acid aptamers have demonstrated their ability to target a broad range of molecules in ways that rival antibodies, but advances have been very uneven for different biochemical classes of targets, and clinical applications have been slow to emerge. What sets different aptamers apart from each other and from rivaling molecular recognition platforms, specifically proteins? What advantages do aptamers as a reagent class offer, and how do the chemical properties and selection procedures of aptamers influence their function? Do the building blocks of nucleic acid aptamers dictate inherent limitations in the nature of molecular targets, and do existing aptamers give us insight in how these challenges might be overcome? This review is written as an introduction for potential endusers of aptamer technology who are evaluating the advantages of aptamers as a versatile, affordable, yet highly expandable platform to target a broad range of biological processes or interactions.

  2. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  3. Aptamer-fluorescent silica nanoparticles bioconjugates based dual-color flow cytometry for specific detection of Staphylococcus aureus.

    Science.gov (United States)

    He, Xiaoxiao; Li, Yuhong; He, Dinggen; Wang, Kemin; Shangguan, Jingfang; Shi, Hui

    2014-07-01

    This paper describes a sensitive and specific determination strategy for Staphylococcus aureus (S. aureus) detection using aptamer recognition and fluorescent silica nanoparticles (FSiNPs) label based dual-color flow cytometry assay (Aptamer/FSiNPs-DCFCM). In the protocol, an aptamer, having high affinity to S. aureus, was first covalently immobilized onto chloropropyl functionalized FSiNPs through a click chemistry approach to generate aptamer-nanoparticles bioconjugates (Aptamer/FSiNPs). Next, S. aureus was incubated with Aptamer/FSiNPs, and then stained with SYBR Green I (a special staining material for the duplex DNA). Upon target binding and nucleic acid staining with SYBR Green I, the S. aureus was determined using two-color flow cytometry. The method took advantage of the specificity of aptamer, signal amplification of FSiNPs label and decreased false positives of two-color flow cytometry assay. It was demonstrated that these Aptamer/FSiNPs could efficiently recognize and fluorescently label target S. aureus. Through multiparameter determination with flow cytometry, this assay allowed for detection of as low as 1.5 x 10(2) and 7.6 x 10(2) cells mL(-1) S. aureus in buffer and spiked milk, respectively, with higher sensitivity than the Aptamer/FITC based flow cytometry.

  4. Comparison of whole-cell SELEX methods for the identification of Staphylococcus aureus-specific DNA aptamers.

    Science.gov (United States)

    Moon, Jihea; Kim, Giyoung; Park, Saet Byeol; Lim, Jongguk; Mo, Changyeun

    2015-04-15

    Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX) is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.

  5. Comparison of Whole-Cell SELEX Methods for the Identification of Staphylococcus Aureus-Specific DNA Aptamers

    Directory of Open Access Journals (Sweden)

    Jihea Moon

    2015-04-01

    Full Text Available Whole-cell Systemic Evolution of Ligands by Exponential enrichment (SELEX is the process by which aptamers specific to target cells are developed. Aptamers selected by whole-cell SELEX have high affinity and specificity for bacterial surface molecules and live bacterial targets. To identify DNA aptamers specific to Staphylococcus aureus, we applied our rapid whole-cell SELEX method to a single-stranded ssDNA library. To improve the specificity and selectivity of the aptamers, we designed, selected, and developed two categories of aptamers that were selected by two kinds of whole-cell SELEX, by mixing and combining FACS analysis and a counter-SELEX process. Using this approach, we have developed a biosensor system that employs a high affinity aptamer for detection of target bacteria. FAM-labeled aptamer sequences with high binding to S. aureus, as determined by fluorescence spectroscopic analysis, were identified, and aptamer A14, selected by the basic whole-cell SELEX using a once-off FACS analysis, and which had a high binding affinity and specificity, was chosen. The binding assay was evaluated using FACS analysis. Our study demonstrated the development of a set of whole-cell SELEX derived aptamers specific to S. aureus; this approach can be used in the identification of other bacteria.

  6. G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONA.

    Science.gov (United States)

    Stoltenburg, Regina; Krafčiková, Petra; Víglaský, Viktor; Strehlitz, Beate

    2016-09-21

    Aptamers for whole cell detection are selected mostly by the Cell-SELEX procedure. Alternatively, the use of specific cell surface epitopes as target during aptamer selections allows the development of aptamers with ability to bind whole cells. In this study, we integrated a formerly selected Protein A-binding aptamer PA#2/8 in an assay format called ELONA (Enzyme-Linked OligoNucleotide Assay) and evaluated the ability of the aptamer to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface. The full-length aptamer and one of its truncated variants could be demonstrated to specifically bind to Protein A-expressing intact cells of S. aureus, and thus have the potential to expand the portfolio of aptamers that can act as an analytical agent for the specific recognition and rapid detection of the bacterial pathogen. The functionality of the aptamer was found to be based on a very complex, but also highly variable structure. Two structural key elements were identified. The aptamer sequence contains several G-clusters allowing folding into a G-quadruplex structure with the potential of dimeric and multimeric assembly. An inverted repeat able to form an imperfect stem-loop at the 5'-end also contributes essentially to the aptameric function.

  7. Towards a unified biological hypothesis for the BDNF Val66Met-associated memory deficits in humans: a model of impaired dendritic mRNA trafficking

    Directory of Open Access Journals (Sweden)

    Gabriele eBaj

    2013-10-01

    Full Text Available Brain-derived neurotrophic factor (BDNF represents promotesa key molecule for the survival and differentiation of specific populations of neurons in the central nervous system. BDNF also regulates plasticity-related processes underlying memory and learning. A common single nucleotide polymorphism (SNP rs6265 has been identified on the coding sequence of human BDNF located at 11p13. The SNP rs6265 is a single base mutation with an adenine instead of a guanine at position 196 (G196A, resulting in the amino acid substitution Val66Met. This polymorphism only exists in humans and has been associated with a plethora of effects ranging from molecular, cellular and brain structural modifications in association with deficits in social and cognitive functions. To date, the literature on Val66Met polymorphism describes a complex and often conflicting pattern of effects. In this review, we attempt to provide a unifying model of the Val66Met effects. We discuss the clinical evidence of the association between Val66Met and memory deficits, as well as the molecular mechanisms involved including the reduced transport of BDNF mRNA to the dendrites as well as the reduced processing and secretion of BDNF protein through the regulated secretory pathway.

  8. Retinoid acid-induced microRNA-27b-3p impairs C2C12 myoblast proliferation and differentiation by suppressing α-dystrobrevin

    Energy Technology Data Exchange (ETDEWEB)

    Li, Nan; Tang, Yi; Liu, Bo; Cong, Wei; Liu, Chao, E-mail: liuchao_19760711@yahoo.com; Xiao, Jing, E-mail: xiaoj@dmu.edu.cn

    2017-01-15

    We previously reported that excess retinoic acid (RA) resulted in hypoplastic and derangement of myofilaments in embryonic tongue by inhibiting myogenic proliferation and differentiation through CamKIID pathway. Our further studies revealed that the expression of a series of miRNAs was altered by RA administration in embryonic tongue as well as in C2C12 cells. Thus, if excess RA impairs myogenic proliferation and differentiation through miRNAs is taken into account. In present study, miR-27b-3p was found up-regulated in RA-treated C2C12 cells as in embryonic tongue, and predicted to target the 3′UTR of α-dystrobrevin (DTNA). Luciferase reporter assays confirmed the direct interaction between miR-27b-3p and the 3′UTR of DTNA. MiR-27b-3p mimics recapitulated the RA repression on DTNA expression, C2C12 proliferation and differentiation, while the miR-27b-3p inhibitor circumvented these defects resulting from excess RA. As expected, the effects of siDTNA on C2C12 were coincided with those by RA treatment or miR-27b-3p mimics. Therefore, these findings indicated that excess RA inhibited the myoblast proliferation and differentiation by up-regulating miR-27b-3p to target DTNA, which implied a new mechanism in myogenic hypoplasia. - Highlights: • A mechanism that RA results in tongue deformity by disrupting the myogenesis. • A non-muscle specific miR mediating the RA suppression on tongue myogenesis. • A target gene of non-muscle specific miR involved in RA induced tongue deformity.

  9. Overexpression of TGF-β Inducible microRNA-143 in Zebrafish Leads to Impairment of the Glomerular Filtration Barrier by Targeting Proteoglycans

    Directory of Open Access Journals (Sweden)

    Janina Müller-Deile

    2016-12-01

    Full Text Available Background: TGF-β is known as an important stress factor of podocytes in glomerular diseases. Apart from activation of direct pro-apoptotic pathways we wanted to analyze micro-RNA (miRs driven regulation of components involved in the integrity of the glomerular filtration barrier induced by TGF-β. Since miR-143-3p (miR-143 is described as a TGF-β inducible miR in other cell types, we examined this specific miR and its ability to induce glomerular pathology. Methods: We analyzed miR-143 expression in cultured human podocytes after stimulation with TGF-β. We also microinjected zebrafish eggs with a miR-143 mimic or with morpholinos specific for its targets syndecan and versican and compared phenotype and proteinuria development. Results: We detected a time dependent, TGF-β inducible expression of miR-143 in human podocytes. Targets of miR-143 relevant in glomerular biology are syndecans and versican, which are known components of the glycocalyx. We found that syndecan 1 and 4 were predominantly expressed in podocytes while syndecan 3 was largely expressed in glomerular endothelial cells. Versican could be detected in both cell types. After injection of a miR-143 mimic in zebrafish larvae, syndecan 3, 4 and versican were significantly downregulated. Moreover, miR-143 overexpression or versican knockdown by morpholino caused loss of plasma proteins, edema, podocyte effacement and endothelial damage. In contrast, knockdown of syndecan 3 and syndecan 4 had no effects on glomerular filtration barrier. Conclusion: Expression of versican and syndecan isoforms is indispensable for proper barrier function. Podocyte-derived miR-143 is a mediator for paracrine and autocrine cross talk between podocytes and glomerular endothelial cells and can alter expression of glomerular glycocalyx proteins.

  10. Laser-Scribed Graphene Electrodes for Aptamer-Based Biosensing

    KAUST Repository

    Fenzl, Christoph

    2017-04-25

    Graphene as a transducer material has produced some of the best performing sensing approaches to date opening the door toward integrated miniaturized all-carbon point-of-care devices. Addressing this opportunity, laser-scribed graphene(LSG) electrodes are demonstrated here as highly sensitive and reliable biosensor transducers in blood serum analysis. These flexible electrodes with large electrochemical surface areas were fabricated using a direct-write laser process on polyimide foils. A universal immobilization approach is established by anchoring 1-pyrenebutyric acid to the graphene and subsequently covalently attaching an aptamer against the coagulation factor thrombin as an exemplary bioreceptor to the carboxyl groups. The resulting biosensor displays extremely low detection limits of 1 pM in buffer and 5 pM in the complex matrix of serum.

  11. An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Song, Min Young [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Jurng, Jongsoo [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Park, Young-Kwon [School of Environmental Engineering, University of Seoul, Seoulsiripdae-ro 163, Dongdaemun-gu, Seoul 02504 (Korea, Republic of); Kim, Byoung Chan, E-mail: bchankim@kist.re.kr [Center for Environment, Health and Welfare Research, Korea Institute of Science and Technology (KIST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of); Department of Energy and Environmental Engineering, University of Science and Technology (UST), Hwarangno 14-gil 5, Seongbuk-gu, Seoul 02792 (Korea, Republic of)

    2016-11-15

    Highlights: • Aptamer-conjugated TiO{sub 2} was developed for target-specific bacterial inactivation. • TiO{sub 2}-aptamer cocktail can enhance inactivation of target bacteria faster than TiO{sub 2}. • TiO{sub 2}-aptamer cocktail can enhance inactivation of target bacteria in mixed culture. • Efficient ROS transfer to the bacteria is caused by close contact of TiO{sub 2}-aptamer. - Abstract: We developed TiO{sub 2} particles conjugated with an Escherichia coli surface-specific ssDNA aptamer cocktail (composed of three different aptamers isolated from E. coli) for targeted and enhanced disinfection of E. coli. We examined the target-specific and enhanced inactivation of this composite (TiO{sub 2}-Apc), which were compared to those of TiO{sub 2} conjugated with a single aptamer (one of the three different aptamers, TiO{sub 2}-Aps) and non-modified TiO{sub 2}. We found that TiO{sub 2}-Apc enhanced the inactivation of targeted E. coli under UV irradiation compared to both the non-modified TiO{sub 2} and TiO{sub 2}-Aps. A higher number of TiO{sub 2}-Apc than TiO{sub 2}-Aps particles was observed on the surface of E. coli. The amount of TiO{sub 2}-Apc required to inactivate ∼99.9% of E. coli (10{sup 6} CFU/ml) was 10 times lower than that of non-modified TiO{sub 2}. The close proximity of functionalized particles with E. coli resulting from the interaction between the target surface and the aptamer induced the efficient and fast transfer of reactive oxygen species to the cells. In a mixed culture of different bacteria (E. coli and Staphylococcus epidermidis), TiO{sub 2}-Apc enhanced the inactivation of only E. coli. Taken together, these results support the use of aptamer cocktail-conjugated TiO{sub 2} for improvement of the target-specific inactivation of bacteria.

  12. Aptamer based vanillin sensor using an ion-sensitive field-effect transistor.

    Science.gov (United States)

    Kuznetsov, Alexander; Komarova, Natalia; Andrianova, Maria; Grudtsov, Vitaliy; Kuznetsov, Evgeniy

    2017-12-02

    An aptamer for vanillin was obtained and then used for the development of an aptasensor based on an ion-sensitive field-effect transistor (ISFET). This aptamer (a single-stranded DNA;ssDNA) was selected using the Capture-SELEX protocol, which suites well for selection of aptamers to small molecules. Among six aptamer candidates, the aptamer Van_74 with the highest affinity for vanillin was chosen (elution of 35% of the aptamer from a solid support in the presence of 2 mM of vanillin). Van_74 was characterized using nondenaturating PAGE of washouts from magnetic beads. It is shown that Van_74 binds to vanillin with an dissociation constant of >7.8 μM (determined by nondenaturating PAGE) and it was specific to vanillin in comparison with interferents: benzaldehyde, guaiacol, furaneol, ethyl guaiacol and ethyl vanillin. Also it was shown that change of buffer composition greatly affected the binding ability of Van_74. For biosensor fabrication aptamer was immobilised on the Ta 2 O 5 -sensitive surface of the ISFET via "click-chemistry". Detection scheme implied dehybridisation of the ssDNA probe from the aptamer and release in the solution during the addition of vanillin. As a result, the surface potential increase upon vanillin binding with the aptamer was detected by the transistor. The biosensor had a detection limit of 1.55 × 10 -7  M and a dynamic range from 1.55 × 10 -7  M to 1 × 10 -6  M. Effective constant K d,eff for vanillin binding on biosensor surface was calculated to be (9 ± 3) × 10 -7  M. This allows selective detection of vanillin in the mixture of interferents and in samples of coffee extract. Graphical abstract A biosensor for vanillin was developed on the basis of an aptamer that was obtained via Capture-SELEX and by using an ISFET. This biosensor can be used for vanillin detection in presence of interferents and in real sample using an approach of ssDNA probe dehybridization.

  13. MicroRNA-29b-1 impairs in vitro cell proliferation, self‑renewal and chemoresistance of human osteosarcoma 3AB-OS cancer stem cells.

    Science.gov (United States)

    Di Fiore, Riccardo; Drago-Ferrante, Rosa; Pentimalli, Francesca; Di Marzo, Domenico; Forte, Iris Maria; D'Anneo, Antonella; Carlisi, Daniela; De Blasio, Anna; Giuliano, Michela; Tesoriere, Giovanni; Giordano, Antonio; Vento, Renza

    2014-11-01

    Osteosarcoma (OS) is the most common type of bone cancer, with a peak incidence in the early childhood. Emerging evidence suggests that treatments targeting cancer stem cells (CSCs) within a tumor can halt cancer and improve patient survival. MicroRNAs (miRNAs) have been implicated in the maintenance of the CSC phenotype, thus, identification of CSC-related miRNAs would provide information for a better understanding of CSCs. Downregulation of miRNA-29 family members (miR-29a/b/c; miR‑29s) was observed in human OS, however, little is known about the functions of miR-29s in human OS CSCs. Previously, during the characterization of 3AB-OS cells, a CSC line selected from human OS MG63 cells, we showed a potent downregulation of miR-29b. In this study, after stable transfection of 3AB-OS cells with miR-29b-1, we investigated the role of miR-29b-1 in regulating cell proliferation, sarcosphere-forming ability, clonogenic growth, chemosensitivity, migration and invasive ability of 3AB-OS cells, in vitro. We found that, miR-29b-1 overexpression consistently reduced both, 3AB-OS CSCs growth in two- and three-dimensional culture systems and their sarcosphere- and colony-forming ability. In addition, while miR-29b-1 overexpression sensitized 3AB-OS cells to chemotherapeutic drug-induced apoptosis, it did not influence their migratory and invasive capacities, thus suggesting a context-depending role of miR-29b-1. Using publicly available databases, we proceeded to identify potential miR-29b target genes, known to play a role in the above reported functions. Among these targets we analyzed CD133, N-Myc, CCND2, E2F1 and E2F2, Bcl-2 and IAP-2. We also analyzed the most important stemness markers as Oct3/4, Sox2 and Nanog. Real-time RT-PCR and western-blot analyses showed that miR-29b-1 negatively regulated the expression of these markers. Overall, the results show that miR-29b-1 suppresses stemness properties of 3AB-OS CSCs and suggest that developing miR-29b-1 as a novel

  14. Genetic selection of peptide aptamers that interact and inhibit both Small protein B and alternative ribosome-rescue factor A of Aeromonas veronii C4

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2016-08-01

    Full Text Available Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB which acts as one of the key components in trans-translation, and alternative ribosome-rescue factor A (ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR when treating in 2.0% KCl. Thus,the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti

  15. Genetic Selection of Peptide Aptamers That Interact and Inhibit Both Small Protein B and Alternative Ribosome-Rescue Factor A of Aeromonas veronii C4.

    Science.gov (United States)

    Liu, Peng; Chen, Yong; Wang, Dan; Tang, Yanqiong; Tang, Hongqian; Song, Haichao; Sun, Qun; Zhang, Yueling; Liu, Zhu

    2016-01-01

    Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA) in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides) was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN) as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB) which acts as one of the key components in trans-translation, and ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H) employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl) and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR) when treating in 2.0% KCl. Thus, the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti-microbial drugs targeted to the ribosome rescued factors in A

  16. Site-selective conjugation of an anticoagulant aptamer to recombinant albumins and maintenance of neonatal Fc receptor binding

    Science.gov (United States)

    Schmøkel, Julie; Voldum, Anders; Tsakiridou, Georgia; Kuhlmann, Matthias; Cameron, Jason; Sørensen, Esben S.; Wengel, Jesper; Howard, Kenneth A.

    2017-05-01

    Aptamers are an attractive molecular medicine that offers high target specificity. Nucleic acid-based aptamers, however, are prone to nuclease degradation and rapid renal excretion that require blood circulatory half-life extension enabling technologies. The long circulatory half-life, predominately facilitated by engagement with the cellular recycling neonatal Fc receptor (FcRn), and ligand transport properties of albumin promote it as an attractive candidate to improve the pharmacokinetic profile of aptamers. This study investigates the effect of Cys34 site-selective covalent attachment of a factor IXa anticoagulant aptamer on aptamer functionality and human FcRn (hFcRn) engagement using recombinant human albumin (rHA) of either a wild type (WT) or an engineered human FcRn high binding variant (HB). Albumin-aptamer conjugates, connected covalently through a heterobifunctional succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate linker, were successfully prepared and purified by high performance liquid chromatography as confirmed by gel electrophoresis band-shift analysis and matrix-assisted laser desorption/ionization time of flight. Minimal reduction (∼25%) in activity of WT-linked aptamer to that of aptamer alone was found using an anticoagulant activity assay measuring temporal levels of activated partial thrombin. Covalent albumin-aptamer conjugation, however, substantially compromized binding to hFcRn, to 10% affinity of that of non-conjugated WT, determined by biolayer interferometry. Binding could be rescued by aptamer conjugation to recombinant albumin engineered for higher FcRn affinity (HB) that exhibited an 8-fold affinity compared to WT alone. This work describes a novel albumin-based aptamer delivery system whose hFcRn binding can be increased using a HB engineered albumin.

  17. Targeted therapy of hepatocellular carcinoma with aptamer-functionalized biodegradable nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Weigum, Shannon, E-mail: sweigum@txstate.edu [Texas State University, Department of Biology (United States); McIvor, Elizabeth; Munoz, Christopher; Feng, Richard [Texas State University, Department of Chemistry and Biochemistry (United States); Cantu, Travis [Texas State University, Materials Science, Engineering, and Commercialization Program (United States); Walsh, Kyle [Texas State University, Department of Chemistry and Biochemistry (United States); Betancourt, Tania, E-mail: tania.betancourt@txstate.edu [Texas State University, Materials Science, Engineering, and Commercialization Program (United States)

    2016-11-15

    Hepatocellular carcinoma (HCC) is the most common form of liver cancer, occurring primarily in regions where viral hepatitis infections are common. Unfortunately, most HCC cases remain undiagnosed until late stages of the disease when patient outcome is poor, typically limiting survival from a few months to a year after initial diagnosis. In order to better care for HCC patients, new target-specific approaches are needed to improve early detection and therapeutic intervention. In this work, polymeric nanoparticles functionalized with a HCC-specific aptamer were examined as potential targeted drug delivery vehicles. Specifically, doxorubicin-loaded nanoparticles were prepared via nanoprecipitation of blends of poly(lactic-co-glycolic acid)-b-poly(ethylene glycol). These particles were further functionalized with the HCC-specific TLS11a aptamer. The in vitro interaction and therapeutic efficacy of the aptamer and aptamer-functionalized nanoparticles were characterized in a hepatoma cell line. Nanoparticles were found to be spherical in shape, roughly 100–125 nm in diameter, with a low polydispersity (≤0.2) and slightly negative surface potential. Doxorubicin was encapsulated within the particles at ~40 % efficiency. Drug release was found to occur through anomalous transport influenced by diffusion and polymer relaxation, releasing ~50 % doxorubicin in the first 10 h and full release occurring within 36 h. Confocal microscopy confirmed binding and attachment of aptamer-targeted nanoparticles to the cell surface of cultured HCC cells. Efficacy studies demonstrated a significant improvement in doxorubicin delivery and cell-killing capacity using the aptamer-functionalized, drug-loaded nanoparticles versus controls further supporting use of aptamer nanoparticles as a targeted drug delivery system for HCC tumors.

  18. Solid-Phase Synthesis of RNA Analogs Containing Phosphorodithioate Linkages.

    Science.gov (United States)

    Yang, Xianbin

    2017-09-18

    The oligoribonucleotide phosphorodithioate (PS2-RNA) modification uses two sulfur atoms to replace two non-bridging oxygen atoms at an internucleotide phosphorodiester backbone linkage. Like a natural phosphodiester RNA backbone linkage, a PS2-modified backbone linkage is achiral at phosphorus. PS2-RNAs are highly stable to nucleases and several in vitro assays have demonstrated their biological activity. For example, PS2-RNAs silenced mRNA in vitro and bound to protein targets in the form of PS2-aptamers (thioaptamers). Thus, the interest in and promise of PS2-RNAs has drawn attention to synthesizing, isolating, and characterizing these compounds. RNA-thiophosphoramidite monomers are commercially available from AM Biotechnologies and this unit describes an effective methodology for solid-phase synthesis, deprotection, and purification of RNAs having PS2 internucleotide linkages. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  19. Targeted Delivery of siRNA Therapeutics to Malignant Tumors

    Directory of Open Access Journals (Sweden)

    Qixin Leng

    2017-01-01

    Full Text Available Over the past 20 years, a diverse group of ligands targeting surface biomarkers or receptors has been identified with several investigated to target siRNA to tumors. Many approaches to developing tumor-homing peptides, RNA and DNA aptamers, and single-chain variable fragment antibodies by using phage display, in vitro evolution, and recombinant antibody methods could not have been imagined by researchers in the 1980s. Despite these many scientific advances, there is no reason to expect that the ligand field will not continue to evolve. From development of ligands based on novel or existing biomarkers to linking ligands to drugs and gene and antisense delivery systems, several fields have coalesced to facilitate ligand-directed siRNA therapeutics. In this review, we discuss the major categories of ligand-targeted siRNA therapeutics for tumors, as well as the different strategies to identify new ligands.

  20. Epstein-Barr nuclear antigen 1 induces expression of the cellular microRNA hsa-miR-127 and impairing B-cell differentiation in EBV-infected memory B cells. New insights into the pathogenesis of Burkitt lymphoma

    International Nuclear Information System (INIS)

    Onnis, A; Navari, M; Antonicelli, G; Morettini, F; Mannucci, S; De Falco, G; Vigorito, E; Leoncini, L

    2012-01-01

    Epstein-Barr Virus (EBV) is a γ-herpesvirus that infects >90% of the human population. Although EBV persists in its latent form in healthy carriers, the virus is also associated with several human cancers. EBV is strongly associated with Burkitt lymphoma (BL), even though there is still no satisfactory explanation of how EBV participates in BL pathogenesis. However, new insights into the interplay between viruses and microRNAs (miRNAs) have recently been proposed. In particular, it has been shown that B-cell differentiation in EBV-positive BL is impaired at the post-transcriptional level by altered expression of hsa-miR-127. Here, we show that the overexpression of hsa-miR-127 is due to the presence of the EBV-encoded nuclear antigen 1 (EBNA1) and give evidence of a novel mechanism of direct regulation of the human miRNA by this viral product. Finally, we show that the combinatorial expression of EBNA1 and hsa-miR-127 affects the expression of master B-cell regulators in human memory B cells, confirming the scenario previously observed in EBV-positive BL primary tumors and cell lines. A good understanding of these mechanisms will help to clarify the complex regulatory networks between host and pathogen, and favor the design of more specific treatments for EBV-associated malignancies

  1. Development of an Efficient G-Quadruplex-Stabilised Thrombin-Binding Aptamer Containing a Three-Carbon Spacer Molecule

    DEFF Research Database (Denmark)

    Aaldering, Lukas J.; Poongavanam, Vasanthanathan; Langkjær, Niels

    2017-01-01

    The thrombin-binding aptamer (TBA), which shows anticoagulant properties, is one of the most studied G-quadruplex-forming aptamers. In this study, we investigated the impact of different chemical modifications such as a three-carbon spacer (spacer-C3), unlocked nucleic acid (UNA) and 3′-amino-mod...

  2. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    DEFF Research Database (Denmark)

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders

    2016-01-01

    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  3. Label-free aptamer-based sensor for specific detection of malathion residues by surface-enhanced Raman scattering

    Science.gov (United States)

    Nie, Yonghui; Teng, Yuanjie; Li, Pan; Liu, Wenhan; Shi, Qianwei; Zhang, Yuchao

    2018-02-01

    A novel label-free aptamer surface-enhanced Raman scattering (SERS) sensor for trace malathion residue detection was proposed. In this process, the binding of malathion molecule with aptamer is identified directly. The silver nanoparticles modified with positively charged spermine served as enhancing and capture reagents for the negatively charged aptamer. Then, the silver nanoparticles modified by aptamer were used to specifically capture the malathion. The SERS background spectra of spermine, aptamer, and malathion were recorded and distinguished with the spectrum of malathion-aptamer. To enhance the characteristic peak signal of malathion captured by the aptamer, the aggregate reagents (NaCl, KCl, MgCl2) were compared and selected. The selectivity of this method was verified in the mixed-pesticide standard solution, which included malathion, phosmet, chlorpyrifos-methyl, and fethion. Results show that malathion can be specifically identified when the mixed-pesticide interferences existed. The standard curve was established, presenting a good linear range of 5 × 10- 7 to 1 × 10- 5 mol·L- 1. The spiked experiments for tap water show good recoveries from 87.4% to 110.5% with a relative standard deviation of less than 4.22%. Therefore, the proposed label-free aptamer SERS sensor is convenient, specifically detects trace malathion residues, and can be applied for qualitative and quantitative analysis of other pesticides.

  4. Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX).

    Science.gov (United States)

    Huang, Chao-June; Lin, Hsin-I; Shiesh, Shu-Chu; Lee, Gwo-Bin

    2010-03-15

    The systematic evolution of ligands by exponential enrichment (SELEX) is an experimental procedure that allows screening of given molecular targets by desired binding affinities from an initial random pool of oligonucleotides and oligomers. The final products of SELEX are usually referred as aptamers, which are recognized as promising molecules for a variety of biomedical applications. However, SELEX is an iterative process requiring multiple rounds of extraction and amplification that demands significant time and labor. Therefore, this study presents a novel, automatic, miniature SELEX platform. As a demonstration, the rapid screening of C-reactive protein (CRP) aptamers was performed. By utilizing microfluidic technologies and magnetic beads conjugated with CRP, aptamers with a high affinity to CRP were extracted from a random single-strand deoxyribonucleic acid (ssDNA) pool. These aptamers were further amplified by an on-chip polymerase chain reaction (PCR) process. After five consecutive extraction and amplification cycles, a specific aptamer with the highest affinity was screened automatically. The screened aptamers were used as a recognition molecule for the detection of CRP. The developed microsystem demonstrated fast screening of CRP aptamers and can be used as a powerful tool to select analyte-specific aptamers for biomedical applications. (c) 2009 Elsevier B.V. All rights reserved.

  5. Selection of aptamers for use as radiopharmaceuticals in bacterial infection diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Ieda Mendes; Faria, Ligia Santana de; Correa, Cristiane Rodrigues; Andrade, Antero Silva Ribeiro de, E-mail: imendesf@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    The difficulty in early detection of specific foci in the bacterial infection caused by bacteria has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy has the advantage that an image of the whole body could be obtained. This study aims to obtain aptamers specific bacteria for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as {sup 99m}Tc, {sup 18}F and {sup 32}P. In this study aptamers anti-peptidoglycan, the main component of the outer cell wall of bacteria, were obtained through SELEX. The SELEX started with a pool of ssDNA that had 10{sup 15}different sequences (library), each oligo has two fixed regions merging a portion of 25 random nucleotides. Initially, the library of ssDNA was incubated with peptidoglycan, for 1h at 37 dec C with stirring. Subsequently, amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reaction). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 rounds of selection the oligonucleotides were cloned using TOPO plasmid and Escherichia coli strain Top10F'. The plasmid DNA from 40 colonies were extracted and quantified. The plasmids were sequenced using the sequencing MegaBase, and two different aptamers sequences were obtained from all clones. The aptamers obtained were synthesized and subsequently labeled with {sup 32}P in the 5' end. The labeled aptamers were incubated

  6. Selection of aptamers for use as radiopharmaceuticals in bacterial infection diagnosis

    International Nuclear Information System (INIS)

    Ferreira, Ieda Mendes; Faria, Ligia Santana de; Correa, Cristiane Rodrigues; Andrade, Antero Silva Ribeiro de

    2013-01-01

    The difficulty in early detection of specific foci in the bacterial infection caused by bacteria has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy has the advantage that an image of the whole body could be obtained. This study aims to obtain aptamers specific bacteria for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as 99m Tc, 18 F and 32 P. In this study aptamers anti-peptidoglycan, the main component of the outer cell wall of bacteria, were obtained through SELEX. The SELEX started with a pool of ssDNA that had 10 15 different sequences (library), each oligo has two fixed regions merging a portion of 25 random nucleotides. Initially, the library of ssDNA was incubated with peptidoglycan, for 1h at 37 dec C with stirring. Subsequently, amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reaction). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 rounds of selection the oligonucleotides were cloned using TOPO plasmid and Escherichia coli strain Top10F'. The plasmid DNA from 40 colonies were extracted and quantified. The plasmids were sequenced using the sequencing MegaBase, and two different aptamers sequences were obtained from all clones. The aptamers obtained were synthesized and subsequently labeled with 32 P in the 5' end. The labeled aptamers were incubated with 10 7 Staphylococcus aureus

  7. Serum inverts and improves the fluorescence response of an aptamer beacon to various vitamin D analytes.

    Science.gov (United States)

    Bruno, John G; Carrillo, Maria P; Phillips, Taylor; Edge, Allison

    2012-01-01

    A dominant aptamer loop structure from a library of nearly 100 candidate aptamer sequences developed against immobilized 25-hydroxyvitamin D(3) (calcidiol) was converted into a 5'-TYE 665 and 3'-Iowa black-labelled aptamer beacon. The aptamer beacon exhibited a mild 'lights on' reaction in buffer as a function of increasing concentrations of several vitamin D analogues and metabolites, with a limit of detection of approximately 200 ng/mL, and was not specific for any particular congener. In 10% or 50% human serum, the same aptamer beacon inverted its fluorescence behaviour to become a more intense 'lights off' reaction with an improved limit of detection in the range 4-16 ng/mL. We hypothesized that this drastic change in fluorescence behaviour was due to the presence of creatinine and urea in serum, which might destabilize the quenched beacon, causing an increase in fluorescence followed by decreasing fluorescence as a function of vitamin D concentrations that may bind and quench increasingly greater fractions of the denatured beacons. However, the results of several control experiments in the presence of physiological or greater concentrations of creatinine and urea, alone or combined in buffer, failed to produce the beacon fluorescence inversion. Other possible mechanistic hypotheses are also discussed. Copyright © 2011 John Wiley & Sons, Ltd.

  8. Graphene oxide and DNA aptamer based sub-nanomolar potassium detecting optical nanosensor

    Science.gov (United States)

    Datta, Debopam; Sarkar, Ketaki; Mukherjee, Souvik; Meshik, Xenia; Stroscio, Michael A.; Dutta, Mitra

    2017-08-01

    Quantum-dot (QD) based nanosensors are frequently used by researchers to detect small molecules, ions and different biomolecules. In this article, we present a sensor complex/system comprised of deoxyribonucleic acid (DNA) aptamer, gold nanoparticle and semiconductor QD, attached to a graphene oxide (GO) flake for detection of potassium. As reported herein, it is demonstrated that QD-aptamer-quencher nanosensor functions even when tethered to GO, opening the way to future applications where sensing can be accomplished simultaneously with other previously demonstrated applications of GO such as serving as a nanocarrier for drug delivery. Herein, it is demonstrated that the DNA based thrombin binding aptamer used in this study undergoes the conformational change needed for sensing even when the nanosensor complex is anchored to the GO. Analysis with the Hill equation indicates the interaction between aptamer and potassium follows sigmoidal Hill kinetics. It is found that the quenching efficiency of the optical sensor is linear with the logarithm of concentration from 1 pM to 100 nM and decreases for higher concentration due to unavailability of aptamer binding sites. Such a simple and sensitive optical aptasensor with minimum detection capability of 1.96 pM for potassium ion can also be employed in-vitro detection of different physiological ions, pathogens and disease detection methods.

  9. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B1

    International Nuclear Information System (INIS)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping; Zhu, Changqing; Jiang, Yuan

    2014-01-01

    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B 1 (FB 1 ). FB 1 is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB 1 were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB 1 via aptasensors. (author)

  10. Selection and characterization of single stranded DNA aptamers recognizing fumonisin B{sub 1}

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Ding, Zhansheng; Wang, Zhouping [State Key Laboratory of Food Science and Technology, Synergetic Innovation Center of Food Safety and Nutrition, School of Food Science and Technology, Jiangnan University, Wuxi, 214122 (China); Zhu, Changqing; Jiang, Yuan [Animal, Plant and Food Inspection Centre, Jiangsu Entry-Exit Inspection and Quarantine Bureau, Nanjing, 210001 (China)

    2014-08-01

    We present an improved method for the selection of single-stranded DNA aptamers that can recognize fumonisin B{sub 1} (FB{sub 1}). FB{sub 1} is a carcinogenic mycotoxin mainly found in corn and corn-based food products worldwide, posing a global threat to feed and food safety. Selection was based on the mag-SELEX (magnetic bead systematic evolution of ligands by exponential enrichment) technology modified by adopting free analogs of targets rather than immobilized targets for counter selections. Firstly, aptamer candidates for FB{sub 1} were selected from an 80 nt random DNA library after 13 rounds of selection. Next, binding assays were performed for affinity evaluation, and circular dichroism spectroscopy was used to investigate their conformation. A high-affinity aptamer designated as F10 (with a dissociation constant of 62 ± 5 nM) was identified and tested for its specificity by competitive binding assays. The results demonstrate that this improved mag-SELEX technology facilitates aptamer screening because it avoids the tedious immobilization of counter-selection molecules on magnetic beads. The aptamers obtained by this technique open new possibilities for the detection of FB{sub 1} via aptasensors. (author)

  11. Colorimetric detection with aptamer–gold nanoparticle conjugates: effect of aptamer length on response

    International Nuclear Information System (INIS)

    Chávez, Jorge L.; MacCuspie, Robert I.; Stone, Morley O.; Kelley-Loughnane, Nancy

    2012-01-01

    A riboflavin binding aptamer (RBA) was used in combination with gold nanoparticles (AuNPs) to detect riboflavin in vitro. The RBA–AuNP conjugates (RBA–AuNPs) responded colorimetrically to the presence of riboflavin and this response could be followed by the naked eye. This system was used as a model to study how modifications on the aptamer sequence affect the RBA–AuNPs’ stability and their response to their target. To mimic primers and other sequence modifications typically used in aptamer work, the RBA was extended by adding extra bases to its 5′ end. These extra bases were designed to avoid interactions with the RBA binding site. The response of these RBA–AuNPs was evaluated and compared. Dynamic light scattering and UV-aggregation kinetics studies showed that the length of the aptamer significantly affected the RBA–AuNPs’ stability and, as a consequence, the magnitude of the detection response to riboflavin. The addition of thymine nucleotides instead of random tails to the RBA showed that the effects observed were not specific to the sequence used. This study shows that modifications of the aptamer sequence provide a means to improve the stability of aptamer–AuNPs conjugates and their sensing response.

  12. An aptamer-based fluorescence bio-sensor for chiral recognition of arginine enantiomers.

    Science.gov (United States)

    Yuan, Haiyan; Huang, Yunmei; Yang, Jidong; Guo, Yuan; Zeng, Xiaoqing; Zhou, Shang; Cheng, Jiawei; Zhang, Yuhui

    2018-07-05

    In this study, a novel aptamer - based fluorescence bio-sensor (aptamer-AuNps) was developed for chiral recognition of arginine (Arg) enantiomers based on aptamer and gold nanoparticles (AuNps). Carboxyfluorescein (FAM) labeled aptamers (Apt) were absorbed on AuNps and their fluorescence intensity could be significantly quenched by AuNps based on fluorescence resonance energy transfer (FRET). Once d-Arg or l-Arg were added into the above solution, the aptamer specifically bind to Arg enantiomers and released from AuNps, so the fluorescence intensity of d-Arg system and l-Arg system were all enhanced. The affinity of Apt to l-Arg is tighter to d-Arg, so the enhanced fluorescence signals of l-Arg system was stronger than d-Arg system. What's more, the enhanced fluorescence were directly proportional to the concentration of d-Arg and l-Arg ranging from 0-300 nM and 0-400 nM with related coefficients of 0.9939 and 0.9952, respectively. Furthermore, the method was successfully applied to detection l-Arg in human urine samples with satisfactory results. Eventually, a simple "OR" logic gate with d-Arg &l-Arg as inputs and AuNps aggregation state as outputs was fabricated, which can help us understand the chiral recognition process deeply. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Aptamer-functionalized magnetic nanoparticles for simultaneous fluorometric determination of oxytetracycline and kanamycin

    International Nuclear Information System (INIS)

    Liu, Changbin; Lu, Chunxia; Tang, Zonggui; Chen, Xia; Wang, Guohong; Sun, Fengxia

    2015-01-01

    This work describes a method for the simultaneous detection of oxytetracycline (OTC) and kanamycin (KMY) using aptamers acting as both recognition and separation elements, and complementary oligonucleotides labeled with a green emitting fluorophore (carboxyfluorescein, FAM) and a yellow emitting fluorophore (carboxy-X-rhodamine, ROX), respectively, as signal labels. An OTC aptamer and a KMY aptamer were immobilized on the surface of magnetic nanoparticles (MNPs) via avidin-biotin chemistry. The aptamers preferentially bind their respective targets and thereby cause the upconcentration of analytes. However, in their absence they bind fluorescently-tagged complementary oligonucleotide later added to the reaction system. This cause the NPs to become fluorescent, with emission peaks located at 520 and 608 nm, respectively. The effects of the concentration of avidin, aptamer, complementary oligonucleotide, incubation temperature and incubation time were optimized. Under the optimal conditions, linear relationships were obtained in the range of 1–50 ng∙mL −1 for OTC and KMY, with limits of detection of 0.85 ng∙mL −1 and 0.92 ng∙mL −1 , respectively. The method was applied to the analysis of pork, milk, and honey samples spiked with OTC and MKY. Recoveries ranged from 76.5 to 94.7 % and 77.8 to 93.1 %, respectively, and the relative standard deviation was <10.0 %. (author)

  14. Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components.

    Science.gov (United States)

    Ramlal, Shylaja; Mondal, Bhairab; Lavu, Padma Sudharani; N, Bhavanashri; Kingston, Joseph

    2018-01-16

    In the present study, a high throughput whole cell SELEX method has been applied successfully in selecting specific aptamers against whole cells of Staphylococcus aureus, a potent food poisoning bacterium. A total ten rounds of SELEX and three rounds of intermittent counter SELEX, was performed to obtain specific aptamers. Obtained oligonucleotide pool were cloned, sequenced and then grouped into different families based on their primary sequence homology and secondary structure similarity. FITC labeled sequences from different families were selected for further characterization via flow cytometry analysis. The dissociation constant (K d ) values of specific and higher binders ranged from 34 to 128nM. Binding assays to assess the selectivity of aptamer RAB10, RAB 20, RAB 28 and RAB 35 demonstrated high affinity against S. aureus and low binding affinity for other bacteria. To demonstrate the potential use of the aptamer a sensitive dual labeled sandwich detection system was developed using aptamer RAB10 and RAB 35 with a detection limit of 10 2 CFU/mL. Furthermore detection from mixed cell population and spiked sample emphasized the robustness as well as applicability of the developed method. Altogether, the established assay could be a reliable detection tool for the routine investigation of Staphylococcus aureus in samples from food and clinical sources. Copyright © 2017. Published by Elsevier B.V.

  15. Structural basis for IL-1α recognition by a modified DNA aptamer that specifically inhibits IL-1α signaling

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Xiaoming; Gelinas, Amy D.; von Carlowitz, Ira; Janjic, Nebojsa; Pyle, Anna Marie (Yale); (SomaLogic)

    2017-10-09

    IL-1α is an essential cytokine that contributes to inflammatory responses and is implicated in various forms of pathogenesis and cancer. Here we report a naphthyl modified DNA aptamer that specifically binds IL-1α and inhibits its signaling pathway. By solving the crystal structure of the IL-1α/aptamer, we provide a high-resolution structure of this critical cytokine and we reveal its functional interaction interface with high-affinity ligands. The non-helical aptamer, which represents a highly compact nucleic acid structure, contains a wealth of new conformational features, including an unknown form of G-quadruplex. The IL-1α/aptamer interface is composed of unusual polar and hydrophobic elements, along with an elaborate hydrogen bonding network that is mediated by sodium ion. IL-1α uses the same interface to interact with both the aptamer and its cognate receptor IL-1RI, thereby suggesting a novel route to immunomodulatory therapeutics.

  16. Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis.

    Science.gov (United States)

    Aimaiti, Rusitanmujiang; Qin, Lianhua; Cao, Ting; Yang, Hua; Wang, Jie; Lu, Junmei; Huang, Xiaochen; Hu, Zhongyi

    2015-11-01

    Microscopy of direct smear with the Ziehl-Neelsen stain is still broadly used in tuberculosis diagnosis. However, this method suffers from low specificity and is difficult to distinguish Mycobacterium tuberculosis (MTB) from nontuberculosis mycobacterial (NTM), since all mycobacterial species are positive in Ziehl-Neelsen stain. In this study, we utilized whole cell SELEX to obtain species-specific aptamers for increasing the specificity of MTB detection. Whole cell SELEX was performed in MTB reference strain H37Rv by two selection processes based on enzyme-linked plate or Eppendorf tube, respectively. To increase success rate of generating aptamers, the selection processes were systematically monitored to understand the dynamic evolution of aptamers against complex structure of target bacteria. Two preponderant groups and ten high-affinity aptamers were obtained by analyzing the dynamic evolution. Preponderant aptamer MA1 from group I showed relatively high binding affinity with apparent dissociation constant (KD value) of 12.02 nM. Sandwich ELISA assay revealed five aptamer combinations effectively bound MTB strains in preliminary evaluation, especially the combination based on aptamer MA2 (another preponderant aptamer from group II) and MA1. Further evaluated in many other strains, MA2/MA1 combination effectively identified MTB from NTM or other pathogenic bacteria, and displayed the high specificity and sensitivity. Binding analysis of aptamer MA1 or MA2 by fluorescence microscopy observation showed high binding reactivity with H37Rv, low apparent cross-reactivity with M. marinum, and no apparent cross-reactivity with Enterobacter cloacae. Taken together, this study provides attractive candidate species-specific aptamers to effectively capture or discriminate MTB strains.

  17. Potential of RNA aptamers in the prevention of HIV-1 subtype C infections

    CSIR Research Space (South Africa)

    London, GM

    2014-10-01

    Full Text Available Compounds that have been used to prevent human immunodeficiency virus type-I (HIV-1) infections include synthetic chemicals, plant extras and monoclonal antibodies. Although most of these compounds have potent antiviral activity, they often fail...

  18. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  19. Aptamer based electrochemical sensor for detection of human lung adenocarcinoma A549 cells

    Science.gov (United States)

    Sharma, Rachna; Varun Agrawal, Ved; Sharma, Pradeep; Varshney, R.; Sinha, R. K.; Malhotra, B. D.

    2012-04-01

    We report results of the studies relating to development of an aptamer-based electrochemical biosensor for detection of human lung adenocarcinoma A549 cells. The aminated 85-mer DNA aptamer probe specific for the A549 cells has been covalently immobilized onto silane self assembled monolayer (SAM) onto ITO surface using glutaraldehyde as the crosslinker. The results of cyclic voltammetry and differential pulse voltammetry studies reveal that the aptamer functionalized bioelectrode can specifically detect lung cancer cells in the concentration range of 103 to 107 cells/ml with detection limit of 103 cells/ml within 60 s. The specificity studies of the bioelectrode have been carried out with control KB cells. No significant change in response is observed for control KB cells as compared to that of the A549 target cells.

  20. Ultrafast Capillary Electrophoresis Isolation of DNA Aptamer for the PCR Amplification-Based Small Analyte Sensing

    Directory of Open Access Journals (Sweden)

    Emmanuelle eFiore

    2015-08-01

    Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.

  1. Isolation and characterization of high affinity aptamers against DNA polymerase iota.

    Science.gov (United States)

    Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

    2012-02-01

    Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

  2. Aptamer-mediated indirect quantum dot labeling and fluorescent imaging of target proteins in living cells

    International Nuclear Information System (INIS)

    Liu, Jianbo; Zhang, Pengfei; Yang, Xiaohai; Wang, Kemin; Guo, Qiuping; Huang, Jin; Li, Wei

    2014-01-01

    Protein labeling for dynamic living cell imaging plays a significant role in basic biological research, as well as in clinical diagnostics and therapeutics. We have developed a novel strategy in which the dynamic visualization of proteins within living cells is achieved by using aptamers as mediators for indirect protein labeling of quantum dots (QDs). With this strategy, the target protein angiogenin was successfully labeled with fluorescent QDs in a minor intactness model, which was mediated by the aptamer AL6-B. Subsequent living cell imaging analyses indicated that the QDs nanoprobes were selectively bound to human umbilical vein endothelial cells, gradually internalized into the cytoplasm, and mostly localized in the lysosome organelle, indicating that the labeled protein retained high activity. Compared with traditional direct protein labeling methods, the proposed aptamer-mediated strategy is simple, inexpensive, and provides a highly selective, stable, and intact labeling platform that has shown great promise for future biomedical labeling and intracellular protein dynamic analyses. (paper)

  3. Impedimetric aptamer-based determination of the mold toxin fumonisin B1

    International Nuclear Information System (INIS)

    Chen, Xiujuan; Huang, Yukun; Ma, Xiaoyuan; Jia, Fei; Guo, Xiaofei; Wang, Zhouping

    2015-01-01

    We are presenting an aptasensor for the sensitive determination of fumonisin B1 (FB-1) via electrochemical impedance spectroscopy (EIS) and applying aptamer-based biorecognition. A thiolated aptamer for FB-1 was anchored onto the surface of gold nanoparticles (AuNPs) on a glassy carbon electrode. A significant increase in resistance (R et ) is found on interaction with FB-1 in the 0.1 nM to 100 μM concentration range, and the detection limit is as low as 2 pM. The assay was applied to determine FB-1 in spiked maize samples and gave recovery rates ranging from 91 to 105 %. The results demonstrate this method to present new possibilities in the application of aptamers in food safety analysis. (author)

  4. Aptamer sensor for cocaine using minor groove binder based energy transfer.

    Science.gov (United States)

    Zhou, Jinwen; Ellis, Amanda V; Kobus, Hilton; Voelcker, Nicolas H

    2012-03-16

    We report on an optical aptamer sensor for cocaine detection. The cocaine sensitive fluorescein isothiocyanate (FITC)-labeled aptamer underwent a conformational change from a partial single-stranded DNA with a short hairpin to a double-stranded T-junction in the presence of the target. The DNA minor groove binder Hoechst 33342 selectively bound to the double-stranded T-junction, bringing the dye within the Förster radius of FITC, and therefore initiating minor groove binder based energy transfer (MBET), and reporting on the presence of cocaine. The sensor showed a detection limit of 0.2 μM. The sensor was also implemented on a carboxy-functionalized polydimethylsiloxane (PDMS) surface by covalently immobilizing DNA aptamers. The ability of surface-bound cocaine detection is crucial for the development of microfluidic sensors. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Improved thrombin binding aptamer by incorporation of a single unlocked nucleic acid monomer

    DEFF Research Database (Denmark)

    Pasternak, Anna; Hernandez, Frank J; Rasmussen, Lars Melholt

    2011-01-01

    A 15-mer DNA aptamer (named TBA) adopts a G-quadruplex structure that strongly inhibits fibrin-clot formation by binding to thrombin. We have performed thermodynamic analysis, binding affinity and biological activity studies of TBA variants modified by unlocked nucleic acid (UNA) monomers. UNA...... that a UNA monomer is allowed in many positions of the aptamer without significantly changing the thrombin-binding properties. The biological effect of a selection of the modified aptamers was tested by a thrombin time assay and showed that most of the UNA-modified TBAs possess anticoagulant properties......, and that the construct with a UNA-U monomer in position 7 is a highly potent inhibitor of fibrin-clot formation....

  6. Development of aptamers for use as radiopharmaceuticals in the bacterial infection identification

    International Nuclear Information System (INIS)

    Ferreira, Ieda Mendes

    2013-01-01

    The difficulty in early detection of specific foci caused by bacteria in the bacterial infection has raised the need to search for new techniques for this purpose, since these foci require prolonged treatment with antibiotics and in some cases even drainage or, if applicable, removal of prostheses or grafts. Detection of bacterial infections by scintigraphy had the advantage that a whole body image could be obtained, since specific tracers were available. This study aims to obtain aptamers specific for bacteria identification for future use as radiopharmaceutical. The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) methodology can generate oligonucleotides (aptamers) that are able to bind with high affinity and specificity to a specific target, from small molecules to complex proteins, by using rounds of enrichment and amplification. Aptamers can be labeled with different radionucleotides such as 99 mTc, 18 F and 32 P. In this study, aptamers anti-peptidoglycan, the main component of the bacterial outer cell wall, were obtained through SELEX. Whole cells of Staphylococcus aureus were also used to perform the SELEX to cells (cell-SELEX). The selection of aptamers was performed by two different procedures (A and B). The A process has been accomplished by 15 SELEX rounds in which the separation of the oligonucleotides bound to the peptidoglycan of unbound ones was performed by filtration. In the B process 15 SELEX rounds were performed using the centrifugation for this separation, followed by 5 rounds cell-SELEX. The SELEX started with a pool of ssDNA (single stranded DNA). For A process, initially a library of ssDNA was incubated with peptidoglycan and the amplification of oligonucleotides that were able to bind to peptidoglycan was performed by PCR (Polymerase Chain Reation). The amplified oligonucleotides were again incubated with peptidoglycan, amplified and purified. At the end of 15 selection rounds the selected oligonucleotides were cloned

  7. Generation of Internal-Image Functional Aptamers of Okadaic Acid via Magnetic-Bead SELEX

    Directory of Open Access Journals (Sweden)

    Chao Lin

    2015-12-01

    Full Text Available Okadaic acid (OA is produced by Dinophysis and Prorocentrum dinoflagellates and primarily accumulates in bivalves, and this toxin has harmful effects on consumers and operators. In this work, we first report the use of aptamers as novel non-toxic probes capable of binding to a monoclonal antibody against OA (OA-mAb. Aptamers that mimic the OA toxin with high affinity and selectivity were generated by the magnetic bead-assisted systematic evolution of ligands by exponential enrichment (SELEX strategy. After 12 selection rounds, cloning, sequencing and enzyme-linked immunosorbent assay (ELISA analysis, four candidate aptamers (O24, O31, O39, O40 were selected that showed high affinity and specificity for OA-mAb. The affinity constants of O24, O31, O39 and O40 were 8.3 × 108 M−1, 1.47 × 109 M−1, 1.23 × 109 M−1 and 1.05 × 109 M−1, respectively. Indirect competitive ELISA was employed to determine the internal-image function of the aptamers. The results reveal that O31 has a similar competitive function as free OA toxin, whereas the other three aptamers did not bear the necessary internal-image function. Based on the derivation of the curvilinear equation for OA/O31, the equation that defined the relationship between the OA toxin content and O31 was Y = 2.185X − 1.78. The IC50 of O31 was 3.39 ng·mL−1, which was close to the value predicted by the OA ELISA (IC50 = 4.4 ng·mL−1; the IC10 was 0.33 ng·mL−1. The above data provides strong evidence that internal-image functional aptamers could be applicable as novel probes in a non-toxic assay.

  8. Selection of aptamers specific for glycated hemoglobin and total hemoglobin using on-chip SELEX.

    Science.gov (United States)

    Lin, Hsin-I; Wu, Ching-Chu; Yang, Ching-Hsuan; Chang, Ko-Wei; Lee, Gwo-Bin; Shiesh, Shu-Chu

    2015-01-21

    Blood glycated hemoglobin (HbA1c) levels reflecting average glucose concentrations over the past three months are fundamental for the diagnosis, monitoring, and risk assessment of diabetes. It has been hypothesized that aptamers, which are single-stranded DNAs or RNAs that demonstrate high affinity to a large variety of molecules ranging from small drugs, metabolites, or proteins, could be used for the measurement of HbA1c. Aptamers are selected through an in vitro process called systematic evolution of ligands by exponential enrichment (SELEX), and they can be chemically synthesized with high reproducibility at relatively low costs. This study therefore aimed to select HbA1c- and hemoglobin (Hb)-specific single-stranded DNA aptamers using an on-chip SELEX protocol. A microfluidic SELEX chip was developed to continuously and automatically carry out multiple rounds of SELEX to screen specific aptamers for HbA1c and Hb. HbA1c and Hb were first coated onto magnetic beads. Following several rounds of selection and enrichment with a randomized 40-mer DNA library, specific oligonucleotides were selected. The binding specificity and affinity were assessed by competitive and binding assays. Using the developed microfluidic system, the incubation and partitioning times were greatly decreased, and the entire process was shortened dramatically. Both HbA1c- and Hb-specific aptamers selected by the microfluidic system showed high specificity and affinity (dissociation constant, Kd = 7.6 ± 3.0 nM and 7.3 ± 2.2 nM for HbA1c and Hb, respectively). With further refinements in the assay, these aptamers may replace the conventional antibodies for in vitro diagnostics applications in the near future.

  9. An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7.

    Directory of Open Access Journals (Sweden)

    Wenhe Wu

    Full Text Available BACKGROUND: An aptamer based biosensor (aptasensor was developed and evaluated for rapid colorimetric detection of Escherichia coli (E. coli O157:H7. METHODOLOGY/PRINCIPAL FINDINGS: The aptasensor was assembled by modifying the truncated lipopolysaccharides (LPS-binding aptamer on the surface of nanoscale polydiacetylene (PDA vesicle using peptide bonding between the carboxyl group of the vesicle and the amine group of the aptamer. Molecular recognition between E. coli O157:H7 and aptamer at the interface of the vesicle lead to blue-red transition of PDA which was readily visible to the naked eyes and could be quantified by colorimetric responses (CR. Confocal laser scanning microscope (CLSM and transmission electron microscopy (TEM was used to confirm the specific interactions between the truncated aptamer and E. coli O157:H7. The aptasensor could detect cellular concentrations in a range of 10(4~ 10(8 colony-forming units (CFU/ml within 2 hours and its specificity was 100% for detection of E. coli O157:H7. Compared with the standard culture method, the correspondent rate was 98.5% for the detection of E. coli O157:H7 on 203 clinical fecal specimens with our aptasensor. CONCLUSIONS: The new aptasensor represents a significant advancement in detection capabilities based on the combination of nucleic acid aptamer with PDA vesicle, and offers a specific and convenient screening method for the detection of pathogenic bacteria. This technic could also be applied in areas from clinical analysis to biological terrorism defense, especially in low-resource settings.

  10. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Science.gov (United States)

    DeGrasse, Jeffrey A

    2012-01-01

    The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs). Staphylococcal food poisoning (SFP) results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB) that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1), successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  11. A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B.

    Directory of Open Access Journals (Sweden)

    Jeffrey A DeGrasse

    Full Text Available The bacterium Staphylococcus aureus is a common foodborne pathogen capable of secreting a cocktail of small, stable, and strain-specific, staphylococcal enterotoxins (SEs. Staphylococcal food poisoning (SFP results when improperly handled food contaminated with SEs is consumed. Gastrointestinal symptoms of SFP include emesis, diarrhea and severe abdominal pain, which manifest within hours of ingesting contaminated food. Immuno-affinity based methods directly detect, identify, and quantify several SEs within a food or clinical sample. However, the success of these assays depends upon the availability of a monoclonal antibody, the development of which is non-trivial and costly. The current scope of the available immuno-affinity based methods is limited to the classical SEs and does not encompass all of the known or emergent SEs. In contrast to antibodies, aptamers are short nucleic acids that exhibit high affinity and specificity for their targets without the high-costs and ethical concerns of animal husbandry. Further, researchers may choose to freely distribute aptamers and develop assays without the proprietary issues that increase the per-sample cost of immuno-affinity assays. This study describes a novel aptamer, selected in vitro, with affinity to staphylococcal enterotoxin B (SEB that may be used in lieu of antibodies in SE detection assays. The aptamer, designated APT(SEB1, successfully isolates SEB from a complex mixture of SEs with extremely high discrimination. This work sets the foundation for future aptamer and assay development towards the entire family of SEs. The rapid, robust, and low-cost identification and quantification of all of the SEs in S. aureus contaminated food is essential for food safety and epidemiological efforts. An in vitro generated library of SE aptamers could potentially allow for the comprehensive and cost-effective analysis of food samples that immuno-affinity assays currently cannot provide.

  12. Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization

    Directory of Open Access Journals (Sweden)

    Victor Constantin Diculescu

    2010-01-01

    Full Text Available The adsorption and the redox behaviour of thrombin-binding aptamer (TBA and extended TBA (eTBA were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands.

  13. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  14. Selection and application of ssDNA aptamers to detect active TB from sputum samples

    CSIR Research Space (South Africa)

    Rotherham, LS

    2012-10-01

    Full Text Available and specificity, has been made possible by the development of the systematic evolution of ligands by exponential enrichment (SELEX) process [22,23,24]. Since aptamers can be produced using chemical synthesis or by PCR, the cost of producing aptamers is 10... urea, 25 mM Tris-HCl, 200 mM NaCl, 10 mM imidazole, pH 7.4). The cells were disrupted by sonication (Bandelin Sonoplus HD2070), after which the lysate was clarified by centrifugation (14,000 rpm for 15 min at 4uC). For CFP-10, the supernatant...

  15. Nucleic Acid Aptamers as Novel Class of Therapeutics to Mitigate Alzheimer's Disease Pathology

    DEFF Research Database (Denmark)

    K. Tannenberg, Rudi; Al. Shamaileh, Hadi; Lauridsen, Lasse Holm

    2013-01-01

    Deposition of amyloid-beta (A beta) peptides in the brain is a central event in the pathogenesis of Alzheimer's disease (AD), which makes A beta peptides a crucial target for therapeutic intervention. Significant efforts have been made towards the development of ligands that bind to A beta peptides...... with a goal of early detection of amyloid aggregation and the neutralization of A toxicity. Short single-stranded oligonucleotide aptamers bind with high affinity and specificity to their targets. Aptamers that specifically bind to A beta monomers, specifically the 40 and 42 amino acid species (A beta(1...

  16. Aptamer-Assisted Detection of the Altered Expression of Estrogen Receptor Alpha in Human Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Rajesh Ahirwar

    Full Text Available An increase in the expression of estrogen receptors (ER and the expanded population of ER-positive cells are two common phenotypes of breast cancer. Detection of the aberrantly expressed ERα in breast cancer is carried out using ERα-antibodies and radiolabelled ligands to make decisions about cancer treatment and targeted therapy. Capitalizing on the beneficial advantages of aptamer over the conventional antibody or radiolabelled ligand, we have identified a DNA aptamer that selectively binds and facilitates the detection of ERα in human breast cancer tissue sections. The aptamer is identified using the high throughput sequencing assisted SELEX screening. Biophysical characterization confirms the binding and formation of a thermodynamically stable complex between the identified DNA aptamer (ERaptD4 and ERα (Ka = 1.55±0.298×108 M(-1; ΔH = 4.32×104±801.1 cal/mol; ΔS = -108 cal/mol/deg. Interestingly, the specificity measurements suggest that the ERaptD4 internalizes into ERα-positive breast cancer cells in a target-selective manner and localizes specifically in the nuclear region. To harness these characteristics of ERaptD4 for detection of ERα expression in breast cancer samples, we performed the aptamer-assisted histochemical analysis of ERα in tissue samples from breast cancer patients. The results were validated by performing the immunohistochemistry on same samples with an ERα-antibody. We found that the two methods agree strongly in assay output (kappa value = 0.930, p-value <0.05 for strong ERα positive and the ERα negative samples; kappa value = 0.823, p-value <0.05 for the weak/moderate ER+ve samples, n = 20. Further, the aptamer stain the ERα-positive cells in breast tissues without cross-reacting to ERα-deficient fibroblasts, adipocytes, or the inflammatory cells. Our results demonstrate a significant consistency in the aptamer-assisted detection of ERα in strong ERα positive, moderate ERα positive and ERα negative

  17. Delivery, Effect on Cell Viability, and Plasticity of Modified Aptamer Constructs

    DEFF Research Database (Denmark)

    Gissberg, Olof; Zaghloul, Eman M; Lundin, Karin E

    2016-01-01

    AS1411 is a g-quadruplex-forming aptamer capable of selectively entering cancer cells by nucleolin receptor-mediated uptake. In this study, we investigated the cell internalization properties and plasticity of AS1411 carrying different locked nucleic acid-containing cargo oligonucleotides (ONs......) for delivery into A549 and U2OS cells. We found that internalization efficiency is highly governed by ON cargo chemistry and composition since the inherent antitumor properties of AS1411 were lost when attached to a nontoxic ON, noTox. However, a toxic ON, Tox, demonstrated potent cytotoxicity after aptamer...

  18. Facile and Cost-Effective Detection of Saxitoxin Exploiting Aptamer Structural Switching

    Directory of Open Access Journals (Sweden)

    Karol Alfaro

    2015-01-01

    Full Text Available A simple method to detect saxitoxin (STX, one of the main components of the paralytic shellfish poison from red tide, has been developed. By using a next generation dye for double-stranded DNA we were able to differentiate fluorescence from STX-binding aptamers when exposed to different concentrations of STX, suggesting a change in aptamer folding upon target binding. The developed method is extremely rapid, only requiring small sample volumes, with quantitative results in the concentration range of 15 ng/mL to 3 μg/mL of STX, with a detection limit of 7.5 ng/mL.

  19. Scintigraphic imaging of Staphylococcus aureus infection using 99mTc radiolabeled aptamers.

    Science.gov (United States)

    Santos, Sara Roberta Dos; de Sousa Lacerda, Camila Maria; Ferreira, Iêda Mendes; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro

    2017-10-01

    Staphylococcus aureus is a specie of great medical importance associated with many infections as bacteremia and infective endocarditis as well as osteoarticular, skin and soft tissue, pleuropulmonary, and device related infections. Early identification of infectious foci is crucial for successful treatment. Scintigraphy could contribute to this purpose since specific radiotracers were available. Aptamers due to their high specificity have great potential for radiopharmaceuticals development. In the present study scintigraphic images of S. aureus infectious foci were obtained using specific S. aureus aptamers radiolabeled with 99m Tc. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. A Cancer Cell-Activatable Aptamer-Reporter System for One-Step Assay of Circulating Tumor Cells

    Directory of Open Access Journals (Sweden)

    Zihua Zeng

    2014-01-01

    Full Text Available The current antibody-mediated numeration assays of circulating tumor cells (CTCs require multiple steps and are time-consuming. To overcome these technical limitations, a cancer cell-activatable aptamer-reporter was formulated by conjugating a biomarker-specific aptamer sequence with paired fluorochrome-quencher molecules. In contrast to the antibody probes, the intact aptamer-reporter was optically silent in the absence of cells of interest. However, when used in an assay, the aptamer selectively targeted cancer cells through interaction with a specific surface biomarker, which triggered internalization of the aptamer-reporter and, subsequently, into cell lysosomes. Rapid lysosomal degradation of the aptamer-reporter resulted in separation of the paired fluorochrome-quencher molecules. The released fluorochrome emitted bright fluorescent signals exclusively within the targeted cancer cells, with no background noise in the assay. Thus, the assays could be completed in a single step within minutes. By using this one-step assay, CTCs in whole blood and marrow aspirate samples of patients with lymphoma tumors were selectively highlighted and rapidly detected with no off-target signals from background blood cells. The development of the cancer cell-activatable aptamer-reporter system allows for the possibility of a simple and robust point-of-care test for CTC detection, which is currently unavailable.

  1. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

    Science.gov (United States)

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

    2013-07-01

    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

  2. Label-free aptamer biosensor for selective detection of thrombin

    Energy Technology Data Exchange (ETDEWEB)

    Na, Weidan; Liu, Xiaotong; Wang, Lei; Su, Xingguang, E-mail: suxg@jlu.edu.cn

    2015-10-29

    We fabricated a novel fluorescence biosensor for the selective detection of thrombin by using bovine serum albumin-capped CdS quantum dots (BSA-CdS QDs). Two kinds of designed DNA (DNA1 and DNA2) could bind to CdS QDs through the electrostatic interaction between DNA and Cd{sup 2+} on the surface of CdS QDs. The obtained DNA/BSA-CdS QDs kept stable in the solution with the fluorescence intensity obviously enhanced. Hairpin structure of DNA1contained two domains, one is the aptamer sequence of thrombin and the other is the complementary sequence of DNA2. When thrombin was added, it would bind to DNA1 and induce the hairpin structure of DNA1 changed into G-quadplex structure. Meanwhile, DNA2 would transfer from the surface of CdS QDs to DNA1 via hybridization, which resulted in the removal of DNA1 and DNA2 from the surface of CdS QDs, and led to the fluorescence intensity of CdS QDs reduced. Thus, the determination of thrombin could be achieved by monitoring the change of the fluorescence intensity of CdS QDs. The present method is simple and fast, and exhibits good selectivity for thrombin over other proteins. We have successfully detected thrombin in human serum samples with satisfactory results. - Highlights: • A novel strategy for the detection of thrombin was established based on BSA-CdS QDs. • DNA could serve as the co-ligands to stabilize CdS QDs and enhance the fluorescence intensity. • Thrombin could change the structure of DNA1 and quench the fluorescence of CdS QDs. • Thrombin in real sample was detected with satisfactory results.

  3. Targeted Delivery of Auristatin-Modified Toxins to Pancreatic Cancer Using Aptamers

    Directory of Open Access Journals (Sweden)

    Christina Kratschmer

    2018-03-01

    Full Text Available Pancreatic cancer is one of the most lethal malignancies. Treatment with the first-line agent, gemcitabine, is often unsuccessful because it, like other traditional chemotherapeutic agents, is non-specific, resulting in off-target effects that necessitate administration of subcurative doses. Alternatively, monomethyl auristatin E (MMAE and monomethyl auristatin F (MMAF are highly toxic small molecules that require ligand-targeted delivery. MMAE has already received FDA approval as a component of an anti-CD30 antibody-drug conjugate, brentuximab vedotin. However, in contrast to antibodies, aptamers have distinct advantages. They are chemicals, which allows them to be produced synthetically and facilitates the rapid development of diagnostics and therapeutics with clinical applicability. In addition, their small size allows for enhanced tissue distribution and rapid systemic clearance. Here, we assayed the toxicity of MMAE and MMAF conjugated to an anti-transferrin receptor aptamer, Waz, and an anti-epidermal growth factor receptor aptamer, E07, on the pancreatic cancer cell lines Panc-1, MIA PaCa-2, and BxPC3. In vitro, our results indicate that these aptamers are a viable option for the targeted delivery of toxic payloads to pancreatic cancer cells.

  4. Aptamer-Based Molecular Recognition of Lysergamine, Metergoline and Small Ergot Alkaloids

    Directory of Open Access Journals (Sweden)

    Johan Robbens

    2012-12-01

    Full Text Available Ergot alkaloids are mycotoxins produced by fungi of the genus Claviceps, which infect cereal crops and grasses. The uptake of ergot alkaloid contaminated cereal products can be lethal to humans and animals. For food safety assessment, analytical techniques are currently used to determine the presence of ergot alkaloids in food and feed samples. However, the number of samples which can be analyzed is limited, due to the cost of the equipment and the need for skilled personnel. In order to compensate for the lack of rapid tests for the detection of ergot alkaloids, the aim of this study was to develop a specific recognition element for ergot alkaloids, which could be further applied to produce a colorimetric reaction in the presence of these toxins. As recognition elements, single-stranded DNA ligands were selected by using an iterative selection procedure named SELEX, i.e., Systematic Evolution of Ligands by EXponential enrichment. After several selection cycles, the resulting aptamers were cloned and sequenced. A surface plasmon resonance analysis enabled determination of the dissociation constants of the complexes of aptamers and lysergamine. Dissociation constants in the nanomolar range were obtained with three selected aptamers. One of the selected aptamers, having a dissociation constant of 44 nM, was linked to gold nanoparticles and it was possible to produce a colorimetric reaction in the presence of lysergamine. This system could also be applied to small ergot alkaloids in an ergot contaminated flour sample.

  5. Building an aptamer/graphene oxide FRET biosensor for one-step detection of bisphenol A.

    Science.gov (United States)

    Zhu, Yingyue; Cai, Yilin; Xu, Liguang; Zheng, Lixue; Wang, Limei; Qi, Bin; Xu, Chuanlai

    2015-04-15

    Bisphenol A (BPA) is an important industrial chemical for polycarbonate (PC) and epoxy resins in paper and plastic industries. In our work, a kind of new method for detection of BPA was designed based on graphene oxide and anti-BPA aptamer. The graphene oxide can specifically adsorb and quench the fluorescence of fluorescently modified ssDNA probes. Meanwhile, the BPA can combine with anti-BPA optamer and switch its configuration to prevent the aptamer from adsorbing on the surface of graphene oxide (GO). Under different concentrations of BPA, based on the target-induced conformational change of anti-BPA aptamer and the interactions between the fluorescently modified anti-BPA aptamer (FAM-ssDNA) and GO, the experimental results show that the intensity of the fluorescence signal was changed. A low limit of detection of 0.05 ng/mL was obtained in the range 0.1-10 ng/mL. In addition, the specificity was outstanding among analogues of BPA. The recovery rate in actual water samples spiked with BPA can be 96.0% to 104.5%. The developed method was successfully used to determine BPA in actual water samples.

  6. Peptide aptamers: The versatile role of specific protein function inhibitors in plant biotechnology.

    Science.gov (United States)

    Colombo, Monica; Mizzotti, Chiara; Masiero, Simona; Kater, Martin M; Pesaresi, Paolo

    2015-11-01

    In recent years, peptide aptamers have emerged as novel molecular tools that have attracted the attention of researchers in various fields of basic and applied science, ranging from medicine to analytical chemistry. These artificial short peptides are able to specifically bind, track, and inhibit a given target molecule with high affinity, even molecules with poor immunogenicity or high toxicity, and represent a remarkable alternative to antibodies in many different applications. Their use is on the rise, driven mainly by the medical and pharmaceutical sector. Here we discuss the enormous potential of peptide aptamers in both basic and applied aspects of plant biotechnology and food safety. The different peptide aptamer selection methods available both in vivo and in vitro are introduced, and the most important possible applications in plant biotechnology are illustrated. In particular, we discuss the generation of broad-based virus resistance in crops, "reverse genetics" and aptasensors in bioassays for detecting contaminations in food and feed. Furthermore, we suggest an alternative to the transfer of peptide aptamers into plant cells via genetic transformation, based on the use of cell-penetrating peptides that overcome the limits imposed by both crop transformation and Genetically Modified Organism commercialization. © 2015 Institute of Botany, Chinese Academy of Sciences.

  7. Selection and application of strand displacement probes for a fumonisin B1 aptamer

    Science.gov (United States)

    Fumonisin B1 (FB1) is a toxin produced by Fusarium moniliforme, mainly on contaminated maize and maize products. In this study a solid surface chain displacement strategy was used to isolate oligonucleotide displacement probes for a FB1 aptamer. The probes were used as the basis for the development ...

  8. Homogeneous electrochemical aptamer-based ATP assay with signal amplification by exonuclease III assisted target recycling.

    Science.gov (United States)

    Liu, Shufeng; Wang, Ying; Zhang, Chengxin; Lin, Ying; Li, Feng

    2013-03-21

    A novel and homogeneous electrochemical aptamer-based adenosine triphosphate (ATP) assay was demonstrated with signal amplification by exonuclease III-assisted target recycling. A superior detection limit of 1 nM toward ATP with an excellent selectivity could be achieved.

  9. Specific detection of oxytetracycline using DNA aptamer-immobilized interdigitated array electrode chip

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Yeon Seok; Niazi, Javed H [School of Life Sciences and Biotechnology, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-701 (Korea, Republic of); Gu, Man Bock [School of Life Sciences and Biotechnology, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-701 (Korea, Republic of)], E-mail: mbgu@korea.ac.kr

    2009-02-23

    An electrochemical sensing system for oxytetracycline (OTC) detection was developed using ssDNA aptamer immobilized on gold interdigitated array (IDA) electrode chip. A highly specific ssDNA aptamer that bind to OTC with high affinity was employed to discriminate other tetracyclines (TCs), such as doxycycline (DOX) and tetracycline (TET). The immobilized thiol-modified aptamer on gold electrode chip served as a biorecognition element for the target molecules and the electrochemical signals generated from interactions between the aptamers and the target molecules was evaluated by cyclic voltammetry (CV) and square wave voltammetry (SWV). The current decrease due to the interference of bound OTC, DOX or TET was analyzed with the electron flow produced by a redox reaction between ferro- and ferricyanide. The specificity of developed EC-biosensor for OTC was highly distinguishable from the structurally similar antibiotics (DOX and TET). The dynamic range was determined to be 1-100 nM of OTC concentration in semi-logarithmic coordinates.

  10. Specific detection of oxytetracycline using DNA aptamer-immobilized interdigitated array electrode chip

    International Nuclear Information System (INIS)

    Kim, Yeon Seok; Niazi, Javed H.; Gu, Man Bock

    2009-01-01

    An electrochemical sensing system for oxytetracycline (OTC) detection was developed using ssDNA aptamer immobilized on gold interdigitated array (IDA) electrode chip. A highly specific ssDNA aptamer that bind to OTC with high affinity was employed to discriminate other tetracyclines (TCs), such as doxycycline (DOX) and tetracycline (TET). The immobilized thiol-modified aptamer on gold electrode chip served as a biorecognition element for the target molecules and the electrochemical signals generated from interactions between the aptamers and the target molecules was evaluated by cyclic voltammetry (CV) and square wave voltammetry (SWV). The current decrease due to the interference of bound OTC, DOX or TET was analyzed with the electron flow produced by a redox reaction between ferro- and ferricyanide. The specificity of developed EC-biosensor for OTC was highly distinguishable from the structurally similar antibiotics (DOX and TET). The dynamic range was determined to be 1-100 nM of OTC concentration in semi-logarithmic coordinates

  11. Potential Diagnostic and Therapeutic Applications of Oligonucleotide Aptamers in Breast Cancer.

    Science.gov (United States)

    Wu, Xiaoqiu; Shaikh, Atik Badshah; Yu, Yuanyuan; Li, Yongshu; Ni, Shuaijian; Lu, Aiping; Zhang, Ge

    2017-08-25

    Breast cancer is one of the most common causes of cancer related deaths in women. Currently, with the development of early detection, increased social awareness and kinds of treatment options, survival rate has improved in nearly every type of breast cancer patients. However, about one third patients still have increased chances of recurrence within five years and the five-year relative survival rate in patients with metastasis is less than 30%. Breast cancer contains multiple subtypes. Each subtype could cause distinct clinical outcomes and systemic interventions. Thereby, new targeted therapies are of particular importance to solve this major clinical problem. Aptamers, often termed "chemical antibodies", are functionally similar to antibodies and have demonstrated their superiority of recognizing target with high selectivity, affinity and stability. With these intrinsic properties, aptamers have been widely studied in cancer biology and some are in clinical trials. In this review, we will firstly discuss about the global impacts and mechanisms of breast cancer, then briefly highlight applications of aptamers that have been developed for breast cancer and finally summarize various challenges in clinical translation of aptamers.

  12. Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin.

    Science.gov (United States)

    Gao, Shunxiang; Zheng, Xin; Hu, Bo; Sun, Mingjuan; Wu, Jihong; Jiao, Binghua; Wang, Lianghua

    2017-03-15

    In this study, we coupled biolayer interferometry (BLI) with competitive binding assay through an enzyme-linked aptamer and developed a real-time, ultra-sensitive, rapid quantitative method for detection of the marine biotoxin palytoxin. Horseradish peroxidase-labeled aptamers were used as biorecognition receptors to competitively bind with palytoxin, which was immobilized on the biosensor surface. The palytoxin: horseradish peroxidase-aptamer complex was then submerged in a 3,3'-diaminobenzidine solution, which resulted in formation of a precipitated polymeric product directly on the biosensor surface and a large change in the optical thickness of the biosensor layer. This change could obviously shift the interference pattern and generate a response profile on the BLI biosensor. The biosensor showed a broad linear range for palytoxin (200-700pg/mL) with a low detection limit (0.04pg/mL). Moreover, the biosensor was applied to the detection of palytoxin in spiked extracts and showed a high degree of selectivity for palytoxin, good reproducibility, and stability. This enzyme-linked, aptamer-based, competitive BLI biosensor offers a promising method for rapid and sensitive detection of palytoxin and other analytes. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Novel MUC1 aptamer selectively delivers cytotoxic agent to cancer cells in vitro.

    Directory of Open Access Journals (Sweden)

    Yan Hu

    Full Text Available Chemotherapy is a primary treatment for cancer, but its efficacy is often limited by the adverse effects of cytotoxic agents. Targeted drug delivery may reduce the non-specific toxicity of chemotherapy by selectively directing anticancer drugs to tumor cells. MUC1 protein is an attractive target for tumor-specific drug delivery owning to its overexpression in most adenocarcinomas. In this study, a novel MUC1 aptamer is exploited as the targeting ligand for carrying doxorubicin (Dox to cancer cells. We developed an 86-base DNA aptamer (MA3 that bound to a peptide epitope of MUC1 with a K(d of 38.3 nM and minimal cross reactivity to albumin. Using A549 lung cancer and MCF-7 breast cancer cells as MUC1-expressing models, MA3 was found to preferentially bind to MUC1-positive but not MUC1-negative cells. An aptamer-doxorubicin complex (Apt-Dox was formulated by intercalating doxorubicin into the DNA structure of MA3. Apt-Dox was found capable of carrying doxorubicin into MUC1-positive tumor cells, while significantly reducing the drug intake by MUC1-negative cells. Moreover, Apt-Dox retained the efficacy of doxorubicin against MUC1-positive tumor cells, but lowered the toxicity to MUC1-negative cells (P<0.01. The results suggest that the MUC1 aptamer may have potential utility as a targeting ligand for selective delivery of cytotoxic agent to MUC1-expressing tumors.

  14. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  15. Visual Impairment

    Science.gov (United States)

    ... site Sitio para adolescentes Body Mind Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español Visual Impairment KidsHealth / For Teens / Visual Impairment What's in ...

  16. Optical Aptamer Probes of Fluorescent Imaging to Rapid Monitoring of Circulating Tumor Cell

    Directory of Open Access Journals (Sweden)

    Ji Yeon Hwang

    2016-11-01

    Full Text Available Fluorescence detecting of exogenous EpCAM (epithelial cell adhesion molecule or muc1 (mucin1 expression correlated to cancer metastasis using nanoparticles provides pivotal information on CTC (circulating tumor cell occurrence in a noninvasive tool. In this study, we study a new skill to detect extracellular EpCAM/muc1 using quantum dot-based aptamer beacon (QD-EpCAM/muc1 ALB (aptamer linker beacon. The QD-EpCAM/muc1 ALB was designed using QDs (quantum dots and probe. The EpCAM/muc1-targeting aptamer contains a Ep-CAM/muc1 binding sequence and BHQ1 (black hole quencher 1 or BHQ2 (black hole quencher2. In the absence of target EpCAM/muc1, the QD-EpCAM/muc1 ALB forms a partial duplex loop-like aptamer beacon and remained in quenched state because the BHQ1/2 quenches the fluorescence signal-on of the QD-EpCAM/muc1 ALB. The binding of EpCAM/muc1 of CTC to the EpCAM/muc1 binding aptamer sequence of the EpCAM/muc1-targeting oligonucleotide triggered the dissociation of the BHQ1/2 quencher and subsequent signal-on of a green/red fluorescence signal. Furthermore, acute inflammation was stimulated by trigger such as caerulein in vivo, which resulted in increased fluorescent signal of the cy5.5-EpCAM/muc1 ALB during cancer metastasis due to exogenous expression of EpCAM/muc1 in Panc02-implanted mouse model.

  17. "DNA Origami Traffic Lights" with a Split Aptamer Sensor for a Bicolor Fluorescence Readout.

    Science.gov (United States)

    Walter, Heidi-Kristin; Bauer, Jens; Steinmeyer, Jeannine; Kuzuya, Akinori; Niemeyer, Christof M; Wagenknecht, Hans-Achim

    2017-04-12

    A split aptamer for adenosine triphosphate (ATP) was embedded as a recognition unit into two levers of a nanomechanical DNA origami construct by extension and modification of selected staple strands. An additional optical module in the stem of the split aptamer comprised two different cyanine-styryl dyes that underwent an energy transfer from green (donor) to red (acceptor) emission if two ATP molecules were bound as target molecule to the recognition module and thereby brought the dyes in close proximity. As a result, the ATP as a target triggered the DNA origami shape transition and yielded a fluorescence color change from green to red as readout. Conventional atomic force microscopy (AFM) images confirmed the topology change from the open form of the DNA origami in the absence of ATP into the closed form in the presence of the target molecule. The obtained closed/open ratios in the absence and presence of target molecules tracked well with the fluorescence color ratios and thereby validated the bicolor fluorescence readout. The correct positioning of the split aptamer as the functional unit farthest away from the fulcrum of the DNA origami was crucial for the aptasensing by fluorescence readout. The fluorescence color change allowed additionally to follow the topology change of the DNA origami aptasensor in real time in solution. The concepts of fluorescence energy transfer for bicolor readout in a split aptamer in solution, and AFM on surfaces, were successfully combined in a single DNA origami construct to obtain a bimodal readout. These results are important for future custom DNA devices for chemical-biological and bioanalytical purposes because they are not only working as simple aptamers but are also visible by AFM on the single-molecule level.

  18. Scintigraphic images of bacterial infection using aptamers directly labeled with {sup 99m}Tc

    Energy Technology Data Exchange (ETDEWEB)

    Santos, S.R.; Correa, C.R.; Andrade, A.S.R., E-mail: sararoberta7@hotmail.com, E-mail: crisrcorrea@gmail.com, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, A.L.B.; Diniz, S.O.F.; Cardoso, V.N., E-mail: brancodebarros@yahoo.com.br, E-mail: valbertcardoso@yahoo.com.br, E-mail: simoneodilia@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas

    2015-07-01

    Staphylococcus aureus is specie of great medical importance and is the most commonly agent found in infections of soft tissues, bone infections and bone prostheses. In this study, aptamers selected to S. aureus were labeled by the direct method with {sup 99m}Tc and used for bacterial infection identification by scintigraphy. The radiolabeled aptamers radiochemical purity and stability were assessed by thin-layer chromatography (TLC). Three groups of Swiss mice (n=6) were used for the scintigraphic imaging studies. The first group was infected intramuscularly in the right thigh with S. aureus, the second group with C. albicans and the third group received zymosan to induce aseptic inflammation. After 24 h, radiolabeled aptamers (18 MBq) were injected by the tail vein. Scintigraphic images were acquired at 1 h and 4 h postinjection. The radiolabeling yield with {sup 99m}Tc was over 90%. The radiolabeled aptamers were stable in 0.9% saline, plasma and cysteine excess. The scintigraphic image profiles showed high uptake in the kidneys and bladder in all groups, indicating a main renal excretion consistent with the hydrophilic nature of the molecule. No accumulation of radioactivity was observed in the thyroid, stomach, liver and spleen, indicating acceptable levels of radiochemical impurities. The group infected with S. aureus showed a visible uptake in the infected right thigh at 1 h post-injection. For the control groups (C. albicans and zymosan) visible differences between the right and left thighs were not observed. The radiolabeled aptamers were able to distinguish aseptic inflammation from bacterial infection and bacterial from fungal infection. (author)

  19. Scintigraphic images of bacterial infection using aptamers directly labeled with 99mTc

    International Nuclear Information System (INIS)

    Santos, S.R.; Correa, C.R.; Andrade, A.S.R.; Barros, A.L.B.; Diniz, S.O.F.; Cardoso, V.N.

    2015-01-01

    Staphylococcus aureus is specie of great medical importance and is the most commonly agent found in infections of soft tissues, bone infections and bone prostheses. In this study, aptamers selected to S. aureus were labeled by the direct method with 99m Tc and used for bacterial infection identification by scintigraphy. The radiolabeled aptamers radiochemical purity and stability were assessed by thin-layer chromatography (TLC). Three groups of Swiss mice (n=6) were used for the scintigraphic imaging studies. The first group was infected intramuscularly in the right thigh with S. aureus, the second group with C. albicans and the third group received zymosan to induce aseptic inflammation. After 24 h, radiolabeled aptamers (18 MBq) were injected by the tail vein. Scintigraphic images were acquired at 1 h and 4 h postinjection. The radiolabeling yield with 99m Tc was over 90%. The radiolabeled aptamers were stable in 0.9% saline, plasma and cysteine excess. The scintigraphic image profiles showed high uptake in the kidneys and bladder in all groups, indicating a main renal excretion consistent with the hydrophilic nature of the molecule. No accumulation of radioactivity was observed in the thyroid, stomach, liver and spleen, indicating acceptable levels of radiochemical impurities. The group infected with S. aureus showed a visible uptake in the infected right thigh at 1 h post-injection. For the control groups (C. albicans and zymosan) visible differences between the right and left thighs were not observed. The radiolabeled aptamers were able to distinguish aseptic inflammation from bacterial infection and bacterial from fungal infection. (author)

  20. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    Science.gov (United States)

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Cation Coordination Alters the Conformation of a Thrombin-Binding G-Quadruplex DNA Aptamer That Affects Inhibition of Thrombin.

    Science.gov (United States)

    Zavyalova, Elena; Tagiltsev, Grigory; Reshetnikov, Roman; Arutyunyan, Alexander; Kopylov, Alexey

    2016-10-01

    Thrombin-binding aptamers are promising anticoagulants. HD1 is a monomolecular antiparallel G-quadruplex with two G-quartets linked by three loops. Aptamer-thrombin interactions are mediated with two TT-loops that bind thrombin exosite I. Several cations were shown to be coordinated inside the G-quadruplex, including K + , Na + , NH 4 + , Ba 2+ , and Sr 2+ ; on the contrary, Mn 2+ was coordinated in the grooves, outside the G-quadruplex. K + or Na + coordination provides aptamer functional activity. The effect of other cations on aptamer functional activity has not yet been described, because of a lack of relevant tests. Interactions between aptamer HD1 and a series of cations were studied. A previously developed enzymatic method was applied to evaluate aptamer inhibitory activity. The structure-function correlation was studied using the characterization of G-quadruplex conformation by circular dichroism spectroscopy. K + coordination provided the well-known high inhibitory activity of the aptamer, whereas Na + coordination supported low activity. Although NH 4 + coordination yielded a typical antiparallel G-quadruplex, no inhibitory activity was shown; a similar effect was observed for Ba 2+ and Sr 2+ coordination. Mn 2+ coordination destabilized the G-quadruplex that drastically diminished aptamer inhibitory activity. Therefore, G-quadruplex existence per se is insufficient for aptamer inhibitory activity. To elicit the nature of these effects, we thoroughly analyzed nuclear magnetic resonance (NMR) and X-ray data on the structure of the HD1 G-quadruplex with various cations. The most reasonable explanation is that cation coordination changes the conformation of TT-loops, affecting thrombin binding and inhibition. HD1 counterparts, aptamers 31-TBA and NU172, behaved similarly with some distinctions. In 31-TBA, an additional duplex module stabilized antiparallel G-quadruplex conformation at high concentrations of divalent cations; whereas in NU172, a different

  2. A DUAL PLATFORM FOR SELECTIVE ANALYTE ENRICHMENT AND IONIZATION IN MASS SPECTROMETRY USING APTAMER-CONJUGATED GRAPHENE OXIDE

    OpenAIRE

    Gulbakan, Basri; Yasun, Emir; Shukoor, M. Ibrahim; Zhu, Zhi; You, Mingxu; Tan, Xiaohong; Sanchez, Hernan; Powell, David H.; Dai, Hongjie; Tan, Weihong

    2010-01-01

    This study demonstrates the use of aptamer-conjugated graphene oxide as an affinity extraction and detection platform for analytes from complex biological media. We have shown that cocaine and adenosine can be selectively enriched from plasma samples and that direct mass spectrometric readout can be obtained without a matrix and with greatly improved signal-to-noise ratios. The aptamer conjugated graphene oxide has clear advantages in target enrichment and in generating highly efficient ioniz...

  3. Generation of a pair of independently binding DNA aptamers in a single round of selection using proximity ligation.

    Science.gov (United States)

    Chumphukam, O; Le, T T; Piletsky, S; Cass, A E G

    2015-05-28

    The ability to rapidly generate a pair of aptamers that bind independently to a protein target would greatly extend their use as reagents for two site ('sandwich') assays. We describe here a method to achieve this through proximity ligation. Using lysozyme as a target we demonstrate that under optimal conditions such a pair of aptamers, with nanomolar affinities, can be generated in a single round.

  4. A smart magnetic resonance imaging contrast agent responsive to adenosine based on a DNA aptamer-conjugated gadolinium complex.

    Science.gov (United States)

    Xu, Weichen; Lu, Yi

    2011-05-07

    We report a general strategy for developing a smart MRI contrast agent for the sensing of small molecules such as adenosine based on a DNA aptamer that is conjugated to a Gd compound and a protein streptavidin. The binding of adenosine to its aptamer results in the dissociation of the Gd compound from the large protein, leading to decreases in the rotational correlation time and thus change of MRI contrast. © The Royal Society of Chemistry 2011

  5. From Ugly Duckling to Swan: Unexpected Identification from Cell-SELEX of an Anti-Annexin A2 Aptamer Targeting Tumors

    Science.gov (United States)

    Cibiel, Agnes; Nguyen Quang, Nam; Gombert, Karine; Thézé, Benoit; Garofalakis, Anikitos; Ducongé, Frédéric

    2014-01-01

    Background Cell-SELEX is now widely used for the selection of aptamers against cell surface biomarkers. However, despite negative selection steps using mock cells, this method sometimes results in aptamers against undesirable targets that are expressed both on mock and targeted cells. Studying these junk aptamers might be useful for further applications than those originally envisaged. Methodology/Principal Findings Cell-SELEX was performed to identify aptamers against CHO-K1 cells expressing human Endothelin type B receptor (ETBR). CHO-K1 cells were used for negative selection of aptamers. Several aptamers were identified but no one could discriminate between both cell lines. We decided to study one of these aptamers, named ACE4, and we identified that it binds to the Annexin A2, a protein overexpressed in many cancers. Radioactive binding assays and flow cytometry demonstrated that the aptamer was able to bind several cancer cell lines from different origins, particularly the MCF-7 cells. Fluorescence microscopy revealed it could be completely internalized in cells in 2 hours. Finally, the tumor targeting of the aptamer was evaluated in vivo in nude mice xenograft with MCF-7 cells using fluorescence diffuse optical tomography (fDOT) imaging. Three hours after intravenous injection, the aptamer demonstrated a significantly higher uptake in the tumor compared to a scramble sequence. Conclusions/Significance Although aptamers could be selected during cell-SELEX against other targets than those initially intended, they represent a potential source of ligands for basic research, diagnoses and therapy. Here, studying such aptamers, we identify one with high affinity for Annexin A2 that could be a promising tool for biomedical application. PMID:24489826

  6. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A

    OpenAIRE

    Regina Stoltenburg; Beate Strehlitz

    2018-01-01

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aur...

  7. Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography.

    Science.gov (United States)

    Hedayati Ch, Mojtaba; Amani, Jafar; Sedighian, Hamid; Amin, Mohsen; Salimian, Jafar; Halabian, Raheleh; Imani Fooladi, Abbas Ali

    2016-09-01

    Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA-aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd  = 2.3 × 10(-11) ). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

    Science.gov (United States)

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

    2013-04-01

    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  9. The detection of platelet derived growth factor using decoupling of quencher-oligonucleotide from aptamer/quantum dot bioconjugates

    International Nuclear Information System (INIS)

    Kim, Gang-Il; Sung, Yun-Mo; Kim, Kyung-Woo; Oh, Min-Kyu

    2009-01-01

    High-sensitivity, high-specificity detection of platelet derived growth factor (PDGF)-BB was realized using the change in fluorescence resonance energy transfer (FRET) occurring between quantum dot (QD) donors and black hole quencher (BHQ) acceptors. CdSe/ZnS QD/mercaptoacetic acid (MAA)/PDGF aptamer bioconjugates were successfully synthesized using ligand exchange. Black hole quencher (BHQ)-bearing oligonucleotide molecules showing partial sequence matching to PDGF aptamer were attached to PDGF aptamers and photoluminescence (PL) quenching was obtained through FRET. By adding target PDGF-BB to the bioconjugates containing BHQs, PL recovery was detected due to detachment of BHQ-bearing oligonucleotide from the PDGF aptamer as a result of the difference in affinity to the PDGF aptamer. The detection limit of the sensor was ∼0.4 nM and the linearity was maintained up to 1.6 nM in the PL intensity versus concentration curve. Measurement of PL recovery was suggested as a strong tool for high-sensitivity detection of PDGF-BB. Epidermal growth factor (EGF), the negative control molecule, did not contribute to PL recovery due to lack of binding affinity to the PDGF aptamers, which demonstrates the selectivity of the biosensor.

  10. Antagonistic effect of disulfide-rich peptide aptamers selected by cDNA display on interleukin-6-dependent cell proliferation

    International Nuclear Information System (INIS)

    Nemoto, Naoto; Tsutsui, Chihiro; Yamaguchi, Junichi; Ueno, Shingo; Machida, Masayuki; Kobayashi, Toshikatsu; Sakai, Takafumi

    2012-01-01

    Highlights: ► Disulfide-rich peptide aptamer inhibits IL-6-dependent cell proliferation. ► Disulfide bond of peptide aptamer is essential for its affinity to IL-6R. ► Inhibitory effect of peptide depends on number and pattern of its disulfide bonds. -- Abstract: Several engineered protein scaffolds have been developed recently to circumvent particular disadvantages of antibodies such as their large size and complex composition, low stability, and high production costs. We previously identified peptide aptamers containing one or two disulfide-bonds as an alternative ligand to the interleukin-6 receptor (IL-6R). Peptide aptamers (32 amino acids in length) were screened from a random peptide library by in vitro peptide selection using the evolutionary molecular engineering method “cDNA display”. In this report, the antagonistic activity of the peptide aptamers were examined by an in vitro competition enzyme-linked immunosorbent assay (ELISA) and an IL-6-dependent cell proliferation assay. The results revealed that a disulfide-rich peptide aptamer inhibited IL-6-dependent cell proliferation with similar efficacy to an anti-IL-6R monoclonal antibody.

  11. A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

    Science.gov (United States)

    Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

    2016-03-05

    A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. The Effect of Aptamer Concetration towards Reduced Graphene Oxide-Field Effect Transistor Surface Channel for Biosensor Application

    Science.gov (United States)

    Syafiq Zainol Abidin, Azrul; Rahim, Ruslinda Abdul; Huan, Chow Yong; Maidin, Nur Nasyifa Mohd; Atiqah Ahmad, Nurul; Hashwan, Saeed S. Ba; Faudzi, Fatin Nabilah Mohd; Hong, Voon Chun

    2018-03-01

    Aptamer are artificially produce bioreceptor that has been developed to bind with various target biomolecules such as ion, cells, protein and small molecules. In this research, an aptamer concentration of 0.5 nM, 1 nM, 5 nM, 10 nM, and 50 nM were immobilized on reduced graphene oxide (rGO) integrated with field effect transistor (FET) respectively to study the effect of aptamer concentration toward rGO surface for stable biosensing platform. The 0.5 nM concentration of aptamer shows the highest current result of 84.3 µA at 1 V applied through the source and drain. After immobilized with aminated aptamer, the conductivity shows significant reduction due to the formation of amide bond on rGO surface between aminated aptamer and carboxyl group on rGO. The electrical performance of FET integrated with rGO shows stable electrical performance suitable to be used in the biosensing application.

  13. A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus.

    Science.gov (United States)

    Lian, Yan; He, Fengjiao; Wang, Huan; Tong, Feifei

    2015-03-15

    A novel aptamer/graphene interdigitated gold electrode piezoelectric sensor was developed for the rapid and specific detection of Staphylococcus aureus (S. aureus) by employing S. aureus aptamer as a biological recognition element. 4-Mercaptobenzene-diazonium tetrafluoroborate (MBDT) salt was used as a molecular cross-linking agent to chemically bind graphene to interdigital gold electrodes (IDE) that are connected to a series electrode piezoelectric quartz crystal (SPQC). S. aureus aptamers were assembly immobilized onto graphene via the π-π stacking of DNA bases. Due to the specific binding between S. aureus and aptamer, when S. aureus is present, the DNA bases interacted with the aptamer, thereby dropping the aptamer from the surface of the graphene. The electric parameters of the electrode surface was changed and resulted in the change of oscillator frequency of the SPQC. This detection was completed within 60min. The constructed sensor demonstrated a linear relationship between resonance frequency shifts with bacterial concentrations ranging from 4.1×10(1)-4.1×10(5)cfu/mL with a detection limit of 41cfu/mL. The developed strategy can detect S. aureus rapidly and specifically for clinical diagnosis and food testing. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. MicroRNA-targeted therapeutics for lung cancer treatment.

    Science.gov (United States)

    Xue, Jing; Yang, Jiali; Luo, Meihui; Cho, William C; Liu, Xiaoming

    2017-02-01

    Lung cancer is one of the leading causes of cancer-related mortality worldwide. MicroRNAs (miRNAs) are endogenous non-coding small RNAs that repress the expression of a broad array of target genes. Many efforts have been made to therapeutically target miRNAs in cancer treatments using miRNA mimics and miRNA antagonists. Areas covered: This article summarizes the recent findings with the role of miRNAs in lung cancer, and discusses the potential and challenges of developing miRNA-targeted therapeutics in this dreadful disease. Expert opinion: The development of miRNA-targeted therapeutics has become an important anti-cancer strategy. Results from both preclinical and clinical trials of microRNA replacement therapy have shown some promise in cancer treatment. However, some obstacles, including drug delivery, specificity, off-target effect, toxicity mediation, immunological activation and dosage determination should be addressed. Several delivery strategies have been employed, including naked oligonucleotides, liposomes, aptamer-conjugates, nanoparticles and viral vectors. However, delivery remains a main challenge in miRNA-targeting therapeutics. Furthermore, immune-related serious adverse events are also a concern, which indicates the complexity of miRNA-based therapy in clinical settings.

  15. Impaired Driving

    Science.gov (United States)

    ... Get the Facts What Works: Strategies to Increase Car Seat and Booster Seat ... narcotics. 3 That’s one percent of the 111 million self-reported episodes of alcohol-impaired driving among U.S. ...

  16. Aptamer-Based Analysis: A Promising Alternative for Food Safety Control

    Directory of Open Access Journals (Sweden)

    Sonia Amaya-González

    2013-11-01

    Full Text Available Ensuring food safety is nowadays a top priority of authorities and professional players in the food supply chain. One of the key challenges to determine the safety of food and guarantee a high level of consumer protection is the availability of fast, sensitive and reliable analytical methods to identify specific hazards associated to food before they become a health problem. The limitations of existing methods have encouraged the development of new technologies, among them biosensors. Success in biosensor design depends largely on the development of novel receptors with enhanced affinity to the target, while being stable and economical. Aptamers fulfill these characteristics, and thus have surfaced as promising alternatives to natural receptors. This Review describes analytical strategies developed so far using aptamers for the control of pathogens, allergens, adulterants, toxins and other forbidden contaminants to ensure food safety. The main progresses to date are presented, highlighting potential prospects for the future.

  17. Evaluation of aptamers labelled with 99mTc for identification of Staphylococcus aureus bacteria

    International Nuclear Information System (INIS)

    dos Santos, Sara Roberta

    2014-01-01

    Staphylococcus aureus is specie of great medical importance because it is often associated with many infections in humans. This bacterium can cause diseases ranging from simple infections to life-threatening infections such as endocarditis, pneumonia, meningitis, toxic shock syndrome, septicemia, osteomyelitis, among others. S. aureus is the most commonly agent found in infections of the skin and soft tissues, bone infections and bone prostheses. The difficulty in early detection of specific foci caused by bacteria has raised the need to search for new techniques for this purpose. Diagnosis by scintigraphy has advantages over other methods because it is able to identify damage tissues without the need of invasive procedures and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis of bacterial infections, since specific radiopharmaceuticals were developed. Aptamers are oligonucleotides that have high affinity and specificity for their molecular targets and are emerging as a new class of molecules for radiopharmaceuticals development. Radiolabeled aptamers specific to the infectious agents, could give a significant contribution to the infection diagnosis by scintigraphy. In this study, aptamers selected to S. aureus were labeled with 99m Tc and used for the bacteria identification in vitro and in vivo. The aptamers labeled with 32 P and incubated in vitro with S. aureus cells showed high affinity for the bacterial cells when compared with the library of oligonucleotides with random sequences used as control. The aptamers labeled with 99m Tc also showed affinity for S. aureus cells when compared with the library, but unspecific binding was also verified. The 99m Tc labelled aptamers were stable in 0.9% saline, plasma of Swiss mice and in excess of cysteine. The in vivo biodistribution studies using Swiss mice with intramuscular infection in the right thigh showed that the aptamers labeled

  18. Automated Enrichment of Sulfanilamide in Milk Matrices by Utilization of Aptamer-Linked Magnetic Particles.

    Science.gov (United States)

    Fischer, Christin; Kallinich, Constanze; Klockmann, Sven; Schrader, Jil; Fischer, Markus

    2016-12-07

    The present work demonstrates the first automated enrichment approach for antibiotics in milk using specific DNA aptamers. First, aptamers toward the antibiotic sulfanilamide were selected and characterized regarding their dissociation constants and specificity toward relevant antibiotics via fluorescence assay and LC-MS/MS detection. The performed enrichment was automated using the KingFisherDuo and compared to a manual approach. Verifying the functionality, trapping was realized in different milk matrices: (i) 0.3% fat milk, (ii) 1.5% fat milk, (iii) 3.5% fat milk, and (iv) 0.3% fat cocoa milk drink. Enrichment factors up to 8-fold could be achieved. Furthermore, it could be shown that novel implementation of a magnetic separator increases the reproducibility and reduces the hands-on time from approximately half a day to 30 min.

  19. Isolation of HL-60 cancer cells from the human serum sample using MnO2-PEI/Ni/Au/aptamer as a novel nanomotor and electrochemical determination of thereof by aptamer/gold nanoparticles-poly(3,4-ethylene dioxythiophene) modified GC electrode.

    Science.gov (United States)

    Amouzadeh Tabrizi, Mahmoud; Shamsipur, Mojtaba; Saber, Reza; Sarkar, Saeed

    2018-07-01

    Herein, aptamer-modified self-propelled nanomotors were used for transportation of human promyelocytic leukemia cells (HL-60) from a human serum sample. For this purpose, the fabricated manganese oxide nanosheets-polyethyleneimine decorated with nickel/gold nanoparticles (MnO 2 -PEI/Ni/Au) as nanomotors were added to a vial containing thiolated aptamer KH1C12 solution as a capture aptamer to attach to the gold nanoparticles on the surface of nanomotors covalently. The aptamer-modified self-propelled nanomotors (aptamer KH1C12 /nanomotors) were then separated by placing the vial in a magnetic stand. The aptamer-modified self-propelled nanomotors were rinsed three times with water to remove the non-attached aptamers. Then, the resulting aptamer KH1C12 /nanomotors were applied for the on-the-fly" transporting of HL-60 cancer cell from a human serum sample. To release of the captured HL-60 cancer cells, the complementary nucleotide sequences of KH1C12 aptamer solution (releasing aptamer) that has a with capture aptamer was added to phosphate buffer solution (1 M, pH 7.4) containing HL-60/aptamer KH1C12 /nanomotors. Because of the high affinity of capture aptamer to complementary nucleotide sequences of aptamer KH1C12 , the HL-60 cancer cells released on the surface of aptamer KH1C12 /nanomotors into the solution. The second goal of the present work was determining the concentration of HL-60 cancer cell in the human serum samples. The electrochemical impedance spectroscopy technique (EIS) was used for the determination of HL-60 cancer cell. The concentration of separated cancer cell was determined by aptamer/gold nanoparticles-poly(3,4-ethylene dioxythiophene) modified GC electrode (GC/PEDOT-Au nano /aptamer KH1C12 ). The proposed aptasensor exhibited a good response to the concentration of HL-60 cancer cells in the range of 2.5 × 10 1 to 5 × 10 5 cells mL -1 with a low limit of detection of 250 cells mL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Physical Impairment

    Science.gov (United States)

    Trewin, Shari

    Many health conditions can lead to physical impairments that impact computer and Web access. Musculoskeletal conditions such as arthritis and cumulative trauma disorders can make movement stiff and painful. Movement disorders such as tremor, Parkinsonism and dystonia affect the ability to control movement, or to prevent unwanted movements. Often, the same underlying health condition also has sensory or cognitive effects. People with dexterity impairments may use a standard keyboard and mouse, or any of a wide range of alternative input mechanisms. Examples are given of the diverse ways that specific dexterity impairments and input mechanisms affect the fundamental actions of Web browsing. As the Web becomes increasingly sophisticated, and physically demanding, new access features at the Web browser and page level will be necessary.

  1. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    Science.gov (United States)

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  2. Combining use of a panel of ssDNA aptamers in the detection of Staphylococcus aureus

    OpenAIRE

    Cao, Xiaoxiao; Li, Shaohua; Chen, Liucun; Ding, Hongmei; Xu, Hua; Huang, Yanping; Li, Jie; Liu, Nongle; Cao, Weihong; Zhu, Yanjun; Shen, Beifen; Shao, Ningsheng

    2009-01-01

    In this article, a panel of ssDNA aptamers specific to Staphylococcus aureus was obtained by a whole bacterium-based SELEX procedure and applied to probing S. aureus. After several rounds of selection with S. aureus as the target and Streptococcus and S. epidermidis as counter targets, the highly enriched oligonucleic acid pool was sequenced and then grouped under different families on the basis of the homology of the primary sequence and the similarity of the secondary structure. Eleven sequ...

  3. A label-free and high sensitive aptamer biosensor based on hyperbranched polyester microspheres for thrombin detection

    International Nuclear Information System (INIS)

    Sun, Chong; Han, Qiaorong; Wang, Daoying; Xu, Weimin; Wang, Weijuan; Zhao, Wenbo; Zhou, Min

    2014-01-01

    Highlights: • A label-free thrombin aptamer biosensor applied in whole blood has been developed. • The aptamer biosensor showed a wide detection range and a low detection limit. • The antibiofouling idea utilized for biosensor is significant for diagnostics. - Abstract: In this paper, we have synthesized hyperbranched polyester microspheres with carboxylic acid functional groups (HBPE-CA) and developed a label-free electrochemical aptamer biosensor using thrombin-binding aptamer (TBA) as receptor for the measurement of thrombin in whole blood. The indium tin oxide (ITO) electrode surface modified with HBPE-CA microspheres was grafted with TBA, which has excellent binding affinity and selectivity for thrombin. Binding of the thrombin at the modified ITO electrode surface greatly restrained access of electrons for a redox probe of [Fe(CN) 6 ] 3−/4− . Moreover, the aptamer biosensor could be used for detection of thrombin in whole blood, a wide detection range (10 fM–100 nM) and a detection limit on the order of 0.90 fM were demonstrated. Control experiments were also carried out by using bull serum albumin (BSA) and lysozyme in the absence of thrombin. The good stability and repeatability of this aptamer biosensor were also proved. We expect that this demonstration will lead to the development of highly sensitive label-free sensors based on aptamer with lower cost than current technology. The integration of the technologies, which include anticoagulant, sensor and nanoscience, will bring significant input to high-performance biosensors relevant to diagnostics and therapy of interest for human health

  4. Novel HER2 Aptamer Selectively Delivers Cytotoxic Drug to HER2-positive Breast Cancer Cells in Vitro

    Directory of Open Access Journals (Sweden)

    Liu Zhe

    2012-07-01

    Full Text Available Abstract Background Aptamer-based tumor targeted drug delivery system is a promising approach that may increase the efficacy of chemotherapy and reduce the related toxicity. HER2 protein is an attractive target for tumor-specific drug delivery because of its overexpression in multiple malignancies, including breast, gastric, ovarian, and lung cancers. Methods In this paper, we developed a new HER2 aptamer (HB5 by using systematic evolution of ligands by exponential enrichment technology (SELEX and exploited its role as a targeting ligand for delivering doxorubicin (Dox to breast cancer cells in vitro. Results The selected aptamer was an 86-nucleotide DNA molecule that bound to an epitope peptide of HER2 with a Kd of 18.9 nM. The aptamer also bound to the extracellular domain (ECD of HER2 protein with a Kdof 316 nM, and had minimal cross reactivity to albumin or trypsin. In addition, the aptamer was found to preferentially bind to HER2-positive but not HER2-negative breast cancer cells. An aptamer-doxorubicin complex (Apt-Dox was formulated by intercalating Dox into the DNA structure of HB5. The Apt-Dox complex could selectively deliver Dox to HER2-positive breast cancer cells while reducing the drug intake by HER2-negative cells in vitro. Moreover, Apt-Dox retained the cytotoxicity of Dox against HER2-positive breast cancer cells, but reduced the cytotoxicity to HER2-negative cells. Conclusions The results suggest that the selected HER2 aptamer may have application potentials in targeted therapy against HER2-positive breast cancer cells.

  5. A label-free and high sensitive aptamer biosensor based on hyperbranched polyester microspheres for thrombin detection

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Chong [Jiangsu Key Laboratory of Biofunctional Materials, Biomedical Functional Materials Collaborative Innovation Center, College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210023 (China); Institute of Agricultural Products Processing, Jiangsu Academy of Agricultural Sciences, Nanjing 210014 (China); Han, Qiaorong [Jiangsu Key Laboratory of Biofunctional Materials, Biomedical Functional Materials Collaborative Innovation Center, College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210023 (China); Wang, Daoying; Xu, Weimin [Institute of Agricultural Products Processing, Jiangsu Academy of Agricultural Sciences, Nanjing 210014 (China); Wang, Weijuan [Jiangsu Key Laboratory of Biofunctional Materials, Biomedical Functional Materials Collaborative Innovation Center, College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210023 (China); Zhao, Wenbo, E-mail: zhaowenbo@njnu.edu.cn [Jiangsu Key Laboratory of Biofunctional Materials, Biomedical Functional Materials Collaborative Innovation Center, College of Chemistry and Materials Science, Nanjing Normal University, Nanjing 210023 (China); Zhou, Min, E-mail: zhouminnju@126.com [Department of Vascular Surgery, the Affiliated Drum Tower Hospital of Nanjing University Medical School, Nanjing 210008 (China)

    2014-11-19

    Highlights: • A label-free thrombin aptamer biosensor applied in whole blood has been developed. • The aptamer biosensor showed a wide detection range and a low detection limit. • The antibiofouling idea utilized for biosensor is significant for diagnostics. - Abstract: In this paper, we have synthesized hyperbranched polyester microspheres with carboxylic acid functional groups (HBPE-CA) and developed a label-free electrochemical aptamer biosensor using thrombin-binding aptamer (TBA) as receptor for the measurement of thrombin in whole blood. The indium tin oxide (ITO) electrode surface modified with HBPE-CA microspheres was grafted with TBA, which has excellent binding affinity and selectivity for thrombin. Binding of the thrombin at the modified ITO electrode surface greatly restrained access of electrons for a redox probe of [Fe(CN){sub 6}]{sup 3−/4−}. Moreover, the aptamer biosensor could be used for detection of thrombin in whole blood, a wide detection range (10 fM–100 nM) and a detection limit on the order of 0.90 fM were demonstrated. Control experiments were also carried out by using bull serum albumin (BSA) and lysozyme in the absence of thrombin. The good stability and repeatability of this aptamer biosensor were also proved. We expect that this demonstration will lead to the development of highly sensitive label-free sensors based on aptamer with lower cost than current technology. The integration of the technologies, which include anticoagulant, sensor and nanoscience, will bring significant input to high-performance biosensors relevant to diagnostics and therapy of interest for human health.

  6. Synthetic mRNA devices that detect endogenous proteins and distinguish mammalian cells.

    Science.gov (United States)

    Kawasaki, Shunsuke; Fujita, Yoshihiko; Nagaike, Takashi; Tomita, Kozo; Saito, Hirohide

    2017-07-07

    Synthetic biology has great potential for future therapeutic applications including autonomous cell programming through the detection of protein signals and the production of desired outputs. Synthetic RNA devices are promising for this purpose. However, the number of available devices is limited due to the difficulty in the detection of endogenous proteins within a cell. Here, we show a strategy to construct synthetic mRNA devices that detect endogenous proteins in living cells, control translation and distinguish cell types. We engineered protein-binding aptamers that have increased stability in the secondary structures of their active conformation. The designed devices can efficiently respond to target proteins including human LIN28A and U1A proteins, while the original aptamers failed to do so. Moreover, mRNA delivery of an LIN28A-responsive device into human induced pluripotent stem cells (hiPSCs) revealed that we can distinguish living hiPSCs and differentiated cells by quantifying endogenous LIN28A protein expression level. Thus, our endogenous protein-driven RNA devices determine live-cell states and program mammalian cells based on intracellular protein information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Aptamers: A Promising Tool for Ochratoxin A Detection in Food Analysis

    Directory of Open Access Journals (Sweden)

    Akhtar Hayat

    2013-11-01

    Full Text Available The contamination of food and feed by mycotoxins has become an increasingly serious problem. Mycotoxins represent a major risk to human and animal health, as well as economics. Herein, we focus on Ochratoxin A (OTA, which is one of the most common mycotoxins contaminating feed and foodstuffs. OTA is a secondary metabolite produced by various Aspergillus and Penicillium strains. Upon ingestion, OTA has a number of acute and chronic toxic effects. It is nephrotoxic, teratogenic, immunosuppressive, and carcinogenic (group 2B. As a consequence, some regulatory limits have been introduced on the levels of OTA in several commodities. The toxic nature of OTA demands highly sensitive and selective monitoring techniques to protect human and animal health. As alternative to traditional analytical techniques, biochemical methods for OTA analysis have attained great interest in the last few decades. They are mainly based on the integration of antibodies or aptamers as biorecognition elements in sensing platforms. However, aptamers have gained more attention in affinity-based assays because of their high affinity, specificity, stability, and their easy chemical synthesis. In this brief review, we present an overview of aptamer-based assays and their applications in OTA purification and detection, appeared in the literature in the last five years.

  8. Breast cancer cells synchronous labeling and separation based on aptamer and fluorescence-magnetic silica nanoparticles

    Science.gov (United States)

    Wang, Qiu-Yue; Huang, Wei; Jiang, Xing-Lin; Kang, Yan-Jun

    2018-01-01

    In this work, an efficient method based on biotin-labeled aptamer and streptavidin-conjugated fluorescence-magnetic silica nanoprobes (FITC@Fe3O4@SiNPs-SA) has been established for human breast carcinoma MCF-7 cells synchronous labeling and separation. Carboxyl-modified fluorescence-magnetic silica nanoparticles (FITC@Fe3O4@SiNPs-COOH) were first synthesized using the Stöber method. Streptavidin (SA) was then conjugated to the surface of FITC@Fe3O4@SiNPs-COOH. The MCF-7 cell suspension was incubated with biotin-labeled MUC-1 aptamer. After centrifugation and washing, the cells were then treated with FITC@Fe3O4@SiNPs-SA. Afterwards, the mixtures were separated by a magnet. The cell-probe conjugates were then imaged using fluorescent microscopy. The results show that the MUC-1 aptamer could recognize and bind to the targeted cells with high affinity and specificity, indicating the prepared FITC@Fe3O4@SiNPs-SA with great photostability and superparamagnetism could be applied effectively in labeling and separation for MCF-7 cell in suspension synchronously. In addition, the feasibility of MCF-7 cells detection in peripheral blood was assessed. The results indicate that the method above is also applicable for cancer cells synchronous labeling and separation in complex biological system.

  9. DNA aptamer evolved by cell-SELEX for recognition of prostate cancer.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Wang

    Full Text Available Morbidity and mortality of prostate cancer (PCa have increased in recent years worldwide. Currently existing methods for diagnosis and treatment do not make the situation improve, especially for hormone refractory prostate cancer (HRPC. The lack of molecular probes for PCa hindered the early diagnosis of metastasis and accurate staging for PCa. In this work, we have developed a new aptamer probe Wy-5a against PCa cell line PC-3 by cell-SELEX technique. Wy-5a shows high specificity to the target cells with dissociation constants in the nanomolar range, and does not recognize other tested PCa cell lines and other tested tumor cell lines. The staining of clinical tissue sections with fluorescent dye labeled Wy-5a shows that sections from high risk group with metastasis exhibited stronger fluorescence and sections from Benign Prostatic Hyperplasia (BPH did not exhibit notable fluorescence, which suggests that aptamer Wy-5a may bind to protein related to the progression of PCa. The high affinity and specificity of Wy-5a makes this aptamer hold potential for application in diagnosis and target therapy of PCa.

  10. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  11. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  12. Competitive horseradish peroxidase-linked aptamer assay for sensitive detection of Aflatoxin B1.

    Science.gov (United States)

    Sun, Linlin; Zhao, Qiang

    2018-03-01

    Aflatoxin B1 (AFB1) is one of highly toxic mycotoxins and a known human carcinogen. The frequent contamination of AFB1 in food products and large health risk of AFB1 have raised global concerns. Sensitive detection of AFB1 is of vital importance and highly demanded. Herein, we reported a competitive horseradish peroxidase (HRP)-linked aptamer assay for AFB1, combining the advantages of aptamer for affinity binding and enzyme label for signal amplification. In this assay, free AFB1 in solution competed with a covalent conjugate of bovine serum albumin-AFB1 (BSA-AFB1) coated on the wells of microplate in binding to the HRP-labeled aptamer probe. HRP attached on BSA-AFB1 in the wells catalyzed the conversion of substrates into products, allowing the final detection of AFB1 through measurement of the generated products. When TMB (3,3',5,5'-tetramethylbenzidine dihydrochloride) was used as substrate, absorbance analysis of the product of enzyme reaction enabled the detection of AFB1 at 0.2nM. We further lowered the detection limit of AFB1 to 0.01nM through chemiluminescence analysis by using chemiluminescence substrate of HRP. This assay enabled the detection of AFB1 in complex sample matrix, such as diluted white wine and maize flour. This assay provides a simple, sensitive and rapid method for AFB1 determination. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Electrochemical aptasensor for highly sensitive determination of cocaine using a supramolecular aptamer and rolling circle amplification

    International Nuclear Information System (INIS)

    Shen, Bo; Yan, Yurong; Tang, Renkuan; Li, Yongguo; Li, Jianbo; Cheng, Wei; Ju, Huangxian; Ding, Shijia

    2015-01-01

    We report on a novel strategy for the electrochemical detection of cocaine. It is based on the use of a supramolecular aptamer, rolling circle amplification (RCA), and multiplex binding of a biotin-strepavidin system. The aptamer fragments were assembled to a supramolecular aptamer which, in the presence of cocaine, conjugates to streptavidin for anchoring of biotinylated circular DNA. This initiates RCA and enables sensitive electrochemical-enzymatic readout. A significant signal amplification was obtained by using streptavidin linked to alkaline phosphatase that binds to the remaining biotinylated detection probes and catalyzes the hydrolysis of the synthetic enzyme substrate α-naphthylphosphate. This dual amplification strategy tremendously increases the detection limit of the aptasensor. Under optimal conditions and using differential pulse voltammetry, cocaine can be detected in the concentration range between 2 and 500 nM with a detection limit as low as 1.3 nM (at S/N = 3). The method is specific and acceptably reproducible. It was successfully applied to the detection of cocaine in (spiked) urine samples. The data were in good agreement with those obtained by the GC-MS reference method. (author)

  14. Aptamer-conjugated and drug-loaded acoustic droplets for ultrasound theranosis.

    Science.gov (United States)

    Wang, Chung-Hsin; Kang, Shih-Tsung; Lee, Ya-Hsuan; Luo, Yun-Ling; Huang, Yu-Fen; Yeh, Chih-Kuang

    2012-02-01

    Tumor therapy requires multi-functional treatment strategies with specific targeting of therapeutics to reduce general toxicity and increase efficacy. In this study we fabricated and functionally tested aptamer-conjugated and doxorubicin (DOX)-loaded acoustic droplets comprising cores of liquid perfluoropentane compound and lipid-based shell materials. Conjugation of sgc8c aptamers provided the ability to specifically target CCRF-CEM cells for both imaging and therapy. High-intensity focused ultrasound (HIFU) was introduced to trigger targeted acoustic droplet vaporization (ADV) which resulted in both mechanical cancer cell destruction by inertial cavitation and chemical treatment through localized drug release. HIFU insonation showed a 56.8% decrease in cell viability with aptamer-conjugated droplets, representing a 4.5-fold increase in comparison to non-conjugated droplets. In addition, the fully-vaporized droplets resulted in the highest DOX uptake by cancer cells, compared to non-vaporized or partially vaporized droplets. Optical studies clearly illustrated the transient changes that occurred upon ADV of droplet-targeted CEM cells, and B-mode ultrasound imaging revealed contrast enhancement by ADV in ultrasound images. In conclusion, our fabricated droplets functioned as a hybrid chemical and mechanical strategy for the specific destruction of cancer cells upon ultrasound-mediated ADV, while simultaneously providing ultrasound imaging capability. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist.

    Science.gov (United States)

    Wang, Kaiyu; Wu, Dong; Chen, Zhuang; Zhang, Xianhui; Yang, Xiangyue; Yang, Chaoyong James; Lan, Xiaopeng

    2016-09-01

    Staphylococcal enterotoxin A (SEA) is an important component of Staphylococcus aureus pathogenesis. SEA induces T lymphocytes activation and proliferation, resulting in the release of a large number of inflammatory cytokines. Blocking the toxic cascade triggered by SEA may be an effective strategy for the treatment of SEA-induced diseases. Through a systematic evolution of ligands by exponential enrichment process, we obtained an aptamer (S3) that could bind SEA with both high affinity and specificity, with a Kd value 36.93 ± 7.29 nM (n = 3). This aptamer antagonist effectively inhibited SEA-mediated human peripheral blood mononuclear cells proliferation and inflammatory cytokines (IFN-γ, TNF-α, IL-2 and IL-6) secretion. Moreover, PEGylated S3 significantly reduced mortality in murine lethal toxic shock models established by lipopolysaccharide-potentiated SEA. Therefore, this novel aptamer antagonist has the potential to become a new strategy for treating S. aureus infections and SEA-induced diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    International Nuclear Information System (INIS)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

    2013-01-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  17. Artificially Expanded Genetic Information Systems for New Aptamer Technologies

    Directory of Open Access Journals (Sweden)

    Elisa Biondi

    2018-05-01

    Full Text Available Directed evolution was first applied to diverse libraries of DNA and RNA molecules a quarter century ago in the hope of gaining technology that would allow the creation of receptors, ligands, and catalysts on demand. Despite isolated successes, the outputs of this technology have been somewhat disappointing, perhaps because the four building blocks of standard DNA and RNA have too little functionality to have versatile binding properties, and offer too little information density to fold unambiguously. This review covers the recent literature that seeks to create an improved platform to support laboratory Darwinism, one based on an artificially expanded genetic information system (AEGIS that adds independently replicating nucleotide “letters” to the evolving “alphabet”.

  18. Colorimetric method for determination of bisphenol A based on aptamer-mediated aggregation of positively charged gold nanoparticles

    International Nuclear Information System (INIS)

    Xu, Jingyue; Li, Ying; Bie, Jiaxin; Guo, Jiajia; Luo, Yeli; Shen, Fei; Sun, Chunyan; Jiang, Wei

    2015-01-01

    A sensitive, specific and rapid colorimetric aptasensor for the determination of the plasticizer bisphenol A (BPA) was developed. It is based on the use of gold nanoparticles (AuNPs) that are positively charged due to the modification with cysteamine which is cationic at near-neutral pH values. If aptamers are added to such AuNPs, aggregation occurs due to electrostatic interactions between the negatively-charged aptamers and the positively-charged AuNPs. This results in a color change of the AuNPs from red to blue. If a sample containing BPA is added to the anti-BPA aptamers, the anti-BPA aptamers undergo folding via an induced-fit binding mechanism. This is accompanied by a conformational change, which prevents the aptamer-induced aggregation and color change of AuNPs. The effect was exploited to design a colorimetric assay for BPA. Under optimum conditions, the absorbance ratio of A 527 /A 680 is linearly proportional to the BPA concentration in the range from 35 to 140 ng∙mL −1 , with a detection limit of 0.11 ng∙mL −1 . The method has been successfully applied to the determination of BPA in spiked tap water and gave recoveries between 91 and 106 %. Data were in full accordance with results obtained from HPLC. This assay is selective, easily performed, and in our perception represents a promising alternative to existing methods for rapid quantification of BPA. (author)

  19. A label-free aptamer-fluorophore assembly for rapid and specific detection of cocaine in biofluids.

    Science.gov (United States)

    Roncancio, Daniel; Yu, Haixiang; Xu, Xiaowen; Wu, Shuo; Liu, Ran; Debord, Joshua; Lou, Xinhui; Xiao, Yi

    2014-11-18

    We report a rapid and specific aptamer-based method for one-step cocaine detection with minimal reagent requirements. The feasibility of aptamer-based detection has been demonstrated with sensors that operate via target-induced conformational change mechanisms, but these have generally exhibited limited target sensitivity. We have discovered that the cocaine-binding aptamer MNS-4.1 can also bind the fluorescent molecule 2-amino-5,6,7-trimethyl-1,8-naphthyridine (ATMND) and thereby quench its fluorescence. We subsequently introduced sequence changes into MNS-4.1 to engineer a new cocaine-binding aptamer (38-GC) that exhibits higher affinity to both ligands, with reduced background signal and increased signal gain. Using this aptamer, we have developed a new sensor platform that relies on the cocaine-mediated displacement of ATMND from 38-GC as a result of competitive binding. We demonstrate that our sensor can detect cocaine within seconds at concentrations as low as 200 nM, which is 50-fold lower than existing assays based on target-induced conformational change. More importantly, our assay achieves successful cocaine detection in body fluids, with a limit of detection of 10.4, 18.4, and 36 μM in undiluted saliva, urine, and serum samples, respectively.

  20. Target-responsive aptamer release from manganese dioxide nanosheets for electrochemical sensing of cocaine with target recycling amplification.

    Science.gov (United States)

    Chen, Zongbao; Lu, Minghua

    2016-11-01

    A novel electrochemical sensing platform based on manganese dioxide (MnO2) nanosheets was developed for sensitive screening of target cocaine with the signal amplification. Ferrocene-labeled cocaine aptamers were initially immobilized onto MnO2 nanosheets-modified screen-printed carbon electrode because of π-stacking interaction between nucleobases and nanosheets. The immobilized ferrocene-aptamer activated the electrical contact with the electrode, thereby resulting in the sensor circuit to switch on. Upon target cocaine introduction, the analyte reacted with the aptamer and caused the dissociation of ferrocene-aptamer from the electrode, thus giving rise to the detection circuit to switch off. The released aptamer was cleaved by DNase I with target recycling. Under optimal conditions, the decreasing percentage of the electronic signal relative to background current increased with the increasing cocaine concentration in the dynamic range of 0.1-20nM, and the detection limit was 32pM. The reproducibility, selectivity and method accuracy were acceptable. Importantly, this concept offers promise for rapid, simple, and cost-effective analysis of cocaine biological samples without the needs of sample separation and multiple washing steps. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Magnetic microparticle-based SELEX process for the identification of highly specific aptamers of heart marker--brain natriuretic peptide

    International Nuclear Information System (INIS)

    Wang, Ying; Cao, Jinxuan; Wu, Jingjing; Xue, Feng; Teng, Jun; Chen, Wei; Chen, Yinji; Lu, Chunxia

    2015-01-01

    The brain natriuretic peptide (BNP) is known to be an effective indicator of heart failure. It has been widely adopted as a parameter for the evaluation of heart function of cardiovascular and cerebrovascular diseases (CVDs). Current immune-recognition based methods for the detection of BNP are limited, to a certain extent, by the poor stability of the antibody and by high costs. The availability of an aptamer specific for BNP would greatly assist in the rapid and early diagnosis of CVDs. In order to screen for such an aptamer by the SELEX method, we have used magnetic microparticles (m-MPs) as the separation substrate for immobilization of target BNP. The use of m-MPs for rapid separation of combined aptamers enables bound oligonucleotides to be separated directly, quickly, and with high efficiency. After 14 rounds of selection, a panel of six aptamers against BNP was identified. Their dissociation constants range from 12.5 to 139 nM. The classical technique for conjugation of a target to m-MPs is known to be applicable to various fields, and we conclude that this m-MP-based SELEX process provides a general strategy for screening of specific aptamers against various analytes. (author)

  2. Screening and Identifying a Novel ssDNA Aptamer against Alpha-fetoprotein Using CE-SELEX

    Science.gov (United States)

    Dong, Lili; Tan, Qiwen; Ye, Wei; Liu, Dongli; Chen, Haifeng; Hu, Hongwei; Wen, Duo; Liu, Yang; Cao, Ya; Kang, Jingwu; Fan, Jia; Guo, Wei; Wu, Weizhong

    2015-01-01

    Alpha-fetoprotein (AFP) is a liver cancer associated protein and has long been utilized as a serum tumor biomarker of disease progression. AFP is usually detected in HCC patients by an antibody based system. Recently, however, aptamers generated from systematic evolution of ligands by exponential enrichment (SELEX) were reported to have an alternative potential in targeted imaging, diagnosis and therapy. In this study, AFP-bound ssDNA aptamers were screened and identified using capillary electrophoresis (CE) SELEX technology. After cloning, sequencing and motif analysis, we successfully confirmed an aptamer, named AP273, specifically targeting AFP. The aptamer could be used as a probe in AFP immunofluorescence imaging in HepG2, one AFP positive cancer cell line, but not in A549, an AFP negative cancer cell line. More interesting, the aptamer efficiently inhibited the migration and invasion of HCC cells after in vivo transfection. Motif analysis revealed that AP273 had several stable secondary motifs in its structure. Our results indicate that CE-SELEX technology is an efficient method to screen specific protein-bound ssDNA, and AP273 could be used as an agent in AFP-based staining, diagnosis and therapy, although more works are still needed. PMID:26497223

  3. A saxitoxin-binding aptamer with higher affinity and inhibitory activity optimized by rational site-directed mutagenesis and truncation.

    Science.gov (United States)

    Zheng, X; Hu, B; Gao, S X; Liu, D J; Sun, M J; Jiao, B H; Wang, L H

    2015-07-01

    Saxitoxin (STX), a member of the family of paralytic shellfish poisoning toxins, poses toxicological and ecotoxicological risks. To develop an analytical recognition element for STX, a DNA aptamer (APT(STX1)) was previously discovered via an iterative process known as Systematic Evolution of Ligands by Exponential Enrichment (SELEX) by Handy et al. Our study focused on generating an improved aptamer based on APT(STX1) through rational site-directed mutation and truncation. In this study, we generated the aptamer, M-30f, with a 30-fold higher affinity for STX compared with APT(STX1). The Kd value for M-30f was 133 nM, which was calculated by Bio-Layer Interferometry. After optimization, we detected and compared the interaction of STX with aptamers (APT(STX1) or M-30f) through several techniques (ELISA, cell bioassay, and mouse bioassay). Both aptamers' STX-binding ability was demonstrated in all three methods. Moreover, M-30f performs better than its parent sequence with higher suppressive activity against STX. As a molecular recognition element, M-30f has good prospects for practical application. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Development of a Biocompatible Layer-by-Layer Film System Using Aptamer Technology for Smart Material Applications

    Directory of Open Access Journals (Sweden)

    Amanda Foster

    2014-05-01

    Full Text Available Aptamers are short, single-stranded nucleic acids that fold into well-defined three dimensional (3D structures that allow for binding to a target molecule with affinities and specificities that can rival or in some cases exceed those of antibodies. The compatibility of aptamers with nanostructures such as thin films, in combination with their affinity, selectivity, and conformational changes upon target interaction, could set the foundation for the development of novel smart materials. In this study, the development of a biocompatible aptamer-polyelectrolyte film system was investigated using a layer-by-layer approach. Using fluorescence microscopy, we demonstrated the ability of the sulforhodamine B aptamer to bind its cognate target while sequestered in a chitosan-hyaluronan film matrix. Studies using Ultraviolet-visible (UV-Vis spectrophotometry also suggest that deposition conditions such as rinsing time and volume play a strong role in the internal film interactions and growth mechanisms of chitosan-hyaluronan films. The continued study and development of aptamer-functionalized thin films provides endless new opportunities for novel smart materials and has the potential to revolutionize the field of controlled release.

  5. Identification of Salmonella Typhimurium-specific DNA aptamers developed using whole-cell SELEX and FACS analysis.

    Science.gov (United States)

    Moon, Jihea; Kim, Giyoung; Lee, Sangdae; Park, Saetbyeol

    2013-11-01

    Conventional methods for detection of infective organisms, such as Salmonella, are complicated and require multiple steps, and the need for rapid detection has increased. Biosensors show great potential for rapid detection of pathogens. In turn, aptamers have great potential for biosensor assay development, given their small size, ease of synthesis and labeling, lack of immunogenicity, a lower cost of production than antibodies, and high target specificity. In this study, ssDNA aptamers specific to Salmonella Typhimurium were obtained by a whole bacterium-based systematic evolution of ligands by exponential enrichment (SELEX) procedure and applied to probing S. Typhimurium. After 10 rounds of selection with S. Typhimurium as the target and Salmonella Enteritidis, Escherichia coli and Staphylococcus aureus as counter targets, the highly enriched oligonucleic acid pool was sorted using flow cytometry. In total, 12 aptamer candidates from different families were sequenced and grouped. Fluorescent analysis demonstrated that aptamer C4 had particularly high binding affinity and selectivity; this aptamer was then further characterized. © 2013 Elsevier B.V. All rights reserved.

  6. Manufacturing of a novel double-function ssDNA aptamer for sensitive diagnosis and efficient neutralization of SEA.

    Science.gov (United States)

    Sedighian, Hamid; Halabian, Raheleh; Amani, Jafar; Heiat, Mohammad; Taheri, Ramezan Ali; Imani Fooladi, Abbas Ali

    2018-05-01

    Staphylococcal enterotoxin A (SEA) is an enterotoxin produced mainly by Staphylococcus aureus. In recent years, it has become the most prevalent compound for staphylococcal food poisoning (SFP) around the world. In this study, we isolate new dual-function single-stranded DNA (ssDNA) aptamers by using some new methods, such as the Taguchi method, by focusing on the detection and neutralization of SEA enterotoxin in food and clinical samples. For the asymmetric polymerase chain reaction (PCR) optimization of each round of systematic evolution of ligands by exponential enrichment (SELEX), we use Taguchi L9 orthogonal arrays, and the aptamer mobility shift assay (AMSA) is used for initial evaluation of the protein-DNA interactions on the last SELEX round. In our investigation the dissociation constant (K D ) value and the limit of detection (LOD) of the candidate aptamer were found to be 8.5 ± 0.91 of nM and 5 ng/ml using surface plasmon resonance (SPR). In the current study, the Taguchi and mobility shift assay methods were innovatively harnessed to improve the selection process and evaluate the protein-aptamer interactions. To the best of our knowledge, this is the first report on employing these two methods in aptamer technology especially against bacterial toxin. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Serum protein profiling using an aptamer array predicts clinical outcomes of stage IIA colon cancer: A leave-one-out crossvalidation

    Science.gov (United States)

    Huh, Jung Wook; Kim, Sung Chun; Sohn, Insuk; Jung, Sin-Ho; Kim, Hee Cheol

    2016-01-01

    Background In this study, we established and validated a model for predicting prognosis of stage IIA colon cancer patients based on expression profiles of aptamers in serum. Methods Bloods samples were collected from 227 consecutive patients with pathologic T3N0M0 (stage IIA) colon cancer. We incubated 1,149 serum molecule-binding aptamer pools of clinical significance with serum from patients to obtain aptamers bound to serum molecules, which were then amplified and marked. Oligonucleotide arrays were constructed with the base sequences of the 1,149 aptamers, and the marked products identified above were reacted with one another to produce profiles of the aptamers bound to serum molecules. These profiles were organized into low- and high-risk groups of colon cancer patients based on clinical information for the serum samples. Cox proportional hazards model and leave-one-out cross-validation (LOOCV) were used to evaluate predictive performance. Results During a median follow-up period of 5 years, 29 of the 227 patients (11.9%) experienced recurrence. There were 212 patients (93.4%) in the low-risk group and 15 patients (6.6%) in the high-risk group in our aptamer prognosis model. Postoperative recurrence significantly correlated with age and aptamer risk stratification (p = 0.046 and p = 0.001, respectively). In multivariate analysis, aptamer risk stratification (p recurrence. Disease-free survival curves calculated according to aptamer risk level predicted through a LOOCV procedure and age showed significant differences (p < 0.001 from permutations). Conclusion Aptamer risk stratification can be a valuable prognostic factor in stage II colon cancer patients. PMID:26908450

  8. Visual detection and microplate assay for Staphylococcus aureus based on aptamer recognition coupled to tyramine signal amplification

    International Nuclear Information System (INIS)

    Yuan, Jinglei; Li, Can; Ma, Xiaoyuan; Xia, Yu; Chen, Jie; Wang, Zhouping; Yu, Ye

    2014-01-01

    We have developed a specific method for the visual detection of Staphylococcus aureus based on aptamer recognition coupled to tyramine signal amplification technology. A biotinylated aptamer specific for S. aureus was immobilized on the surface of the wells of a microplate via biotin-avidin binding. Then, the target bacteria (S. aureus), the biotinylated-aptamer-streptavidin-HRP conjugates, biotinylated tyramine, hydrogen peroxide and streptavidin-HRP were successively placed in the wells of the microplate. After adding TMB reagent and stop solution, the intensity of the yellow reaction product can be visually inspected or measured with a plate reader. Under optimized conditions, there is a linear relationship between absorbance at 450 nm and the concentration of S. aureus in the 10 to 107 cfu mL −1 concentration range (with an R 2 of 0.9976). The limit of detection is 8 cfu mL −1 . (author)

  9. Aptamer-based isolation and subsequent imaging of mesenchymal stem cells in ischemic myocard by magnetic resonance imaging.

    Science.gov (United States)

    Schäfer, R; Wiskirchen, J; Guo, K; Neumann, B; Kehlbach, R; Pintaske, J; Voth, V; Walker, T; Scheule, A M; Greiner, T O; Hermanutz-Klein, U; Claussen, C D; Northoff, H; Ziemer, G; Wendel, H P

    2007-10-01

    Mesenchymal stem cells (MSC) seem to be a promising cell source for cellular cardiomyoplasty. We recently developed a new aptamer-based specific selection of MSC to provide "ready to transplant" cells directly after isolation. We evaluated MRI tracking of newly isolated and freshly transplanted MSC in the heart using one short ex vivo selection step combining specific aptamer-based isolation and labeling of the cells. Bone marrow (BM) was collected from healthy pigs. The animals were euthanized and the heart was placed in a perfusion model. During cold ischemia, immunomagnetic isolation of MSC from the BM by MSC-specific aptamers labeled with Dynabeads was performed within 2 h. For histological identification the cells were additionally stained with PKH26. Approx. 3 x 10(6) of the freshly aptamer-isolated cells were injected into the ramus interventricularis anterior (RIVA) and 5 x 10(5) cells were injected directly into myocardial tissue after damaging the respective area by freezing (cryo-scar). 3 x 10(6) of the aptamer-isolated cells were kept for further characterization (FACS and differentiation assays). 20 h after cell transplantation, MRI of the heart using a clinical 3.0 Tesla whole body scanner (Magnetom Trio, Siemens, Germany) was performed followed by histological examinations. The average yield of sorted cells from 120 ml BM was 7 x 10(6) cells. The cells were cultured and showed MSC-like properties. MRI showed reproducible artifacts within the RIVA-perfusion area and the cryo-scar with surprisingly excellent quality. The histological examination of the biopsies showed PKH26-positive cells within the areas which were positive in the MRI in contrast to the control biopsies. Immunomagnetic separation of MSC by specific aptamers linked to magnetic particles is feasible, effective and combines a specific separation and labeling technique to a "one stop shop" strategy.

  10. Double targeting and aptamer-assisted controlled release delivery of epirubicin to cancer cells by aptamers-based dendrimer in vitro and in vivo.

    Science.gov (United States)

    Taghdisi, Seyed Mohammad; Danesh, Noor Mohammad; Ramezani, Mohammad; Lavaee, Parirokh; Jalalian, Seyed Hamid; Robati, Rezvan Yazdian; Abnous, Khalil

    2016-05-01

    Clinical use of epirubicin (Epi) in the treatment of cancer has been limited, due to its cardiotoxicity. Targeted delivery of chemotherapeutic agents could increase their efficacy and reduce their off-target effects. High drug loading and excellent stability of DNA dendrimers make these DNA nanostructures unique candidates for biological applications. In this study a modified and promoted dendrimer using three kinds of aptamers (MUC1, AS1411 and ATP aptamers) was designed for targeted delivery of Epi and its efficacy was evaluated in target cells including MCF-7 cells (breast cancer cell) and C26 cells (murine colon carcinoma cell). Aptamers (Apts)-Dendrimer-Epi complex formation was analyzed by fluorometric analysis and gel retardation assay. Release profiles of Epi from the designed complex were assessed at pHs 5.4 and 7.4. For MTT assay (cytotoxic study) MCF-7 and C26 cells (target cells) and CHO cells (Chinese hamster ovary cell, nontarget) were treated with Epi, Apts-Dendrimer-Epi complex and Apts-Dendrimer conjugate. Internalization was evaluated using flow cytometry analysis. Finally, the developed complex was used for inhibition of tumor growth in vivo. 25μM Epi was efficiently intercalated to 1μM dendrimer. Epi was released from the Apts-Dendrimer-Epi complex in a pH-sensitive manner (more release at pH 5.5). The results of flow cytometry analysis indicated that the designed complex was efficiently internalized into target cells, but not into control cells. The internalization data were confirmed by the results of MTT assay. Apts-Dendrimer-Epi complex had less cytotoxicity in CHO cells compared to Epi alone. The complex had more cytotoxicity in C26 and MCF-7 cells compared to Epi alone. Moreover, the Apts-Dendrimer-Epi complex could efficiently prohibit tumor growth in vivo. In conclusion, the designed targeted drug delivery system inherited characteristics of pH-dependent drug release, high drug loading and tumor targeting in vitro and in vivo

  11. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  12. A dual platform for selective analyte enrichment and ionization in mass spectrometry using aptamer-conjugated graphene oxide.

    Science.gov (United States)

    Gulbakan, Basri; Yasun, Emir; Shukoor, M Ibrahim; Zhu, Zhi; You, Mingxu; Tan, Xiaohong; Sanchez, Hernan; Powell, David H; Dai, Hongjie; Tan, Weihong

    2010-12-15

    This study demonstrates the use of aptamer-conjugated graphene oxide as an affinity extraction and detection platform for analytes from complex biological media. We have shown that cocaine and adenosine can be selectively enriched from plasma samples and that direct mass spectrometric readouts can be obtained without a matrix and with greatly improved signal-to-noise ratios. Aptamer-conjugated graphene oxide has clear advantages in target enrichment and in generating highly efficient ionization of target molecules for mass spectrometry. These results demonstrate the utility of the approach for analysis of small molecules in real biological samples.

  13. Novel aptamer-linked nanoconjugate approach for detection of waterborne bacterial pathogens: an update

    International Nuclear Information System (INIS)

    Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi

    2017-01-01

    The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is