WorldWideScience

Sample records for rna aptamer impairs

  1. RNA and DNA aptamers in cytomics analysis.

    Science.gov (United States)

    Ulrich, Henning; Martins, Antonio Henrique B; Pesquero, João Bosco

    2005-08-01

    Using systematic evolution of ligands by exponential enrichment (SELEX), RNA or DNA molecules are selected from a combinatorial oligonucleotide library by their ability to bind their targets, i.e., cell surface antigens, with affinity and specificity similar to that of monoclonal antibodies. The generation of these high-affinity binders, also denominated aptamers, is carried out in vitro and does not involve animals. Therefore, aptamers can be developed against almost every molecule of biological importance, including toxins and nonimmunogenic targets, against which antibodies cannot be raised. The incorporation of modified pyrimidines resulting in nuclease-resistant RNA aptamers makes them promising candidates for studying protein interactions in vitro and in vivo. DNA aptamers do not need modifications for most applications. The protocols in this unit can be used for the development of fluorescent-tagged RNA or DNA aptamers for any cell surface protein in cytomics analysis.

  2. RNA fluorescence with light-up aptamers

    Science.gov (United States)

    Ouellet, Jonathan

    2016-06-01

    Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way.

  3. RAPID-SELEX for RNA Aptamers

    Science.gov (United States)

    Ozer, Abdullah; Pagano, John M.; White, Brian S.; Shalloway, David; Lis, John T.; Craighead, Harold G.

    2013-01-01

    Aptamers are high-affinity ligands selected from DNA or RNA libraries via SELEX, a repetitive in vitro process of sequential selection and amplification steps. RNA SELEX is more complicated than DNA SELEX because of the additional transcription and reverse transcription steps. Here, we report a new selection scheme, RAPID-SELEX (RNA Aptamer Isolation via Dual-cycles SELEX), that simplifies this process by systematically skipping unnecessary amplification steps. Using affinity microcolumns, we were able to complete a multiplex selection for protein targets, CHK2 and UBLCP1, in a third of the time required for analogous selections using a conventional SELEX approach. High-throughput sequencing of the enriched pools from both RAPID and SELEX revealed many identical candidate aptamers from the starting pool of 5×1015 sequences. For CHK2, the same sequence was preferentially enriched in both selections as the top candidate and was found to bind to its respective target. These results demonstrate the efficiency and, most importantly, the robustness of our selection scheme. RAPID provides a generalized approach that can be used with any selection technology to accelerate the rate of aptamer discovery, without compromising selection performance. PMID:24376564

  4. RAPID-SELEX for RNA aptamers.

    Science.gov (United States)

    Szeto, Kylan; Latulippe, David R; Ozer, Abdullah; Pagano, John M; White, Brian S; Shalloway, David; Lis, John T; Craighead, Harold G

    2013-01-01

    Aptamers are high-affinity ligands selected from DNA or RNA libraries via SELEX, a repetitive in vitro process of sequential selection and amplification steps. RNA SELEX is more complicated than DNA SELEX because of the additional transcription and reverse transcription steps. Here, we report a new selection scheme, RAPID-SELEX (RNA Aptamer Isolation via Dual-cycles SELEX), that simplifies this process by systematically skipping unnecessary amplification steps. Using affinity microcolumns, we were able to complete a multiplex selection for protein targets, CHK2 and UBLCP1, in a third of the time required for analogous selections using a conventional SELEX approach. High-throughput sequencing of the enriched pools from both RAPID and SELEX revealed many identical candidate aptamers from the starting pool of 5 × 10(15) sequences. For CHK2, the same sequence was preferentially enriched in both selections as the top candidate and was found to bind to its respective target. These results demonstrate the efficiency and, most importantly, the robustness of our selection scheme. RAPID provides a generalized approach that can be used with any selection technology to accelerate the rate of aptamer discovery, without compromising selection performance.

  5. Development of RNA aptamers for detection of Salmonella Enteritidis.

    Science.gov (United States)

    Hyeon, Ji-Yeon; Chon, Jung-Whan; Choi, In-Soo; Park, Chankyu; Kim, Dong-Eun; Seo, Kun-Ho

    2012-04-01

    We developed and evaluated RNA aptamers to analyze their potential for use in detecting Salmonella Enteritidis. The selected aptamer was observed to specifically bind to Salmonella Enteritidis without any cross-reactivity to other Salmonella serovars. Thus, this study suggests that aptamers specific to Salmonella Enteritidis have a high potential for use in presumptive presumptive screening methods or alternative serotyping methods.

  6. Cell-SELEX Identifies a "Sticky" RNA Aptamer Sequence.

    Science.gov (United States)

    Ray, Partha; White, Rebekah R

    2017-01-01

    Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface.

  7. Method for Confirming Cytoplasmic Delivery of RNA Aptamers

    Science.gov (United States)

    Dickey, David D; Dassie, Justin P; Giangrande, Paloma H

    2016-01-01

    RNA aptamers are single-stranded RNA oligos that represent a powerful emerging technology with potential for treating numerous diseases. More recently, cell-targeted RNA aptamers have been developed for delivering RNA interference (RNAi) modulators (siRNAs and miRNAs) to specific diseased cells (e.g., cancer cells or HIV infected cells) in vitro and in vivo. However, despite initial promising reports, the broad application of this aptamer delivery technology awaits the development of methods that can verify and confirm delivery of aptamers to the cytoplasm of target cells where the RNAi machinery resides. We recently developed a functional assay (RIP assay) to confirm cellular uptake and subsequent cytoplasmic release of an RNA aptamer which binds to a cell surface receptor expressed on prostate cancer cells (PSMA). To assess cytoplasmic delivery, the aptamer was chemically conjugated to saporin, a ribosome inactivating protein toxin that is toxic to cells only when delivered to the cytoplasm (where it inhibits the ribosome) by a cell-targeting ligand (e.g., aptamer). Here, we describe the chemistry used to conjugate the aptamer to saporin and discuss a gel-based method to verify conjugation efficiency. We also detail an in vitro functional assay to confirm that the aptamer retains function following conjugation to saporin and describe a cellular assay to measure aptamer-mediated saporin-induced cytotoxicity. PMID:26472453

  8. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    Science.gov (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Thermal Stability of siRNA Modulates Aptamer- conjugated siRNA Inhibition

    Directory of Open Access Journals (Sweden)

    Alexey Berezhnoy

    2012-01-01

    Full Text Available Oligonucleotide aptamer-mediated in vivo cell targeting of small interfering RNAs (siRNAs is emerging as a useful approach to enhance the efficacy and reduce the adverse effects resulting from siRNA-mediated genetic interference. A current main impediment in aptamer-mediated siRNA targeting is that the activity of the siRNA is often compromised when conjugated to an aptamer, often requiring labor intensive and time consuming design and testing of multiple configurations to identify a conjugate in which the siRNA activity has not been significantly reduced. Here, we show that the thermal stability of the siRNA is an important parameter of siRNA activity in its conjugated form, and that siRNAs with lower melting temperature (Tm are not or are minimally affected when conjugated to the 3′ end of 2′F-pyrimidine-modified aptamers. In addition, the configuration of the aptamer-siRNA conjugate retains activity comparable with the free siRNA duplex when the passenger strand is co-transcribed with the aptamer and 3′ overhangs on the passenger strand are removed. The approach described in this paper significantly reduces the time and effort necessary to screening siRNA sequences that retain biological activity upon aptamer conjugation, facilitating the process of identifying candidate aptamer-siRNA conjugates suitable for in vivo testing.

  10. Label-free selection of RNA aptamers for metabolic engineering.

    Science.gov (United States)

    Hwang, Chuhern; Carothers, James M

    2016-08-15

    RNA aptamers can be assembled into genetic regulatory devices that sense and respond to levels of specific cellular metabolites and thus serve an integral part of designing dynamic control into engineered metabolic pathways. Here, we describe a practical method for generating specific and high affinity aptamers to enable the wider use of in vitro selection and a broader application of aptamers for metabolic engineering. Conventional selection methods involving either radioactive labeling of RNA or the use of label-free methods such as SPR to track aptamer enrichment require resources that are not widely accessible to research groups. We present a label-free selection method that uses small volume spectrophotometers to track RNA enrichment paired with previously characterized affinity chromatography methods. Borrowing techniques used in solid phase peptide synthesis, we present an approach for immobilizing a wide range of metabolites to an amino PEGA matrix. As an illustration, we detail laboratory techniques employed to generate aptamers that bind p-aminophenylalanine, a metabolic precursor for bio-based production of plastics and the pristinamycin family of antibiotics. We focused on the development of methods for ligand immobilization, selection via affinity chromatography, and nucleic acid quantification that can be performed with common laboratory equipment.

  11. Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Iwao Waga

    2010-08-01

    Full Text Available Sphingosylphosphorylcholine (SPC is a lysosphingolipid that exerts multiple functions, including acting as a spasmogen, as a mitogenic factor for various types of cells, and sometimes as an inflammatory mediator. Currently, liquid chromatography/tandem mass spectrometry (LC/MS/MS is used for the quantitation of SPC. However, because of the complicated procedures required it may not be cost effective, hampering its regular usage in a routine practical SPC monitoring. In this report, we have generated RNA aptamers that bind to SPC with high affinity using an in vitro selection procedure and developed an enzyme-linked aptamer assay system using the minimized SPC aptamer that can successfully distinguish SPC from the structurally related sphingosine 1-phosphate (S1P. This is the first case of the Systematic Evolution of Ligands by EXponential enrichment (SELEX process being performed with a lysosphingolipid. The SPC aptamers would be valuable tools for the development of aptamer-based medical diagnosis and for elucidating the biological role of SPC.

  12. Regulation of photosensitisation processes by an RNA aptamer

    Science.gov (United States)

    Thoa, Tran Thi Thanh; Minagawa, Noriko; Aigaki, Toshiro; Ito, Yoshihiro; Uzawa, Takanori

    2017-02-01

    One of the most powerful attributes of proteins is their ability to bind to and modulate the chemistry of cofactors and prosthetic groups. Here, we demonstrated the ability of an artificial nucleic acid (an aptamer) to similarly control the functionality of a non-biological element. Specifically, we selected an RNA aptamer that binds tris(bipyridine) ruthenium (II), Ru(bpy)32+, an inorganic complex that has attracted intense interest due to its photoredox chemistry, including its ability to split water by visible light. We found that a newly discovered aptamer strongly and enantioselectively binds Λ-Ru(bpy)32+ (Kd = 65 nM) and, in doing so, selectively suppresses deactivation via energy transfer, thereby elongating the lifetime of its photo-excited state by four-fold. The ability of the aptamer to enhance this important aspect of Ru(bpy)32+ chemistry illustrates a broader point concerning the potential power of combining in vitro-created biomolecules with non-biological reactants to perform enhanced chemical reactions.

  13. RNA aptamers inhibit the growth of the fish pathogen viral hemorrhagic septicemia virus (VHSV).

    Science.gov (United States)

    Punnarak, Porntep; Santos, Mudjekeewis D; Hwang, Seong Don; Kondo, Hidehiro; Hirono, Ikuo; Kikuchi, Yo; Aoki, Takashi

    2012-12-01

    Viral hemorrhagic septicemia virus (VHSV) is a serious disease impacting wild and cultured fish worldwide. Hence, an effective therapeutic method against VHSV infection needs to be developed. Aptamer technology is a new and promising method for diagnostics and therapeutics. It revolves around the use of an aptamer molecule, an artificial ligand (nucleic acid or protein), which has the capacity to recognize target molecules with high affinity and specificity. Here, we aimed at selecting RNA aptamers that can specifically bind to and inhibit the growth of a strain of fish VHSV both in vitro and in vivo. Three VHSV-specific RNA aptamers (F1, F2, and C6) were selected from a pool of artificially and randomly produced oligonucleotides using systematic evolution of ligands by exponential enrichment. The three RNA aptamers showed obvious binding to VHSV in an electrophoretic mobility shift assay but not to other tested viruses. The RNA aptamers were tested for their ability to inhibit VHSV in vitro using hirame natural embryo (HINAE) cells. Cytopathic effect and plaque assays showed that all aptamers inhibited the growth of VHSV in HINAE cells. In vivo tests using RNA aptamers produced by Rhodovulum sulfidophilum showed that extracellular RNA aptamers inhibited VHSV infection in Japanese flounder. These results suggest that the RNA aptamers are a useful tool for protection against VHSV infection in Japanese flounder.

  14. tPA-binding RNA Aptamers

    DEFF Research Database (Denmark)

    Bjerregaard, Nils

    2015-01-01

    The serine protease Tissue-type Plasminogen Activator (tPA) is the principal initiator of fibrinolysis in mammalian physiology. Recombinant tPA is employed in the pharmacological resolution of vessel occlusions caused by pathological thrombosis, the originating cause of cerebral ischaemic strokes....... Globally, stroke is the leading cause of disability and the third leading cause of mortality. Fibrinolytic therapy with recombinant tPA rescues suboptimally perfused penumbral nervous tissue, but has also been implicated in detrimental neurotoxic effects, which are chiefly mediated by the Low......, and upon conjugation to serum albumin. K18v2 was able to inhibit tPA-induced fibrinogen depletion in vitro, which may provide additional benefits in stroke treatment. A conjugate of both aptamers separated by a linker encompassed the activities of both constituent sequences, and additionally possessed...

  15. Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence

    Science.gov (United States)

    2017-01-01

    Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing) this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface. PMID:28194280

  16. Cell-SELEX Identifies a “Sticky” RNA Aptamer Sequence

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2017-01-01

    Full Text Available Cell-SELEX is performed to select for cell binding aptamers. We employed an additional selection pressure by using RNAse to remove surface-binding aptamers and select for cell-internalizing aptamers. A common RNA sequence was identified from independent cell-SELEX procedures against two different pancreatic cancer cell lines, indicating a strong selection pressure towards this sequence from the large pool of other available sequences present in the aptamer library. The aptamer is not specific for the pancreatic cancer cell lines, and a similar sequence motif is present in previously published internalizing aptamers. The identified sequence forms a structural motif that binds to a surface protein, which either is highly abundant or has strong affinity for the selected aptamer sequence. Deselecting (removing this sequence during cell-SELEX may increase the probability of identifying aptamers against cell type-specific targets on the cell surface.

  17. RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine

    DEFF Research Database (Denmark)

    Farjami, Elahe; Campos, Rui; Nielsen, Jesper Sejrup

    2013-01-01

    , including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine...

  18. Inhibition of HCV NS3 protease by RNA aptamers in cells.

    Science.gov (United States)

    Nishikawa, Fumiko; Kakiuchi, Nobuko; Funaji, Kohei; Fukuda, Kotaro; Sekiya, Satoru; Nishikawa, Satoshi

    2003-04-01

    Non-structural protein 3 (NS3) of hepatitis C virus (HCV) has two distinct activities, protease and helicase, which are essential for HCV proliferation. In previous work, we obtained RNA aptamers (G9-I, II and III) which specifically bound the NS3 protease domain (DeltaNS3), efficiently inhibiting protease activity in vitro. To utilize these aptamers in vivo, we constructed a G9 aptamer expression system in cultured cells, using the cytomegarovirus enhancer + chicken beta-actin globin (CAG) promoter. By conjugating the cis-acting genomic human hepatitis delta virus (HDV) ribozyme and G9-II aptamer, a chimeric HDV ribozyme-G9-II aptamer (HA) was constructed, which was used to produce stable RNA in vivo and to create tandem repeats of the functional unit. To target the transcribed RNA aptamers to the cytoplasm, the minimal mutant of constitutive transport element (CTE), derived from type D retroviruses, was conjugated at the 3' end of HA (HAC). Transcript RNAs from (HA)(n) and (HAC)(n) were processed into the G9-II aptamer unit by the cis-acting HDV ribozyme, both in vitro and in vivo. Efficient protease inhibition activity of HDV ribozyme-G9-II aptamer expression plasmid was demonstrated in HeLa cells. Protease inhibition activity level of tandem chimeric aptamers, (HA)(n) and (HAC)(n), rose with the increase of n from 1 to 4.

  19. Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins.

    Science.gov (United States)

    Challa, Sreerupa; Tzipori, Saul; Sheoran, Abhineet

    2014-01-01

    Infection with Shiga toxin- (Stx-) producing E. coli causes life threatening hemolytic uremic syndrome (HUS), a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX) was used in an attempt to identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56). Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD) recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells.

  20. Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins

    Directory of Open Access Journals (Sweden)

    Sreerupa Challa

    2014-01-01

    Full Text Available Infection with Shiga toxin- (Stx- producing E. coli causes life threatening hemolytic uremic syndrome (HUS, a leading cause of acute renal failure in children. Of the two antigenically distinct toxins, Stx1 and Stx2, Stx2 is more firmly linked with the development of HUS. In the present study, selective evolution of ligands by exponential enrichment (SELEX was used in an attempt to identify RNA aptamers against Stx1 and Stx2. After 5 rounds of selection, significant enrichment of aptamer pool was obtained against Stx2, but not against Stx1, using a RNA aptamer library containing 56 random nucleotides (N56. Characterization of individual aptamer sequences revealed that six unique RNA aptamers (mA/pC, mB/pA, mC, mD, pB, and pD recognized Stx2 in a filter binding assay. None of these aptamers bound Stx1. Aptamers mA/pC, mB/pA, mC, and mD, but not pB and pD, partially blocked binding of Alexa 488-labeled Stx2 with HeLa cells in a flow cytometry assay. However, none of the aptamers neutralized Stx2-mediated cytotoxicity and death of HeLa cells.

  1. IN VITRO SELECTION AND CHARACTERIZATION OF CELLULOSE-BINDING RNA APTAMERS USING ISOTHERMAL AMPLIFICATION

    Science.gov (United States)

    Boese, B. J.; Corbino, K.; Breaker, R. R.

    2017-01-01

    We sought to create new cellulose-binding RNA aptamers for use as modular components in the engineering of complex functional nucleic acids. We designed our in vitro selection strategy to incorporate self-sustained sequence replication (3SR), which is an isothermal nucleic acid amplification protocol that allows for the rapid amplification of RNAs with little manipulation. The best performing aptamer representative was chosen for reselection and further optimization. The aptamer exhibits robust affinity for cellulose in both the powdered and paper form, but did not show any significant affinity for closely related polysaccharides. The minimal cellulose-binding RNA aptamer also can be grafted onto other RNAs to permit the isolation of RNAs from complex biochemical mixtures via cellulose affinity chromatography. This was demonstrated by fusing the aptamer to a glmS ribozyme sequence, and selectively eluting ribozyme cleavage products from cellulose using the glucosamine 6-phosphate to activate glmS ribozyme function. PMID:18696364

  2. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  3. Inhibition of PAI-1 antiproteolytic activity against tPA by RNA aptamers.

    Science.gov (United States)

    Damare, Jared; Brandal, Stephanie; Fortenberry, Yolanda M

    2014-08-01

    Plasminogen activator inhibitor-1 (PAI-1; SERPINE1) inhibits the plasminogen activators: tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA). Elevated levels of PAI-1 have been correlated with an increased risk for cardiovascular disease. Pharmacologically suppressing PAI-1 might prevent, or successfully treat PAI-1 related vascular diseases. This can potentially be accomplished by using small RNA molecules (aptamers). This study's goal is to develop RNA aptamers to a region of PAI-1 that will prevent the ability of PAI-1 to interact with the plasminogen activators. The aptamers were generated through a systematic evolution of ligands via exponential enrichment approach that ensures the creation of RNA molecules that bind to our target protein, PAI-1. In vitro assays were used to determine the effect of these aptamers on PAI-1's inhibitory activity. Three aptamers that bind to PAI-1 with affinities in the nanomolar range were isolated. The aptamer clones R10-4 and R10-2 inhibited PAI-1's antiproteolytic activity against tPA and disrupted PAI-1's ability to form a stable covalent complex with tPA. Increasing aptamer concentrations correlated positively with an increase in cleaved PAI-1. To the best of our knowledge, this is the first report of RNA molecules that inhibit the antiproteolytic activity of PAI-1.

  4. Potent Inhibition of HIV-1 Reverse Transcriptase and Replication by Nonpseudoknot, "UCAA-motif" RNA Aptamers.

    Science.gov (United States)

    Whatley, Angela S; Ditzler, Mark A; Lange, Margaret J; Biondi, Elisa; Sawyer, Andrew W; Chang, Jonathan L; Franken, Joshua D; Burke, Donald H

    2013-02-05

    RNA aptamers that bind the reverse transcriptase (RT) of human immunodeficiency virus (HIV) compete with nucleic acid primer/template for access to RT, inhibit RT enzymatic activity in vitro, and suppress viral replication when expressed in human cells. Numerous pseudoknot aptamers have been identified by sequence analysis, but relatively few have been confirmed experimentally. In this work, a screen of nearly 100 full-length and >60 truncated aptamer transcripts established the predictive value of the F1Pk and F2Pk pseudoknot signature motifs. The screen also identified a new, nonpseudoknot motif with a conserved unpaired UCAA element. High-throughput sequence (HTS) analysis identified 181 clusters capable of forming this novel element. Comparative sequence analysis, enzymatic probing and RT inhibition by aptamer variants established the essential requirements of the motif, which include two conserved base pairs (AC/GU) on the 5' side of the unpaired UCAA. Aptamers in this family inhibit RT in primer extension assays with IC(50) values in the low nmol/l range, and they suppress viral replication with a potency that is comparable with that of previously studied aptamers. All three known anti-RT aptamer families (pseudoknots, the UCAA element, and the recently described "(6/5)AL" motif) are therefore suitable for developing aptamer-based antiviral gene therapies.Molecular Therapy - Nucleic Acids (2013) 2, e71; doi:10.1038/mtna.2012.62; published online 5 February 2013.

  5. Structure analysis of free and bound states of an RNA aptamer against ribosomal protein S8 from Bacillus anthracis.

    Science.gov (United States)

    Davlieva, Milya; Donarski, James; Wang, Jiachen; Shamoo, Yousif; Nikonowicz, Edward P

    2014-01-01

    Several protein-targeted RNA aptamers have been identified for a variety of applications and although the affinities of numerous protein-aptamer complexes have been determined, the structural details of these complexes have not been widely explored. We examined the structural accommodation of an RNA aptamer that binds bacterial r-protein S8. The core of the primary binding site for S8 on helix 21 of 16S rRNA contains a pair of conserved base triples that mold the sugar-phosphate backbone to S8. The aptamer, which does not contain the conserved sequence motif, is specific for the rRNA binding site of S8. The protein-free RNA aptamer adopts a helical structure with multiple non-canonical base pairs. Surprisingly, binding of S8 leads to a dramatic change in the RNA conformation that restores the signature S8 recognition fold through a novel combination of nucleobase interactions. Nucleotides within the non-canonical core rearrange to create a G-(G-C) triple and a U-(A-U)-U quartet. Although native-like S8-RNA interactions are present in the aptamer-S8 complex, the topology of the aptamer RNA differs from that of the helix 21-S8 complex. This is the first example of an RNA aptamer that adopts substantially different secondary structures in the free and protein-bound states and highlights the remarkable plasticity of RNA secondary structure.

  6. Anti-HCV RNA Aptamers Targeting the Genomic cis-Acting Replication Element

    Directory of Open Access Journals (Sweden)

    Alfredo Berzal-Herranz

    2011-12-01

    Full Text Available Hepatitis C virus (HCV replication is dependent on the existence of several highly conserved functional genomic RNA domains. The cis-acting replication element (CRE, located within the 3' end of the NS5B coding region of the HCV genome, has been shown essential for efficient viral replication. Its sequence and structural features determine its involvement in functional interactions with viral RNA-dependent RNA polymerase and distant RNA domains of the viral genome. This work reports the use of an in vitro selection strategy to select aptamer RNA molecules against the complete HCV-CRE. After six selection cycles, five potential target sites were identified within this domain. Inhibition assays using a sample of representative aptamers showed that the selected RNAs significantly inhibit the replication (>80% of a subgenomic HCV replicon in Huh-7 cell cultures. These results highlight the potential of aptamer RNA molecules as therapeutic antiviral agents.

  7. Isolation and Characterization of 2'-amino-modified RNA Aptamers for Human TNFα

    Institute of Scientific and Technical Information of China (English)

    Xinrui Yan; Xuwen Gao; Zhiqing Zhang

    2004-01-01

    Human tumor necrosis factor α (hTNFα), a pleiotropic cytokine with activities ranging from host defense mechanisms in infection and injury to severe toxicity in septic shock or other related diseases, is a promising target for drug screening. Using the SELEX (systematic evolution of ligands by exponential enrichment) process, we isolated oligonucleotide ligands (aptamers) with high affinities for hTNFα. Aptamers were selected from a starting pool of 40 randomized sequences composed of about 1015 RNA molecules. Representative aptamers were truncated to the minimal length with high affinity for hTNFα and were further modified by replacement of 2'-OH with 2'-F and 2'-NH2 at all ribopurine positions. These modified RNA aptamers were resistant to nuclease. The specificity of these aptamers for hTNFαwas confirmed, and their activity to inhibit the cytotoxicity of hTNFα on mouse L929 cells was determined. Results demonstrated that four 2'-NH2-modified aptamers bound to hTNFα with high affinity and blocked the binding of hTNFα to its receptor, thus protecting the L929 cells from the cytotoxicity of hTNFα. Oligonucleotide aptamers described here are potential therapeutics and diagnostics for hTNFc-related diseases.

  8. Smart ligand: aptamer-mediated targeted delivery of chemotherapeutic drugs and siRNA for cancer therapy.

    Science.gov (United States)

    Li, Xin; Zhao, Qinghe; Qiu, Liyan

    2013-10-28

    Aptamers are a class of oligonucleotides that can specifically bind to different targets with high affinity. Since their discovery in 1980s, aptamers have attracted considerable interests in medical applications. So far, initial research using aptamers as delivery systems has produced exciting results. In this review, we summarize recent progress in aptamer-mediated chemotherapeutic drug and siRNA delivery systems in tumor treatment. With regard to chemotherapeutic drugs, the 2 main methods for targeted delivery using aptamers are as follows: aptamer-drug systems (in which aptamers directly deliver the drug both as a carrier and as a ligand) and aptamer-nanoparticles systems (in which nanoparticles function together with aptamers for targeted delivery of drugs). For delivery of siRNA, aptamers can be utilized by the following ways to facilitate targeting: (1) linked by a connector; (2) form a chimera; and (3) combined with nanoparticles. In co-delivery system, the advantages associated with the use of aptamers are beginning to become apparent also. Here, the challenges and new perspectives in the field of aptamer-mediated delivery have been discussed.

  9. In vitro selection of G-rich RNA aptamers that target HIV-1 integrase

    Institute of Scientific and Technical Information of China (English)

    LIU YingChun; ZHANG Yan; YE GuoZhu; YANG ZhenJun; ZHANG LiangRen; ZHANG LiHe

    2008-01-01

    Aptamers that interact with various HIV-1 proteins, such as reverse transcriptase, Rev, Tat protein, and nuclear capsule protein, have been prepared through SELEX (systematic evolution of ligands by ex-ponential enrichment) technique. However, there are few reports about the DNA or RNA aptamers that target HIV-1 integrase. In this investigation, we selected alternative RNA aptamers specific for the HIV-1 Aptamer IN1, IN2, IN3 had similar and the highest Kd values from 145 to 239 nmol. L-1. Structural studies showed that they formed similar stem-loop structure. Deletion of any stem structure resulted in diminished affinity. In addition, structure probing study with antisense DNA indicated that the stem-loop structure in the random region was critical for integrase binding. Although aptamer IN1 failed to form G-quartet structure, it might directly interact with the DDE motif of integrase, which is the virus DNA-binding site, because G-quadruplex T40214 competitively inhibited the interaction between IN1 and integrase. Together, this study generated a novel RNA aptamer IN1, which could be useful in basic research and anti-HIV drug screening.

  10. In vitro selection of G-rich RNA aptamers that target HIV-1 integrase

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Aptamers that interact with various HIV-1 proteins,such as reverse transcriptase,Rev,Tat protein,and nuclear capsule protein,have been prepared through SELEX (systematic evolution of ligands by ex-ponential enrichment) technique. However,there are few reports about the DNA or RNA aptamers that target HIV-1 integrase. In this investigation,we selected alternative RNA aptamers specific for the HIV-1 integrase by using a different binding buffer containing 10 mmol·L-1 MgCl2 and 100 mmol·L-1 KCl. Aptamer IN1,IN2,IN3 had similar and the highest Kd values from 145 to 239 nmol·L-1. Structural studies showed that they formed similar stem-loop structure. Deletion of any stem structure resulted in diminished affinity. In addition,structure probing study with antisense DNA indicated that the stem-loop structure in the random region was critical for integrase binding. Although aptamer IN1 failed to form G-quartet structure,it might directly interact with the DDE motif of integrase,which is the virus DNA-binding site,because G-quadruplex T40214 competitively inhibited the interaction between IN1 and integrase. Together,this study generated a novel RNA aptamer IN1,which could be useful in basic research and anti-HIV drug screening.

  11. Computational Selection of RNA Aptamer against Angiopoietin-2 and Experimental Evaluation

    Directory of Open Access Journals (Sweden)

    Wen-Pin Hu

    2015-01-01

    Full Text Available Angiogenesis plays a decisive role in the growth and spread of cancer and angiopoietin-2 (Ang2 is in the spotlight of studies for its unique role in modulating angiogenesis. The aim of this study was to introduce a computational simulation approach to screen aptamers with high binding ability for Ang2. We carried out computational simulations of aptamer-protein interactions by using ZDOCK and ZRANK functions in Discovery Studio 3.5 starting from the available information of aptamers generated through the systematic evolution of ligands by exponential enrichment (SELEX in the literature. From the best of three aptamers on the basis of ZRANK scores, 189 sequences with two-point mutations were created and simulated with Ang2. Then, we used a surface plasmon resonance (SPR biosensor to test 3 mutant sequences of high ZRANK scores along with a high and a low affinity binding sequence as reported in the literature. We found a selected RNA aptamer has a higher binding affinity and SPR response than a reported sequence with the highest affinity. This is the first study of in silico selection of aptamers against Ang2 by using the ZRANK scoring function, which should help to increase the efficiency of selecting aptamers with high target-binding ability.

  12. Inhibition of the foot-and-mouth disease virus subgenomic replicon by RNA aptamers.

    Science.gov (United States)

    Forrest, Sophie; Lear, Zoe; Herod, Morgan R; Ryan, Martin; Rowlands, David J; Stonehouse, Nicola J

    2014-12-01

    We have previously documented the inhibitory activity of RNA aptamers to the RNA-dependent RNA polymerase of foot-and-mouth disease virus (3D(pol)). Here we report their modification and use with a subgenomic replicon incorporating GFP (pGFP-PAC replicon), allowing replication to be monitored and quantified in real-time. GFP expression in transfected BHK-21 cells reached a maximum at approximately 8 h post-transfection, at which time change in morphology of the cells was consistent with a virus-induced cytopathic effect. However, transfection of replicon-bearing cells with a 3D(pol) aptamer RNA resulted in inhibition of GFP expression and maintenance of normal cell morphology, whereas a control aptamer RNA had little effect. The inhibition was correlated with a reduction in 3D(pol) (detected by immunoblotting) and shown to be dose dependent. The 3D(pol) aptamers appeared to be more effective than 2'-C-methylcytidine (2'CMC). Aptamers to components of the replication complex are therefore useful molecular tools for studying viral replication and also have potential as diagnostic molecules in the future.

  13. Protective effects of anti-ricin A-chain RNA aptamer against ricin toxicity

    Institute of Scientific and Technical Information of China (English)

    Shaoan Fan; Feng Wu; Frank Martiniuk; Martha L Hale; Andrew D Ellington; Kam-Meng Tchou-Wong

    2008-01-01

    AIM: To investigate the therapeutic potential of an RNA ligand (aptamer) specific for the catalytic ricin A-chain (RTA), the protective effects of a 31-nucleo-tide RNA aptamer (31RA), which formed a high affinity complex with RTA, against ricin-induced toxicity in cell-based luciferase translation and ceil cytotoxicity assays were evaluated. METHODS: To test the therapeutic potential of anti-RTA aptamers in Chinese hamster ovary (CHO) AA8 cells stably transfected with a tetracycline regulato able promoter, ricin ribotoxicity was measured us-ing luciferase and ricin-induced cytotoxicity was ascertained by MTS cell proliferation assay with tet-razolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]. RESULTS: Inhibition of protein synthesis by ricin in CHO AA8 cells resulted in diminished luciferase activity and treatment with polyclonal antibody against degly-cosylated RTA (dgA) neutralized the inhibitory effects of ricin on luciferase activity and protected against ricin-induced cytotoxicity as measured by MTS assay. The 31RA anti-RTA aptamer inhibited the translation of luciferase mRNA in cell-free reticulocyte translation as-say. 31RA aptamer also partially neutralized the inhibi-tory effects of ricin on luciferase activity and partially protected against ricin-induced cytotoxicity in CHO AA8 cells. CONCLUSION- We have shown that anti-RTA RNA aptamer can protect against ricin ribotoxicity in ceil-based luciferase and cell cytotoxicity assays. Hence, RNA aptamer that inhibits RTA enzymatic activity rep-resents a novel class of nucleic acid inhibitor that has the potential to be developed as a therapeutic agent for the treatment of ricin intoxication.

  14. Inducible control of subcellular RNA localization using a synthetic protein-RNA aptamer interaction.

    Directory of Open Access Journals (Sweden)

    Brian J Belmont

    Full Text Available Evidence is accumulating in support of the functional importance of subcellular RNA localization in diverse biological contexts. In different cell types, distinct RNA localization patterns are frequently observed, and the available data indicate that this is achieved through a series of highly coordinated events. Classically, cis-elements within the RNA to be localized are recognized by RNA-binding proteins (RBPs, which then direct specific localization of a target RNA. Until now, the precise control of the spatiotemporal parameters inherent to regulating RNA localization has not been experimentally possible. Here, we demonstrate the development and use of a chemically-inducible RNA-protein interaction to regulate subcellular RNA localization. Our system is composed primarily of two parts: (i the Tet Repressor protein (TetR genetically fused to proteins natively involved in localizing endogenous transcripts; and (ii a target transcript containing genetically encoded TetR-binding RNA aptamers. TetR-fusion protein binding to the target RNA and subsequent localization of the latter are directly regulated by doxycycline. Using this platform, we demonstrate that enhanced and controlled subcellular localization of engineered transcripts are achievable. We also analyze rules for forward engineering this RNA localization system in an effort to facilitate its straightforward application to studying RNA localization more generally.

  15. Aptamers to the sigma factor mimic promoter recognition and inhibit transcription initiation by bacterial RNA polymerase.

    Science.gov (United States)

    Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2016-01-08

    Promoter recognition by bacterial RNA polymerase (RNAP) is a multi-step process involving multiple protein-DNA interactions and several structural and kinetic intermediates which remain only partially characterized. We used single-stranded DNA aptamers containing specific promoter motifs to probe the interactions of the Thermus aquaticus RNAP σ(A) subunit with the -10 promoter element in the absence of other parts of the promoter complex. The aptamer binding decreased intrinsic fluorescence of the σ subunit, likely as a result of interactions between the -10 element and conserved tryptophan residues of the σ DNA-binding region 2. By monitoring these changes, we demonstrated that DNA binding proceeds through a single rate-limiting step resulting in formation of very stable complexes. Deletion of the N-terminal domain of the σ(A) subunit increased the rate of aptamer binding while replacement of this domain with an unrelated N-terminal region 1.1 from the Escherichia coli σ(70) subunit restored the original kinetics of σ-aptamer interactions. The results demonstrate that the key step in promoter recognition can be modelled in a simple σ-aptamer system and reveal that highly divergent N-terminal domains similarly modulate the DNA-binding properties of the σ subunit. The aptamers efficiently suppressed promoter-dependent transcription initiation by the holoenzyme of RNA polymerase, suggesting that they may be used for development of novel transcription inhibitors.

  16. Prostate-specific RNA aptamer: promising nucleic acid antibody-like cancer detection.

    Science.gov (United States)

    Marangoni, Karina; Neves, Adriana F; Rocha, Rafael M; Faria, Paulo R; Alves, Patrícia T; Souza, Aline G; Fujimura, Patrícia T; Santos, Fabiana A A; Araújo, Thaise G; Ward, Laura S; Goulart, Luiz R

    2015-07-15

    We described the selection of a novel nucleic acid antibody-like prostate cancer (PCa) that specifically binds to the single-stranded DNA molecule from a 277-nt fragment that may have been partially paired and bound to the PCA3 RNA conformational structure. PCA3-277 aptamer ligands were obtained, and the best binding molecule, named CG3, was synthesized for validation. Aiming to prove its diagnostic utility, we used an apta-qPCR assay with CG3-aptamer conjugated to magnetic beads to capture PCA3 transcripts, which were amplified 97-fold and 7-fold higher than conventional qPCR in blood and tissue, respectively. Histopathologic analysis of 161 prostate biopsies arranged in a TMA and marked with biotin-labeled CG3-aptamer showed moderate staining in both cytoplasm and nucleus of PCa samples; in contrast, benign prostatic hyperplasia (BPH) samples presented strong nuclear staining (78% of the cases). No staining was observed in stromal cells. In addition, using an apta-qPCR, we demonstrated that CG3-aptamer specifically recognizes the conformational PCA3-277 molecule and at least three other transcript variants, indicating that long non-coding RNA (lncRNA) is processed after transcription. We suggest that CG3-aptamer may be a useful PCa diagnostic tool. In addition, this molecule may be used in drug design and drug delivery for PCa therapy.

  17. A strategy to enhance the binding affinity of fluorophore-aptamer pairs for RNA tagging with neomycin conjugation.

    Science.gov (United States)

    Jeon, Jongho; Lee, Kyung Hyun; Rao, Jianghong

    2012-10-14

    Fluorogenic sulforhodamine-neomycin conjugates have been designed and synthesized for RNA tagging. Conjugates were fluorescently activated by binding to RNA aptamers and exhibited greater than 250-400 fold enhancement in binding affinity relative to corresponding unconjugated fluorophores.

  18. RNA aptamers generated against oligomeric Abeta40 recognize common amyloid aptatopes with low specificity but high sensitivity.

    Directory of Open Access Journals (Sweden)

    Farid Rahimi

    Full Text Available Aptamers are useful molecular recognition tools in research, diagnostics, and therapy. Despite promising results in other fields, aptamer use has remained scarce in amyloid research, including Alzheimer's disease (AD. AD is a progressive neurodegenerative disease believed to be caused by neurotoxic amyloid beta-protein (Abeta oligomers. Abeta oligomers therefore are an attractive target for development of diagnostic and therapeutic reagents. We used covalently-stabilized oligomers of the 40-residue form of Abeta (Abeta40 for aptamer selection. Despite gradually increasing the stringency of selection conditions, the selected aptamers did not recognize Abeta40 oligomers but reacted with fibrils of Abeta40, Abeta42, and several other amyloidogenic proteins. Aptamer reactivity with amyloid fibrils showed some degree of protein-sequence dependency. Significant fibril binding also was found for the naïve library and could not be eliminated by counter-selection using Abeta40 fibrils, suggesting that aptamer binding to amyloid fibrils was RNA-sequence-independent. Aptamer binding depended on fibrillogenesis and showed a lag phase. Interestingly, aptamers detected fibril formation with > or =15-fold higher sensitivity than thioflavin T (ThT, revealing substantial beta-sheet and fibril formation undetected by ThT. The data suggest that under physiologic conditions, aptamers for oligomeric forms of amyloidogenic proteins cannot be selected due to high, non-specific affinity of oligonucleotides for amyloid fibrils. Nevertheless, the high sensitivity, whereby aptamers detect beta-sheet formation, suggests that they can serve as superior amyloid recognition tools.

  19. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    Directory of Open Access Journals (Sweden)

    Seyedeh Alia Moosavian

    2015-06-01

    Full Text Available Objective(s: Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2 is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX. Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy.

  20. Isolation and characterization of 20'-F-RNA aptamers against whole HIV-1 subtype C envelope pseudovirus

    CSIR Research Space (South Africa)

    London, GM

    2015-01-01

    Full Text Available Aptamers, which are artificial nucleic acid ligands akin to antibodies in function, represent a new class of molecules that can prevent HIV infection. In this study, we isolated RNA aptamers against whole HV-1CAP45 enveloped pseudotyped virus...

  1. Evolution of Cell-Type-Specific RNA Aptamers Via Live Cell-Based SELEX.

    Science.gov (United States)

    Zhou, Jiehua; Rossi, John J

    2016-01-01

    Live cell-based SELEX (Systematic Evolution of Ligand EXponential enrichment) is a promising approach for identifying aptamers that can selectively bind to a cell-surface antigen or a particular target cell population. In particular, it offers a facile selection strategy for some special cell-surface proteins that are original glycosylated or heavily post-translationally modified, and are unavailable in their native/active conformation after in vitro expression and purification. In this chapter, we describe evolution of cell-type-specific RNA aptamers targeting the human CCR5 by combining the live cell-based SELEX strategy with high-throughput sequencing (HTS) and bioinformatics analysis.

  2. Characterization of RNA aptamers that disrupt the RUNX1–CBFβ/DNA complex

    Science.gov (United States)

    Barton, Jenny L.; Bunka, David H. J.; Knowling, Stuart E.; Lefevre, Pascal; Warren, Alan J.; Bonifer, Constanze; Stockley, Peter G.

    2009-01-01

    The transcription factor RUNX1 (AML1) is an important regulator of haematopoiesis, and an important fusion partner in leukaemic translocations. High-affinity DNA binding by RUNX1 requires the interaction of the RUNX1 Runt-Homology-Domain (RHD) with the core-binding factor β protein (CBFβ). To generate novel reagents for in vitro and in vivo studies of RUNX1 function, we have selected high-affinity RNA aptamers against a recombinant RHD–CBFβ complex. Selection yielded two sequence families, each dominated by a single consensus sequence. Aptamers from each family disrupt DNA binding by the RUNX1 protein in vitro and compete with sequence-specific dsDNA binding. Minimal, high-affinity (∼100–160 nM) active aptamer fragments 28 and 30 nts in length, consisting of simple short stem-loop structures, were then identified. These bind to the RHD subunit and disrupt its interaction with CBFβ, which is consistent with reduced DNA affinity in the presence of aptamer. These aptamers represent new reagents that target a novel surface on the RHD required to stabilize the recombinant RHD–CBFβ complex and thus will further aid exploring the functions of this key transcription factor. PMID:19740763

  3. 2-fluoro-RNA oligonucleotide CD40 targeted aptamers for the control of B lymphoma and bone-marrow aplasia.

    Science.gov (United States)

    Soldevilla, Mario Martinez; Villanueva, Helena; Bendandi, Maurizio; Inoges, Susana; López-Díaz de Cerio, Ascensión; Pastor, Fernando

    2015-10-01

    Recent studies have underscored the importance of immunomodulatory antibodies in the treatment of solid and hematological tumors. ODN-Aptamers are rising as a novel class of drugs that can rival therapeutic antibodies. The success of some of the current cancer immunotherapy approaches in oncological patients depends on the intrinsic antigenicity of each tumor as has recently been disclosed, and it is hampered in those patients that are treated with myeloablative chemotherapy or radiotherapy, which induce profound immunosuppression. CD40 agonist and antagonist molecules offer a new therapeutic alternative which has the potential to generate anticancer effects by different mechanisms. HS-SELEX was performed to identify high-affinity aptamers against CD40, and three therapeutic CD40 constructs were engineered as: CD40 agonist aptamer, CD40 antagonist aptamer and CD40 agonistic aptamer-shRNA chimera. It is shown that CD40 agonist aptamers can be used to promote bone-marrow aplasia recovery. CD40 antagonist aptamers are revealed to have a direct antitumor effect on CD40-expressing B-cell lymphoma in vitro and in vivo. Further, in order to identify a therapeutic reagent that will generate the optimal conditions for cancer immunotherapy (antigen-presenting cell activation, tumor antigenicity enhancement and bone-marrow aplasia recovery), CD40 agonist aptamer-shRNA chimera was generated to target the inhibition of the Nonsense mRNA Mediated Decay (NMD) to tumor cells. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. A Novel PEGylation Method for Improving the Pharmacokinetic Properties of Anti-Interleukin-17A RNA Aptamers.

    Science.gov (United States)

    Haruta, Kazuhiko; Otaki, Natsuki; Nagamine, Masakazu; Kayo, Tomoyoshi; Sasaki, Asako; Hiramoto, Shinsuke; Takahashi, Masayuki; Hota, Kuniyoshi; Sato, Hideaki; Yamazaki, Hiroaki

    2017-02-01

    The obstacles to the development of therapeutic aptamers for systemic inflammatory diseases, such as nuclease degradation and renal clearance, have not been fully overcome. Here, we report a novel PEGylation method, sbC-PEGylation, which improves the pharmacokinetic properties of RNA aptamers that act against interleukin-17A (IL-17A) in mice and monkeys. sbC-PEGylated aptamers were synthesized by coupling the symmetrical branching molecule 2-cyanoethyl-N,N-diisopropyl phosphoroamidite to the 5' end of the aptamer, before conjugating two polyethylene glycol (PEG) molecules to the aptamer. Pharmacokinetic studies showed that compared with conventionally PEGylated aptamers, the sbC-PEGylated aptamer exhibited excellent stability in the blood circulation of mice and monkeys. In addition, one of the sbC-PEGylated aptamers, 17M-382, inhibited the interleukin-6 (IL-6) production induced by IL-17A in NIH3T3 cells in a concentration-dependent manner, and the half-maximal inhibitory concentration of sbC-PEGylated 17M-382 was two times lower than that of non-PEGylated 17M-382. Furthermore, the intraperitoneal administration of sbC-PEGylated 17M-382 significantly inhibited the IL-6 production induced by IL-17A in a mouse air pouch model. Our findings suggest that the novel PEGylation method described in this study, sbC-PEGylation, could be used to develop anti-IL-17A aptamers as a therapeutic option for systemic inflammatory disease.

  5. Dissecting the effect of RNA aptamer binding on the dynamics of plasminogen activator inhibitor 1 using hydrogen/deuterium exchange mass spectrometry

    DEFF Research Database (Denmark)

    Trelle, Morten B; Dupont, Daniel Miotto; Madsen, Jeppe Buur

    2014-01-01

    , about their effects on protein conformation and dynamics. We have employed hydrogen/deuterium exchange (HDX) mass spectrometry to study the effect of RNA aptamers on the structural flexibility of the serpin plasminogen activator inhibitor-1 (PAI-1). The aptamers have characteristic effects...... of the aptamers to PAI-1 is associated with substantial and widespread protection against deuterium uptake in PAI-1. The aptamers induce protection against exchange with the solvent both in the protein-aptamer interface as well as in other specific areas. Interestingly, the aptamers induce substantial protection...

  6. RNA Detection in Live Bacterial Cells Using Fluorescent Protein Complementation Triggered by Interaction of Two RNA Aptamers with Two RNA-Binding Peptides

    Directory of Open Access Journals (Sweden)

    Charles R. Cantor

    2011-03-01

    Full Text Available Many genetic and infectious diseases can be targeted at the RNA level as RNA is more accessible than DNA. We seek to develop new approaches for detection and tracking RNA in live cells, which is necessary for RNA-based diagnostics and therapy. We recently described a method for RNA visualization in live bacterial cells based on fluorescent protein complementation [1-3]. The RNA is tagged with an RNA aptamer that binds an RNA-binding protein with high affinity. This RNA-binding protein is expressed as two split fragments fused to the fragments of a split fluorescent protein. In the presence of RNA the fragments of the RNA-binding protein bind the aptamer and bring together the fragments of the fluorescent protein, which results in its re-assembly and fluorescence development [1-3]. Here we describe a new version of the RNA labeling method where fluorescent protein complementation is triggered by paired interactions of two different closely-positioned RNA aptamers with two different RNA-binding viral peptides. The new method, which has been developed in bacteria as a model system, uses a smaller ribonucleoprotein complementation complex, as compared with the method using split RNA-binding protein, and it can potentially be applied to a broad variety of RNA targets in both prokaryotic and eukaryotic cells. We also describe experiments exploring background fluorescence in these RNA detection systems and conditions that improve the signal-to-background ratio.

  7. In Vivo Selection Against Human Colorectal Cancer Xenografts Identifies an Aptamer That Targets RNA Helicase Protein DHX9

    Directory of Open Access Journals (Sweden)

    Jing Mi

    2016-01-01

    Full Text Available The ability to selectively target disease-related tissues with molecules is critical to the design of effective therapeutic and diagnostic reagents. Recognizing the differences between the in vivo environment and in vitro conditions, we employed an in vivo selection strategy to identify RNA aptamers (targeting motifs that could localize to tumor in situ. One of the selected molecules is an aptamer that binds to the protein DHX9, an RNA helicase that is known to be upregulated in colorectal cancer. Upon systemic administration, the aptamer preferentially localized to the nucleus of cancer cells in vivo and thus has the potential to be used for targeted delivery.

  8. An RNA Aptamer Targets the PDZ-Binding Motif of the HPV16 E6 Oncoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Belyaeva, Tamara A.; Nicol, Clare; Cesur, Özlem [School of Molecular and Cellular Biology, Faculty of Biological Sciences and Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom); Travé, Gilles [UMR 7242 CNRS-Université de Strasbourg, Ecole Supérieure de Biotechnologie, Boulevard Sébastien Brant, Illkirch 67412 (France); Blair, George Eric; Stonehouse, Nicola J., E-mail: n.j.stonehouse@leeds.ac.uk [School of Molecular and Cellular Biology, Faculty of Biological Sciences and Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom)

    2014-07-24

    Human papillomavirus 16 (HPV16) is a high-risk DNA tumour virus which is the primary causative agent of cervical cancer. Cell transformation arises from deregulated expression of the E6 and E7 oncogenes. E6 has been shown to bind a number of cellular proteins, including p53 and proteins containing a PDZ domain. This study reports the first RNA aptamers to E6. These have been employed as molecular tools to further investigate E6-p53 and E6-PDZ interactions. This study is focussed on two aptamers (termed F2 and F4) which induced apoptosis in cells derived from an HPV16-transformed cervical carcinoma. The molecules were able to inhibit the interaction between E6 and PDZ1 from Magi1, with F2 being the most effective inhibitor. Neither of the aptamers inhibited E6-p53 interaction or p53 degradation. This study shows the specificity of this approach and highlights the potential benefits of the E6 aptamers as potential therapeutic or diagnostic agents in the future.

  9. An RNA Aptamer Targets the PDZ-Binding Motif of the HPV16 E6 Oncoprotein

    Directory of Open Access Journals (Sweden)

    Tamara A. Belyaeva

    2014-07-01

    Full Text Available Human papillomavirus 16 (HPV16 is a high-risk DNA tumour virus which is the primary causative agent of cervical cancer. Cell transformation arises from deregulated expression of the E6 and E7 oncogenes. E6 has been shown to bind a number of cellular proteins, including p53 and proteins containing a PDZ domain. This study reports the first RNA aptamers to E6. These have been employed as molecular tools to further investigate E6-p53 and E6-PDZ interactions. This study is focussed on two aptamers (termed F2 and F4 which induced apoptosis in cells derived from an HPV16-transformed cervical carcinoma. The molecules were able to inhibit the interaction between E6 and PDZ1 from Magi1, with F2 being the most effective inhibitor. Neither of the aptamers inhibited E6-p53 interaction or p53 degradation. This study shows the specificity of this approach and highlights the potential benefits of the E6 aptamers as potential therapeutic or diagnostic agents in the future.

  10. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    John C. Leach

    2016-03-01

    Full Text Available The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA, was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells.

  11. Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization.

    Science.gov (United States)

    Lee, Sang-Choon; Gedi, Vinayakumar; Ha, Na-Reum; Cho, Jun-Haeng; Park, Hae-Chul; Yoon, Moon-Young

    2015-01-01

    Anthrax toxin excreted by Bacillus anthracis is the key causative agent of infectious anthrax disease. In the present study, we targeted the binding of PA to the ATR/TEM8 Von Willebrand factor type A (VWA) domain, which we cloned into Escherichia coli and purified to homogeneity under denaturing conditions. To develop an anthrax toxin inhibitor, we selected and identified short single strand RNA aptamers (approximately 30mer) consisting of different sequences of nucleic acids with a high binding affinity in the 100 nanomolar range against the recombinant ATR/TEM8 VWA domain using systematic evolution of ligands by exponential enrichment (SELEX). Five candidate aptamers were further characterized by several techniques including secondary structural analysis. The inhibitor efficiency (IC50) of one of the aptamers toward anthrax toxin was approximately 5μM in macrophage RAW 264.7 cells, as determined from cytotoxicity analysis by MTT assay. We believe that the candidate aptamers should be useful for blocking the binding of PA to its receptor in order to neutralize anthrax toxin. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Electroanalysis of pM-levels of urokinase plasminogen activator in serum by phosphorothioated RNA aptamer.

    Science.gov (United States)

    Jarczewska, Marta; Kékedy-Nagy, László; Nielsen, Jesper S; Campos, Rui; Kjems, Jørgen; Malinowska, Elżbieta; Ferapontova, Elena E

    2015-06-01

    Protein biomarkers of cancer allow a dramatic improvement in cancer diagnostics as compared to the traditional histological characterisation of tumours by enabling a non-invasive analysis of cancer development and treatment. Here, an electrochemical label-free assay for urokinase plasminogen activator (uPA), a universal biomarker of several cancers, has been developed based on the recently selected uPA-specific fluorinated RNA aptamer, tethered to a gold electrode via a phosphorothioated dA tag, and soluble redox indicators. The binding properties of the uPA-aptamer couple and interference from the non-specific adsorption of bovine serum albumin (BSA) were modulated by the electrode surface charge. A nM uPA electroanalysis at positively charged surfaces, complicated by the competitive adsorption of BSA, was tuned to the pM uPA analysis at negative surface charges of the electrode, being improved in the presence of negatively charged BSA. The aptamer affinity for uPA displayed via the binding/dissociation constant relationship correspondingly increased, ca. three orders of magnitude, from 0.441 to 367. Under optimal conditions, the aptasensor allowed 10(-12)-10(-9) M uPA analysis, also in serum, being practically useful for clinical applications. The proposed strategy for optimization of the electrochemical protein sensing is of particular importance for the assessment and optimization of in vivo protein ligand binding by surface-tethered aptamers.

  13. RNA and DNA aptamers as potential tools to prevent cell adhesion in disease

    Directory of Open Access Journals (Sweden)

    Ulrich H.

    2001-01-01

    Full Text Available Recent research has shown that receptor-ligand interactions between surfaces of communicating cells are necessary prerequisites for cell proliferation, cell differentiation and immune defense. Cell-adhesion events have also been proposed for pathological conditions such as cancer growth, metastasis, and host-cell invasion by parasites such as Trypanosoma cruzi. RNA and DNA aptamers (aptus = Latin, fit that have been selected from combinatorial nucleic acid libraries are capable of binding to cell-adhesion receptors leading to a halt in cellular processes induced by outside signals as a consequence of blockage of receptor-ligand interactions. We outline here a novel approach using RNA aptamers that bind to T. cruzi receptors and interrupt host-cell invasion in analogy to existing procedures of blocking selectin adhesion and function in vitro and in vivo.

  14. A SELEX-screened aptamer of human hepatitis B virus RNA encapsidation signal suppresses viral replication.

    Directory of Open Access Journals (Sweden)

    Hui Feng

    Full Text Available BACKGROUND: The specific interaction between hepatitis B virus (HBV polymerase (P protein and the ε RNA stem-loop on pregenomic (pg RNA is crucial for viral replication. It triggers both pgRNA packaging and reverse transcription and thus represents an attractive antiviral target. RNA decoys mimicking ε in P protein binding but not supporting replication might represent novel HBV inhibitors. However, because generation of recombinant enzymatically active HBV polymerase is notoriously difficult, such decoys have as yet not been identified. METHODOLOGY/PRINCIPAL FINDINGS: Here we used a SELEX approach, based on a new in vitro reconstitution system exploiting a recombinant truncated HBV P protein (miniP, to identify potential ε decoys in two large ε RNA pools with randomized upper stem. Selection of strongly P protein binding RNAs correlated with an unexpected strong enrichment of A residues. Two aptamers, S6 and S9, displayed particularly high affinity and specificity for miniP in vitro, yet did not support viral replication when part of a complete HBV genome. Introducing S9 RNA into transiently HBV producing HepG2 cells strongly suppressed pgRNA packaging and DNA synthesis, indicating the S9 RNA can indeed act as an ε decoy that competitively inhibits P protein binding to the authentic ε signal on pgRNA. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the first successful identification of human HBV ε aptamers by an in vitro SELEX approach. Effective suppression of HBV replication by the S9 aptamer provides proof-of-principle for the ability of ε decoy RNAs to interfere with viral P-ε complex formation and suggests that S9-like RNAs may further be developed into useful therapeutics against chronic hepatitis B.

  15. Cellular delivery of shRNA using aptamer-conjugated PLL-alkyl-PEI nanoparticles.

    Science.gov (United States)

    Askarian, Saeedeh; Abnous, Khalil; Taghavi, Sahar; Oskuee, Reza Kazemi; Ramezani, Mohammad

    2015-12-01

    Introduction of an efficient gene delivery vector is still the main challenge of gene therapy. Both polyethylenimine (PEI) and poly(l-lysine) (PLL) comprise disadvantages which limited their application. To explore whether their deficiencies could be compensated by preparing copolymers consisting of both PLL and PEI, we generated several combinations of PLL-alkyl-PEI copolymers conjugated to aptamer and evaluated their both gene delivery efficiency and down-regulation of Bcl-XL, an anti-apoptotic gene, in lung cancer cell line. PLL was conjugated to either 10% or 50% of PEI by grafting different percentages of PEI to alkylated-PLL as core. The properties of modified polymers including size, surface charge density, DNA condensation ability, buffering capacity and cytotoxicity were evaluated. According to transfection results, aptamer conjugated PLL-alkyl-10%-PEI (PLPE8%) was selected for further gene silencing study by plasmid shRNA. Decrease in Bcl-XL gene expression was estimated by both RT-PCR and western-blot experiments. The obtained results revealed that the new copolymers had appropriate nano-scale size (117-128 nm) even after aptamer conjugation (168-183 nm). Moreover, they exhibited increased transfection efficiencies by up to 1.8-5 folds and acceptable cytotoxicity. The apoptosis was induced in transfected cells by shRNA-aptamer-copolymer due to the down-regulation of mRNA and protein levels. This study suggested a new vector for targeted non-viral gene delivery with high transfection efficiency in lung cancer or pulmonary systems. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. The tyranny of adenosine recognition among RNA aptamers to coenzyme A

    Directory of Open Access Journals (Sweden)

    Frank Joseph

    2003-12-01

    Full Text Available Abstract Background Understanding the diversity of interactions between RNA aptamers and nucleotide cofactors promises both to facilitate the design of new RNA enzymes that utilize these cofactors and to constrain models of RNA World evolution. In previous work, we isolated six pools of high affinity RNA aptamers to coenzyme A (CoA, the principle cofactor in biological acyltransfer reactions. Interpretation of the evolutionary significance of those results was made difficult by the fact that the affinity resin attachment strongly influenced the outcome of those selections. Here we describe the selection of four new pools isolated on a disulfide-linked CoA affinity matrix to minimize context-dependent recognition imposed by the attachment to the solid support. Results The four new aptamer libraries show no sequence or structural relation to a previously dominant CoA-binding species, even though they were isolated from the same initial random libraries. Recognition appears to be limited to the adenosine portion of the CoA – in particular the Höogsteen edge – for most isolates surveyed, even when a counter selection was employed to remove such RNAs. Two of the recovered isolates are eluted with intact CoA more efficiently than with AMP alone suggesting a possible pantotheine interaction. However, a detailed examination of recognition specificity revealed that the 3' phosphate of CoA, and not the pantotheine arm, determined recognition by these two isolates. Conclusion Most aptamers that have been targeted towards cofactors containing adenosine recognize only the adenosine portion of the cofactor. They do not distinguish substituents on the 5' carbon, even when those substituents have offered hydrogen bonding opportunities and the selection conditions discouraged adenosine recognition. Beyond hydrogen bonding, additional factors that guide the selection towards adenosine recognition include aromatic stacking interactions and relatively few

  17. Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

    Science.gov (United States)

    Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

    2014-10-01

    The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.

  18. RNA aptamers for an essential prebiotic molecule: adenine

    Science.gov (United States)

    Meli, M.; Vergne, J.; Josse, T.; Décout, J.-L.; Maurel, M.-C.

    2001-08-01

    Among all known bio-organic molecules within the living cells, RNA molecules are the only ones storing genetic information and performing catalysis. The RNA world hypthesis assumes that livings on earth are derived from an RNA molecular ancestor where RNA both stored the genetic information and catalyzed the first metabolic reactions. Among diverse RNA worlds proposed, it is thought that the invention of translation and encoded peptide synthesis took place with a "breakthrough organism", then giving rise to a ribonucleoprotein (RNP) world. Finally, modern biochemistry arose with the invention of DNA and the birth of modern molecular biology where the information flows from DNA to RNA which directs protein synthesis. Considering modern metabolism, it is possible to assign biochemical traits to the last common ancestor by simple parsimony rules, and assumptions about earlier metabolisms are possible using chemical criteria. According to this point of view, modern metabolism is considered as a palimpsest that has to be read and deciphered in ordered to understand its origin and evolution.

  19. Identification of RNA aptamers that internalize into HPV-16 E6/E7 transformed tonsillar epithelial cells.

    Science.gov (United States)

    Gourronc, Francoise A; Rockey, William M; Thiel, William H; Giangrande, Paloma H; Klingelhutz, Aloysius J

    2013-11-01

    Human papillomavirus type 16 (HPV-16) associated oropharyngeal cancers are on a significant increase and better therapeutic strategies are needed. The HPV-16 oncogenes E6 and E7 are expressed in HPV-associated cancers and are able to transform human tonsillar epithelial cells (HTECs). We used cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to select for RNA aptamers that entered into HPV-16 E6/E7-HTECs. After 12 rounds of cell-SELEX, a pool of aptamers was obtained that had significantly greater internalization capacity (~5-fold) into E6/E7-HTECs as compared to primary HTECs or fibroblasts. Analysis of individual aptamers from the pool indicated variable internalization into E6/E7-HTECs (1-8-fold as compared to a negative control). Most of the individual aptamers internalized into E6/E7 and primary HTECs with similar efficiency, while one aptamer exhibited ~3-fold better internalization into E6/E7-HTECs. Aptamers that internalize into cells may be useful for delivering therapeutic agents to HPV-16 associated malignancies. © 2013 Elsevier Inc. All rights reserved.

  20. Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Tesmer, Valerie M.; Lennarz, Sabine; Mayer, Günter; Tesmer, John J.G. (Bonn); (Michigan)

    2012-08-31

    Cardiovascular homeostasis is maintained in part by the rapid desensitization of activated heptahelical receptors that have been phosphorylated by G protein-coupled receptor kinase 2 (GRK2). However, during chronic heart failure GRK2 is upregulated and believed to contribute to disease progression. We have determined crystallographic structures of GRK2 bound to an RNA aptamer that potently and selectively inhibits kinase activity. Key to the mechanism of inhibition is the positioning of an adenine nucleotide into the ATP-binding pocket and interactions with the basic {alpha}F-{alpha}G loop region of the GRK2 kinase domain. Constraints imposed on the RNA by the terminal stem of the aptamer also play a role. These results highlight how a high-affinity aptamer can be used to selectively trap a novel conformational state of a protein kinase.

  1. Cell-Internalization SELEX: Method for Identifying Cell-Internalizing RNA Aptamers for Delivering siRNAs to Target Cells

    Science.gov (United States)

    Thiel, William H.; Thiel, Kristina W.; Flenker, Katie S.; Bair, Tom; Dupuy, Adam J.; McNamara, James O.; Miller, Francis J.; Giangrande, Paloma H.

    2015-01-01

    After a decade of work to address cellular uptake, the principal obstacle to RNAi-based therapeutics, there is now well-deserved, renewed optimism about RNAi-based drugs. Phase I and II studies have shown safe, strong, and durable-gene knockdown (80–90 %, lasting for a month after a single injection) and/or clinical benefit in treating several liver pathologies. Although promising, these studies have also highlighted the need for robust delivery techniques to develop RNAi therapeutics for treating other organ systems and diseases. Conjugation of siRNAs to cell-specific, synthetic RNA ligands (aptamers) is being proposed as a viable solution to this problem. While encouraging, the extended use of RNA aptamers as a delivery tool for siRNAs awaits the identification of RNA aptamer sequences capable of targeting and entering the cytoplasm of many different cell types. We describe a cell-based selection process for the rapid identification and characterization of RNA aptamers suited for delivering siRNA drugs into the cytoplasm of target cells. This process, termed “cell-internalization SELEX (Systematic Evolution of Ligands by Exponential Enrichment),” entails the combination of multiple sophisticated technologies, including cell culture-based SELEX procedures, next-generation sequencing (NGS), and novel bioinformatics tools. PMID:25319652

  2. Blind SELEX Approach Identifies RNA Aptamers That Regulate EMT and Inhibit Metastasis.

    Science.gov (United States)

    Yoon, Sorah; Armstrong, Brian; Habib, Nagy; Rossi, John J

    2017-07-01

    Identifying targets that are exposed on the plasma membrane of tumor cells, but expressed internally in normal cells, is a fundamental issue for improving the specificity and efficacy of anticancer therpeutics. Using blind cell Systemic Evolution of Ligands by EXponetial enrichment (SELEX), which is untargeted SELEX, we have identified an aptamer, P15, which specifically bound to the human pancreatic adenocarcinoma cells. To identify the aptamer binding plasma membrane protein, liquid chromatography tandem mass spectrometry (LC-MS/MS) was used. The results of this unbiased proteomic mass spectrometry approach identified the target of P15 as the intermediate filament vimentin, biomarker of epithelial-mesenchymal transition (EMT), which is an intracellular protein but is specifically expressed on the plasma membrane of cancer cells. As EMT plays a pivotal role to transit cancer cells to invasive cells, tumor cell metastasis assays were performed in vitro P15-treated pancreatic cancer cells showed the significant inhibition of tumor metastasis. To investigate the downstream effects of P15, EMT-related gene expression analysis was performed to identify differently expressed genes (DEG). Among five DEGs, P15-treated cells showed the downregulated expression of matrix metallopeptidase 3 (MMP3), which is involved in cancer invasion. These results, for the first time, demonstrate that P15 binding to cell surface vimentin inhibits the tumor cell invasion and is associated with reduced MMP3 expression. Thus, suggesting that P15 has potential as an anti-metastatic therapy in pancreatic cancer.Implications: This study reveals that anti-vimentin RNA aptamers selected via blind-SELEX inhibit the tumor cell metastasis. Mol Cancer Res; 15(7); 811-20. ©2017 AACR. ©2017 American Association for Cancer Research.

  3. RNA nanoparticles harboring annexin A2 aptamer can target ovarian cancer for tumor-specific doxorubicin delivery.

    Science.gov (United States)

    Pi, Fengmei; Zhang, Hui; Li, Hui; Thiviyanathan, Varatharasa; Gorenstein, David G; Sood, Anil K; Guo, Peixuan

    2017-04-01

    A novel modified nucleic acid nanoparticle harboring an annexin A2 aptamer for ovarian cancer cell targeting and a GC rich sequence for doxorubicin loading is designed and constructed. The system utilizes a highly stable three-way junction (3WJ) motif from phi29 packaging RNA as a core structure. A phosphorothioate-modified DNA aptamer targeting annexin A2, Endo28, was conjugated to one arm of the 3WJ. The pRNA-3WJ motif retains correct folding of attached aptamer, keeping its functions intact. It is of significant utility for aptamer-mediated targeted delivery. The DNA/RNA hybrid nanoparticles remained intact after systemic injection in mice and strongly bound to tumors with little accumulation in healthy organs 6 h post-injection. The Endo28-3WJ-Sph1/Dox intercalates selectively enhanced toxicity to annexin A2 positive ovarian cancer cells in vitro. The constructed RNA/DNA hybrid nanoparticles can potentially enhance the therapeutic efficiency of doxorubicin at low doses for ovarian cancer treatment through annexin A2 targeted drug delivery. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. HIV-1 subtype C primary isolates exhibit high sensitivity to an anti-gp120 RNA aptamer

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2012-09-01

    Full Text Available Globally, HIV-1 subtype C is the most prevalent subtype, yet most antiretroviral drugs are developed against subtype B. UCLA1 RNA aptamer, which we previously showed neutralizes HIV-1 subtype C Env-pseudotyped viruses was examined for neutralization...

  5. The nucleolin targeting aptamer AS1411 destabilizes Bcl-2 messenger RNA in human breast cancer cells.

    Science.gov (United States)

    Soundararajan, Sridharan; Chen, Weiwei; Spicer, Eleanor K; Courtenay-Luck, Nigel; Fernandes, Daniel J

    2008-04-01

    We sought to determine whether nucleolin, a bcl-2 mRNA-binding protein, has a role in the regulation of bcl-2 mRNA stability in MCF-7 and MDA-MB-231 breast cancer cells. Furthermore, we examined the efficacy of the aptamer AS1411 in targeting nucleolin and inducing bcl-2 mRNA instability and cytotoxicity in these cells. AS1411 at 5 micromol/L inhibited the growth of MCF-7 and MDA-MB-231 cells, whereas 20 micromol/L AS1411 had no effect on the growth rate or viability of normal MCF-10A mammary epithelial cells. This selectivity of AS1411 was related to a greater uptake of AS1411 into the cytoplasm of MCF-7 cells compared with MCF-10A cells and to a 4-fold higher level of cytoplasmic nucleolin in MCF-7 cells. Stable siRNA knockdown of nucleolin in MCF-7 cells reduced nucleolin and bcl-2 protein levels and decreased the half-life of bcl-2 mRNA from 11 to 5 hours. Similarly, AS1411 (10 micromol/L) decreased the half-life of bcl-2 mRNA in MCF-7 and MDA-MB-231 cells to 1.0 and 1.2 hours, respectively. In contrast, AS1411 had no effect on the stability of bcl-2 mRNA in normal MCF-10A cells. AS1411 also inhibited the binding of nucleolin to the instability element AU-rich element 1 of bcl-2 mRNA in a cell-free system and in MCF-7 cells. Together, the results suggest that AS1411 acts as a molecular decoy by competing with bcl-2 mRNA for binding to cytoplasmic nucleolin in these breast cancer cell lines. This interferes with the stabilization of bcl-2 mRNA by nucleolin and may be one mechanism by which AS1411 induces tumor cell death.

  6. In vivo SELEX for Identification of Brain-penetrating Aptamers

    Directory of Open Access Journals (Sweden)

    Congsheng Cheng

    2013-01-01

    Full Text Available The physiological barriers of the brain impair drug delivery for treatment of many neurological disorders. One delivery approach that has not been investigated for their ability to penetrate the brain is RNA-based aptamers. These molecules can impart delivery to peripheral tissues and circulating immune cells, where they act as ligand mimics or can be modified to carry payloads. We developed a library of aptamers and an in vivo evolution protocol to determine whether specific aptamers could be identified that would home to the brain after injection into the peripheral vasculature. Unlike biopanning with recombinant bacteriophage libraries, we found that the aptamer library employed here required more than 15 rounds of in vivo selection for convergence to specific sequences. The aptamer species identified through this approach bound to brain capillary endothelia and penetrated into the parenchyma. The methods described may find general utility for targeting various payloads to the brain.

  7. Cell-specific RNA aptamer against human CCR5 specifically targets HIV-1 susceptible cells and inhibits HIV-1 infectivity.

    Science.gov (United States)

    Zhou, Jiehua; Satheesan, Sangeetha; Li, Haitang; Weinberg, Marc S; Morris, Kevin V; Burnett, John C; Rossi, John J

    2015-03-19

    The C-C chemokine receptor type 5 (CCR5) is a receptor expressed by T cells and macrophages that serves as a coreceptor for macrophage-tropic HIV-1. Loss of CCR5 is associated with resistance to HIV-1. Here, we combine the live-cell-based SELEX with high-throughput sequencing technology to generate CCR5 RNA aptamers capable of specifically targeting HIV-1 susceptible cells (as small interfering RNA [siRNA] delivery agent) and inhibiting HIV-1 infectivity (as antiviral agent) via block of the CCR5 required for HIV-1 to enter cells. One of the best candidates, G-3, efficiently bound and was internalized into human CCR5-expressing cells. The G-3 specifically neutralized R5 virus infection in primary peripheral blood mononuclear cells, and in vivo generated human CD4(+) T cells with a nanomolar inhibitory concentration 50%. G-3 was also capable of transferring functional siRNAs to CCR5-expressing cells. Collectively, the cell-specific, internalizing, CCR5-targeted aptamers and aptamer-siRNA conjugates offer promise for overcoming some of the current challenges of drug resistance in HIV-1 by providing cell-type- or tissue-specific delivery of various therapeutic moieties.

  8. Aptamers for biosensors

    OpenAIRE

    Bini, A

    2009-01-01

    Aptamers are single-stranded DNA or RNA molecules isolated in vitro by a selection and amplification method. Aptamers bind with high specificity and affinity to a wide range of target molecules, with dissociation constant comparable to antibodies. In this work aptamers were employed as a new kind of bio-recognition element in affinity biosensors for the detection of clinically relevant proteins in heterogeneous assay, using Piezoelectric Quartz Crystal Microbalance and Surface ...

  9. Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats.

    Science.gov (United States)

    Dua, Pooja; Ren, Shuo; Lee, Sang Wook; Kim, Joon-Ki; Shin, Hye-Su; Jeong, Ok-Chan; Kim, Soyoun; Lee, Dong-Ki

    2016-11-30

    Escherichia coli are important indicator organisms, used routinely for the monitoring of water and food safety. For quick, sensitive and real-time detection of E. coli we developed a 2'F modified RNA aptamer Ec3, by Cell-SELEX. The 31 nucleotide truncated Ec3 demonstrated improved binding and low nano-molar affinity to E. coli. The aptamer developed by us out-performs the commercial antibody and aptamer used for E. coli detection. Ec3(31) aptamer based E. coli detection was done using three different detection formats and the assay sensitivities were determined. Conventional Ec3(31)-biotin-streptavidin magnetic separation could detect E. coli with a limit of detection of 1.3 × 10(6) CFU/ml. Although, optical analytic technique, biolayer interferometry, did not improve the sensitivity of detection for whole cells, a very significant improvement in the detection was seen with the E. coli cell lysate (5 × 10(4) CFU/ml). Finally we developed Electrochemical Impedance Spectroscopy (EIS) gap capacitance biosensor that has detection limits of 2 × 10(4) CFU/mL of E. coli cells, without any labeling and signal amplification techniques. We believe that our developed method can step towards more complex and real sample application.

  10. 3D Cell-SELEX: Development of RNA aptamers as molecular probes for PC-3 tumor cell line.

    Science.gov (United States)

    Souza, Aline G; Marangoni, Karina; Fujimura, Patrícia T; Alves, Patrícia T; Silva, Márcio J; Bastos, Victor Alexandre F; Goulart, Luiz R; Goulart, Vivian A

    2016-02-15

    Human prostate cancer (PCa) is a highly heterogeneous and multifactorial disease. Current clinical biomarkers are not sufficiently accurate, thus being unable to predict the clinical outcome. Therefore, searching for new biomarkers aiming to improve diagnosis, prognosis and therapy is still required. In this study, we performed 3D Cell-SELEX against PC-3 prostate cancer cell line, a novel strategy to select specific nucleic acid ligands against spheroid cells in 3D cell culture. This original system combines Cell-SELEX, a process that exploits the cellular structure to generate specific ligands, and 3D cell culture, an approach that mimics the tissue microenvironment in vitro. In the first round of 3D Cell-SELEX, a negative selection against RWPE-1, non-tumor cell line, was performed to subtract non-tumor specific aptamers. The supernatant was used in eight additional rounds of selection, which were performed against PC-3 cell line. After nine selection cycles, eight PC-3 specific RNA aptamers were selected and sequenced. The aptamers presented sizes between 20 and 50 nucleotides-long, with low free energy (∆GSELEX procedure improved the selection of PCa cell-surface ligands and the aptamer A4 has shown potential for the identification of prostate tumor cells, suggesting the application of this molecule in further screening assays for PCa. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Label-free RNA aptamer-based capacitive biosensor for the detection of C-reactive protein.

    Science.gov (United States)

    Qureshi, Anjum; Gurbuz, Yasar; Kallempudi, Saravan; Niazi, Javed H

    2010-08-28

    In this study, we report a novel aptamer-based capacitive label-free biosensor for monitoring transducing aptamer-protein recognition events, based on charge distribution under the applied frequency by non-Faradaic impedance spectroscopy (NFIS). This approach to capacitive biosensors is reported for the first time in this study, is reagent-less in processing and is developed using gold interdigitated (GID) capacitor arrays functionalized with synthetic RNA aptamers. The RNA atpamers served as biorecognition elements for C-reactive protein (CRP), a biomarker for cardiovascular disease risk (CVR). The signal is generated as a result of the change in relative capacitance occurring as a result of the formation of an RNA-CRP complex on GID capacitors with the applied AC electrical frequency (50-350 MHz). The dispersion peak of the capacitance curve was dependent on the CRP concentration and tends to shift toward lower frequencies, accompanied by the increase in relaxation time due to the increased size of the aptamer-CRP complex. The dissociation constant (K(d)) calculated from the non-linear regression analysis of the relative capacitance change with the applied frequency showed that strong binding of CRP occurred at 208 MHz (K(d) = 1.6 microM) followed by 150 MHz (K(d) = 4.2 microM) and 306 MHz (K(d) = 3.4 microM) frequencies. The dynamic detection range for CRP is determined to be within 100-500 pg ml(-1). Our results demonstrates the behavior of an RNA-protein complex on GID capacitors under an applied electric field, which can be extended to other pairs of affinity biomolecules as well as for the development of electrical biosensor systems for different applications, including the early diagnosis of diseases.

  12. Aptamer-miRNA-212 Conjugate Sensitizes NSCLC Cells to TRAIL

    Directory of Open Access Journals (Sweden)

    Margherita Iaboni

    2016-01-01

    Full Text Available TNF-related apoptosis-inducing ligand (TRAIL is a promising antitumor agent for its remarkable ability to selectively induce apoptosis in cancer cells, without affecting the viability of healthy bystander cells. The TRAIL tumor suppressor pathway is deregulated in many human malignancies including lung cancer. In human non-small cell lung cancer (NSCLC cells, sensitization to TRAIL therapy can be restored by increasing the expression levels of the tumor suppressor microRNA-212 (miR-212 leading to inhibition of the anti-apoptotic protein PED/PEA-15 implicated in treatment resistance. In this study, we exploited a previously described RNA aptamer inhibitor of the tyrosine kinase receptor Axl (GL21.T expressed on lung cancer cells, as a means to deliver miR-212 into human NSCLC cells expressing Axl. We demonstrate efficient delivery of miR-212 following conjugation of the miR to GL21.T (GL21.T-miR212 chimera. We show that the chimera downregulates PED and restores TRAIL-mediate cytotoxicity in cancer cells. Importantly, treatment of Axl+ lung cancer cells with the chimera resulted in (i an increase in caspase activation and (ii a reduction of cell viability in combination with TRAIL therapy. In conclusion, we demonstrate that the GL21.T-miR212 chimera can be employed as an adjuvant to TRAIL therapy for the treatment of lung cancer.

  13. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites

    DEFF Research Database (Denmark)

    Dupont, Daniel M; Thuesen, Cathrine K; Bøtkjær, Kenneth A;

    2015-01-01

    Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless...... potential, both binding to the serine protease urokinase-type plasminogen activator (uPA). We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A) controlling uPA activities. One of the aptamers (upanap-126) binds to the area...... around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12) binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro...

  14. Blocking the maturation of OncomiRNAs using pri-miRNA-17∼92 aptamer in retinoblastoma.

    Science.gov (United States)

    Subramanian, Nithya; Kanwar, Jagat R; Kanwar, Rupinder K; Krishnakumar, Subramanian

    2015-02-01

    The miR-17∼92. or oncomiR-1, cluster encodes oncogenic microRNAs (miRNAs), and it also promotes retinoblastoma (RB) tumor formation. Antagomir and miRNA mimics based approaches are widely tried against oncogenic and tumor suppressive miRNAs. Other methods for targeting cancer related miRNAs are still under development. In the current study, we focused on the pri-miRNA-17∼92 aptamer (pri-apt), which can potentially replace the mix of five antagomirs by one aptamer that function to abrogate the maturation of miR-17, miR-18a, and miR-19b (Ppri-apt led to S-phase arrest in WERI-Rb1 cells and onset of apoptosis in both Y79 and WERI-Rb1 cell lines. There was increased cytotoxicity as measured by lactate dehydrogenase activity in pri-apt treated Y79 cells (Ppri-apt in RB cell lines, which can be readily modified by developing appropriate vectors for the delivery of the aptamer specifically to cancer cells.

  15. EpCAM Aptamer-siRNA Chimera Targets and Regress Epithelial Cancer.

    Directory of Open Access Journals (Sweden)

    Nithya Subramanian

    Full Text Available Epithelial cell adhesion molecule (EpCAM, a cancer stem cell (CSC marker is over expressed in epithelial cancers and in retinoblastoma (RB. We fabricated an EpCAM targeting aptamer-siRNA chimera and investigated its anti-tumor property and EpCAM intracellular domain (EpICD mediated signaling in epithelial cancer. The anti-tumor efficacy of EpCAM aptamer-siEpCAM chimera (EpApt-siEp was evaluated by qPCR, northern and Western blotting in WERI-Rb1- RB cell line, primary RB tumor cells and in MCF7- breast cancer cell line. Anti-tumor activity of EpApt-siEp was studied in vivo using epithelial cancer (MCF7 mice xenograft model. The mechanism and pathways involved in the anti-tumor activity was further studied using protein arrays and qPCR. EpApt-siEp chimera was processed in vitro by dicer enzyme. Treatment of the WERI-Rb1 and MCF7 cells with EpApt-siEp revealed statistically significant down regulation of EpCAM expression (P<0.005 and concomitant reduction in cellular proliferation. In primary RB cells cultured from RB tumors, EpApt-siEp silenced EpCAM, significantly inhibited (P<0.01 cell proliferation and induced cytotoxicity. Knockdown of EpICD expressed in RB primary tumors led to repression of pluripotency markers, SOX2, OCT4, NANOG, and CD133. In vivo studies showed complete tumor growth regression without any toxicity in animals (P<0.001 and tumor tissues showed significant downregulation (P<0.05 of EpCAM, MRP1, ABCG2, stathmin, survivin and upregulation of ATM (P<0.05 leading to apoptosis by intrinsic pathway with minor alteration in cytokines. Our results revealed that EpApt-siEp potentially eradicated EpCAM positive cancer cells through CSC marker suppression and apoptosis, while sparing normal EpCAM negative adjacent cells.

  16. An RNA aptamer provides a novel approach for the induction of apoptosis by targeting the HPV16 E7 oncoprotein.

    Directory of Open Access Journals (Sweden)

    Clare Nicol

    Full Text Available BACKGROUND: Human papillomavirus 16 (HPV16 is a high-risk DNA tumour virus, which is a major causative agent of cervical cancer. Cellular transformation is associated with deregulated expression of the E6 and E7 oncogenes. E7 has been shown to bind a number of cellular proteins, including the cell cycle control protein pRb. In this study, RNA aptamers (small, single-stranded oligonucleotides selected for high-affinity binding to HPV16 E7 were employed as molecular tools to further investigate these protein-protein interactions. METHODOLOGY/PRINCIPAL FINDINGS: This study is focused on one aptamer (termed A2. Transfection of this molecule into HPV16-transformed cells resulted in inhibition of cell proliferation (shown using real-time cell electronic sensing and MTT assays due to the induction of apoptosis (as demonstrated by Annexin V/propidium iodide staining. GST-pull down and bead binding assays were used to demonstrate that the binding of A2 required N-terminal residues of E7 known to be involved in interaction with the cell cycle control protein, pRb. Using a similar approach, A2 was shown to disrupt the interaction between E7 and pRb in vitro. Furthermore, transfection of HPV16-transformed cells with A2 appeared to result in the loss of E7 and rise in pRb levels, as observed by immunoblotting. CONCLUSIONS/SIGNIFICANCE: This paper includes the first characterisation of the effects of an E7 RNA aptamer in a cell line derived from a cervical carcinoma. Transfection of cells with A2 was correlated with the loss of E7 and the induction of apoptosis. Aptamers specific for a number of cellular and viral proteins have been documented previously; one aptamer (Macugen is approved for clinical use and several others are in clinical trials. In addition to its role as a molecular tool, A2 could have further applications in the future.

  17. An RNA aptamer possessing a novel monovalent cation-mediated fold inhibits lysozyme catalysis by inhibiting the binding of long natural substrates.

    Science.gov (United States)

    Padlan, Camille S; Malashkevich, Vladimir N; Almo, Steve C; Levy, Matthew; Brenowitz, Michael; Girvin, Mark E

    2014-04-01

    RNA aptamers are being developed as inhibitors of macromolecular and cellular function, diagnostic tools, and potential therapeutics. Our understanding of the physical nature of this emerging class of nucleic acid-protein complexes is limited; few atomic resolution structures have been reported for aptamers bound to their protein target. Guided by chemical mapping, we systematically minimized an RNA aptamer (Lys1) selected against hen egg white lysozyme. The resultant 59-nucleotide compact aptamer (Lys1.2minE) retains nanomolar binding affinity and the ability to inhibit lysozyme's catalytic activity. Our 2.0-Å crystal structure of the aptamer-protein complex reveals a helical stem stabilizing two loops to form a protein binding platform that binds lysozyme distal to the catalytic cleft. This structure along with complementary solution analyses illuminate a novel protein-nucleic acid interface; (1) only 410 Å(2) of solvent accessible surface are buried by aptamer binding; (2) an unusually small fraction (∼18%) of the RNA-protein interaction is electrostatic, consistent with the limited protein phosphate backbone contacts observed in the structure; (3) a single Na(+) stabilizes the loops that constitute the protein-binding platform, and consistent with this observation, Lys1.2minE-lysozyme complex formation takes up rather than displaces cations at low ionic strength; (4) Lys1.2minE inhibits catalysis of large cell wall substrates but not catalysis of small model substrates; and (5) the helical stem of Lys1.2minE can be shortened to four base pairs (Lys1.2minF) without compromising binding affinity, yielding a 45-nucleotide aptamer whose structure may be an adaptable protein binding platform.

  18. The screening of RNA aptamers specific for carbonic anhydrase I using the Systematic Evolution of Ligands by an Exponential Enrichment Method (SELEX).

    Science.gov (United States)

    Shrivastava, Garima; Hyodo, Mamoru; Ara, Mst Naznin; Harashima, Hideyoshi

    2014-01-01

    Carbonic anhydrases (CA) or carbonate dehydratases are a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate. CA I is the most abundant protein in the cytosol and has been reported to the partially associated with a number of fatal diseases. A newly established Systematic Evolution of Ligands by EXponential enrichment (SELEX) method referred to as Protein-SELEX was used to select RNA aptamers against the human erythrocyte CA I (CA I) protein. After five rounds of selection and counter selection the specific binding of the 6th cycle in vitro transcribed RNA library to CA I was detected by an Electrophoretic Mobility Shift Assay (EMSA). Three Specific sequences were identified as binding candidates after cloning and sequence analysis and one of the selected CA I specific RNA aptamers, CAapt1, was used to confirm specific binding and the Kd values were determined using an EMSA. The CAapt1 RNA aptamer showed no affinity towards any other protein and in comparison to the "0" cycle library, a significant enrichment was obtained. This methodology permitted us to successfully investigate the ssRNA aptamer CAapt1 for CA I protein.

  19. Efficient Reverse Transcription Using Locked Nucleic Acid Nucleotides towards the Evolution of Nuclease Resistant RNA Aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    Modified nucleotides are increasingly being utilized in the de novo selection of aptamers for enhancing their drug-like character and abolishing the need for time consuming trial-and-error based post-selection modifications. Locked nucleic acid (LNA) is one of the most prominent and successful nu...

  20. Use of aptamers in immunoassays.

    Science.gov (United States)

    Nezlin, Roald

    2016-02-01

    Aptamers, short single-chain DNA or RNA oligonucleotides, react specifically with small molecules, as well as with proteins. Unlike antibodies, they may be obtained relatively easily. Aptamers are now widely employed in immunological studies and could replace antibodies in immunoassays. In this short review, methods for immobilizing aptamers on various insoluble materials (so-called apta-sorbents) are described. Recent findings on their use in the detection and isolation of immunoglobulins and their application in various immunoassays are also discussed.

  1. Selection of 2'F-modified RNA aptamers against prostate-specific antigen and their evaluation for diagnostic and therapeutic applications.

    Science.gov (United States)

    Svobodova, M; Bunka, D H J; Nadal, P; Stockley, P G; O'Sullivan, C K

    2013-11-01

    Currently, prostate-specific antigen (PSA) is considered to be the most sensitive marker available for prostate cancer detection and for monitoring of disease progression. In addition to its importance as a tumor marker, PSA has a role in the biological activity of cancer growth and proliferation. Therefore, the inhibition or activation of its biological activity may be used in prostate cancer therapy. Here, we describe the isolation and characterization of new 2'F-modified RNA aptamers directed against PSA. Binding studies demonstrate the ability of these new aptamers to specifically recognize their target with dissociation constants in the nanomolar range. In order to demonstrate the functionality of the selected aptamers, an apta-PCR approach was used for the quantitative detection of PSA, achieving a limit of detection of 11 nM. Furthermore, the potential use of the selected aptamers in therapeutics was demonstrated with the 2'F-modified aptamers being highly stable in human serum and having the ability to moderate the activity of PSA, which will be explored for the treatment of prostate cancer.

  2. A combinatorial approach to the repertoire of RNA kissing motifs; towards multiplex detection by switching hairpin aptamers.

    Science.gov (United States)

    Durand, Guillaume; Dausse, Eric; Goux, Emma; Fiore, Emmanuelle; Peyrin, Eric; Ravelet, Corinne; Toulmé, Jean-Jacques

    2016-05-19

    Loop-loop (also known as kissing) interactions between RNA hairpins are involved in several mechanisms in both prokaryotes and eukaryotes such as the regulation of the plasmid copy number or the dimerization of retroviral genomes. The stability of kissing complexes relies on loop parameters (base composition, sequence and size) and base combination at the loop-loop helix - stem junctions. In order to identify kissing partners that could be used as regulatory elements or building blocks of RNA scaffolds, we analysed a pool of 5.2 × 10(6) RNA hairpins with randomized loops. We identified more than 50 pairs of kissing RNA hairpins. Two kissing motifs, 5'CCNY and 5'RYRY, generate highly stable complexes with KDs in the low nanomolar range. Such motifs were introduced in the apical loop of hairpin aptamers that switch between unfolded and folded state upon binding to their cognate target molecule, hence their name aptaswitch. The aptaswitch-ligand complex is specifically recognized by a second RNA hairpin named aptakiss through loop-loop interaction. Taking advantage of our kissing motif repertoire we engineered aptaswitch-aptakiss modules for purine derivatives, namely adenosine, GTP and theophylline and demonstrated that these molecules can be specifically and simultaneously detected by surface plasmon resonance or by fluorescence anisotropy. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Crystal structure of Hfq from Bacillus subtilis in complex with SELEX-derived RNA aptamer: insight into RNA-binding properties of bacterial Hfq

    Science.gov (United States)

    Someya, Tatsuhiko; Baba, Seiki; Fujimoto, Mai; Kawai, Gota; Kumasaka, Takashi; Nakamura, Kouji

    2012-01-01

    Bacterial Hfq is a protein that plays an important role in the regulation of genes in cooperation with sRNAs. Escherichia coli Hfq (EcHfq) has two or more sites that bind RNA(s) including U-rich and/or the poly(A) tail of mRNA. However, functional and structural information about Bacillus subtilis Hfq (BsHfq) including the RNA sequences that specifically bind to it remain unknown. Here, we describe RNA aptamers including fragment (AG)3A that are recognized by BsHfq and crystal structures of the BsHfq–(AG)3A complex at 2.2 Å resolution. Mutational and structural studies revealed that the RNA fragment binds to the distal site, one of the two binding sites on Hfq, and identified amino acid residues that are critical for sequence-specific interactions between BsHfq and (AG)3A. In particular, R32 appears to interact with G bases in (AG)3A. Poly(A) also binds to the distal site of EcHfq, but the overall RNA structure and protein–RNA interaction patterns engaged in the R32 residues of BsHfq–(AG)3A differ from those of EcHfq–poly(A). These findings provide novel insight into how the Hfq homologue recognizes RNA. PMID:22053080

  4. Recent advances of aptamer sensors

    Institute of Scientific and Technical Information of China (English)

    LI YiLin; GUO Lei; ZHANG ZhaoYang; TANG JiJun; XIE JianWei

    2008-01-01

    Aptamers are a series of high-affinity and high-specificity oligoneucleotides (single-stranded DNA or RNA) to the target, usually selected by the combinatorial chemistry SELEX technique (systematic evolution of ligands by exponential enrichment). Aptamers have proved to be one kind of novel func-tional molecules in life science and chemistry. After being labeled by signaling groups, the aptamer probe can conveniently transfer the characteristics of aptamer-target recognition to a form of high-sensitive signal, and the high-affinity, high-specificity measurements of metal ion, organic mole-cules, nucleic acid, proteins, or cells become possible. This article summarizes the recent advances of aptamer probes in different sensing fields, with special emphasis on aptamer probes as fluorescent sensors.

  5. Recent advances of aptamer sensors

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Aptamers are a series of high-affinity and high-specificity oligoneucleotides (single-stranded DNA or RNA) to the target, usually selected by the combinatorial chemistry SELEX technique (systematic evolution of ligands by exponential enrichment). Aptamers have proved to be one kind of novel functional molecules in life science and chemistry. After being labeled by signaling groups, the aptamer probe can conveniently transfer the characteristics of aptamer-target recognition to a form of high-sensitive signal, and the high-affinity, high-specificity measurements of metal ion, organic molecules, nucleic acid, proteins, or cells become possible. This article summarizes the recent advances of aptamer probes in different sensing fields, with special emphasis on aptamer probes as fluorescent sensors.

  6. The Toolbox for Modified Aptamers.

    Science.gov (United States)

    Lapa, Sergey A; Chudinov, Alexander V; Timofeev, Edward N

    2016-02-01

    Aptamers are nucleic acid-based scaffolds that can bind with high affinity to a variety of biological targets. Aptamers are identified from large DNA or RNA libraries through a process of directed molecular evolution (SELEX). Chemical modification of nucleic acids considerably increases the functional and structural diversity of aptamer libraries and substantially increases the affinity of the aptamers. Additionally, modified aptamers exhibit much greater resistance to biodegradation. The evolutionary selection of modified aptamers is conditioned by the possibility of the enzymatic synthesis and replication of non-natural nucleic acids. Wild-type or mutant polymerases and their non-natural nucleotide substrates that can support SELEX are highlighted in the present review. A focus is made on the efforts to find the most suitable type of nucleotide modifications and the engineering of new polymerases. Post-SELEX modification as a complementary method will be briefly considered as well.

  7. Aptamer-hybrid nanoparticle bioconjugate efficiently delivers miRNA-29b to non-small-cell lung cancer cells and inhibits growth by downregulating essential oncoproteins

    Directory of Open Access Journals (Sweden)

    Perepelyuk M

    2016-07-01

    Full Text Available Maryna Perepelyuk, Christina Maher, Ashakumary Lakshmikuttyamma, Sunday A Shoyele Department of Pharmaceutical Science, College of Pharmacy, Thomas Jefferson University, Philadelphia, PA, USA Abstract: MicroRNAs (miRNAs are potentially attractive candidates for cancer therapy. However, their therapeutic application is limited by lack of availability of an efficient delivery system to stably deliver these potent molecules intracellularly to cancer cells while avoiding healthy cells. We developed a novel aptamer-hybrid nanoparticle bioconjugate delivery system to selectively deliver miRNA-29b to MUC1-expressing cancer cells. Significant downregulation of oncoproteins DNMT3b and MCL1 was demonstrated by these MUC1 aptamer-functionalized hybrid nanoparticles in A549 cells. Furthermore, downregulation of these oncoproteins led to antiproliferative effect and induction of apoptosis in a superior version when compared with Lipofectamine 2000. This novel aptamer-hybrid nanoparticle bioconjugate delivery system could potentially serve as a platform for intracellular delivery of miRNAs to cancer cells, hence improving the therapeutic outcome of lung cancer. Keywords: aptamer, nanoparticles, microRNA, lung cancer, targeted delivery

  8. Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2

    Science.gov (United States)

    Oberthür, Dominik; Achenbach, John; Gabdulkhakov, Azat; Buchner, Klaus; Maasch, Christian; Falke, Sven; Rehders, Dirk; Klussmann, Sven; Betzel, Christian

    2015-04-01

    We report the crystal structure of a 40mer mirror-image RNA oligonucleotide completely built from nucleotides of the non-natural L-chirality in complex with the pro-inflammatory chemokine L-CLL2 (monocyte chemoattractant protein-1), a natural protein composed of regular L-amino acids. The L-oligonucleotide is an L-aptamer (a Spiegelmer) identified to bind L-CCL2 with high affinity, thereby neutralizing the chemokine's activity. CCL2 plays a key role in attracting and positioning monocytes; its overexpression in several inflammatory diseases makes CCL2 an interesting pharmacological target. The PEGylated form of the L-aptamer, NOX-E36 (emapticap pegol), already showed promising efficacy in clinical Phase II studies conducted in diabetic nephropathy patients. The structure of the L-oligonucleotide.L-protein complex was solved and refined to 2.05 Å. It unveils the L-aptamer's intramolecular contacts and permits a detailed analysis of its structure-function relationship. Furthermore, the analysis of the intermolecular drug-target interactions reveals insight into the selectivity of the L-aptamer for certain related chemokines.

  9. Molecular imaging of a cancer-targeting theragnostics probe using a nucleolin aptamer- and microRNA-221 molecular beacon-conjugated nanoparticle.

    Science.gov (United States)

    Kim, Jin Kyeoung; Choi, Kyung-Ju; Lee, Minhyung; Jo, Mi-hee; Kim, Soonhag

    2012-01-01

    MicroRNAs (miRNA, miR) have been reported as cancer biomarkers that regulate tumor suppressor genes. Hence, simultaneous detecting and inhibiting of miRNA function will be useful as a cancer theragnostics probe to minimize side effects and invasiveness. In this study, we developed a cancer-targeting therangostics probe in a single system using an AS1411 aptamer - and miRNA-221 molecular beacon (miR-221 MB)-conjugated magnetic fluorescence (MF) nanoparticle (MFAS miR-221 MB) to simultaneously target to cancer tissue, image intracellularly expressed miRNA-221 and treat miRNA-221-involved carcinogenesis. AS1411 aptamer-conjugated MF (MFAS) nanoparticles displayed a great selectivity and delivery into various cancer cell lines. The miR-221 MB detached from the MFAS miR-221 MB in the cytoplasm of C6 cells clearly imaged miRNA-221 biogenesis and simultaneously resulted in antitumor therapeutic effects by inhibiting miRNA function, indicating a successful astrocytoma-targeting theragnostics. MFAS miRNA MB can be easily applied to other cancers by simply changing a targeted miRNA highly expressed in cancers.

  10. The efficient cell-SELEX strategy, Icell-SELEX, using isogenic cell lines for selection and counter-selection to generate RNA aptamers to cell surface proteins.

    Science.gov (United States)

    Takahashi, Masaki; Sakota, Eri; Nakamura, Yoshikazu

    2016-12-01

    Aptamers are short single-stranded nucleic acid molecules that are selected in vitro from a large random sequence library based on their high and specific affinity to a target molecule by a process known as SELEX. Cell-SELEX that employs whole living cells overexpressing the defined cell surface proteins (for selection) and appropriate mock cells (for counter-selection) has been widely used as a valid and feasible method for generating aptamers against specific cell surface proteins. However, the endogenous expression of target proteins in mock cells or the heterogeneity of surface proteins between selection and counter-selection cells often impeded the isolation of proper aptamers against target proteins. To solve this problem, we developed "Isogenic cell-SELEX" (Icell SELEX in short) method, in which isogenic cell lines were manipulated for counter-selection by microRNA-mediated silencing and for selection by overexpression of target proteins. As a model experiment, we targeted integrin alpha V (ITGAV), which is a major transmembrane receptor expressed in almost all the cells, and established ITGAV-overexpressed and -downregulated HEK293 cells for selection and counter-selection, respectively. By taking advantage of a hundred-fold difference in the expression level of ITGAV between these two isogenic cell lines, we easily isolated several anti-ITGAV aptamers, whose binding to the cell-surface ITGAV was confirmed by flow cytometry with the dissociation constant of 300-400 nM range. We assume that Icell-SELEX could be applicable to a wide range of cell-surface proteins including various transmembrane proteins of biological and pharmacological significance. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  11. Glutamate Receptor Aptamers and ALS

    Science.gov (United States)

    2009-01-01

    proposed, including oxidative stress, excitotoxicity, mitochondrial dysfunction, etc., the cause(s) of the disease, including the pathogenesis of the...GluR6-Selective Aptamers for Potential Autism Therapy This project is to develop RNA aptamers against a GluR6 kainate receptor mutant thought to be...involved in autism . Role: PI Department of Defense (PI: Niu) 4/1/09-3/30/14 Advanced Tech./Therapeutic Develop. Grant Developing Biostable

  12. DNA Aptamers in the Diagnosis and Treatment of Human Diseases

    Directory of Open Access Journals (Sweden)

    Qinchang Zhu

    2015-11-01

    Full Text Available Aptamers have a promising role in the field of life science and have been extensively researched for application as analytical tools, therapeutic agents and as vehicles for targeted drug delivery. Compared with RNA aptamers, DNA aptamers have inherent advantages in stability and facility of generation and synthesis. To better understand the specific potential of DNA aptamers, an overview of the progress in the generation and application of DNA aptamers in human disease diagnosis and therapy are presented in this review. Special attention is given to researches that are relatively close to practical application. DNA aptamers are expected to have great potential in the diagnosis and treatment of human diseases.

  13. The Subcellular Localisation of the Human Papillomavirus (HPV 16 E7 Protein in Cervical Cancer Cells and Its Perturbation by RNA Aptamers

    Directory of Open Access Journals (Sweden)

    Özlem Cesur

    2015-06-01

    Full Text Available Human papillomavirus (HPV is the most common viral infection of the reproductive tract, affecting both men and women. High-risk oncogenic types are responsible for almost 90% of anogenital and oropharyngeal cancers including cervical cancer. Some of the HPV “early” genes, particularly E6 and E7, are known to act as oncogenes that promote tumour growth and malignant transformation. Most notably, HPV-16 E7 interacts with the tumour suppressor protein pRb, promoting its degradation, leading to cell cycle dysregulation in infected cells. We have previously shown that an RNA aptamer (termed A2 selectively binds to HPV16 E7 and is able to induce apoptosis in HPV16-transformed cervical carcinoma cell lines (SiHa through reduction of E7 levels. In this study, we investigated the effects of the A2 aptamer on E7 localisation in order to define its effects on E7 activity. We demonstrate for the first time that E7 localised to the plasma membrane. In addition, we show that A2 enhanced E7 localisation in the ER and that the A2-mediated reduction of E7 was not associated with proteasomal degradation. These data suggest that A2 perturbs normal E7 trafficking through promoting E7 ER retention.

  14. The dual aptamer approach: rational design of a high-affinity FAD aptamer.

    Science.gov (United States)

    Merkle, T; Holder, I T; Hartig, J S

    2016-01-14

    A design strategy for high-affinity aptamers of complex biomolecules is presented. We developed an RNA with FAD-binding properties by combining known ATP- and FMN-aptamers. Cooperative binding of FAD was shown by SPR spectroscopy and fluorescence assays. The strategy should be transferable to several other biomolecules.

  15. Aptamers: Biomedical Interest and Applications

    Directory of Open Access Journals (Sweden)

    Cristina Romero-López

    2017-03-01

    Full Text Available Aptamers are short DNA or RNA oligonucleotides specialized in the specific and efficient binding to a target molecule. They are obtained by in vitro selection or evolution processes. It was in 1990 that two independent research groups described the bases of a new in vitro technology for the identification of RNA molecules able to specifically bind to a target [1,2]. Tuerk and Gold established the principals of the in vitro selection process that was named SELEX (Systematic Evolution of Ligands by Exponential enrichment, which is based on iterative cycles of binding, partitioning, and amplification of oligonucleotides from a pool of variant sequences [2]. Ellington and Szostak coined the term aptamer to define the selected molecules by the application of this method [1]. To date, numerous reports have described the isolation of aptamers directed against a great variety of targets covering a wide diversity of molecules varying in nature, size, and complexity ranging from ions to whole cells, including small molecules (e.g., aminoacids, nucleotides, antibiotics, peptides, proteins, nucleic acids, and viruses, among others (for example, see [3–6]. Modifications and optimization of the SELEX procedure aimed to get newly modified aptamers has also attracted much interest (examples can be found in [7,8]. These advances along with the parallel progresses in the nucleic acids chemistry and cellular delivery fields have allowed for the rise of a new hope in developing aptamers as efficient molecular tools for diagnostics and therapeutics (for recent comprehensive reviews, see [9–11].

  16. Nucleolin-targeting liposomes guided by aptamer AS1411 for the delivery of siRNA for the treatment of malignant melanomas.

    Science.gov (United States)

    Li, Liyu; Hou, Jianjun; Liu, Xinjie; Guo, Yujia; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2014-04-01

    BRAF gene mutation is found in more than 60% of malignant melanomas, which are difficult to treat. In this study, a new tumor-targeting liposome was developed to deliver anti-BRAF siRNA (siBraf) for the treatment of melanomas. Nucleolin is overexpressed on the surface of cancer cells. AS1411, an aptamer showing specific binding to nucleolin, was conjugated to PEGylated cationic liposome as the targeting probe ASLP (AS1411-PEG-liposome). The ASLP/siRNA complex was formed through electrostatic interaction between ASLP and siRNA. The binding of AS1411 to the surface of PEGylated liposomes was confirmed by gel electrophoresis and capillary electrophoresis. Real-time PCR and Western blot analysis showed that ASLP/siBraf exhibited strong silencing activity of BRAF gene. The much higher accumulation of the siRNA in tumor cells comparing with normal cells indicated that ASLP displayed excellent tumor-targeting capability. Notably, ASLP/siBraf showed significant silencing activity in A375 tumor xenograft mice and inhibited the melanoma growth. These results suggested that the new nucleolin-targeted siRNA delivery system by AS1411 may have the potential for the treatment of melanoma.

  17. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hongguang Sun

    2014-01-01

    Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

  18. Using Aptamers for Cancer Biomarker Discovery

    Directory of Open Access Journals (Sweden)

    Yun Min Chang

    2013-01-01

    Full Text Available Aptamers are single-stranded synthetic DNA- or RNA-based oligonucleotides that fold into various shapes to bind to a specific target, which includes proteins, metals, and molecules. Aptamers have high affinity and high specificity that are comparable to that of antibodies. They are obtained using iterative method, called (Systematic Evolution of Ligands by Exponential Enrichment SELEX and cell-based SELEX (cell-SELEX. Aptamers can be paired with recent advances in nanotechnology, microarray, microfluidics, and other technologies for applications in clinical medicine. One particular area that aptamers can shed a light on is biomarker discovery. Biomarkers are important in diagnosis and treatment of cancer. In this paper, we will describe ways in which aptamers can be used to discover biomarkers for cancer diagnosis and therapeutics.

  19. DNA-Aptamers Binding Aminoglycoside Antibiotics

    Directory of Open Access Journals (Sweden)

    Nadia Nikolaus

    2014-02-01

    Full Text Available Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  20. Post-SELEX optimization of aptamers.

    Science.gov (United States)

    Gao, Shunxiang; Zheng, Xin; Jiao, Binghua; Wang, Lianghua

    2016-07-01

    Aptamers are functional single-stranded DNA or RNA oligonucleotides, selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment), which can fold into stable unique three-dimensional structures that bind their target ligands with high affinity and specificity. Although aptamers show a number of favorable advantages such as better stability and easier modification when compared with the properties of antibodies, only a handful of aptamers have entered clinical trials and only one, pegaptanib, has received US Food and Drug Administration approval for clinical use. The main reasons that limit the practical application of aptamers are insufficient nuclease stability, bioavailability, thermal stability, or even affinity. Some aptamers obtained from modified libraries show better properties; however, polymerase amplification of nucleic acids containing non-natural bases is currently a primary drawback of the SELEX process. This review focuses on several post-SELEX optimization strategies of aptamers identified in recent years. We describe four common methods in detail: truncation, chemical modification, bivalent or multivalent aptamer construction, and mutagenesis. We believe that these optimization strategies should improve one or more specific properties of aptamers, and the type of feature(s) selected for improvement will be dependent on the application purpose.

  1. Aptamer-functionalized peptide H3CR5C as a novel nanovehicle for codelivery of fasudil and miRNA-195 targeting hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Liu Y

    2016-08-01

    Full Text Available Ying Liu,1,* Xin Wu,1,* Yuan Gao,2,* Jigang Zhang,1 Dandan Zhang,1 Shengying Gu,1 Guanhua Zhu,1 Gaolin Liu,1 Xiaoyu Li1 1Department of Clinical Pharmacy, Shanghai General Hospital, Shanghai Jiaotong University School of Medicine, 2Department of Pharmaceutics, Changhai Hospital, Second Military Medical University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Liver cancer is the fifth most commonly diagnosed malignancy, of which hepatocellular carcinoma (HCC represents the dominating histological subtype. Antiangiogenic therapy aimed at vascular endothelial growth factor (VEGF has shown promising but deficient clinical prospects on account of vasculogenic mimicry, a highly patterned vascular channel distinguished from the endothelium-dependent blood vessel, which may function as blood supply networks occurring in aggressive tumors including HCC. In this study, we used a new cationic peptide, disulfide cross-linked stearylated polyarginine peptide modified with histidine (H3R5, as a reducible vector, cell penetrating peptide-modified aptamer (ST21 with specific binding to HCC cells to conjugate to peptide H3R5 as the targeting probe, miRNA-195 (miR195as a powerful gene drug to inhibit VEGF, and fasudil to suppress vasculogenic mimicry by blocking ROCK2, all of which were simultaneously encapsulated in the same nanoparticles. Fasudil was loaded by ammonium sulfate-induced transmembrane electrochemical gradient and miR195 was condensed through electrostatic interaction. ST21-H3R5-polyethylene glycol (PEG exhibited excellent loading capacities for both fasudil and miR195 with adjustable dosing ratios. Western blot analysis showed that FasudilST21-H3R5-PEGmiR195 had strong silencing activity of ROCK2 and VEGF, as compared with FasudilH3R5-PEGmiR195. In vitro and in vivo experiments confirmed that ST21-modified nanoparticles showed significantly higher cellular uptake and therapeutic efficacy in tumor

  2. Aptamer-functionalized peptide H3CR5C as a novel nanovehicle for codelivery of fasudil and miRNA-195 targeting hepatocellular carcinoma

    Science.gov (United States)

    Liu, Ying; Wu, Xin; Gao, Yuan; Zhang, Jigang; Zhang, Dandan; Gu, Shengying; Zhu, Guanhua; Liu, Gaolin; Li, Xiaoyu

    2016-01-01

    Liver cancer is the fifth most commonly diagnosed malignancy, of which hepatocellular carcinoma (HCC) represents the dominating histological subtype. Antiangiogenic therapy aimed at vascular endothelial growth factor (VEGF) has shown promising but deficient clinical prospects on account of vasculogenic mimicry, a highly patterned vascular channel distinguished from the endothelium-dependent blood vessel, which may function as blood supply networks occurring in aggressive tumors including HCC. In this study, we used a new cationic peptide, disulfide cross-linked stearylated polyarginine peptide modified with histidine (H3R5), as a reducible vector, cell penetrating peptide-modified aptamer (ST21) with specific binding to HCC cells to conjugate to peptide H3R5 as the targeting probe, miRNA-195 (miR195) as a powerful gene drug to inhibit VEGF, and fasudil to suppress vasculogenic mimicry by blocking ROCK2, all of which were simultaneously encapsulated in the same nanoparticles. Fasudil was loaded by ammonium sulfate-induced transmembrane electrochemical gradient and miR195 was condensed through electrostatic interaction. ST21-H3R5-polyethylene glycol (PEG) exhibited excellent loading capacities for both fasudil and miR195 with adjustable dosing ratios. Western blot analysis showed that FasudilST21-H3R5-PEGmiR195 had strong silencing activity of ROCK2 and VEGF, as compared with FasudilH3R5-PEGmiR195. In vitro and in vivo experiments confirmed that ST21-modified nanoparticles showed significantly higher cellular uptake and therapeutic efficacy in tumor cells or tumor tissues than the unmodified counterparts. These findings suggest that aptamer-conjugated peptide holds great promise for delivering chemical drugs and gene drugs simultaneously to overcome HCC. PMID:27574422

  3. Efficient delivery of micro RNA to bone-metastatic prostate tumors by using aptamer-conjugated atelocollagen in vitro and in vivo.

    Science.gov (United States)

    Hao, Zhao; Fan, Wei; Hao, Jian; Wu, Xin; Zeng, Guo Qing; Zhang, Li Juan; Nie, Sui Feng; Wang, Xu Dong

    2016-01-01

    Bone is the primary site of skeletal metastasis in prostate cancer (PCa). Atelocollagen (ATE)-mediated siRNA delivery system can be used to silence endogenous genes involved in PCa metastatic tumor cell growth. However, we hope that the delivery system can target PCa cells to reduce damage to the bone tissue and improve the therapeutic effect. RNA aptamer (APT) A10-3.2 has been used as a ligand to target PCa cells that express prostate-specific membrane antigen (PSMA). APT was investigated as a PSMA-targeting ligand in the design of an ATE-based microRNA (miRNA; miR-15a and miR-16-1) vector to PCa bone metastasis. To observe the targeted delivery and transfection efficiency of ATE-APT in PSMA-overexpressing cells, luciferase activity and biodistribution of nanoparticles in Balb/c mice was analyzed. The anticancer effect of nanoparticles in vivo was investigated using the survival times of human PCa bone metastasis mice model. Luciferase assays of pGL-3 expression against PC3 (PSMA(-)) and LNCaP (PSMA(+)) cells showed that the transfection efficiency of the synthesized DNA/ATE-APT complex was higher than that of the DNA/ATE complex. The anticancer efficacy of miRNA/ATE-APT was superior to those of other treatments in vivo. This PSMA-targeted system may prove useful in widening the therapeutic window and allow for selective killing of PCa cells in bone metastatic foci.

  4. UCLA1, a synthetic derivative of a gp120 RNA aptamer, inhibits entry of human immunodeficiency virus type 1 subtype C

    CSIR Research Space (South Africa)

    Mufhandu, Hazel T

    2012-05-01

    Full Text Available aptamers and showed that they neutralized the infectivity of HIV-1. In this study, we assessed the activity of a shortened synthetic derivative of the B40 aptamer, called UCLA1, against a large panel of HIV-1 subtype C viruses. UCLA1 tightly bound to a...

  5. Increased anticoagulant activity of thrombin-binding DNA aptamers by nanoscale organization on DNA nanostructures

    DEFF Research Database (Denmark)

    Rangnekar, Abhijit; Zhang, Alex M.; Shiyuan Li, Susan;

    2012-01-01

    Control over thrombin activity is much desired to regulate blood clotting in surgical and therapeutic situations. Thrombin-binding RNA and DNA aptamers have been used to inhibit thrombin activity and thus the coagulation cascade. Soluble DNA aptamers, as well as two different aptamers tethered by...

  6. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  7. Nucleic acid aptamers: research tools in disease diagnostics and therapeutics.

    Science.gov (United States)

    Santosh, Baby; Yadava, Pramod K

    2014-01-01

    Aptamers are short sequences of nucleic acid (DNA or RNA) or peptide molecules which adopt a conformation and bind cognate ligands with high affinity and specificity in a manner akin to antibody-antigen interactions. It has been globally acknowledged that aptamers promise a plethora of diagnostic and therapeutic applications. Although use of nucleic acid aptamers as targeted therapeutics or mediators of targeted drug delivery is a relatively new avenue of research, one aptamer-based drug "Macugen" is FDA approved and a series of aptamer-based drugs are in clinical pipelines. The present review discusses the aspects of design, unique properties, applications, and development of different aptamers to aid in cancer diagnosis, prevention, and/or treatment under defined conditions.

  8. Aptamers: A Feasible Technology in Cancer Immunotherapy

    Directory of Open Access Journals (Sweden)

    M. M. Soldevilla

    2016-01-01

    Full Text Available Aptamers are single-chained RNA or DNA oligonucleotides (ODNs with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy.

  9. Aptamers: A Feasible Technology in Cancer Immunotherapy.

    Science.gov (United States)

    Soldevilla, M M; Villanueva, H; Pastor, F

    2016-01-01

    Aptamers are single-chained RNA or DNA oligonucleotides (ODNs) with three-dimensional folding structures which allow them to bind to their targets with high specificity. Aptamers normally show affinities comparable to or higher than that of antibodies. They are chemically synthesized and therefore less expensive to manufacture and produce. A variety of aptamers described to date have been shown to be reliable in modulating immune responses against cancer by either blocking or activating immune receptors. Some of them have been conjugated to other molecules to target the immune system and reduce off-target side effects. Despite the success of first-line treatments against cancer, the elevated number of relapsing cases and the tremendous side effects shown by the commonly used agents hinder conventional treatments against cancer. The advantages provided by aptamers could enhance the therapeutic index of a given strategy and therefore enhance the antitumor effect. Here we recapitulate the provided benefits of aptamers with immunomodulatory activity described to date in cancer therapy and the benefits that aptamer-based immunotherapy could provide either alone or combined with first-line treatments in cancer therapy.

  10. Discovery of Aptamer Ligands for Hepatic Stellate Cells Using SELEX.

    Science.gov (United States)

    Chen, Zhijin; Liu, Hao; Jain, Akshay; Zhang, Li; Liu, Chang; Cheng, Kun

    2017-01-01

    Insulin like growth factor II receptor (IGFIIR) is a transmembrane protein overexpressed in activated hepatic stellate cells (HSCs), which are the major target for the treatment of liver fibrosis. In this study, we aim to discover an IGFIIR-specific aptamer that can be potentially used as a targeting ligand for the treatment and diagnosis of liver fibrosis. Systematic evolution of ligands by exponential enrichment (SELEX) was conducted on recombinant human IGFIIR to identify IGFIIR-specific aptamers. The binding affinity and specificity of the discovered aptamers to IGFIIR and hepatic stellate cells were studied using flow cytometry and Surface Plasmon Resonance (SPR). Aptamer-20 showed the highest affinity to recombinant human IGFIIR protein with a Kd of 35.5 nM, as determined by SPR. Aptamer-20 also has a high affinity (apparent Kd 45.12 nM) to LX-2 human hepatic stellate cells. Binding of aptamer-20 to hepatic stellate cells could be inhibited by knockdown of IGFIIR using siRNA, indicating a high specificity of the aptamer. The aptamer formed a chimera with an anti-fibrotic PCBP2 siRNA and delivered the siRNA to HSC-T6 cells to trigger silencing activity. In Vivo biodistribution study of the siRNA-aptamer chimera also demonstrated a high and specific uptake in the liver of the rats with CCl4-induced liver fibrosis. These data suggest that aptamer-20 is a high-affinity ligand for antifibrotic and diagnostic agents for liver fibrosis.

  11. Application of aptamers in diagnostics, drug-delivery and imaging

    Indian Academy of Sciences (India)

    CHETAN CHANDOLA; SHEETAL KALME; MARCO G CASTELEIJN; ARTO URTTI; MUNIASAMY NEERATHILINGAM

    2016-09-01

    Aptamers are small, single-stranded oligonucleotides (DNA or RNA) that bind to their target with high specificity andaffinity. Although aptamers are analogous to antibodies for a wide range of target recognition and variety ofapplications, they have significant advantages over antibodies. Since aptamers have recently emerged as a class ofbiomolecules with an application in a wide array of fields, we need to summarize the latest developments herein. Inthis review we will discuss about the latest developments in using aptamers in diagnostics, drug delivery and imaging.We begin with diagnostics, discussing the application of aptamers for the detection of infective agents itself, antigens/toxins (bacteria), biomarkers (cancer), or a combination. The ease of conjugation and labelling of aptamers makesthem a potential tool for diagnostics. Also, due to the reduced off-target effects of aptamers, their use as a potentialdrug delivery tool is emerging rapidly. Hence, we discuss their use in targeted delivery in conjugation with siRNAs,nanoparticles, liposomes, drugs and antibodies. Finally, we discuss about the conjugation strategies applicable forRNA and DNA aptamers for imaging. Their stability and self-assembly after heating makes them superior overprotein-based binding molecules in terms of labelling and conjugation strategies.

  12. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range...

  13. Aptamers Against Immunologic Targets: Diagnostic and Therapeutic Prospects.

    Science.gov (United States)

    Vorobyeva, Mariya; Timoshenko, Valentina; Vorobjev, Pavel; Venyaminova, Alya

    2016-02-01

    The concept of in vitro selection of nucleic acid aptamers emerged 25 years ago, and since then tremendous progress has been achieved in the development of different aptamers and their applications for various bioanalytical and therapeutic purposes. Among other protein targets of aptamers, immune system proteins are of particular interest both as diagnostic markers and therapeutic targets. The present review summarizes up-to-date articles concerning the selection and design of DNA and RNA aptamers against immunologic targets such as antibodies, cytokines, and T-cell and B-cell receptors. We also discuss the prospects of employing aptamers as recognizing modules of diagnostic aptasensors, potential therapeutic candidates for the treatment of autoimmune diseases and cancer, and specific tools for functional studies of immune system proteins.

  14. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  15. Probing the coagulation pathway with aptamers identifies combinations that synergistically inhibit blood clot formation.

    Science.gov (United States)

    Bompiani, Kristin M; Lohrmann, Jens L; Pitoc, George A; Frederiksen, James W; Mackensen, George B; Sullenger, Bruce A

    2014-08-14

    Coordinated enzymatic reactions regulate blood clot generation. To explore the contributions of various coagulation enzymes in this process, we utilized a panel of aptamers against factors VIIa, IXa, Xa, and prothrombin. Each aptamer dose-dependently inhibited clot formation, yet none was able to completely impede this process in highly procoagulant settings. However, several combinations of two aptamers synergistically impaired clot formation. One extremely potent aptamer combination was able to maintain human blood fluidity even during extracorporeal circulation, a highly procoagulant setting encountered during cardiopulmonary bypass surgery. Moreover, this aptamer cocktail could be rapidly reversed with antidotes to restore normal hemostasis, indicating that even highly potent aptamer combinations can be rapidly controlled. These studies highlight the potential utility of using sets of aptamers to probe the functions of proteins in molecular pathways for research and therapeutic ends. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Lasse H Lauridsen

    Full Text Available BACKGROUND: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF for the treatment of age related macular degeneration (AMD. Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. PRINCIPAL FINDINGS: Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. CONCLUSION: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  17. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against α-bungarotoxin.

    Science.gov (United States)

    Lauridsen, Lasse H; Shamaileh, Hadi A; Edwards, Stacey L; Taran, Elena; Veedu, Rakesh N

    2012-01-01

    Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen®, an inhibitor of vascular endothelial growth factor (VEGF) for the treatment of age related macular degeneration (AMD). Aptamer technology may prove useful as a therapeutic alternative against an array of human maladies. Considering the increased interest in aptamer technology globally that rival antibody mediated therapeutic approaches, a simplified selection, possibly in one-step, technique is required for developing aptamers in limited time period. Herein, we present a simple one-step selection of DNA aptamers against α-bungarotoxin. A toxin immobilized glass coverslip was subjected to nucleic acid pool binding and extensive washing followed by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 µM. We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way of deriving an aptamer unlike the time consuming conventional SELEX-based approach. The most important application of this method is that chemically-modified nucleic acid libraries can also be used for aptamer selection as it requires only one enzymatic step. This method could equally be suitable for developing RNA aptamers.

  18. Aptamer-targeted RNAi for HIV-1 therapy.

    Science.gov (United States)

    Zhou, Jiehua; Rossi, John J

    2011-01-01

    The highly specific mechanism of RNA (RNAi) that inhibits the expression of disease genes is increasingly being harnessed to develop a new class of therapeutics for a wide variety of human maladies. The successful use of small interfering RNAs (siRNAs) for therapeutic purposes requires safe and efficient delivery to specific cells and tissues. Herein, we demonstrate novel cell type-specific dual inhibitory function anti-gp120 aptamer-siRNA delivery systems for HIV-1 therapy, in which both the aptamer and the siRNA portions have potent anti-HIV activities. The envelope glycoprotein is expressed on the surface of HIV-1 infected cells, allowing binding and internalization of the aptamer-siRNA chimeric molecules. The Dicer substrate siRNA delivered by the aptamers is functionally processed by Dicer, resulting in specific inhibition of HIV-1 replication and infectivity in cultured CEM T-cells and primary blood mononuclear cells. Our results provide a set of novel aptamer-targeted RNAi therapeutics to combat HIV and further validate the use of anti-gp120 aptamers for delivery of Dicer substrate siRNAs.

  19. Ultrasensitive Label-Free Sensing of IL-6 Based on PASE Functionalized Carbon Nanotube Micro-Arrays with RNA-Aptamers as Molecular Recognition Elements.

    Science.gov (United States)

    Khosravi, Farhad; Loeian, Seyed Masoud; Panchapakesan, Balaji

    2017-04-17

    This study demonstrates the rapid and label-free detection of Interleukin-6 (IL-6) using carbon nanotube micro-arrays with aptamer as the molecular recognition element. Single wall carbon nanotubes micro-arrays biosensors were manufactured using photo-lithography, metal deposition, and etching techniques. Nanotube biosensors were functionalized with 1-Pyrenebutanoic Acid Succinimidyl Ester (PASE) conjugated IL-6 aptamers. Real time response of the sensor conductance was monitored with increasing concentration of IL-6 (1 pg/mL to 10 ng/mL), exposure to the sensing surface in buffer solution, and clinically relevant spiked blood samples. Non-specific Bovine Serum Albumin (BSA), PBS samples, and anti-IgG functionalized devices gave similar signatures in the real time conductance versus time experiments with no significant change in sensor signal. Exposure of the aptamer functionalized nanotube surface to IL-6 decreased the conductance with increasing concentration of IL-6. Experiments based on field effect transistor arrays suggested shift in drain current versus gate voltage for 1 pg and 1 ng of IL-6 exposure. Non-specific BSA did not produce any appreciable shift in the Ids versus Vg suggesting specific interactions of IL-6 on PASE conjugated aptamer surface gave rise to the change in electrical signal. Both Z axis and phase image in an Atomic Force Microscope (AFM) suggested unambiguous molecular interaction of the IL-6 on the nanotube-aptamer surface at 1 pg/mL concentration. The concentration of 1 pg falls below the diagnostic gray zone for cancer (2.3 pg-4 ng/mL), which is an indicator of early stage cancer. Thus, nanotube micro-arrays could potentially be developed for creating multiplexed assays involving cancer biomarker proteins and possibly circulating tumor cells all in a single assay using PASE functionalization protocol.

  20. Aptamers: active targeting ligands for cancer diagnosis and therapy.

    Science.gov (United States)

    Wu, Xu; Chen, Jiao; Wu, Min; Zhao, Julia Xiaojun

    2015-01-01

    Aptamers, including DNA, RNA and peptide aptamers, are a group of promising recognition units that can specifically bind to target molecules and cells. Due to their excellent specificity and high affinity to targets, aptamers have attracted great attention in various fields in which selective recognition units are required. They have been used in biosensing, drug delivery, disease diagnosis and therapy (especially for cancer treatment). In this review, we summarized recent applications of DNA and RNA aptamers in cancer theranostics. The specific binding ability of aptamers to cancer-related markers and cancer cells ensured their high performance for early diagnosis of cancer. Meanwhile, the efficient targeting ability of aptamers to cancer cells and tissues provided a promising way to deliver imaging agents and drugs for cancer imaging and therapy. Furthermore, with the development of nanoscience and nanotechnology, the conjugation of aptamers with functional nanomaterials paved an exciting way for the fabrication of theranostic agents for different types of cancers, which might be a powerful tool for cancer treatment.

  1. In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes

    Institute of Scientific and Technical Information of China (English)

    LIU Guo-qing; LIAN Ying-qi; GAO Chao; YU Xiao-feng; ZHU Ming; ZONG Kai; CHEN Xue-jiao; YAN Yi

    2014-01-01

    Aptamers are speciifc nucleic acid sequences that can bind to a wide range of nucleic acid and non-nucleic acid targets with high afifnity and speciifcity. Nucleic acid aptamers are selected in vitro from single stranded DNA or RNA ligands containing random sequences of up to a few hundred nucleotides. Systematic evolution of ligands by exponential enrichment (SELEX) was used to select and PCR amplify DNA sequences (aptamers) capable of binding to and detecting Listeria monocytogenes, one of the major food-borne pathogens. A simpliifed afifnity separation approach was employed, in which L. monocytogenes in exponential (log) phase of growth was used as the separation target. A lfuorescently-labeled aptamer assay scheme was devised for detecting L. monocytogenes. This report described a novel approach to the detection of L. monocytogenes using DNA aptamers. Aptamers were developed by nine rounds of SELEX. A high afifnity aptamer was successfully selected from the initial random DNA pool, and its secondary structure was also investigated. One of aptamers named e01 with the highest afifnity was further tested in aptamer-peroxidase and aptamer-lfuorescence staining protocols. This study has proved the principle that the whole-cell SELEX could be a promising technique to design aptamer-based molecular probes for dectection of pathogenic microorganisms without tedious isolation and puriifcation of complex markers or targets.

  2. CELL-SELEX: Novel Perspectives of Aptamer-Based Therapeutics

    Directory of Open Access Journals (Sweden)

    Hans P. Wendel

    2008-04-01

    Full Text Available Aptamers, single stranded DNA or RNA molecules, generated by a method called SELEX (systematic evolution of ligands by exponential enrichment have been widely used in various biomedical applications. The newly developed Cell-SELEX (cell based-SELEX targeting whole living cells has raised great expectations for cancer biology, -therapy and regenerative medicine. Combining nanobiotechnology with aptamers, this technology opens the way to more sophisticated applications in molecular diagnosis. This paper gives a review of recent developments in SELEX technologies and new applications of aptamers.

  3. In vitro evaluation of radiolabeled aptamers for colon carcinoma diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Ferreira, I.M; Santos, S.R.; Faria, L.S.; Andrade, A.S.R., E-mail: crisrcorrea@gmail.com, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Inst. de Ciencias Biologicas. Dept. de Imunologia e Bioquimica

    2013-07-01

    Cancer is a leading cause of death worldwide, representing a major public health problem worldwide. Colorectal cancers accounts around 8% of all deaths for cancer in 2008, is the fourth most lethal. Many colorectal cancer markers, such as carcinoembryonic antigen (CEA), A33, and CSA-p, have been studied as the therapeutic targets in preclinical or clinical settings. CEA is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. Since its discovery in 1965, a very large number of studies have been carried out to determine the effectiveness of CEA as clinically useful tumor markers. Aptamers are short single-stranded nucleic acid oligomers (DNA or RNA) that can form specific and complex three-dimensional structures which can bind with high affinity to specific targets, they are functionally equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small size, and non-immunogenic. The aim of this study was develop anti-CEA aptamers for use as imaging agents. The aptamers are obtained through by SELEX (systematic evolution of ligands by exponential enrichment), in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by fluorescence microscopic images. Individual aptamers sequences that bound T84 cells were {sup 32}P-radiolabeled and incubated at different concentrations on cell monolayers, to monitor the aptamers affinity binding. The selected aptamers can identify colon cancer cell line. This aptamers could be further developed for early disease detection as radiopharmaceuticals, as well as prognostic markers, of colorectal cancers. (author)

  4. Aptamer-based nanobiosensors.

    Science.gov (United States)

    Kim, Yeon Seok; Raston, Nurul Hanun Ahmad; Gu, Man Bock

    2016-02-15

    It has been more than two decades since aptamer and the systematic evolution of ligands by exponential enrichment (SELEX) method were discovered by Larry Gold and Andrew Ellington in 1990, respectively. Based on the various advantages of aptamers, they have become a potent rival of antibodies in therapeutics and bio-analysis. Especially, the recent advances in aptamer biosensor application are remarkable due to its intrinsic properties of aptamers as nucleic acids and target induced conformational changes, in addition to the introduction of graphene oxide-based easy and simple immobilization-free screening method even for dual aptamers. In addition, the incorporation of various nanomaterials such as metallic nanoparticles, carbon materials, and functional nanospheres in aptasensors has facilitated the improvement of analytical performance and commercial application of aptasensors. In this review, recent prominent reports on aptasensors utilizing nanomaterials were introduced to understand the principle of aptamer-based biosensors and provide an insight for new strategies of aptasensors and the application of various nanomaterials. The perspective on aptamer-based biosensors and diagnostics was also discussed in view of technology and market.

  5. MicroRNA-192* impairs adipocyte triglyceride storage.

    Science.gov (United States)

    Mysore, Raghavendra; Zhou, You; Sädevirta, Sanja; Savolainen-Peltonen, Hanna; Nidhina Haridas, P A; Soronen, Jarkko; Leivonen, Marja; Sarin, Antti-Pekka; Fischer-Posovszky, Pamela; Wabitsch, Martin; Yki-Järvinen, Hannele; Olkkonen, Vesa M

    2016-04-01

    We investigated the expression of miR-192* (miR-192-3p) in the visceral adipose tissue (VAT) of obese subjects and its function in cultured human adipocytes. This miRNA is a 3' arm derived from the same pre-miRNA as miR-192 (miR-192-5p) implicated in type 2 diabetes, liver disease and cancers, and is predicted to target key genes in lipid metabolism. In morbidly obese subjects undergoing bariatric surgery preceded by a very low calorie diet, miR-192* in VAT correlated negatively (r=-0.387; p=0.046) with serum triglyceride (TG) and positively with high-density lipoprotein (HDL) concentration (r=0.396; p=0.041). In a less obese patient cohort, the miRNA correlated negatively with the body mass index (r=-0.537; p=0.026). To characterize the function of miR-192*, we overexpressed it in cultured adipocytes and analyzed the expression of adipogenic differentiation markers as well as cellular TG content. Reduced TG and expression of the adipocyte marker proteins aP2 (adipocyte protein 2) and perilipin 1 were observed. The function of miR-192* was further investigated by transcriptomic profiling of adipocytes expressing this miRNA, revealing impacts on key lipogenic genes. A number of the mRNA alterations were validated by qPCR. Western analysis confirmed a marked reduction of the lipogenic enzyme SCD (stearoyl coenzyme A desaturase-1), the fatty aldehyde dehydrogenase ALDH3A2 (aldehyde dehydrogenase 3 family member A2) and the high-density lipoprotein receptor SCARB1 (scavenger receptor B, type I). SCD and ALDH3A2 were demonstrated to be direct targets of miR-192*. To conclude, the present data identify miR-192* as a novel controller of adipocyte differentiation and lipid homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. A Small Aptamer with Strong and Specific Recognition of the Triphosphate of ATP

    Science.gov (United States)

    Sazani, Peter L.; Larralde, Rosa

    2004-01-01

    We report the in vitro selection of an RNA-based ATP aptamer with the ability to discriminate between adenosine ligands based on their 5‘ phosphorylation state. Previous selection of ATP aptamers yielded molecules that do not significantly discriminate between ligands at the 5‘ position. By applying a selective pressure that demands recognition of the 5‘ triphosphate, we obtained an aptamer that binds to ATP with a Kd of approximately 5 μM, and to AMP with a Kd of approximately 5.5 mM, a difference of 1100-fold. This aptamer demonstrates the ability of small RNAs to interact with negatively charged moieties. PMID:15237981

  7. Targeting of Antibodies using Aptamers

    OpenAIRE

    2003-01-01

    The chapter presents a methodology for the rapid selection of aptamers against antibody targets. It is a detailed account of the various methodological steps that describe the selection of aptamers, including PCR steps, buffers to be used, target immobilisation, partitioning and amplification of aptamers, clonning and sequencing, to results in high affinity and specificity ligands for the chosen target antibody.

  8. SELEX Modifications and Bioanalytical Techniques for Aptamer-Target Binding Characterization.

    Science.gov (United States)

    Tan, Sze Y; Acquah, Caleb; Sidhu, Amandeep; Ongkudon, Clarence M; Yon, L S; Danquah, Michael K

    2016-11-01

    The quest to improve the detection of biomolecules and cells in health and life sciences has led to the discovery and characterization of various affinity bioprobes. Libraries of synthetic oligonucleotides (ssDNA/ssRNA) with randomized sequences are employed during Systematic Evolution of Ligands by Exponential Enrichment (SELEX) to select highly specific affinity probes called aptamers. With much focus on the generation of aptamers for a variety of target molecules, conventional SELEX protocols have been modified to develop new and improved SELEX protocols yielding highly specific and stable aptamers. Various techniques have been used to analyze the binding interactions between aptamers and their cognate molecules with associated merits and limitations. This article comprehensively reviews research advancements in the generation of aptamers, analyses physicochemical conditions affecting their binding characteristics to cellular and biomolecular targets, and discusses various field applications of aptameric binding. Biophysical techniques employed in the characterization of the molecular and binding features of aptamers to their cognate targets are also discussed.

  9. A general double library SELEX strategy for aptamer selection using unmodified nonimmobilized targets.

    Science.gov (United States)

    Lee, Kyung Hyun; Zeng, Huaqiang

    2017-08-01

    Aptamer discovery for unmodified nonimmobilized targets has been constantly presenting itself as a significant challenge to the research community. We demonstrate here a novel double library (DL) SELEX strategy and its usefulness and generality toward discovering both ssDNA- and RNA-based aptamers with nanomolar binding affinities toward unmodified targets of both small (e.g., doxycycline) and large (e.g., VEGF165) sizes. The same selection strategy further allows for concurrent selection of an aptamer pair, recognizing discrete epitopes on the same protein, from the same selection cycles for the sandwich aptamer pair-based biosensor development (e.g., one aptamer for the recognition and the other for the signal transduction). These results establish the DL-SELEX method developed here as a valuable and highly accessible selection strategy for aptamer discovery, especially when chemical modifications of target molecules are not preferred or simply impossible.

  10. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14.

    Science.gov (United States)

    Cho, Yuri; Lee, Yun Bin; Lee, Jeong-Hoon; Lee, Dong Hyeon; Cho, Eun Ju; Yu, Su Jong; Kim, Yoon Jun; Kim, Jong In; Im, Jong Hun; Lee, Jung Hwan; Oh, Eun Ju; Yoon, Jung-Hwan

    2016-01-01

    Aptamers are small synthetic oligonucleotides that bind to target proteins with high specificity and affinity. AS1411 is an aptamer that binds to nucleolin, which is overexpressed in the cytoplasm and occurs on the surface of cancer cells. We investigated the therapeutic potential of aptamers in hepatocellular carcinoma (HCC) by evaluating anti-tumor effects and confirming the affinity and specificity of AS1411- and modified AS1411-aptamers in HCC cells. Cell growth was assessed using the MTS assay, and cell death signaling was explored by immunoblot analysis. Fluorescence-activated cell sorting was performed to evaluate the affinity and specificity of AS1411-aptamers in SNU-761 HCC cells. We investigated the in vivo effects of the AS1411-aptamer using BALB/c nude mice in a subcutaneous xenograft model with SNU-761 cells. Treatment with a modified AS1411-aptamer significantly decreased in vitro (under normoxic [P = 0.035] and hypoxic [P = 0.018] conditions) and in vivo (under normoxic conditions, P = 0.041) HCC cell proliferation compared to control aptamers. AS1411- and control aptamers failed to control HCC cell proliferation. However, AS1411- and the modified AS1411-aptamer did not induce caspase activation. Decrease in cell growth by AS1411 or modified AS1411 was not prevented by caspase or necrosis inhibitors. In a microarray, AS1411 significantly enhanced galectin-14 expression. Suppression of HCC cell proliferation by the modified AS1411-aptamer was attenuated by galectin-14 siRNA transfection. Modified AS1411-aptamer suppressed HCC cell growth in vitro and in vivo by up-regulating galectin-14 expressions. Modified AS1411-aptamers may have therapeutic potential as a novel targeted therapy for HCC.

  11. Comparison of Flow Cytometry and ELASA for Screening of Proper Candidate Aptamer in Cell-SELEX Pool.

    Science.gov (United States)

    Nabavinia, Maryam Sadat; Charbgoo, Fahimeh; Alibolandi, Mona; Mosaffa, Fatemeh; Gholoobi, Aida; Ramezani, Mohammad; Abnous, Khalil

    2017-07-19

    Aptamers are single-stranded RNA or DNA, which bind to their target with high affinity and specificity. Method of isolating aptamers against cell surface protein is called cell-SELEX. Common approach for monitoring cell-SELEX developed aptamers is flow cytometry. Since flow cytometry is costly and requires sophisticated equipments, we suggested implementing easy access, high throughput enzyme-link apta-sorbent assay test (ELASA) to confirm the specificity of aptamers selected through cell-SELEX process. In this regard, we compared ELASA and flow cytometry techniques in order to screen potent candidate aptamers against A2780 Rcis cell line, which were selected by cell-SELEX. The obtained results demonstrated that both ELASA and flow cytometry are identical in terms of sensivity and precision for aptamers selection. Then it could be concluded that ELASA method could be used as a versatile, inexpensive procedure for in vito evaluation of isolated aptamers from cell-SELEX based process.

  12. Methods To Identify Aptamers against Cell Surface Biomarkers

    Directory of Open Access Journals (Sweden)

    Frédéric Ducongé

    2011-09-01

    Full Text Available Aptamers are nucleic acid-based ligands identified through a process of molecular evolution named SELEX (Systematic Evolution of Ligands by Exponential enrichment. During the last 10-15 years, numerous aptamers have been developed specifically against targets present on or associated with the surface of human cells or infectious pathogens such as viruses, bacteria, fungi or parasites. Several of the aptamers have been described as potent probes, rivalling antibodies, for use in flow cytometry or microscopy. Some have also been used as drugs by inhibiting or activating functions of their targets in a manner similar to neutralizing or agonistic antibodies. Additionally, it is straightforward to conjugate aptamers to other agents without losing their affinity and they have successfully been used in vitro and in vivo to deliver drugs, siRNA, nanoparticles or contrast agents to target cells. Hence, aptamers identified against cell surface biomarkers represent a promising class of ligands. This review presents the different strategies of SELEX that have been developed to identify aptamers for cell surface-associated proteins as well as some of the methods that are used to study their binding on living cells.

  13. Aptamers Binding to c-Met Inhibiting Tumor Cell Migration.

    Directory of Open Access Journals (Sweden)

    Birgit Piater

    Full Text Available The human receptor tyrosine kinase c-Met plays an important role in the control of critical cellular processes. Since c-Met is frequently over expressed or deregulated in human malignancies, blocking its activation is of special interest for therapy. In normal conditions, the c-Met receptor is activated by its bivalent ligand hepatocyte growth factor (HGF. Also bivalent antibodies can activate the receptor by cross linking, limiting therapeutic applications. We report the generation of the RNA aptamer CLN64 containing 2'-fluoro pyrimidine modifications by systematic evolution of ligands by exponential enrichment (SELEX. CLN64 and a previously described single-stranded DNA (ssDNA aptamer CLN3 exhibited high specificities and affinities to recombinant and cellular expressed c-Met. Both aptamers effectively inhibited HGF-dependent c-Met activation, signaling and cell migration. We showed that these aptamers did not induce c-Met activation, revealing an advantage over bivalent therapeutic molecules. Both aptamers were shown to bind overlapping epitopes but only CLN3 competed with HGF binding to cMet. In addition to their therapeutic and diagnostic potential, CLN3 and CLN64 aptamers exhibit valuable tools to further understand the structural and functional basis for c-Met activation or inhibition by synthetic ligands and their interplay with HGF binding.

  14. One-step selection of Vaccinia virus-binding DNA aptamers by MonoLEX

    Directory of Open Access Journals (Sweden)

    Stöcklein Walter

    2007-08-01

    Full Text Available Abstract Background As a new class of therapeutic and diagnostic reagents, more than fifteen years ago RNA and DNA aptamers were identified as binding molecules to numerous small compounds, proteins and rarely even to complete pathogen particles. Most aptamers were isolated from complex libraries of synthetic nucleic acids by a process termed SELEX based on several selection and amplification steps. Here we report the application of a new one-step selection method (MonoLEX to acquire high-affinity DNA aptamers binding Vaccinia virus used as a model organism for complex target structures. Results The selection against complete Vaccinia virus particles resulted in a 64-base DNA aptamer specifically binding to orthopoxviruses as validated by dot blot analysis, Surface Plasmon Resonance, Fluorescence Correlation Spectroscopy and real-time PCR, following an aptamer blotting assay. The same oligonucleotide showed the ability to inhibit in vitro infection of Vaccinia virus and other orthopoxviruses in a concentration-dependent manner. Conclusion The MonoLEX method is a straightforward procedure as demonstrated here for the identification of a high-affinity DNA aptamer binding Vaccinia virus. MonoLEX comprises a single affinity chromatography step, followed by subsequent physical segmentation of the affinity resin and a single final PCR amplification step of bound aptamers. Therefore, this procedure improves the selection of high affinity aptamers by reducing the competition between aptamers of different affinities during the PCR step, indicating an advantage for the single-round MonoLEX method.

  15. Galaxy Workflows for Web-based Bioinformatics Analysis of Aptamer High-throughput Sequencing Data

    Directory of Open Access Journals (Sweden)

    William H Thiel

    2016-01-01

    Full Text Available Development of RNA and DNA aptamers for diagnostic and therapeutic applications is a rapidly growing field. Aptamers are identified through iterative rounds of selection in a process termed SELEX (Systematic Evolution of Ligands by EXponential enrichment. High-throughput sequencing (HTS revolutionized the modern SELEX process by identifying millions of aptamer sequences across multiple rounds of aptamer selection. However, these vast aptamer HTS datasets necessitated bioinformatics techniques. Herein, we describe a semiautomated approach to analyze aptamer HTS datasets using the Galaxy Project, a web-based open source collection of bioinformatics tools that were originally developed to analyze genome, exome, and transcriptome HTS data. Using a series of Workflows created in the Galaxy webserver, we demonstrate efficient processing of aptamer HTS data and compilation of a database of unique aptamer sequences. Additional Workflows were created to characterize the abundance and persistence of aptamer sequences within a selection and to filter sequences based on these parameters. A key advantage of this approach is that the online nature of the Galaxy webserver and its graphical interface allow for the analysis of HTS data without the need to compile code or install multiple programs.

  16. Peptide aptamers as new tools to modulate clathrin-mediated internalisation — inhibition of MT1-MMP internalisation

    Directory of Open Access Journals (Sweden)

    Ferrigno Paul

    2010-07-01

    Full Text Available Abstract Background Peptide aptamers are combinatorial protein reagents that bind to targets with a high specificity and a strong affinity thus providing a molecular tool kit for modulating the function of their targets in vivo. Results Here we report the isolation of a peptide aptamer named swiggle that interacts with the very short (21 amino acid long intracellular domain of membrane type 1-metalloproteinase (MT1-MMP, a key cell surface protease involved in numerous and crucial physiological and pathological cellular events. Expression of swiggle in mammalian cells was found to increase the cell surface expression of MT1-MMP by impairing its internalisation. Swiggle interacts with the LLY573 internalisation motif of MT1-MMP intracellular domain, thus disrupting the interaction with the μ2 subunit of the AP-2 internalisation complex required for endocytosis of the protease. Interestingly, swiggle-mediated inhibition of MT1-MMP clathrin-mediated internalisation was also found to promote MT1-MMP-mediated cell migration. Conclusions Taken together, our results provide further evidence that peptide aptamers can be used to dissect molecular events mediated by individual protein domains, in contrast to the pleiotropic effects of RNA interference techniques.

  17. Discovery and development of anticancer aptamers.

    Science.gov (United States)

    Ireson, Christopher R; Kelland, Lloyd R

    2006-12-01

    Aptamers, also termed as decoys or "chemical antibodies," represent an emerging class of therapeutics. They are short DNA or RNA oligonucleotides or peptides that assume a specific and stable three-dimensional shape in vivo, thereby providing specific tight binding to protein targets. In some cases and as opposed to antisense oligonucleotides, effects can be mediated against extracellular targets, thereby preventing a need for intracellular transportation. The first aptamer approved for use in man is a RNA-based molecule (Macugen, pegaptanib) that is administered locally (intravitreally) to treat age-related macular degeneration by targeting vascular endothelial growth factor. The most advanced aptamer in the cancer setting is AS1411, formerly known as AGRO100, which is being administered systemically in clinical trials. AS1411 is a 26-mer unmodified guanosine-rich oligonucleotide, which induces growth inhibition in vitro, and has shown activity against human tumor xenografts in vivo. The mechanism underlying its antiproliferative effects in cancer cells seems to involve initial binding to cell surface nucleolin and internalization, leading to an inhibition of DNA replication. In contrast to other unmodified oligonucleotides, AS1411 is relatively stable in serum-containing medium, probably as a result of the formation of dimers and a quartet structure. In a dose escalation phase I study in patients with advanced solid tumors, doses up to 10 mg/kg/d (using a four or seven continuous infusion regime) have been studied. Promising signs of activity have been reported (multiple cases of stable disease and one near complete response in a patient with renal cancer) in the absence of any significant adverse effects. Further trials are ongoing in renal and non-small cell lung cancers. In preclinical studies, additional aptamers have been described against several cancer targets, such as tenascin-C, the transcription factor signal transducer and activator of transcription 3

  18. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    Science.gov (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  19. Aggregation of ALS-linked FUS mutant sequesters RNA binding proteins and impairs RNA granules formation

    Energy Technology Data Exchange (ETDEWEB)

    Takanashi, Keisuke; Yamaguchi, Atsushi, E-mail: atsyama@restaff.chiba-u.jp

    2014-09-26

    Highlights: • Aggregation of ALS-linked FUS mutant sequesters ALS-associated RNA-binding proteins (FUS wt, hnRNP A1, and hnRNP A2). • Aggregation of ALS-linked FUS mutant sequesters SMN1 in the detergent-insoluble fraction. • Aggregation of ALS-linked FUS mutant reduced the number of speckles in the nucleus. • Overproduced ALS-linked FUS mutant reduced the number of processing-bodies (PBs). - Abstract: Protein aggregate/inclusion is one of hallmarks for neurodegenerative disorders including amyotrophic lateral sclerosis (ALS). FUS/TLS, one of causative genes for familial ALS, encodes a multifunctional DNA/RNA binding protein predominantly localized in the nucleus. C-terminal mutations in FUS/TLS cause the retention and the inclusion of FUS/TLS mutants in the cytoplasm. In the present study, we examined the effects of ALS-linked FUS mutants on ALS-associated RNA binding proteins and RNA granules. FUS C-terminal mutants were diffusely mislocalized in the cytoplasm as small granules in transiently transfected SH-SY5Y cells, whereas large aggregates were spontaneously formed in ∼10% of those cells. hnRNP A1, hnRNP A2, and SMN1 as well as FUS wild type were assembled into stress granules under stress conditions, and these were also recruited to FUS mutant-derived spontaneous aggregates in the cytoplasm. These aggregates stalled poly(A) mRNAs and sequestered SMN1 in the detergent insoluble fraction, which also reduced the number of nuclear oligo(dT)-positive foci (speckles) in FISH (fluorescence in situ hybridization) assay. In addition, the number of P-bodies was decreased in cells harboring cytoplasmic granules of FUS P525L. These findings raise the possibility that ALS-linked C-terminal FUS mutants could sequester a variety of RNA binding proteins and mRNAs in the cytoplasmic aggregates, which could disrupt various aspects of RNA equilibrium and biogenesis.

  20. 7-Ketocholesterol inhibits isocitrate dehydrogenase 2 expression and impairs endothelial function via microRNA-144.

    Science.gov (United States)

    Fu, Xiaodong; Huang, Xiuwei; Li, Ping; Chen, Weiyu; Xia, Min

    2014-06-01

    Oxysterol is associated with the induction of endothelial oxidative stress and impaired endothelial function. Mitochondria play a central role in oxidative energy metabolism and the maintenance of proper redox status. The purpose of this study was to determine the effects and mechanisms of 7-ketocholesterol (7-KC) on isocitrate dehydrogenase 2 (IDH2) and its impact on endothelial function in both human aortic endothelial cells (HAECs) and C57BL/6J mice. HAECs treated with 7-KC showed significant reductions of IDH2 mRNA and protein levels and enzyme activity, leading to decreased NADPH concentration and an increased ratio of reduced-to-oxidized glutathione in the mitochondria. 7-KC induced the expression of a specific microRNA, miR-144, which in turn targets and downregulates IDH2. In silico analysis predicted that miR-144 could bind to the 3'-untranslated region of IDH2 mRNA. Overexpression of miR-144 decreased the expression of IDH2 and the levels of NADPH. A complementary finding is that a miR-144 inhibitor increased the mRNA and protein expression levels of IDH2. Furthermore, miR-144 level was elevated in HAECs in response to 7-KC. Anti-Ago1/2 immunoprecipitation coupled with a real-time polymerase chain reaction assay revealed that 7-KC increased the functional targeting of miR-144/IDH2 mRNA in HAECs. Infusion of 7-KC in vivo decreased vascular IDH2 expression and impaired vascular reactivity via miR-144. 7-KC controls miR-144 expression, which in turn decreases IDH2 expression and attenuates NO bioavailability to impair endothelial homeostasis. The newly identified 7-KC-miR-144-IDH2 pathway may contribute to atherosclerosis progression and provides new insight into 7-KC function and microRNA biology in cardiovascular disease.

  1. Aptamers: The "evolution" of SELEX.

    Science.gov (United States)

    Wu, Yi Xi; Kwon, Young Jik

    2016-08-15

    It has been more than two decades since the first aptamer molecule was discovered. Since then, aptamer molecules have gain much attention in the scientific field. This increasing traction can be attributed to their many desirable traits, such as 1) their potentials to bind a wide range of molecules, 2) their malleability, and 3) their low cost of production. These traits have made aptamer molecules an ideal platform to pursue in the realm of pharmaceuticals and bio-sensors. Despite the broad applications of aptamers, tedious procedure, high resource consumption, and limited nucleobase repertoire have hindered aptamer in application usage. To address these issues, new innovative methodologies, such as automation and single round SELEX, are being developed to improve the outcomes and rates in which aptamers are discovered. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Aptamers and Their Biological Applications

    Directory of Open Access Journals (Sweden)

    Changill Ban

    2012-01-01

    Full Text Available Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we present the reasons why aptamers are known as alternatives to antibodies. Furthermore, several types of in vitro selection processes, including nitrocellulose membrane filtration, affinity chromatography, magnetic bead, and capillary electrophoresis-based selection methods, are explained in detail. We also introduce various applications of aptamers for the diagnosis of diseases and detection of small molecules. Numerous analytical techniques, such as electrochemical, colorimetric, optical, and mass-sensitive methods, can be utilized to detect targets, due to convenient modifications and the stability of aptamers. Finally, several medical and analytical applications of aptamers are presented. In summary, aptamers are promising materials for diverse areas, not just as alternatives to antibodies, but as the core components of medical and analytical equipment.

  3. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    Proteases are potential or realized therapeutic targets in a wide variety of pathological conditions. Moreover, proteases are classical subjects for studies of enzymatic and regulatory mechanisms. We here review the literature on nucleic acid aptamers selected with proteases as targets. Designing...... strategies and of new principles for regulating the activity of the inhibitory action of aptamers of general interest to researchers working with nucleic acid aptamers...

  4. The role of microRNA-15b in the impaired angiogenesis in diabetic wounds.

    Science.gov (United States)

    Xu, Junwang; Zgheib, Carlos; Hu, Junyi; Wu, Wenjie; Zhang, Liping; Liechty, Kenneth W

    2014-01-01

    The impairment in diabetic wound healing represents a significant clinical problem. Decreased angiogenesis is thought to play a central role in the pathogenesis of this impairment. We have previously shown that treatment of diabetic murine wounds with mesenchymal stem cells can improve healing, but the mechanisms are not completely defined. MicroRNA-15b (miR-15b) has been implicated in the regulation of the angiogenic response. We hypothesized that abnormal miR-15b expression may contribute to the impaired angiogenesis observed in impaired diabetic wound healing. To test this hypothesis, we examined the expression of miR-15b and its target genes in diabetic and nondiabetic mice before and after injury. MiR-15b expression was significantly up-regulated in diabetic mouse wounds during the wound healing response. Increased miR-15b levels also closely correlated with decreased gene expression of its proangiogenic target genes. Furthermore, the correction of the diabetic wound healing impairment with mesenchymal stem cell treatment was associated with a significant decrease in miR-15b expression level and increased gene expression of its proangiogenic target genes. These results provide the first evidence that increased expression of miR-15b in diabetic wounds in response to injury may, in part, be responsible for the abnormal angiogenic response seen in diabetic wounds and may contribute to the observed wound healing impairment. © 2014 by the Wound Healing Society.

  5. Nucleic Acid Aptamers Against Proteases

    DEFF Research Database (Denmark)

    Dupont, D M; Andersen, L M; Bøtkjær, Kenneth Alrø

    2011-01-01

    -specifically, for instance with vastly different affinities to zymogen and active enzyme forms. Furthermore, aptamers can be selected to inhibit the enzyme activity of the target proteases, but also to inhibit functionally important exosite interactions, for instance cofactor binding. Several protease-inhibiting aptamers......, directed against blood coagulation factors, are in clinical trials as anticoagulant drugs. Several of the studies on protease-binding aptamers have been pioneering and trend-setting in the field. The work with protease-binding aptamers also demonstrates many interesting examples of non-standard selection...

  6. Binding of an RNA aptamer and a partial peptide of a prion protein: crucial importance of water entropy in molecular recognition

    Science.gov (United States)

    Hayashi, Tomohiko; Oshima, Hiraku; Mashima, Tsukasa; Nagata, Takashi; Katahira, Masato; Kinoshita, Masahiro

    2014-01-01

    It is a central issue to elucidate the new type of molecular recognition accompanied by a global structural change of a molecule upon binding to its targets. Here we investigate the driving force for the binding of R12 (a ribonucleic acid aptamer) and P16 (a partial peptide of a prion protein) during which P16 exhibits the global structural change. We calculate changes in thermodynamic quantities upon the R12–P16 binding using a statistical-mechanical approach combined with molecular models for water which is currently best suited to studies on hydration of biomolecules. The binding is driven by a water-entropy gain originating primarily from an increase in the total volume available to the translational displacement of water molecules in the system. The energy decrease due to the gain of R12–P16 attractive (van der Waals and electrostatic) interactions is almost canceled out by the energy increase related to the loss of R12–water and P16–water attractive interactions. We can explain the general experimental result that stacking of flat moieties, hydrogen bonding and molecular-shape and electrostatic complementarities are frequently observed in the complexes. It is argued that the water-entropy gain is largely influenced by the geometric characteristics (overall shapes, sizes and detailed polyatomic structures) of the biomolecules. PMID:24803670

  7. Targeting Two Coagulation Cascade Proteases with a Bivalent Aptamer Yields a Potent and Antidote-Controllable Anticoagulant.

    Science.gov (United States)

    Soule, Erin E; Bompiani, Kristin M; Woodruff, Rebecca S; Sullenger, Bruce A

    2016-02-01

    Potent and rapid-onset anticoagulation is required for several clinical settings, including cardiopulmonary bypass surgery. In addition, because anticoagulation is associated with increased bleeding following surgery, the ability to rapidly reverse such robust anticoagulation is also important. Previously, we observed that no single aptamer was as potent as heparin for anticoagulating blood. However, we discovered that combinations of two aptamers were as potent as heparin. Herein, we sought to combine two individual anticoagulant aptamers into a single bivalent RNA molecule in an effort to generate a single molecule that retained the potent anticoagulant activity of the combination of individual aptamers. We created four bivalent aptamers that can inhibit Factor X/Xa and prothrombin/thrombin and anticoagulate plasma, as well as the combination of individual aptamers. Detailed characterization of the shortest bivalent aptamer indicates that each aptamer retains full binding and functional activity when presented in the bivalent context. Finally, reversal of this bivalent aptamer with a single antidote was explored, and anticoagulant activity could be rapidly turned off in a dose-dependent manner. These studies demonstrate that bivalent anticoagulant aptamers represent a novel and potent approach to actively and reversibly control coagulation.

  8. Development of aptamer based HIV-1 entry inhibitor prophylactic drugs

    CSIR Research Space (South Africa)

    London, G

    2013-08-01

    Full Text Available AIDS remains a major public health problem globally, especially in Southern Africa where over 6.4 million people are infected by the most prevalent HIV-1 subtype C. To help stop the spread of HIV-1 subtype C, we isolated 2ʹ-F-RNA aptamers against gp...

  9. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

    Science.gov (United States)

    Lipi, Farhana; Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N

    2016-12-01

    Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries.

  10. Laser ablation-based one-step generation and bio-functionalization of gold nanoparticles conjugated with aptamers

    Directory of Open Access Journals (Sweden)

    Walter Johanna G

    2010-08-01

    Full Text Available Abstract Background Bio-conjugated nanoparticles are important analytical tools with emerging biological and medical applications. In this context, in situ conjugation of nanoparticles with biomolecules via laser ablation in an aqueous media is a highly promising one-step method for the production of functional nanoparticles resulting in highly efficient conjugation. Increased yields are required, particularly considering the conjugation of cost-intensive biomolecules like RNA aptamers. Results Using a DNA aptamer directed against streptavidin, in situ conjugation results in nanoparticles with diameters of approximately 9 nm exhibiting a high aptamer surface density (98 aptamers per nanoparticle and a maximal conjugation efficiency of 40.3%. We have demonstrated the functionality of the aptamer-conjugated nanoparticles using three independent analytical methods, including an agglomeration-based colorimetric assay, and solid-phase assays proving high aptamer activity. To demonstrate the general applicability of the in situ conjugation of gold nanoparticles with aptamers, we have transferred the method to an RNA aptamer directed against prostate-specific membrane antigen (PSMA. Successful detection of PSMA in human prostate cancer tissue was achieved utilizing tissue microarrays. Conclusions In comparison to the conventional generation of bio-conjugated gold nanoparticles using chemical synthesis and subsequent bio-functionalization, the laser-ablation-based in situ conjugation is a rapid, one-step production method. Due to high conjugation efficiency and productivity, in situ conjugation can be easily used for high throughput generation of gold nanoparticles conjugated with valuable biomolecules like aptamers.

  11. Characterisation of aptamer-target interactions by branched selection and high-throughput sequencing of SELEX pools.

    Science.gov (United States)

    Dupont, Daniel M; Larsen, Niels; Jensen, Jan K; Andreasen, Peter A; Kjems, Jørgen

    2015-12-02

    Nucleic acid aptamer selection by systematic evolution of ligands by exponential enrichment (SELEX) has shown great promise for use in the development of research tools, therapeutics and diagnostics. Typically, aptamers are identified from libraries containing up to 10(16) different RNA or DNA sequences by 5-10 rounds of affinity selection towards a target of interest. Such library screenings can result in complex pools of many target-binding aptamers. New high-throughput sequencing techniques may potentially revolutionise aptamer selection by allowing quantitative assessment of the dynamic changes in the pool composition during the SELEX process and by facilitating large-scale post-SELEX characterisation. In the present study, we demonstrate how high-throughput sequencing of SELEX pools, before and after a single round of branched selection for binding to different target variants, can provide detailed information about aptamer binding sites, preferences for specific target conformations, and functional effects of the aptamers. The procedure was applied on a diverse pool of 2'-fluoropyrimidine-modified RNA enriched for aptamers specific for the serpin plasminogen activator inhibitor-1 (PAI-1) through five rounds of standard selection. The results demonstrate that it is possible to perform large-scale detailed characterisation of aptamer sequences directly in the complex pools obtained from library selection methods, thus without the need to produce individual aptamers. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Aptamer-Drug Conjugates.

    Science.gov (United States)

    Zhu, Guizhi; Niu, Gang; Chen, Xiaoyuan

    2015-11-18

    Western medicine often aims to specifically treat diseased tissues or organs. However, the majority of current therapeutics failed to do so owing to their limited selectivity and the consequent "off-target" side effects. Targeted therapy aims to enhance the selectivity of therapeutic effects and reduce adverse side effects. One approach toward this goal is to utilize disease-specific ligands to guide the delivery of less-specific therapeutics, such that the therapeutic effects can be guided specifically to diseased tissues or organs. Among these ligands, aptamers, also known as chemical antibodies, have emerged over the past decades as a novel class of targeting ligands that are capable of specific binding to disease biomarkers. Compared with other types of targeting ligands, aptamers have an array of unique advantageous features, which make them promising for developing aptamer-drug conjugates (ApDCs) for targeted therapy. In this Review, we will discuss ApDCs for targeted drug delivery in chemotherapy, gene therapy, immunotherapy, photodynamic therapy, and photothermal therapy, primarily of cancer.

  13. Intracellular Expression of PAI-1 Specific Aptamers Alters Breast Cancer Cell Migration, Invasion and Angiogenesis

    Science.gov (United States)

    Fortenberry, Yolanda M.; Brandal, Stephanie M.; Carpentier, Gilles; Hemani, Malvi; Pathak, Arvind P.

    2016-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is elevated in various cancers, where it has been shown to effect cell migration and invasion and angiogenesis. While, PAI-1 is a secreted protein, its intercellular levels are increased in cancer cells. Consequently, intracellular PAI-1 could contribute to cancer progression. While various small molecule inhibitors of PAI-1 are currently being investigated, none specifically target intracellular PAI-1. A class of inhibitors, termed aptamers, has been used effectively in several clinical applications. We previously generated RNA aptamers that target PAI-1 and demonstrated their ability to inhibit extracellular PAI-1. In the current study we explored the effect of these aptamers on intracellular PAI-1. We transiently transfected the PAI-1 specific aptamers into both MDA-MB-231 human breast cancer cells, and human umbilical vein endothelial cells (HUVECs) and studied their effects on cell migration, invasion and angiogenesis. Aptamer expressing MDA-MB-231 cells exhibited a decrease in cell migration and invasion. Additionally, intracellular PAI-1 and urokinase plasminogen activator (uPA) protein levels decreased, while the PAI-1/uPA complex increased. Moreover, a significant decrease in endothelial tube formation in HUVECs transfected with the aptamers was observed. In contrast, conditioned media from aptamer transfected MDA-MB-231 cells displayed a slight pro-angiogenic effect. Collectively, our study shows that expressing functional aptamers inside breast and endothelial cells is feasible and may exhibit therapeutic potential. PMID:27755560

  14. Aptamers as a promising approach for the control of parasitic diseases

    Directory of Open Access Journals (Sweden)

    Juan David Ospina-Villa

    Full Text Available ABSTRACT Aptamers are short single-stranded RNA or DNA oligonucleotides that are capable of binding various biological targets with high affinity and specificity. Their identification initially relies on a molecular process named SELEX (Systematic Evolution of Ligands by EXponential enrichment that has been later modified in order to improve aptamer sensitivity, minimize duration and cost of the assay, as well as increase target types. Several biochemical modifications can help to enhance aptamer stability without affecting significantly target interaction. As a result, aptamers have generated a large interest as promising tools to compete with monoclonal antibodies for detection and inhibition of specific markers of human diseases. One aptamer-based drug is currently authorized and several others are being clinically evaluated. Despite advances in the knowledge of parasite biology and host-parasite interactions from "omics" data, protozoan parasites still affect millions of people around the world and there is an urgent need for drug target discovery and novel therapeutic concepts. In this context, aptamers represent promising tools for pathogen identification and control. Recent studies have reported the identification of "aptasensors" for parasite diagnosis, and "intramers" targeting intracellular proteins. Here we discuss various strategies that have been employed for intracellular expression of aptamers and expansion of their possible application, and propose that they may be suitable for the clinical use of aptamers in parasitic infections.

  15. Intracellular Expression of PAI-1 Specific Aptamers Alters Breast Cancer Cell Migration, Invasion and Angiogenesis.

    Science.gov (United States)

    Fortenberry, Yolanda M; Brandal, Stephanie M; Carpentier, Gilles; Hemani, Malvi; Pathak, Arvind P

    2016-01-01

    Plasminogen activator inhibitor-1 (PAI-1) is elevated in various cancers, where it has been shown to effect cell migration and invasion and angiogenesis. While, PAI-1 is a secreted protein, its intercellular levels are increased in cancer cells. Consequently, intracellular PAI-1 could contribute to cancer progression. While various small molecule inhibitors of PAI-1 are currently being investigated, none specifically target intracellular PAI-1. A class of inhibitors, termed aptamers, has been used effectively in several clinical applications. We previously generated RNA aptamers that target PAI-1 and demonstrated their ability to inhibit extracellular PAI-1. In the current study we explored the effect of these aptamers on intracellular PAI-1. We transiently transfected the PAI-1 specific aptamers into both MDA-MB-231 human breast cancer cells, and human umbilical vein endothelial cells (HUVECs) and studied their effects on cell migration, invasion and angiogenesis. Aptamer expressing MDA-MB-231 cells exhibited a decrease in cell migration and invasion. Additionally, intracellular PAI-1 and urokinase plasminogen activator (uPA) protein levels decreased, while the PAI-1/uPA complex increased. Moreover, a significant decrease in endothelial tube formation in HUVECs transfected with the aptamers was observed. In contrast, conditioned media from aptamer transfected MDA-MB-231 cells displayed a slight pro-angiogenic effect. Collectively, our study shows that expressing functional aptamers inside breast and endothelial cells is feasible and may exhibit therapeutic potential.

  16. Protein Detection with Aptamer Biosensors

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    2008-07-01

    Full Text Available Aptamers have been developed for different applications. Their use as new biological recognition elements in biosensors promises progress for fast and easy detection of proteins. This new generation of biosensor (aptasensors will be more stable and well adapted to the conditions of real samples because of the specific properties of aptamers.

  17. Aptamers in Diagnostics and Treatment of Viral Infections

    Directory of Open Access Journals (Sweden)

    Tomasz Wandtke

    2015-02-01

    Full Text Available Aptamers are in vitro selected DNA or RNA molecules that are capable of binding a wide range of nucleic and non-nucleic acid molecules with high affinity and specificity. They have been conducted through the process known as SELEX (Systematic Evolution of Ligands by Exponential Enrichment. It serves to reach specificity and considerable affinity to target molecules, including those of viral origin, both proteins and nucleic acids. Properties of aptamers allow detecting virus infected cells or viruses themselves and make them competitive to monoclonal antibodies. Specific aptamers can be used to interfere in each stage of the viral replication cycle and also inhibit its penetration into cells. Many current studies have reported possible application of aptamers as a treatment or diagnostic tool in viral infections, e.g., HIV (Human Immunodeficiency Virus, HBV (Hepatitis B Virus, HCV (Hepatitis C Virus, SARS (Severe Acute Respiratory Syndrome, H5N1 avian influenza and recently spread Ebola. This review presents current developments of using aptamers in the diagnostics and treatment of viral diseases.

  18. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Directory of Open Access Journals (Sweden)

    Jun Teng

    2016-09-01

    Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.

  19. Targeting Insulin Receptor with a Novel Internalizing Aptamer

    Directory of Open Access Journals (Sweden)

    Margherita Iaboni

    2016-01-01

    Full Text Available Nucleic acid-based aptamers are emerging as therapeutic antagonists of disease-associated proteins such as receptor tyrosine kinases. They are selected by an in vitro combinatorial chemistry approach, named Systematic Evolution of Ligands by Exponential enrichment (SELEX, and thanks to their small size and unique chemical characteristics, they possess several advantages over antibodies as diagnostics and therapeutics. In addition, aptamers that rapidly internalize into target cells hold as well great potential for their in vivo use as delivery tools of secondary therapeutic agents. Here, we describe a nuclease resistant RNA aptamer, named GL56, which specifically recognizes the insulin receptor (IR. Isolated by a cell-based SELEX method that allows enrichment for internalizing aptamers, GL56 rapidly internalizes into target cells and is able to discriminate IR from the highly homologous insulin-like growth factor receptor 1. Notably, when applied to IR expressing cancer cells, the aptamer inhibits IR dependent signaling. Given the growing interest in the insulin receptor as target for cancer treatment, GL56 reveals a novel molecule with great translational potential as inhibitor and delivery tool for IR-dependent cancers.

  20. Aptamer-Based Technologies in Foodborne Pathogen Detection

    Science.gov (United States)

    Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang

    2016-01-01

    Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome. PMID:27672383

  1. Robust suppression of HIV replication by intracellularly expressed reverse transcriptase aptamers is independent of ribozyme processing.

    Science.gov (United States)

    Lange, Margaret J; Sharma, Tarun K; Whatley, Angela S; Landon, Linda A; Tempesta, Michael A; Johnson, Marc C; Burke, Donald H

    2012-12-01

    RNA aptamers that bind human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT) also inhibit viral replication, making them attractive as therapeutic candidates and potential tools for dissecting viral pathogenesis. However, it is not well understood how aptamer-expression context and cellular RNA pathways govern aptamer accumulation and net antiviral bioactivity. Using a previously-described expression cassette in which aptamers were flanked by two "minimal core" hammerhead ribozymes, we observed only weak suppression of pseudotyped HIV. To evaluate the importance of the minimal ribozymes, we replaced them with extended, tertiary-stabilized hammerhead ribozymes with enhanced self-cleavage activity, in addition to noncleaving ribozymes with active site mutations. Both the active and inactive versions of the extended hammerhead ribozymes increased inhibition of pseudotyped virus, indicating that processing is not necessary for bioactivity. Clonal stable cell lines expressing aptamers from these modified constructs strongly suppressed infectious virus, and were more effective than minimal ribozymes at high viral multiplicity of infection (MOI). Tertiary stabilization greatly increased aptamer accumulation in viral and subcellular compartments, again regardless of self-cleavage capability. We therefore propose that the increased accumulation is responsible for increased suppression, that the bioactive form of the aptamer is one of the uncleaved or partially cleaved transcripts, and that tertiary stabilization increases transcript stability by reducing exonuclease degradation.

  2. Aptaligner: automated software for aligning pseudorandom DNA X-aptamers from next-generation sequencing data.

    Science.gov (United States)

    Lu, Emily; Elizondo-Riojas, Miguel-Angel; Chang, Jeffrey T; Volk, David E

    2014-06-10

    Next-generation sequencing results from bead-based aptamer libraries have demonstrated that traditional DNA/RNA alignment software is insufficient. This is particularly true for X-aptamers containing specialty bases (W, X, Y, Z, ...) that are identified by special encoding. Thus, we sought an automated program that uses the inherent design scheme of bead-based X-aptamers to create a hypothetical reference library and Markov modeling techniques to provide improved alignments. Aptaligner provides this feature as well as length error and noise level cutoff features, is parallelized to run on multiple central processing units (cores), and sorts sequences from a single chip into projects and subprojects.

  3. MicroRNA-22 impairs anti-tumor ability of dendritic cells by targeting p38.

    Directory of Open Access Journals (Sweden)

    Xue Liang

    Full Text Available Dendritic cells (DCs play a critical role in triggering anti-tumor immune responses. Their intracellular p38 signaling is of great importance in controlling DC activity. In this study, we identified microRNA-22 (miR-22 as a microRNA inhibiting p38 protein expression by directly binding to the 3' untranslated region (3'UTR of its mRNA. The p38 down-regulation further interfered with the synthesis of DC-derived IL-6 and the differentiation of DC-driven Th17 cells. Moreover, overexpression of miR-22 in DCs impaired their tumor-suppressing ability while miR-22 inhibitor could reverse this phenomenon and improve the curative effect of DC-based immunotherapy. Thus, our results highlight a suppressive role for miR-22 in the process of DC-invoked anti-tumor immunity and that blocking this microRNA provides a new strategy for generating potent DC vaccines for patients with cancer.

  4. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  5. Screening and Identification of DNA Aptamers to Tyramine Using in Vitro Selection and High-Throughput Sequencing.

    Science.gov (United States)

    Valenzano, Stefania; De Girolamo, Annalisa; DeRosa, Maria C; McKeague, Maureen; Schena, Roberto; Catucci, Lucia; Pascale, Michelangelo

    2016-06-13

    Aptamers are synthetic single-stranded DNA or RNA sequences that can fold into tertiary structures allowing them to interact with and bind to targets with high affinity and specificity. This paper describes the first selection and identification of DNA aptamers able to recognize the biogenic amine tyramine. To successfully isolate aptamers to this challenging small molecule target, the SELEX methodology was adapted by combining a systematic strategy to increase the selection stringency and monitor enrichment success. As the benefits of applying high-throughput sequencing (HTS) in SELEX experiments is becoming more clear, this method was employed in combination with bioinformatics analysis to evaluate the utility of the selection strategy and to uncover new potential high affinity sequences. On the basis of the presence of consensus regions (sequence families) and family similarities (clusters), 15 putative aptamers to tyramine were identified. A recently described workflow approach to perform a primary screening and characterization of the aptamer candidates by microequilibrium dialysis and by microscale thermophoresis was next leveraged. These candidate aptamers exhibited dissociation constant (Kd) values in the range of 0.2-152 μM with aptamer Tyr_10 as the most promising one followed by aptamer Tyr_14. These aptamers could be used as promising molecular recognition tools for the development of inexpensive, robust and innovative biosensor platforms for the detection of tyramine in food and beverages.

  6. In vitro selection of a peptide aptamer that changes fluorescence in response to verotoxin.

    Science.gov (United States)

    Manandhar, Yasodha; Bahadur, K C Tara; Wang, Wei; Uzawa, Takanori; Aigaki, Toshiro; Ito, Yoshihiro

    2015-03-01

    A peptide aptamer that changes fluorescence upon binding to verotoxin was selected in vitro using ribosome display with a tRNA carrying an environment-sensitive fluorescent probe. The aptamer specifically bound to verotoxin with a dissociation constant (K d) of 3.94 ± 1.6 µM, and the fluorescence decreased by 78% as the verotoxin concentration was increased. The selected peptide can be used for detection of verotoxin.

  7. An aptamer based competition assay for protein detection using CNT activated gold-interdigitated capacitor arrays.

    Science.gov (United States)

    Qureshi, Anjum; Roci, Irena; Gurbuz, Yasar; Niazi, Javed H

    2012-04-15

    An aptamer can specifically bind to its target molecule, or hybridize with its complementary strand. A target bound aptamer complex has difficulty to hybridize with its complementary strand. It is possible to determine the concentration of target based on affinity separation system for the protein detection. Here, we exploited this property using C-reactive protein (CRP) specific RNA aptamers as probes that were immobilized by physical adsorption on carbon nanotubes (CNTs) activated gold interdigitated electrodes of capacitors. The selective binding ability of RNA aptamer with its target molecule was determined by change in capacitance after allowing competitive binding with CRP and complementary RNA (cRNA) strands in pure form and co-mixtures (CRP:cRNA=0:1, 1:0, 1:1, 1:2 and 2:1). The sensor showed significant capacitance change with pure forms of CRP/cRNA while responses reduced considerably in presence of CRP:cRNA in co-mixtures (1:1 and 1:2) because of the binding competition. At a critical CRP:cRNA ratio of 2:1, the capacitance response was dramatically lost because of the dissociation of adsorbed aptamers from the sensor surface to bind when excess CRP. Binding assays showed that the immobilized aptamers had strong affinity for cRNA (K(d)=1.98 μM) and CRP molecules (K(d)=2.4 μM) in pure forms, but low affinity for CRP:cRNA ratio of 2:1 (K(d)=8.58 μM). The dynamic detection range for CRP was determined to be 1-8 μM (0.58-4.6 μg/capacitor). The approach described in this study is a sensitive label-free method to detect proteins based on affinity separation of target molecules that can potentially be used for probing molecular interactions.

  8. Rationally Designing Aptamer Sequences with Reduced Affinity for Controlled Sensor Performance

    Directory of Open Access Journals (Sweden)

    Lauren R. Schoukroun-Barnes

    2015-03-01

    Full Text Available The relative ease of predicting the secondary structure of nucleic acid sequences lends itself to the design of sequences to perform desired functions. Here, we combine the utility of nucleic acid aptamers with predictable control over the secondary structure to rationally design sequences with controlled affinity towards a target analyte when employed as the recognition element in an electrochemical sensor. Specifically, we present a method to modify an existing high-gain aptamer sequence to create sequences that, when employed in an electrochemical, aptamer-based sensor, exhibit reduced affinity towards a small molecule analyte tobramycin. Sensors fabricated with the high-gain parent sequence saturate at concentrations much below the therapeutic window for tobramycin (7–18 µM. Accordingly, the rationale behind modifying this high-gain sequence to reduce binding affinity was to tune sensor performance for optimal sensitivity in the therapeutic window. Using secondary structure predictions and analysis of the NMR structure of an aminoglycoside RNA aptamer bound to tobramycin, we are able to successfully modify the aptamer sequence to tune the dissociation constants of electrochemical aptamer-based sensors between 0.17 and 3 µM. The guidelines we present represent a general strategy to lessening binding affinity of sensors employing aptamer-modified electrodes.

  9. A Review of Therapeutic Aptamer Conjugates with Emphasis on New Approaches

    Directory of Open Access Journals (Sweden)

    John G. Bruno

    2013-03-01

    Full Text Available The potential to emulate or enhance antibodies with nucleic acid aptamers while lowering costs has prompted development of new aptamer-protein, siRNA, drug, and nanoparticle conjugates. Specific focal points of this review discuss DNA aptamers covalently bound at their 3' ends to various proteins for enhanced stability and greater pharmacokinetic lifetimes in vivo. The proteins can include Fc tails of IgG for opsonization, and the first component of complement (C1q to trigger complement-mediated lysis of antibiotic-resistant Gram negative bacteria, cancer cells and possibly some parasites during vulnerable stages. In addition, the 3' protein adduct may be a biotoxin, enzyme, or may simply be human serum albumin (HSA or a drug known to bind HSA, thereby retarding kidney and other organ clearance and inhibiting serum exonucleases. In this review, the author summarizes existing therapeutic aptamer conjugate categories and describes his patented concept for PCR-based amplification of double-stranded aptamers followed by covalent attachment of proteins or other agents to the chemically vulnerable overhanging 3' adenine added by Taq polymerase. PCR amplification of aptamers could dramatically lower the current $2,000/gram cost of parallel chemical oligonucleotide synthesis, thereby enabling mass production of aptamer-3'-protein or drug conjugates to better compete against expensive humanized monoclonal antibodies.

  10. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  11. Aptamers in Virology: Recent Advances and Challenges

    OpenAIRE

    Binning, Jennifer M.; Leung, Daisy W.; Amarasinghe, Gaya K.

    2012-01-01

    Aptamers generated from randomized libraries of nucleic acids have found utility in a wide variety of fields and in the clinic. Aptamers can be used to target both intracellular and extracellular components, including small molecules, proteins, cells, and viruses. With recent technological developments in stringent selection and rapid isolation strategies, it is likely that aptamers will continue to make an impact as useful tools and reagents. Although many recently developed aptamers are int...

  12. DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX.

    Science.gov (United States)

    Bitaraf, F S; Rasooli, I; Mousavi Gargari, S L

    2016-03-01

    Haemophilus influenzae type b (Hib) causes acute bacterial meningitis (ABM) in children, with a mortality rate of about 3-6 % of the affected patients. ABM can lead to death during a period of hours to several days and, hence, rapid and early detection of the infection is crucial. Aptamers, the short single-stranded DNA or RNA with high affinity to target molecules, are selected by a high-flux screening technique known as in vitro screening and systematic evolution of ligands by exponential enrichment technology (SELEX). In this study, whole-cell SELEX was applied for the selection of target-specific aptamers with high affinity to Hib. ssDNA aptamers prepared by lambda exonuclease were incubated with the target cells (Hib). The aptameric binding rate to Hib was characterized for binding affinity after seven SELEX rounds by flow cytometry. The aptamers with higher binding affinity were cloned. Four of 68 aptamer clones were selected for sequencing. The dissociation constant (Kd) of the high-affinity aptamer clones 45 and 63 were 47.10 and 28.46 pM, respectively. These aptamers did not bind to other bacterial species, including the seven meningitis-causing bacteria. They showed distinct affinity to various H. influenzae strains only. These aptamers showed the highest affinity to Hib and the lowest affinity to H. influenzae type c and to other meningitis-causing bacteria. Clone 63 could detect Hib in patients' cerebrospinal fluid (CSF) samples at 60 colony-forming units (CFU)/mL. The results indicate applicability of the aptamers for rapid and early detection of infections brought about by Hib.

  13. Intranasal siRNA administration reveals IGF2 deficiency contributes to impaired cognition in Fragile X syndrome mice

    Science.gov (United States)

    Pardo, Marta; Cheng, Yuyan; Velmeshev, Dmitry; Magistri, Marco; Martinez, Ana; Faghihi, Mohammad A.; Jope, Richard S.; Beurel, Eleonore

    2017-01-01

    Molecular mechanisms underlying learning and memory remain imprecisely understood, and restorative interventions are lacking. We report that intranasal administration of siRNAs can be used to identify targets important in cognitive processes and to improve genetically impaired learning and memory. In mice modeling the intellectual deficiency of Fragile X syndrome, intranasally administered siRNA targeting glycogen synthase kinase-3β (GSK3β), histone deacetylase-1 (HDAC1), HDAC2, or HDAC3 diminished cognitive impairments. In WT mice, intranasally administered brain-derived neurotrophic factor (BDNF) siRNA or HDAC4 siRNA impaired learning and memory, which was partially due to reduced insulin-like growth factor-2 (IGF2) levels because the BDNF siRNA– or HDAC4 siRNA–induced cognitive impairments were ameliorated by intranasal IGF2 administration. In Fmr1–/– mice, hippocampal IGF2 was deficient, and learning and memory impairments were ameliorated by IGF2 intranasal administration. Therefore intranasal siRNA administration is an effective means to identify mechanisms regulating cognition and to modulate therapeutic targets. PMID:28352664

  14. Modifications of the chromophore of Spinach aptamer based on QM:MM calculations.

    Science.gov (United States)

    Skúpa, Katarína; Urban, Ján

    2017-02-01

    Spinach aptamer was developed as an RNA analog of the green fluorescent protein. The aptamer interacts with its ligand and modifies its electronic spectrum so that it fluoresces brightly at the wavelength of 501 nm. Song et al. investigated modifications of the ligand in their experimental study and found a molecule emitting at 523 nm upon creating a complex with the Spinach aptamer. The crystal structure of the aptamer in complex with its original ligand has been published, which enabled us to study the system computationally. In this article, we suggest several new modifications of the ligand that shift the emission maximum of the complex to even longer wavelengths. Our results are based on combined quantum mechanical/molecular mechanical calculations with DFT method used for geometry optimization and TD-DFT for calculations of absorption and emission energies.

  15. Generating aptamers by cell-SELEX for applications in molecular medicine.

    Science.gov (United States)

    Ye, Mao; Hu, Jun; Peng, Minyuan; Liu, Jing; Liu, Jun; Liu, Huixia; Zhao, Xielan; Tan, Weihong

    2012-01-01

    Aptamers are single-stranded oligonucleotides of DNA or RNA that bind to target molecules with high affinity and specificity. Typically, aptamers are generated by an iterative selection process, called systematic evolution of ligands by exponential enrichment (SELEX). Recent advancements in SELEX technology have extended aptamer selection from comparatively simple mixtures of purified proteins to whole living cells, and now cell-based SELEX (or cell-SELEX) can isolate aptamers that bind to specific target cells. Combined with nanotechnology, microchips, microfluidic devices, RNAi and other advanced technologies, cell-SELEX represents an integrated platform providing ultrasensitive and highly specific tools for clinical medicine. In this review, we describe the recent progress made in the application of cell-SELEX for diagnosis, therapy and biomarker discovery.

  16. Generating Aptamers by Cell-SELEX for Applications in Molecular Medicine

    Directory of Open Access Journals (Sweden)

    Huixia Liu

    2012-03-01

    Full Text Available Aptamers are single-stranded oligonucleotides of DNA or RNA that bind to target molecules with high affinity and specificity. Typically, aptamers are generated by an iterative selection process, called systematic evolution of ligands by exponential enrichment (SELEX. Recent advancements in SELEX technology have extended aptamer selection from comparatively simple mixtures of purified proteins to whole living cells, and now cell-based SELEX (or cell-SELEX can isolate aptamers that bind to specific target cells. Combined with nanotechnology, microchips, microfluidic devices, RNAi and other advanced technologies, cell-SELEX represents an integrated platform providing ultrasensitive and highly specific tools for clinical medicine. In this review, we describe the recent progress made in the application of cell-SELEX for diagnosis, therapy and biomarker discovery.

  17. Electrochemical biosensors and logic devices based on aptamers

    Institute of Scientific and Technical Information of China (English)

    Zuo Xiaolei; Lin Meihua; Fan Chunhai

    2013-01-01

    Aptamers are molecular recognition elements with high specificity that are selected from deoxyribonucleic acid/ribonucleic acid (DNA/RNA) library.Compared with the traditional protein recognition elements,aptamers have excellent properties such as cost-effective,stable,easy for synthesis and modification.In recent years,electrochemistry plays an important role in biosensor field because of its high sensitivity,high stability,fast response and easy miniaturization.Through the combination of these two technologies and our rational design,we constructed a series of biosensors and biochips that are simple,fast,cheap and miniaturized.Firstly,we designed an adenosine triphosphate (ATP) electrochemical biosensor based on the strand displacement strategy.We can detect as low as 10 nmol/L of ATP both in pure solution and complicated cell lysates.Secondly,we creatively split the aptamers into two fragments and constructed the sandwich assay platform only based on single aptamer sequence.We successfully transferred this design on biochips with multiple micro electrodes (6×6) and accomplished multiplex detection.In the fields of biochips and biocomputers,we designed several DNA logic gates with electric (electrochemical) signal as output which paves a new way for the development of DNA computer.

  18. Somatic mutations in DROSHA and DICER1 impair microRNA biogenesis through distinct mechanisms in Wilms tumors

    Science.gov (United States)

    Rakheja, Dinesh; Chen, Kenneth S.; Liu, Yangjian; Shukla, Abhay A.; Schmid, Vanessa; Chang, Tsung-Cheng; Khokhar, Shama; Wickiser, Jonathan E.; Karandikar, Nitin J.; Malter, James S.; Mendell, Joshua T.; Amatruda, James F.

    2014-01-01

    Wilms tumor is the most common childhood kidney cancer. Here we report the whole-exome sequencing of 44 Wilms tumors, identifying missense mutations in the microRNA (miRNA)-processing enzymes DROSHA and DICER1 and novel mutations in MYCN, SMARCA4 and ARID1A. Examination of tumor miRNA expression, in vitro processing assays, and genomic editing in human cells demonstrate that DICER1 and DROSHA mutations influence miRNA processing through distinct mechanisms. DICER1 RNase IIIB mutations preferentially impair processing of miRNAs deriving from the 5′ arm of pre-miRNA hairpins, while DROSHA RNase IIIB mutations globally inhibit miRNA biogenesis through a dominant-negative mechanism. Both DROSHA and DICER1 mutations impair expression of tumor-suppressing miRNAs including the let-7 family, important regulators of MYCN, LIN28 and other Wilms tumor oncogenes. These results provide new insights into the mechanisms through which mutations in miRNA biogenesis components reprogram miRNA expression in human cancer and suggest that these defects define a distinct subclass of Wilms tumors. PMID:25190313

  19. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    Science.gov (United States)

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  20. Developing aptamers into tumor diagnostics and therapeutics

    Institute of Scientific and Technical Information of China (English)

    Jing Mi; Bryan M. Clary; Bruce A. Sullenger

    2008-01-01

    Aptamers are small single-stranded nucleic acid molecules that bind a target protein with high affinity and specificity. Due to their stability, low toxicity and immunogenicity, as well as improved safety, aptamers are attractive alternatives to antibody and are therefore suitable for in vivo applications. Aptamers are typically isolated, through a process termed SELEX (systematic evolution of ligands by exponential enrichment), from combinatorial libraries with desired proteins. In the present review, the recent non-conventional aptamer selection process will be discussed together with an overview on the aptamer application in cancer diagnosis and therapy.

  1. G4 Aptamers: Trends in Structural Design.

    Science.gov (United States)

    Varizhuk, Anna; Ilyinsky, Nikolay; Smirnov, Igor; Pozmogova, Galina

    2016-01-01

    Many potent DNA aptamers are known to contain a G-quadruplex (G4) core. Structures and applications of the majority of such aptamers have been reviewed previously. The present review focuses on the design and optimization of G4 aptamers. General features of bioactive G4s are analyzed, and the main strategies for construction of aptamers with desired properties and topologies, including modular assembly, control of an aptamer folding and some others, are outlined. Chemical modification as a method for post-SELEX G4 aptamer optimization is also discussed, and the effects of loop and core modifications are compared. Particular attention is paid to the emerging trends, such as the development of genomic G4- inspired aptamers and the combinatorial approaches which aim to find a balance between rational design and selection.

  2. DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin.

    Science.gov (United States)

    Vivekananda, Jeevalatha; Salgado, Christi; Millenbaugh, Nancy J

    2014-02-14

    Staphylococcus aureus is a versatile pathogen capable of causing a broad spectrum of diseases ranging from superficial skin infections to life threatening conditions such as endocarditis, septicemia, pneumonia and toxic shock syndrome. In vitro and in vivo studies identified an exotoxin, α-toxin, as a major cause of S. aureus toxicity. Because S. aureus has rapidly evolved resistance to a number of antibiotics, including methicillin, it is important to identify new therapeutic strategies, other than antibiotics, for inhibiting the harmful effects of this pathogen. Aptamers are single-stranded DNA or RNA oligonucleotides with three-dimensional folded conformations that bind with high affinity and selectivity to targets and modulate their biological functions. The goal of this study was to isolate DNA aptamers that specifically inhibit the cytotoxic activity of α-toxin. After 10 rounds of Systematic Evolution of Ligands by EXponential Enrichment (SELEX), 49 potential anti-α-toxin aptamers were identified. In vitro neutralization assays demonstrated that 4 of these 49 aptamers, AT-27, AT-33, AT-36, and AT-49, significantly inhibited α-toxin-mediated cell death in Jurkat T cells. Furthermore, RT-PCR analysis revealed that α-toxin increased the transcription of the inflammatory cytokines TNF-α and IL-17 and that anti-α-toxin aptamers AT-33 and AT-36 inhibited the upregulation of these genes. Collectively, the data suggest the feasibility of generating functionally effective aptamers against α-toxin for treatment of S. aureus infections.

  3. Searching the Sequence Space for Potent Aptamers Using SELEX in Silico.

    Science.gov (United States)

    Zhou, Qingtong; Xia, Xiaole; Luo, Zhaofeng; Liang, Haojun; Shakhnovich, Eugene

    2015-12-08

    To isolate functional nucleic acids that bind to defined targets with high affinity and specificity, which are known as aptamers, the systematic evolution of ligands by exponential enrichment (SELEX) methodology has emerged as the preferred approach. Here, we propose a computational approach, SELEX in silico, that allows the sequence space to be more thoroughly explored regarding binding of a certain target. Our approach consists of two steps: (i) secondary structure-based sequence screening, which aims to collect the sequences that can form a desired RNA motif as an enhanced initial library, followed by (ii) sequence enrichment regarding target binding by molecular dynamics simulation-based virtual screening. Our SELEX in silico method provided a practical computational solution to three key problems in aptamer sequence searching: design of nucleic acid libraries, knowledge of sequence enrichment, and identification of potent aptamers. Six potent theophylline-binding aptamers, which were isolated by SELEX in silico from a sequence space containing 4(13) sequences, were experimentally verified to bind theophylline with high affinity: Kd ranging from 0.16 to 0.52 μM, compared with the dissociation constant of the original aptamer-theophylline, 0.32 μM. These results demonstrate the significant potential of SELEX in silico as a new method for aptamer discovery and optimization.

  4. Use of cell-SELEX to generate DNA aptamers as molecular probes of HPV-associated cervical cancer cells.

    Science.gov (United States)

    Graham, Jessica C; Zarbl, Helmut

    2012-01-01

    Disease-specific biomarkers are an important tool for the timely and effective management of pathological conditions, including determination of susceptibility, diagnosis, and monitoring efficacy of preventive or therapeutic strategies. Aptamers, comprising single-stranded or double-stranded DNA or RNA, can serve as biomarkers of disease or biological states. Aptamers can bind to specific epitopes on macromolecules by virtue of their three dimensional structures and, much like antibodies, aptamers can be used to target specific epitopes on the basis of their molecular shape. The Systematic Evolution of Ligands by EXponential enrichment (SELEX) is the approach used to select high affinity aptamers for specific macromolecular targets from among the >10(13) oligomers comprising typical random oligomer libraries. In the present study, we used live cell-based SELEX to identify DNA aptamers which recognize cell surface differences between HPV-transformed cervical carcinoma cancer cells and isogenic, nontumorigenic, revertant cell lines. Whole-cell SELEX methodology was adapted for use with adherent cell lines (which we termed Adherent Cell-SELEX (AC-SELEX)). Using this approach, we identified high affinity aptamers (nanomolar range K(d)) to epitopes specific to the cell surface of two nontumorigenic, nontumorigenic revertants derived from the human cervical cancer HeLa cell line, and demonstrated the loss of these epitopes in another human papillomavirus transformed cervical cancer cell line (SiHa). We also performed preliminary investigation of the aptamer epitopes and their binding characteristics. Using AC-SELEX we have generated several aptamers that have high affinity and specificity to the nontumorigenic, revertant of HPV-transformed cervical cancer cells. These aptamers can be used to identify new biomarkers that are related to carcinogenesis. Panels of aptamers, such as these may be useful in predicting the tumorigenic potential and properties of cancer biopsies

  5. Use of cell-SELEX to generate DNA aptamers as molecular probes of HPV-associated cervical cancer cells.

    Directory of Open Access Journals (Sweden)

    Jessica C Graham

    Full Text Available BACKGROUND: Disease-specific biomarkers are an important tool for the timely and effective management of pathological conditions, including determination of susceptibility, diagnosis, and monitoring efficacy of preventive or therapeutic strategies. Aptamers, comprising single-stranded or double-stranded DNA or RNA, can serve as biomarkers of disease or biological states. Aptamers can bind to specific epitopes on macromolecules by virtue of their three dimensional structures and, much like antibodies, aptamers can be used to target specific epitopes on the basis of their molecular shape. The Systematic Evolution of Ligands by EXponential enrichment (SELEX is the approach used to select high affinity aptamers for specific macromolecular targets from among the >10(13 oligomers comprising typical random oligomer libraries. In the present study, we used live cell-based SELEX to identify DNA aptamers which recognize cell surface differences between HPV-transformed cervical carcinoma cancer cells and isogenic, nontumorigenic, revertant cell lines. METHODOLOGY/PRINCIPAL FINDINGS: Whole-cell SELEX methodology was adapted for use with adherent cell lines (which we termed Adherent Cell-SELEX (AC-SELEX. Using this approach, we identified high affinity aptamers (nanomolar range K(d to epitopes specific to the cell surface of two nontumorigenic, nontumorigenic revertants derived from the human cervical cancer HeLa cell line, and demonstrated the loss of these epitopes in another human papillomavirus transformed cervical cancer cell line (SiHa. We also performed preliminary investigation of the aptamer epitopes and their binding characteristics. CONCLUSIONS/SIGNIFICANCE: Using AC-SELEX we have generated several aptamers that have high affinity and specificity to the nontumorigenic, revertant of HPV-transformed cervical cancer cells. These aptamers can be used to identify new biomarkers that are related to carcinogenesis. Panels of aptamers, such as these may

  6. MicroRNA-34a and Impaired FGF19/21 Signaling in Obesity.

    Science.gov (United States)

    Fu, T; Kemper, J K

    2016-01-01

    The obesity epidemic and the urgent need for effective and safe drugs to treat obesity-related diseases have greatly increased research interest in the metabolic hormones, fibroblast growth factor-19 (FGF19, FGF15 in mice), and FGF21. FGF19 and FGF21 function as endocrine hormones that play key roles in energy metabolism and counteract obesity. Importantly, in obese humans and lab animals, circulating FGF19 and FGF21 levels are elevated, and metabolic actions of these hormones are impaired but the underlying mechanisms remained unknown. Recent microRNA (miR) studies have revealed that aberrantly elevated miR-34a in obesity directly targets β-Klotho, the obligate coreceptor for both FGF19 and FGF21, and attenuates metabolic signaling of these hormones. In this review, we will discuss recent findings in the miR and FGF19/21 fields, emphasizing the novel function of obesity-associated miR-34a in attenuation of FGF19/21 metabolic actions, and further discuss miRs, including miR-34a, as potential drug targets for obesity-related diseases.

  7. Strategies for the discovery of therapeutic Aptamers

    Science.gov (United States)

    Yang, Xianbin; Li, Na; Gorenstein, David G.

    2010-01-01

    Importance of the field Therapeutic aptamers are synthetic, structured oligonucleotides that bind to a very broad range of targets with high affinity and specificity. They are an emerging class of targeting ligand that show great promise for treating a number of diseases. A series of aptamers currently in various stages of clinical development highlights the potential of aptamers for therapeutic applications. Area covered in this review This review will cover in vitro selection of oligonucleotide ligands, called aptamers, from a combinatorial library using the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process as well as the other known strategies for finding aptamers against various targets. What the reader will gain Readers will gain an understanding of the highly useful strategies for successful aptamer discovery. They may also be able combine two or more of the presented strategies for their aptamer discovery projects. Take home message Although many processes are available for discovering aptamers, it is not trivial to discover an aptamer candidate that is ready to move toward pharmaceutical drug development. It is also apparent that there have been relatively few therapeutic advances and clinical trials undertaken due to the small number of companies that participate in aptamer development. PMID:21359096

  8. Aptamers generated from cell-SELEX for molecular medicine: a chemical biology approach.

    Science.gov (United States)

    Fang, Xiaohong; Tan, Weihong

    2010-01-19

    Molecular medicine is an emerging field focused on understanding the molecular basis of diseases and translating this information into strategies for diagnosis and therapy. This approach could lead to personalized medical treatments. Currently, our ability to understand human diseases at the molecular level is limited by the lack of molecular tools to identify and characterize the distinct molecular features of the disease state, especially for diseases such as cancer. Among the new tools being developed by researchers including chemists, engineers, and other scientists is a new class of nucleic acid probes called aptamers, which are ssDNA/RNA molecules selected to target a wide range of molecules and even cells. In this Account, we will focus on the use of aptamers, generated from cell-based selections, as a novel molecular tool for cancer research. Cancers originate from mutations of human genes. These genetic alterations result in molecular changes to diseased cells, which, in turn, lead to changes in cell morphology and physiology. For decades, clinicians have diagnosed cancers primarily based on the morphology of tumor cells or tissues. However, this method does not always give an accurate diagnosis and does not allow clinicians to effectively assess the complex molecular alterations that are predictive of cancer progression. As genomics and proteomics do not yet allow a full access to this molecular knowledge, aptamer probes represent one effective and practical avenue toward this goal. One special feature of aptamers is that we can isolate them by selection against cancer cells without prior knowledge of the number and arrangement of proteins on the cellular surface. These probes can identify molecular differences between normal and tumor cells and can discriminate among tumor cells of different classifications, at different disease stages, or from different patients. This Account summarizes our recent efforts to develop aptamers through cell-SELEX for the

  9. Current approaches in SELEX: An update to aptamer selection technology.

    Science.gov (United States)

    Darmostuk, Mariia; Rimpelova, Silvie; Gbelcova, Helena; Ruml, Tomas

    2015-11-01

    Systematic evolution of ligands by exponential enrichment (SELEX) is a well-established and efficient technology for the generation of oligonucleotides with a high target affinity. These SELEX-derived single stranded DNA and RNA molecules, called aptamers, were selected against various targets, such as proteins, cells, microorganisms, chemical compounds etc. They have a great potential in the use as novel antibodies, in cancer theragnostics and in biomedical research. Vast interest in aptamers stimulated continuous development of SELEX, which underwent numerous modifications since its first application in 1990. Novel modifications made the selection process more efficient, cost-effective and significantly less time-consuming. This article brings a comprehensive and up-to-date review of recent advances in SELEX methods and pinpoints advantages, main obstacles and limitations. The post-SELEX strategies and examples of application are also briefly outlined in this review. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Aptamers in Virology: Recent advances and challenges

    Directory of Open Access Journals (Sweden)

    Jennifer M. Binning

    2012-02-01

    Full Text Available Aptamers generated from randomized libraries of nucleic acids have found utility in a wide variety of fields and in the clinic. Aptamers can be used to target both intracellular and extracellular components, including small molecules, proteins, cells, and viruses. With recent technological developments in stringent selection and rapid isolation strategies, it is likely that aptamers will continue to make an impact as useful tools and reagents. Although many recently developed aptamers are intended for use as therapeutic and diagnostic agents, use of aptamers for basic research, including target validation remains an active area with high potential to impact our understanding of molecular mechanisms and for drug discovery. In this brief review, we will discuss recent aptamer discoveries, their potential role in structural virology as well as challenges and future prospects.

  11. Regulation of impaired angiogenesis in diabetic dermal wound healing by microRNA-26a.

    Science.gov (United States)

    Icli, Basak; Nabzdyk, Christoph S; Lujan-Hernandez, Jorge; Cahill, Meghan; Auster, Michael E; Wara, A K M; Sun, Xinghui; Ozdemir, Denizhan; Giatsidis, Giorgio; Orgill, Dennis P; Feinberg, Mark W

    2016-02-01

    Wound healing is a physiological reparative response to injury and a well-orchestrated process that involves hemostasis, cellular migration, proliferation, angiogenesis, extracellular matrix deposition, and wound contraction and re-epithelialization. However, patients with type 2 diabetes mellitus (T2D) are frequently afflicted with impaired wound healing that progresses into chronic wounds or diabetic ulcers, and may lead to complications including limb amputation. Herein, we investigate the potential role of microRNA-26a (miR-26a) in a diabetic model of wound healing. Expression of miR-26a is rapidly induced in response to high glucose in endothelial cells (ECs). Punch skin biopsy wounding of db/db mice revealed increased expression of miR-26a (~3.5-fold) four days post-wounding compared to that of WT mice. Local administration of a miR-26a inhibitor, LNA-anti-miR-26a, induced angiogenesis (up to ~80%), increased granulation tissue thickness (by 2.5-fold) and accelerated wound closure (53% after nine days) compared to scrambled anti-miR controls in db/db mice. These effects were independent of altered M1/M2 macrophage ratios. Mechanistically, inhibition of miR-26a increased its target gene SMAD1 in ECs nine days post-wounding of diabetic mice. In addition, high glucose reduced activity of the SMAD1-3'-UTR. Diabetic dermal wounds treated with LNA-anti-miR-26a had increased expression of ID1, a downstream modulator or SMAD1, and decreased expression of the cell cycle inhibitor p27. These findings establish miR-26a as an important regulator on the progression of skin wounds of diabetic mice by specifically regulating the angiogenic response after injury, and demonstrate that neutralization of miR-26a may serve as a novel approach for therapy.

  12. Array-Based Discovery of Aptamer Pairs

    Science.gov (United States)

    2014-12-11

    18460−18465. (25) Liu, Y.; Adams, J. D.; Turner, K.; Cochran, F. V.; Gambhir, S. S.; Soh, H. T. Lab Chip 2009, 9, 1033−1036. (26) Katilius, E.; Flores, C...discovery of aptamer pairs. We use microfluidic selection and high-throughput sequencing to obtain an enriched pool of aptamer sequences. Next, we...overcomes this problem to achieve efficient discovery of aptamer pairs. We use microfluidic selection and high- throughput sequencing to obtain an

  13. RNA signal amplifier circuit with integrated fluorescence output.

    Science.gov (United States)

    Akter, Farhima; Yokobayashi, Yohei

    2015-05-15

    We designed an in vitro signal amplification circuit that takes a short RNA input that catalytically activates the Spinach RNA aptamer to produce a fluorescent output. The circuit consists of three RNA strands: an internally blocked Spinach aptamer, a fuel strand, and an input strand (catalyst), as well as the Spinach aptamer ligand 3,5-difluoro-4-hydroxylbenzylidene imidazolinone (DFHBI). The input strand initially displaces the internal inhibitory strand to activate the fluorescent aptamer while exposing a toehold to which the fuel strand can bind to further displace and recycle the input strand. Under a favorable condition, one input strand was able to activate up to five molecules of the internally blocked Spinach aptamer in 185 min at 30 °C. The simple RNA circuit reported here serves as a model for catalytic activation of arbitrary RNA effectors by chemical triggers.

  14. Functional detection of proteins by caged aptamers.

    Science.gov (United States)

    Pinto, Alessandro; Lennarz, Sabine; Rodrigues-Correia, Alexandre; Heckel, Alexander; O'Sullivan, Ciara K; Mayer, Günter

    2012-02-17

    While many diagnostic assay platforms enable the measurement of analytes with high sensitivity, most of them result in a disruption of the analyte's native structure and, thus, in loss of function. Consequently, the analyte can be used neither for further analytical assessment nor functional analysis. Herein we report the use of caged aptamers as templates during apta-PCR analysis of targets. Aptamers are short nucleic acids that fold into a well-defined three-dimensional structure in which they interact with target molecules with high affinity and specificity. Nucleic acid aptamers can also serve as templates for qPCR approaches and, thus, have been used as high affinity ligands to bind to target molecules and subsequently for quantification by qPCR, an assay format coined apta-PCR. Caged aptamers in turn refer to variants that bear one or more photolabile groups at strategic positions. The activity of caged aptamers can thus be turned on or off by light irradiation. The latter allows the mild elution of target-bound aptamers while the target's native structure and function remain intact. We demonstrate that this approach allows the quantitative and subsequently the functional assessment of analytes. Since caged aptamers can be generated emanating from virtually every available aptamer, the described approach can be generalized and adopted to any target-aptamer pair and, thus, have a broad applicability in proteomics and clinical diagnostics.

  15. Aptamers overview: selection, features and applications.

    Science.gov (United States)

    Hernandez, Luiza I; Machado, Isabel; Schafer, Thomas; Hernandez, Frank J

    2015-01-01

    Apatamer technology has been around for a quarter of a century and the field had matured enough to start seeing real applications, especially in the medical field. Since their discovery, aptamers rapidly emerged as key players in many fields, such as diagnostics, drug discovery, food science, drug delivery and therapeutics. Because of their synthetic nature, aptamers are evolving at an exponential rate gaining from the newest advances in chemistry, nanotechnology, biology and medicine. This review is meant to give an overview of the aptamer field, by including general aspects of aptamer identification and applications as well as highlighting certain features that contribute to their quick deployment in the biomedical field.

  16. Regulation of metallothionein-III (GIF) mRNA in the brain of patients with Alzheimer disease is not impaired.

    Science.gov (United States)

    Amoureux, M C; Van Gool, D; Herrero, M T; Dom, R; Colpaert, F C; Pauwels, P J

    1997-01-01

    Contradictory results have been reported on the downregulation and role of the brain-specific protein metallothionein-III (MT-III, GIF) in Alzheimer disease (AD). In this article, the importance of MT-III downregulation in AD brain was re-evaluated in temporal and frontal cortex, hippocampus, and cerebellum of 11 AD patients and two groups of five and six control subjects, respectively. Reverse transcription-polymerase chain reaction (RT-PCR) was used to quantify the levels of MT-III mRNA relative to the levels of three constitutive RNAs: beta-actin, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), and ribosomal RNA 18S (rRNA 18S). The distribution of MT-III was similar to that of each of the three constitutive RNAs. The relative levels of each of these RNAs was high in brain regions examined in both AD patients and control subjects. Our findings do not support a downregulation of MT-III mRNA in the frontal cortex as well as the temporal cortex and hippocampus of AD patients. However, the level of MT-III mRNA was not constant in the investigated samples, suggesting that MT-III mRNA regulation could be controlled by factors other than AD pathology. Brain-derived neurotrophic factor (BDNF) mRNA levels were hardly detectable by RT-PCR in human brain tissue; a trend for a decrease was apparent in the temporal cortex of AD patients. In conclusion, the content of MT-III mRNA in the brain of AD patients was not detectably impaired, whereas BDNF mRNA may be affected.

  17. Viral suppressors of RNA interference impair RNA silencing induced by a Semliki Forest virus replicon in tick cells

    NARCIS (Netherlands)

    Garcia, S.; Billecocq, A.; Crance, J.M.; Prins, M.W.; Garin, D.; Bouloy, M.

    2006-01-01

    It was recently shown that infection of ISE6 tick cells by a recombinant Semliki Forest virus (SFV) expressing a heterologous gene induced small interfering RNAs (siRNAs) and silencing of the gene. To gain information on RNA interference (RNAi) in ticks, three known viral inhibitors that act in diff

  18. Viral suppressors of RNA interference impair RNA silencing induced by a Semliki Forest virus replicon in tick cells

    NARCIS (Netherlands)

    Garcia, S.; Billecocq, A.; Crance, J.M.; Prins, M.W.; Garin, D.; Bouloy, M.

    2006-01-01

    It was recently shown that infection of ISE6 tick cells by a recombinant Semliki Forest virus (SFV) expressing a heterologous gene induced small interfering RNAs (siRNAs) and silencing of the gene. To gain information on RNA interference (RNAi) in ticks, three known viral inhibitors that act in diff

  19. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Il Chung [Iowa State Univ., Ames, IA (United States)

    2011-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  20. Imaging gene expression in real-time using aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ilchung [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    Signal transduction pathways are usually activated by external stimuli and are transient. The downstream changes such as transcription of the activated genes are also transient. Real-time detection of promoter activity is useful for understanding changes in gene expression, especially during cell differentiation and in development. A simple and reliable method for viewing gene expression in real time is not yet available. Reporter proteins such as fluorescent proteins and luciferase allow for non-invasive detection of the products of gene expression in living cells. However, current reporter systems do not provide for real-time imaging of promoter activity in living cells. This is because of the long time period after transcription required for fluorescent protein synthesis and maturation. We have developed an RNA reporter system for imaging in real-time to detect changes in promoter activity as they occur. The RNA reporter uses strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags), which can be expressed from a promoter of choice. The tobramycin, neomycin and PDC RNA aptamers have been utilized for this system and expressed in yeast from the GAL1 promoter. The IMAGEtag RNA kinetics were quantified by RT-qPCR. In yeast precultured in raffinose containing media the GAL1 promoter responded faster than in yeast precultured in glucose containing media. IMAGEtag RNA has relatively short half-life (5.5 min) in yeast. For imaging, the yeast cells are incubated with their ligands that are labeled with fluorescent dyes. To increase signal to noise, ligands have been separately conjugated with the FRET (Förster resonance energy transfer) pairs, Cy3 and Cy5. With these constructs, the transcribed aptamers can be imaged after activation of the promoter by galactose. FRET was confirmed with three different approaches, which were sensitized emission, acceptor photobleaching and donor lifetime by FLIM (fluorescence lifetime imaging

  1. Aptamers that bind to the hemagglutinin of the recent pandemic influenza virus H1N1 and efficiently inhibit agglutination.

    Science.gov (United States)

    Gopinath, Subash C B; Kumar, Penmetcha K R

    2013-11-01

    Influenza virus hemagglutinin (HA) mediates both receptor (glycan) binding and membrane fusion for cell entry and has been the basis for typing influenza A viruses. In this study we have selected RNA aptamers (D-12 and D-26) that specifically target the HA protein of the recent pandemic influenza virus pdmH1N1 (A/California/07/2009). Among the selected aptamers the D-26 aptamer showed higher affinity for the HA of pdmH1N1 and was able to distinguish HA derived from other sub-types of influenza A viruses. The affinity of the D-26 aptamer was further improved upon incorporation of 2'-fluoropyrimidines to a level of 67 fM. Furthermore, the high affinity D-12 and D-26 aptamers were tested for their ability to interfere with HA-glycan interactions using a chicken red blood cell (RBC) agglutination assay. At a concentration of 200 nM the D-26 aptamer completely abolished the agglutination of RBCs, whereas D-12 only did so at 400 nM. These studies suggest that the selected aptamer D-26 not only has a higher affinity and specificity for the HA of pdmH1N1 but also has a better ability to efficiently interfere with HA-glycan interactions compared with the D-12 aptamer. The D-26 aptamer warrants further study regarding its application in developing topical virucidal products against the pdmH1N1 virus and also in surveillance of the pdmH1N1 influenza virus.

  2. Downregulation of the microtubule associated protein tau impairs process outgrowth and myelin basic protein mRNA transport in oligodendrocytes.

    Science.gov (United States)

    Seiberlich, Veronika; Bauer, Nina G; Schwarz, Lisa; Ffrench-Constant, Charles; Goldbaum, Olaf; Richter-Landsberg, Christiane

    2015-09-01

    Oligodendrocytes, the myelin forming cells of the CNS, are characterized by their numerous membranous extensions, which enwrap neuronal axons and form myelin sheaths. During differentiation oligodendrocytes pass different morphological stages, downregulate the expression of the proteoglycan NG2, and acquire major myelin specific proteins, such as myelin basic proteins (MBP) and proteolipid protein. MBP mRNA is transported in RNA granules along the microtubules (MTs) to the periphery and translated locally. MTs participate in the elaboration and stabilization of the myelin forming extensions and are essential for cellular sorting processes. Their dynamic properties are regulated by microtubule associated proteins (MAPs). The MAP tau is present in oligodendrocytes and involved in the regulation and stabilization of the MT network. To further elucidate the functional significance of tau in oligodendrocytes, we have downregulated tau by siRNA technology and studied the effects on cell differentiation and neuron-glia contact formation. The data show that tau knockdown impairs process outgrowth and leads to a decrease in MBP expression. Furthermore, MBP mRNA transport to distant cellular extensions is impaired and cells remain in the NG2 stage. In myelinating cocultures with dorsal root ganglion neurons, oligodendrocyte precursor cells after tau miR RNA lentiviral knockdown develop into NG2 positive cells with very long and thin processes, contacting axons loosely, but fail to form internodes. This demonstrates that tau is important for MBP mRNA transport and involved in process formation. The disturbance of the balance of tau leads to abnormalities in oligodendrocyte differentiation, neuron-glia contact formation and the early myelination process.

  3. Aptamer-Magnetic Bead Quantum Dot Sandwich Assays for Foodborne Pathogen Detection: Pros, Cons, and Lessons Learned.

    Science.gov (United States)

    Bruno, John G; Sivils, Jeffrey C; Phillips, Taylor

    2017-07-01

    DNA and RNA aptamers have been extensively investigated as potential competitors for antibodies for a variety of applications including food safety testing. Ultrasensitive fluorescence detection of foodborne pathogenic bacteria as low as 1-10 cells/mL has been achieved using aptamers coupled to quantum dots in clear pristine buffers for environmental sample detection. Quantum dots offer other advantages, including single UV or blue light source multiplex (multicolored) detection. However, quantum dots can exhibit decreased fluorescence in some food matrixes and even completely fail to fluoresce in some fatty matrixes, as documented in this report. Given the need to detect substances in complex food matrixes (and from data reported elsewhere), aptamer-magnetic bead pull-down methods followed by enzymatic/fluorometric- or PCR-based detection methods may be more robust methods for testing in foods or enrichment cultures. Other lessons learned, including the initial choice of aptamer targets to enhance assay specificity, are also discussed.

  4. Hi-Fi SELEX: A High-Fidelity Digital-PCR Based Therapeutic Aptamer Discovery Platform.

    Science.gov (United States)

    Ouellet, Eric; Foley, Jonathan H; Conway, Edward M; Haynes, Charles

    2015-08-01

    Current technologies for aptamer discovery typically leverage the systematic evolution of ligands by exponential enrichment (SELEX) concept by recursively panning semi-combinatorial ssDNA or RNA libraries against a molecular target. The expectation is that this iterative selection process will be sufficiently stringent to identify a candidate pool of specific high-affinity aptamers. However, failure of this process to yield promising aptamers is common, due in part to (i) limitations in library designs, (ii) retention of non-specific aptamers during screening rounds, (iii) excessive accumulation of amplification artifacts, and (iv) the use of screening criteria (binding affinity) that does not reflect therapeutic activity. We report a new selection platform, High-Fidelity (Hi-Fi) SELEX, that introduces fixed-region blocking elements to safeguard the functional diversity of the library. The chemistry of the target-display surface and the composition of the equilibration solvent are engineered to strongly inhibit non-specific retention of aptamers. Partition efficiencies approaching 10(6) are thereby realized. Retained members are amplified in Hi-Fi SELEX by digital PCR in a manner that ensures both elimination of amplification artifacts and stoichiometric conversion of amplicons into the single-stranded library required for the next selection round. Improvements to aptamer selections are first demonstrated using human α-thrombin as the target. Three clinical targets (human factors IXa, X, and D) are then subjected to Hi-Fi SELEX. For each, rapid enrichment of ssDNA aptamers offering an order-nM mean equilibrium dissociation constant (Kd) is achieved within three selection rounds, as quantified by a new label-free qPCR assay reported here. Therapeutic candidates against factor D are identified. © 2015 Wiley Periodicals, Inc.

  5. Specific detection of tetanus toxoid using an aptamer-based matrix.

    Science.gov (United States)

    Modh, Harshvardhan B; Bhadra, Ankan K; Patel, Kinjal A; Chaudhary, Rajeev K; Jain, Nishant K; Roy, Ipsita

    2016-11-20

    Batch-to-batch variation of therapeutic proteins produced by biological means requires rigorous monitoring at all stages of the production process. A large number of animals are employed for risk assessment of biologicals, which has low ethical and economic acceptability. Research is now focussed on the validation of in vitro and ex vivo tests to replace live challenges. Among in vitro methods, enzyme-linked immunosorbent assay (ELISA) is considered to be the gold standard for estimation of integrity of tetanus toxoid. ELISA utilizes antibodies for detection, which, because of their biological origin and limited modifiability, may have low stability and result in irreproducibility. We have developed a method using highly specific and selective RNA aptamers for detection of tetanus toxoid. Using displacement assay, we first identified aptamers which bind to different aptatopes on the surface of the toxoid. Pairs of these aptamers were employed as capture-detection ligands in a sandwich-ALISA (aptamer-linked immobilized sorbent assay) format. The binding efficiency was confirmed by the fluorescence intensity in each microtire plate well. Using aptamers alone, detection of tetanus toxoid was possible with the same level of sensitivity as antibody. Aptamers were also used in the capture ALISA format. Adjuvanted tetanus toxoid was subjected to accelerated stress testing, including thermal, mechanical and freeze-thawing stress conditions. The loss in antigenicity of the preparation determined by ALISA in each case was found to be similar to that determined by conventional ELISA. Thus, it is possible to replace antibodies with aptamers to develop a more robust detection tool for tetanus toxoid.

  6. Selection and characterization of DNA aptamers

    NARCIS (Netherlands)

    Ruigrok, V.J.B.

    2013-01-01

    This thesis focusses on the selection and characterisation of DNA aptamers and the various aspects related to their selection from large pools of randomized oligonucleotides. Aptamers are affinity tools that can specifically recognize and bind predefined target molecules; this ability, however, is

  7. Selection and characterization of DNA aptamers

    NARCIS (Netherlands)

    Ruigrok, V.J.B.

    2013-01-01

    This thesis focusses on the selection and characterisation of DNA aptamers and the various aspects related to their selection from large pools of randomized oligonucleotides. Aptamers are affinity tools that can specifically recognize and bind predefined target molecules; this ability, however, is n

  8. Evolution of Complex Target SELEX to Identify Aptamers against Mammalian Cell-Surface Antigens

    Directory of Open Access Journals (Sweden)

    Prabodhika Mallikaratchy

    2017-01-01

    Full Text Available The demand has increased for sophisticated molecular tools with improved detection limits. Such molecules should be simple in structure, yet stable enough for clinical applications. Nucleic acid aptamers (NAAs represent a class of molecules able to meet this demand. In particular, aptamers, a class of small nucleic acid ligands that are composed of single-stranded modified/unmodified RNA/DNA molecules, can be evolved from a complex library using Systematic Evolution of Ligands by EXponential enrichment (SELEX against almost any molecule. Since its introduction in 1990, in stages, SELEX technology has itself undergone several modifications, improving selection and broadening the repertoire of targets. This review summarizes these milestones that have pushed the field forward, allowing researchers to generate aptamers that can potentially be applied as therapeutic and diagnostic agents.

  9. Evolution of Complex Target SELEX to Identify Aptamers against Mammalian Cell-Surface Antigens.

    Science.gov (United States)

    Mallikaratchy, Prabodhika

    2017-01-30

    The demand has increased for sophisticated molecular tools with improved detection limits. Such molecules should be simple in structure, yet stable enough for clinical applications. Nucleic acid aptamers (NAAs) represent a class of molecules able to meet this demand. In particular, aptamers, a class of small nucleic acid ligands that are composed of single-stranded modified/unmodified RNA/DNA molecules, can be evolved from a complex library using Systematic Evolution of Ligands by EXponential enrichment (SELEX) against almost any molecule. Since its introduction in 1990, in stages, SELEX technology has itself undergone several modifications, improving selection and broadening the repertoire of targets. This review summarizes these milestones that have pushed the field forward, allowing researchers to generate aptamers that can potentially be applied as therapeutic and diagnostic agents.

  10. Aptamer Selection Technology and Recent Advances

    Directory of Open Access Journals (Sweden)

    Michael Blind

    2015-01-01

    Full Text Available Over the last decade, aptamers have begun to find their way from basic research to diverse commercial applications. The development of diagnostics is even more widespread than clinical applications because aptamers do not have to be extensively modified to enhance their in vivo stability and pharmacokinetics in diagnostic assays. The increasing attention has propelled the technical progress of the in vitro selection technology (SELEX to enhance the efficiency of developing aptamers for commercially interesting targets. This review highlights recent progress in the technical steps of a SELEX experiment with a focus on high-throughput next-generation sequencing and bioinformatics. Achievements have been made in the optimization of aptamer libraries, separation schemes, amplification of the selected libraries and the identification of aptamer sequences from enriched libraries.

  11. Sensitivity and Selectivity on Aptamer-Based Assay: The Determination of Tetracycline Residue in Bovine Milk

    Directory of Open Access Journals (Sweden)

    Sohee Jeong

    2012-01-01

    Full Text Available A competitive enzyme-linked aptamer assay (ELAA to detect tetracycline in milk was performed by using two different aptamers individually; one is 76 mer-DNA aptamer and the other is 57 mer-RNA aptamer. The best optimum condition was obtained without monovalent ion, Na+ and also by adding no Mg2+ ion in the assay buffer, along with RT incubation. The optimized ELAA showed a good sensitivity (LOD of 2.10 × 10−8 M with a wide dynamic range (3.16 × 10−8 M ~ 3.16 × 10−4 M. In addition, the average R.S.D. across all data points of the curve was less than 2.5% with good recoveries (~101.8% from the milk media. Thus, this method provides a good tool to monitor tetracycline in milk from MRLs’ point of view. However, this ELAA method was not superior to the ELISA method in terms of specificity. This paper describes that it does not always give better sensitivity and specificity in assays even though aptamers have several advantages over antibodies and have been known to be good binders for binding assays.

  12. Aptamers provide superior stainings of cellular receptors studied under super-resolution microscopy

    Science.gov (United States)

    Höbartner, Claudia

    2017-01-01

    Continuous improvements in imaging techniques are challenging biologists to search for more accurate methods to label cellular elements. This is particularly relevant for diffraction-unlimited fluorescence imaging, where the perceived resolution is affected by the size of the affinity probes. This is evident when antibodies, which are 10–15 nm in size, are used. Previously it has been suggested that RNA aptamers (~3 nm) can be used to detect cellular proteins under super-resolution imaging. However, a direct comparison between several aptamers and antibodies is needed, to clearly show the advantages and/or disadvantages of the different probes. Here we have conducted such a comparative study, by testing several aptamers and antibodies using stimulated emission depletion microscopy (STED). We have targeted three membrane receptors, EGFR, ErbB2 and Epha2, which are relevant to human health, and recycle between plasma membrane and intracellular organelles. Our results suggest that the aptamers can reveal more epitopes than most antibodies, thus providing a denser labeling of the stained structures. Moreover, this improves the overall quality of the information that can be extracted from the images. We conclude that aptamers could become useful fluorescent labeling tools for light microscopy and super-resolution imaging, and that their development for novel targets is imperative. PMID:28235049

  13. Nucleic acid aptamers as stabilizers of proteins: the stability of tetanus toxoid.

    Science.gov (United States)

    Jain, Nishant Kumar; Jetani, Hardik C; Roy, Ipsita

    2013-07-01

    Exposure of tetanus toxoid to moisture leads to its aggregation and reduction of potency. The aim of this work was to use SELEX (systematic evolution of ligands by exponential enrichment) protocol and select aptamers which recognize tetanus toxoid (Mr ~150 kDa) with high affinity. Colyophilized preparations of tetanus toxoid and specific aptamers were encapsulated in PLGA microspheres and sustained release of the antigen was observed up to 55 days using different techniques. The total protein released was between 40-55% (24-45% residual antigenicity) in the presence of the aptamers as compared to 25% (11% residual antigenicity) for the antigen alone. We show that instead of inhibiting absorption of moisture, the aptamers blocked the protein unfolding upon absorption of moisture, inhibiting the initiation of aggregation. When exposed to accelerated storage conditions, some of the RNA sequences were able to inhibit moisture-induced aggregation in vitro and retain antigenicity of tetanus toxoid. Nucleic acid aptamers represent a novel class of protein stabilizers which stabilize the protein by interacting directly with it. This mechanism is unlike that of small molecules which alter the medium properties and hence depend on the stress condition a protein is exposed to.

  14. Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX.

    Science.gov (United States)

    Wang, Guodong; Liu, Jun; Chen, Ke; Xu, Yiling; Liu, Bo; Liao, Jie; Zhu, Lei; Hu, Xiaoxiao; Li, Jianglin; Pu, Ying; Zhong, Wen; Fu, Ting; Liu, Huixia; Tan, Weihong

    2017-08-03

    Excessive secretion of glucagon, a functional insulin antagonist, significantly contributes to hyperglycemia. Glucagon exerts its physiological functions through activation of the glucagon receptor (GCGR). Inhibition of GCGR activity represents a potential therapeutic approach for reducing excess glucose production in diabetes mellitus. Aptamers are short DNA or RNA oligonucleotides evolved from systematic evolution of ligands by exponential enrichment (SELEX). Here, we have successfully selected a DNA aptamer against GCGR by cell-SELEX, which can specifically bind membrane protein of CHO-GCGR cells with a K d of 52.7 ± 5.1 nM. Aptamer-mediated pull-down and gcgr knockdown assay verified that GCGR was the target of aptamer GR-3. Binding analysis revealed that GR-3 could recognize other cells with different affinity according to the level of GCGR protein expressed in these cells. Hepatic tissue imaging suggested that GR-3 could bind the cell membrane of hepatic tissues. With the advantages of small size, high binding affinity, good stability, lack of immunogenicity, and easy synthesis, aptamer GR-3 against GCGR can be a promising tool with the potential to attenuate hyperglycemia in diabetes mellitus.

  15. Impaired expression of glycogen synthase mRNA in skeletal muscle of NIDDM patients

    DEFF Research Database (Denmark)

    Vestergaard, H; Bjørbaek, C; Andersen, P H

    1991-01-01

    with NIDDM were accompanied by a 39% reduction (P less than 0.02) in the steady state level of GS mRNA per microgram DNA of muscle. In both diabetic and control subjects, the mRNA expression of GS was unaffected after euglycemic-hyperinsulinemic clamp for 4 h. With single-stranded conformation polymorphism...

  16. Impaired expression of glycogen synthase mRNA in skeletal muscle of NIDDM patients

    DEFF Research Database (Denmark)

    Vestergaard, H; Bjørbaek, C; Andersen, P H

    1991-01-01

    with NIDDM were accompanied by a 39% reduction (P less than 0.02) in the steady state level of GS mRNA per microgram DNA of muscle. In both diabetic and control subjects, the mRNA expression of GS was unaffected after euglycemic-hyperinsulinemic clamp for 4 h. With single-stranded conformation polymorphism...

  17. Transcriptional pausing coordinates folding of the aptamer domain and the expression platform of a riboswitch.

    Science.gov (United States)

    Perdrizet, George A; Artsimovitch, Irina; Furman, Ran; Sosnick, Tobin R; Pan, Tao

    2012-02-28

    Riboswitches are cis-acting elements that regulate gene expression by affecting transcriptional termination or translational initiation in response to binding of a metabolite. A typical riboswitch is made of an upstream aptamer domain and a downstream expression platform. Both domains participate in the folding and structural rearrangement in the absence or presence of its cognate metabolite. RNA polymerase pausing is a fundamental property of transcription that can influence RNA folding. Here we show that pausing plays an important role in the folding and conformational rearrangement of the Escherichia coli btuB riboswitch during transcription by the E. coli RNA polymerase. This riboswitch consists of an approximately 200 nucleotide, coenzyme B12 binding aptamer domain and an approximately 40 nucleotide expression platform that controls the ribosome access for translational initiation. We found that transcriptional pauses at strategic locations facilitate folding and structural rearrangement of the full-length riboswitch, but have minimal effect on the folding of the isolated aptamer domain. Pausing at these regulatory sites blocks the formation of alternate structures and plays a chaperoning role that couples folding of the aptamer domain and the expression platform. Pausing at strategic locations may be a general mechanism for coordinated folding and conformational rearrangements of riboswitch structures that underlie their response to environmental cues.

  18. Fluorescence-based strategies to investigate the structure and dynamics of aptamer-ligand complexes

    Science.gov (United States)

    Perez-Gonzalez, Cibran; Lafontaine, Daniel; Penedo, J.

    2016-08-01

    In addition to the helical nature of double-stranded DNA and RNA, single-stranded oligonucleotides can arrange themselves into tridimensional structures containing loops, bulges, internal hairpins and many other motifs. This ability has been used for more than two decades to generate oligonucleotide sequences, so-called aptamers, that can recognize certain metabolites with high affinity and specificity. More recently, this library of artificially-generated nucleic acid aptamers has been expanded by the discovery that naturally occurring RNA sequences control bacterial gene expression in response to cellular concentration of a given metabolite. The application of fluorescence methods has been pivotal to characterize in detail the structure and dynamics of these aptamer-ligand complexes in solution. This is mostly due to the intrinsic high sensitivity of fluorescence methods and also to significant improvements in solid-phase synthesis, post-synthetic labelling strategies and optical instrumentation that took place during the last decade. In this work, we provide an overview of the most widely employed fluorescence methods to investigate aptamer structure and function by describing the use of aptamers labelled with a single dye in fluorescence quenching and anisotropy assays. The use of 2-aminopurine as a fluorescent analog of adenine to monitor local changes in structure and fluorescence resonance energy transfer (FRET) to follow long-range conformational changes is also covered in detail. The last part of the review is dedicated to the application of fluorescence techniques based on single-molecule microscopy, a technique that has revolutionized our understanding of nucleic acid structure and dynamics. We finally describe the advantages of monitoring ligand-binding and conformational changes, one molecule at a time, to decipher the complexity of regulatory aptamers and summarize the emerging folding and ligand-binding models arising from the application of these

  19. Genomic SELEX: a discovery tool for genomic aptamers.

    Science.gov (United States)

    Zimmermann, Bob; Bilusic, Ivana; Lorenz, Christina; Schroeder, Renée

    2010-10-01

    Genomic SELEX is a discovery tool for genomic aptamers, which are genomically encoded functional domains in nucleic acid molecules that recognize and bind specific ligands. When combined with genomic libraries and using RNA-binding proteins as baits, Genomic SELEX used with high-throughput sequencing enables the discovery of genomic RNA aptamers and the identification of RNA-protein interaction networks. Here we describe how to construct and analyze genomic libraries, how to choose baits for selections, how to perform the selection procedure and finally how to analyze the enriched sequences derived from deep sequencing. As a control procedure, we recommend performing a "Neutral" SELEX experiment in parallel to the selection, omitting the selection step. This control experiment provides a background signal for comparison with the positively selected pool. We also recommend deep sequencing the initial library in order to facilitate the final in silico analysis of enrichment with respect to the initial levels. Counter selection procedures, using modified or inactive baits, allow strengthening the binding specificity of the winning selected sequences.

  20. Integrative analysis of miRNA and mRNA paired expression profiling of primary fibroblast derived from diabetic foot ulcers reveals multiple impaired cellular functions.

    Science.gov (United States)

    Liang, Liang; Stone, Rivka C; Stojadinovic, Olivera; Ramirez, Horacio; Pastar, Irena; Maione, Anna G; Smith, Avi; Yanez, Vanessa; Veves, Aristides; Kirsner, Robert S; Garlick, Jonathan A; Tomic-Canic, Marjana

    2016-11-01

    Diabetic foot ulcers (DFUs) are one of the major complications of diabetes. Its molecular pathology remains poorly understood, impeding the development of effective treatments. Although it has been established that multiple cell types, including fibroblasts, keratinocytes, macrophages, and endothelial cells, all contribute to inhibition of healing, less is known regarding contributions of individual cell type. Thus, we generated primary fibroblasts from nonhealing DFUs and evaluated their cellular and molecular properties in comparison to nondiabetic foot fibroblasts (NFFs). Specifically, we analyzed both micro-RNA and mRNA expression profiles of primary DFU fibroblasts. Paired genomic analyses identified a total of 331 reciprocal miRNA-mRNA pairs including 21 miRNAs (FC > 2.0) along with 239 predicted target genes (FC > 1.5) that are significantly and differentially expressed. Of these, we focused on three miRNAs (miR-21-5p, miR-34a-5p, miR-145-5p) that were induced in DFU fibroblasts as most differentially regulated. The involvement of these microRNAs in wound healing was investigated by testing the expression of their downstream targets as well as by quantifying cellular behaviors in prospectively collected and generated cell lines from 15 patients (seven DFUF and eight NFF samples). We found large number of downstream targets of miR-21-5p, miR-34a-5p, miR-145-5p to be coordinately regulated in mRNA profiles, which was confirmed by quantitative real-time PCR. Pathway analysis on paired miRNA-mRNA profiles predicted inhibition of cell movement and cell proliferation, as well as activation of cell differentiation and senescence in DFU fibroblasts, which was confirmed by cellular assays. We concluded that induction of miR-21-5p, miR-34a-5p, miR-145-5p in DFU dermal fibroblasts plays an important role in impairing multiple cellular functions, thus contributing to overall inhibition of healing in DFUs.

  1. Impaired Embryonic Development in Mice Overexpressing the RNA-Binding Protein TIAR

    OpenAIRE

    Yacine Kharraz; Pierre-Adrien Salmand; Anne Camus; Jacques Auriol; Cyril Gueydan; Véronique Kruys; Dominique Morello

    2010-01-01

    BACKGROUND: TIA-1-related (TIAR) protein is a shuttling RNA-binding protein involved in several steps of RNA metabolism. While in the nucleus TIAR participates to alternative splicing events, in the cytoplasm TIAR acts as a translational repressor on specific transcripts such as those containing AU-Rich Elements (AREs). Due to its ability to assemble abortive pre-initiation complexes coalescing into cytoplasmic granules called stress granules, TIAR is also involved in the general translationa...

  2. Mapping the affinity landscape of Thrombin-binding aptamers on 2'F-ANA/DNA chimeric G-Quadruplex microarrays.

    Science.gov (United States)

    Lietard, Jory; Abou Assi, Hala; Gómez-Pinto, Irene; González, Carlos; Somoza, Mark M; Damha, Masad J

    2017-01-18

    In situ fabricated nucleic acids microarrays are versatile and very high-throughput platforms for aptamer optimization and discovery, but the chemical space that can be probed against a given target has largely been confined to DNA, while RNA and non-natural nucleic acid microarrays are still an essentially uncharted territory. 2'-Fluoroarabinonucleic acid (2'F-ANA) is a prime candidate for such use in microarrays. Indeed, 2'F-ANA chemistry is readily amenable to photolithographic microarray synthesis and its potential in high affinity aptamers has been recently discovered. We thus synthesized the first microarrays containing 2'F-ANA and 2'F-ANA/DNA chimeric sequences to fully map the binding affinity landscape of the TBA1 thrombin-binding G-quadruplex aptamer containing all 32 768 possible DNA-to-2'F-ANA mutations. The resulting microarray was screened against thrombin to identify a series of promising 2'F-ANA-modified aptamer candidates with Kds significantly lower than that of the unmodified control and which were found to adopt highly stable, antiparallel-folded G-quadruplex structures. The solution structure of the TBA1 aptamer modified with 2'F-ANA at position T3 shows that fluorine substitution preorganizes the dinucleotide loop into the proper conformation for interaction with thrombin. Overall, our work strengthens the potential of 2'F-ANA in aptamer research and further expands non-genomic applications of nucleic acids microarrays.

  3. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    Abreu-Silva R.S.

    2006-01-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  4. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    R.S. Abreu-Silva

    2006-02-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  5. Development of radiopharmaceuticals based on aptamers: selection and characterization of DNA aptamers for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Correa, C.R.; Andrade, A.S.R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Augusto-Pinto, L. [BioAptus, Belo Horizonte, MG (Brazil); Goes, A.M., E-mail: goes@icb.ufmg.br [Departamento de Imunologia e Bioquimica. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais. Belo Horizonte, MG (Brazil)

    2011-07-01

    Colorectal cancer is among the top four causes of cancer deaths worldwide. Carcinoembryonic antigen (CEA) is a complex intracellular glycoprotein produced by about 90% of colorectal cancers. CEA has been identified as an attractive target for cancer research because of its pattern of expression in the surface cell and its likely functional role in tumorigenesis. Research on the rapid selection of ligands based on the SELEX (systematic evolution of ligands by exponential enrichment) forms the basis for the development of high affinity and high specificity molecules, which can bind to surface determinants of tumour cells, like CEA. The oligonucleotides ligands generated in this technique are called aptamers. Aptamers can potentially find applications as therapeutic or diagnostic tools for many kind of diseases, like a tumor. Aptamers offer low immunogenicity, good tumour penetration, rapid uptake and fast systemic clearance, which favour their application as effective vehicles for radiotherapy. In addition aptamers can be labeled with different radioactive isotopes. The aim of this work was select aptamers binding to the CEA tumor marker. The aptamers are obtained through by SELEX, in which aptamers are selected from a library of random sequences of synthetic DNA by repetitive binding of the oligonucleotides to target molecule (CEA). Analyses of the secondary structure of the aptamers were determined using the m fold toll. Three aptamers were selected to binding assay with target cells. These aptamers were confirmed to have affinity and specific binding for T84 cell line (target cell), showed by confocal imaging. We are currently studying the potential efficacy of these aptamers as targeted radiopharmaceuticals, for use as imaging agents or therapeutic applications. The development of aptamers specific to CEA open new perspectives for colorectal cancer diagnosis and treatment. Acknowledgments: This investigation was supported by the Centro de Desenvolvimento da

  6. Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

    Science.gov (United States)

    2008-12-01

    aptamers of Bacillus anthracis (Ba), Shiga toxin , botulinum neurotoxin (BoNT), and Francisella tularensis bacteria (all selected by SELEX) have been...This process has been used to select aptamers against different types of targets ( Bacillus anthracis spores, Bacillus thuringiensis spores, MS-2...studied by reselecting aptamers against different targets, Ba spores, Shiga toxin , and F. tularensis bacteria. In contrast to SELEX, the use of

  7. Future of aptamers in medicine

    CSIR Research Space (South Africa)

    Khati, M

    2010-06-01

    Full Text Available stream_source_info Khati_2010.pdf.txt stream_content_type text/plain stream_size 59703 Content-Encoding ISO-8859-1 stream_name Khati_2010.pdf.txt Content-Type text/plain; charset=ISO-8859-1 doi: 10.1136/jcp.2008....062786 2010 63: 480-487 originally published online April 1, 2010J Clin Pathol Makobetsa Khati The future of aptamers in medicine http://jcp.bmj.com/content/63/6/480.full.html Updated information and services can be found at: These include...

  8. Adaptation and Diversification of an RNA Replication System under Initiation- or Termination-Impaired Translational Conditions.

    Science.gov (United States)

    Mizuuchi, Ryo; Ichihashi, Norikazu; Yomo, Tetsuya

    2016-07-01

    Adaptation to various environments is a remarkable characteristic of life. Is this limited to extant complex living organisms, or is it also possible for a simpler self-replication system to adapt? In this study, we addressed this question by using a translation-coupled RNA replication system that comprised a reconstituted translation system and an RNA "genome" that encoded a replicase gene. We performed RNA replication reactions under four conditions, under which different components of translation were partly inhibited. We found that replication efficiency increased with the number of rounds of replication under all the tested conditions. The types of dominant mutations differed depending on the condition, thus indicating that this simple system adapted to different environments in different ways. This suggests that even a primitive self-replication system composed of a small number of genes on the early earth could have had the ability to adapt to various environments.

  9. Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.

    Directory of Open Access Journals (Sweden)

    Blanca I Escudero-Abarca

    Full Text Available Human noroviruses (HuNoV are the leading cause of acute viral gastroenteritis and an important cause of foodborne disease. Despite their public health significance, routine detection of HuNoV in community settings, or food and environmental samples, is limited, and there is a need to develop alternative HuNoV diagnostic reagents to complement existing ones. The purpose of this study was to select and characterize single-stranded (ssDNA aptamers with binding affinity to HuNoV. The utility of these aptamers was demonstrated in their use for capture and detection of HuNoV in outbreak-derived fecal samples and a representative food matrix. SELEX (Systematic Evolution of Ligands by EXponential enrichment was used to isolate ssDNA aptamer sequences with broad reactivity to the prototype GII.2 HuNoV strain, Snow Mountain Virus (SMV. Four aptamer candidates (designated 19, 21, 25 and 26 were identified and screened for binding affinity to 14 different virus-like particles (VLPs corresponding to various GI and GII HuNoV strains using an Enzyme-Linked Aptamer Sorbant Assay (ELASA. Collectively, aptamers 21 and 25 showed affinity to 13 of the 14 VLPs tested, with strongest binding to GII.2 (SMV and GII.4 VLPs. Aptamer 25 was chosen for further study. Its binding affinity to SMV-VLPs was equivalent to that of a commercial antibody within a range of 1 to 5 µg/ml. Aptamer 25 also showed binding to representative HuNoV strains present in stool specimens obtained from naturally infected individuals. Lastly, an aptamer magnetic capture (AMC method using aptamer 25 coupled with RT-qPCR was developed for recovery and detection of HuNoV in artificially contaminated lettuce. The capture efficiency of the AMC was 2.5-36% with an assay detection limit of 10 RNA copies per lettuce sample. These ssDNA aptamer candidates show promise as broadly reactive reagents for use in HuNoV capture and detection assays in various sample types.

  10. E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

    Science.gov (United States)

    Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

    2017-01-01

    Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

  11. Riboswitch-Mediated Aptamer Binding for Imaging and Therapy (RABIT): A Novel Technique to Selectively Target an Intracellular Ligand Specific for Ovarian Cancer

    Science.gov (United States)

    2013-10-01

    iodine it will be possible to image the cancer cells (125I and 123I) and treat the cancer (131I). In contrast to other toxins , radioactive...also began a search for DNA rather than RNA aptamers to antipyrine. A modified SELEX approach was used, followed by next generation sequencing...oligonucleotides showing preferential PCR amplification, and used in a subsequent round of aptamer selection. After 5 rounds of SELEX selection the

  12. Cell-type-specific, Aptamer-functionalized Agents for Targeted Disease Therapy.

    Science.gov (United States)

    Zhou, Jiehua; Rossi, John J

    2014-06-17

    One hundred years ago, Dr. Paul Ehrlich popularized the "magic bullet" concept for cancer therapy in which an ideal therapeutic agent would only kill the specific tumor cells it targeted. Since then, "targeted therapy" that specifically targets the molecular defects responsible for a patient's condition has become a long-standing goal for treating human disease. However, safe and efficient drug delivery during the treatment of cancer and infectious disease remains a major challenge for clinical translation and the development of new therapies. The advent of SELEX technology has inspired many groundbreaking studies that successfully adapted cell-specific aptamers for targeted delivery of active drug substances in both in vitro and in vivo models. By covalently linking or physically functionalizing the cell-specific aptamers with therapeutic agents, such as siRNA, microRNA, chemotherapeutics or toxins, or delivery vehicles, such as organic or inorganic nanocarriers, the targeted cells and tissues can be specifically recognized and the therapeutic compounds internalized, thereby improving the local concentration of the drug and its therapeutic efficacy. Currently, many cell-type-specific aptamers have been developed that can target distinct diseases or tissues in a cell-type-specific manner. In this review, we discuss recent advances in the use of cell-specific aptamers for targeted disease therapy, as well as conjugation strategies and challenges.

  13. Selection and analysis of a DNA aptamer binding α-amanitin from Amanita phalloides.

    Science.gov (United States)

    Muszyńska, Klaudia; Ostrowska, Dominika; Bartnicki, Filip; Kowalska, Ewa; Bodaszewska-Lubaś, Małgorzata; Hermanowicz, Paweł; Faulstich, Heinz; Strzałka, Wojciech

    2017-08-09

    Mushroom foraging is very popular in some regions of the world. Sometimes toxic and edible mushrooms are mistaken by mushroom collectors, leading to serious human poisoning. The group of mushrooms highly dangerous for human health includes Amanita phalloides. This mushroom produces a toxic octapeptide called α-amanitin which is an inhibitor of nuclear RNA polymerase II. The inhibition of this polymerase results in the abortion of mRNA synthesis. The ingestion of A. phalloides causes liver failure due to the fact that most of the toxin is uptaken by hepatocytes. The hospitalization of poisoned patients involves the removal of the toxin from the digestive tract, its dilution in the circulatory system and the administration of therapeutic adjuvants. Since there is no effective antidote against amanitin poisoning, in this study we developed a DNA aptamer exhibiting specific binding to α-amanitin. This aptamer was selected using the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method. Next, its ability of toxin removal from aqueous solution was confirmed by pull-down assay. The aptamer region sufficient for α-amanitin binding was determined. Finally, the dissociation constant of the α-amanitin/DNA aptamer complex was calculated.

  14. ELAKCA: Enzyme-Linked Aptamer Kissing Complex Assay as a Small Molecule Sensing Platform.

    Science.gov (United States)

    Chovelon, Benoit; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Faure, Patrice; Peyrin, Eric; Ravelet, Corinne

    2016-03-01

    We report herein a novel sandwich-type enzyme-linked assay for the "signal-on" colorimetric detection of small molecules. The approach (referred to as enzyme-linked aptamer kissing complex assay (ELAKCA)) relied on the kissing complex-based recognition of the target-bound hairpin aptamer conformational state by a specific RNA hairpin probe. The aptamer was covalently immobilized on a microplate well surface to act as target capture element. Upon small analyte addition, the folded aptamer was able to bind to the biotinylated RNA hairpin module through loop-loop interaction. The formed ternary complex was then revealed by the introduction of the streptavidin-horseradish peroxidase conjugate that catalytically converted the 3,3',5,5'-tetramethylbenzidine substrate into a colorimetric product. ELAKCA was successfully designed for two different systems allowing detecting the adenosine and theophylline molecules. The potential practical applicability in terms of biological sample analysis (human plasma), temporal stability, and reusability was also reported. Owing to the variety of both hairpin functional nucleic acids, kissing motifs, and enzyme-based signaling systems, ELAKCA opens up new prospects for developing small molecule sensing platforms of wide applications.

  15. Grouping Pentylenetetrazol-Induced Epileptic Rats According to Memory Impairment and MicroRNA Expression Profiles in the Hippocampus.

    Directory of Open Access Journals (Sweden)

    Xixia Liu

    Full Text Available Previous studies have demonstrated a close relationship between abnormal regulation of microRNA (miRNA and various types of diseases, including epilepsy and other neurological disorders of memory. However, the role of miRNA in the memory impairment observed in epilepsy remains unknown. In this study, a model of temporal lobe epilepsy (TLE was induced via pentylenetetrazol (PTZ kindling in Sprague-Dawley rats. First, the TLE rats were subjected to Morris water maze to identify those with memory impairment (TLE-MI compared with TLE control rats (TLE-C, which presented normal memory. Both groups were analyzed to detect dysregulated miRNAs in the hippocampus; four up-regulated miRNAs (miR-34c, miR-374, miR-181a, and miR-let-7c-1 and seven down-regulated miRNAs (miR-1188, miR-770-5p, miR-127-5p, miR-375, miR-331, miR-873-5p, and miR-328a were found. Some of the dysregulated miRNAs (miR-34c, miR-1188a, miR-328a, and miR-331 were confirmed using qRT-PCR, and their blood expression patterns were identical to those of their counterparts in the rat hippocampus. The targets of these dysregulated miRNAs and other potentially enriched biological signaling pathways were analyzed using bioinformatics. Following these results, the MAPK, apoptosis and hippocampal signaling pathways might be involved in the molecular mechanisms underlying the memory disorders of TLE.

  16. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    NARCIS (Netherlands)

    Thiffault, I.; Wolf, N.I.; Forget, D.; Guerrero, K.; Tran, L.T.; Choquet, K.; Lavallee-Adam, M.; Poitras, C.; Brais, B.; Yoon, G.; Sztriha, L.; Webster, R.I.; Timmann, D.; Warrenburg, B.P.C. van de; Seeger, J.; Zimmermann, A.; Mate, A.; Goizet, C.; Fung, E.; Knaap, M.S. van der; Fribourg, S.; Vanderver, A.; Simons, C.; Taft, R.J.; Yates, J.R., 3rd; Coulombe, B.; Bernard, G.

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutati

  17. Aptamer-Mediated Codelivery of Doxorubicin and NF-κB Decoy Enhances Chemosensitivity of Pancreatic Tumor Cells

    Directory of Open Access Journals (Sweden)

    David Porciani

    2015-01-01

    Full Text Available Aptamers able to bind efficiently cell-surface receptors differentially expressed in tumor and in healthy cells are emerging as powerful tools to perform targeted anticancer therapy. Here, we present a novel oligonucleotide chimera, composed by an RNA aptamer and a DNA decoy. Our assembly is able to (i target tumor cells via an antitransferrin receptor RNA aptamer and (ii perform selective codelivery of a chemotherapeutic drug (Doxorubicin and of an inhibitor of a cell-survival factor, the nuclear factor κB decoy oligonucleotide. Both payloads are released under conditions found in endolysosomal compartments (low pH and reductive environment. Targeting and cytotoxicity of the oligonucleotidic chimera were assessed by confocal microscopy, cell viability, and Western blot analysis. These data indicated that the nuclear factor κB decoy does inhibit nuclear factor κB activity and ultimately leads to an increased therapeutic efficacy of Doxorubicin selectively in tumor cells.

  18. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  19. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons.

    Science.gov (United States)

    Kiryk, Anna; Sowodniok, Katharina; Kreiner, Grzegorz; Rodriguez-Parkitna, Jan; Sönmez, Aynur; Górkiewicz, Tomasz; Bierhoff, Holger; Wawrzyniak, Marcin; Janusz, Artur K; Liss, Birgit; Konopka, Witold; Schütz, Günther; Kaczmarek, Leszek; Parlato, Rosanna

    2013-01-01

    Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer's disease (AD) and may play a role in dementia. Moreover, aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3, and dentate gyrus (DG). Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that 36 transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF) binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the DG a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving neuronal function.

  20. Cell-Specific Aptamers as Emerging Therapeutics

    Directory of Open Access Journals (Sweden)

    Cindy Meyer

    2011-01-01

    Full Text Available Aptamers are short nucleic acids that bind to defined targets with high affinity and specificity. The first aptamers have been selected about two decades ago by an in vitro process named SELEX (systematic evolution of ligands by exponential enrichment. Since then, numerous aptamers with specificities for a variety of targets from small molecules to proteins or even whole cells have been selected. Their applications range from biosensing and diagnostics to therapy and target-oriented drug delivery. More recently, selections using complex targets such as live cells have become feasible. This paper summarizes progress in cell-SELEX techniques and highlights recent developments, particularly in the field of medically relevant aptamers with a focus on therapeutic and drug-delivery applications.

  1. DNA aptamer raised against advanced glycation end products (AGEs) improves glycemic control and decreases adipocyte size in fructose-fed rats by suppressing AGE-RAGE axis.

    Science.gov (United States)

    Ojima, A; Matsui, T; Nakamura, N; Higashimoto, Y; Ueda, S; Fukami, K; Okuda, S; Yamagishi, S

    2015-04-01

    Advanced glycation end products (AGEs) decrease adiponectin expression and suppress insulin signaling in cultured adipocytes through the interaction with a receptor for AGEs (RAGE) via oxidative stress generation. We have recently found that high-affinity DNA aptamer directed against AGE (AGE-aptamer) prevents the progression of experimental diabetic nephropathy by blocking the harmful actions of AGEs in the kidney. This study examined the effects of AGE-aptamer on adipocyte remodeling, AGE-RAGE-oxidative stress axis, and adiponectin expression in fructose-fed rats. Although AGE-aptamer treatment by an osmotic mini pump for 8 weeks did not affect serum insulin levels, it significantly decreased average fasting blood glucose and had a tendency to inhibit body weight gain in fructose-fed rats. Furthermore, AGE-aptamer significantly suppressed the increase in adipocyte size and prevented the elevation in AGEs, RAGE, and an oxidative stress marker, 8-hydroxydeoxyguanosine (8-OHdG), levels in adipose tissues of fructose-fed rats at 14-week-old, while it restored the decrease in adiponectin mRNA levels. Our present study suggests that AGE-aptamer could improve glycemic control and prevent adipocyte remodeling in fructose-fed rats partly by suppressing the AGE-RAGE-mediated oxidative stress generation. AGE-aptamer might be a novel therapeutic strategy for fructose-induced metabolic derangements.

  2. Impairment of pre-mRNA splicing in liver disease: Mechanisms and consequences

    Institute of Scientific and Technical Information of China (English)

    Carmen; Berasain; Saioa; Gońi; Josefa; Castillo; Maria; Ujue; Latasa; Jesús; Prieto; Matias; A; Avila

    2010-01-01

    Pre-mRNA splicing is an essential step in the process of gene expression in eukaryotes and consists of the removal ofintrons and the linking of exons to generate mature mRNAs. This is a highly regulated mechanism that allows the alternative usage of exons, the retention ofintronic sequences and the generation of exonic sequences of variable length. Most human genes undergo splicing events, and disruptions of this process have been associated with a variety of diseases, including cancer. Hepatocellular carci...

  3. From selection hits to clinical leads: progress in aptamer discovery

    Directory of Open Access Journals (Sweden)

    Keith E Maier

    2016-01-01

    Full Text Available Aptamers were discovered more than 25 years ago, yet only one has been approved by the US Food and Drug Administration to date. With some noteworthy advances in their chemical design and the enzymes we use to make them, aptamers and aptamer-based therapeutics have seen a resurgence in interest. New aptamer drugs are being approved for clinical evaluation, and it is certain that we will see increasingly more aptamers and aptamer-like drugs in the future. In this review, we will discuss the production of aptamers with an emphasis on the advances and modifications that enabled early aptamers to succeed in clinical trials as well as those that are likely to be important for future generations of these drugs.

  4. Impaired embryonic development in mice overexpressing the RNA-binding protein TIAR.

    Directory of Open Access Journals (Sweden)

    Yacine Kharraz

    Full Text Available BACKGROUND: TIA-1-related (TIAR protein is a shuttling RNA-binding protein involved in several steps of RNA metabolism. While in the nucleus TIAR participates to alternative splicing events, in the cytoplasm TIAR acts as a translational repressor on specific transcripts such as those containing AU-Rich Elements (AREs. Due to its ability to assemble abortive pre-initiation complexes coalescing into cytoplasmic granules called stress granules, TIAR is also involved in the general translational arrest observed in cells exposed to environmental stress. However, the in vivo role of this protein has not been studied so far mainly due to severe embryonic lethality upon tiar invalidation. METHODOLOGY/PRINCIPAL FINDINGS: To examine potential TIAR tissue-specificity in various cellular contexts, either embryonic or adult, we constructed a TIAR transgenic allele (loxPGFPloxPTIAR allowing the conditional expression of TIAR protein upon Cre recombinase activity. Here, we report the role of TIAR during mouse embryogenesis. We observed that early TIAR overexpression led to low transgene transmission associated with embryonic lethality starting at early post-implantation stages. Interestingly, while pre-implantation steps evolved correctly in utero, in vitro cultured embryos were very sensitive to culture medium. Control and transgenic embryos developed equally well in the G2 medium, whereas culture in M16 medium led to the phosphorylation of eIF2alpha that accumulated in cytoplasmic granules precluding transgenic blastocyst hatching. Our results thus reveal a differential TIAR-mediated embryonic response following artificial or natural growth environment. CONCLUSIONS/SIGNIFICANCE: This study reports the importance of the tightly balanced expression of the RNA-binding protein TIAR for normal embryonic development, thereby emphasizing the role of post-transcriptional regulations in early embryonic programming.

  5. Impaired Embryonic Development in Mice Overexpressing the RNA-Binding Protein TIAR

    Science.gov (United States)

    Kharraz, Yacine; Salmand, Pierre-Adrien; Camus, Anne; Auriol, Jacques; Gueydan, Cyril; Kruys, Véronique; Morello, Dominique

    2010-01-01

    Background TIA-1-related (TIAR) protein is a shuttling RNA-binding protein involved in several steps of RNA metabolism. While in the nucleus TIAR participates to alternative splicing events, in the cytoplasm TIAR acts as a translational repressor on specific transcripts such as those containing AU-Rich Elements (AREs). Due to its ability to assemble abortive pre-initiation complexes coalescing into cytoplasmic granules called stress granules, TIAR is also involved in the general translational arrest observed in cells exposed to environmental stress. However, the in vivo role of this protein has not been studied so far mainly due to severe embryonic lethality upon tiar invalidation. Methodology/Principal Findings To examine potential TIAR tissue-specificity in various cellular contexts, either embryonic or adult, we constructed a TIAR transgenic allele (loxPGFPloxPTIAR) allowing the conditional expression of TIAR protein upon Cre recombinase activity. Here, we report the role of TIAR during mouse embryogenesis. We observed that early TIAR overexpression led to low transgene transmission associated with embryonic lethality starting at early post-implantation stages. Interestingly, while pre-implantation steps evolved correctly in utero, in vitro cultured embryos were very sensitive to culture medium. Control and transgenic embryos developed equally well in the G2 medium, whereas culture in M16 medium led to the phosphorylation of eIF2α that accumulated in cytoplasmic granules precluding transgenic blastocyst hatching. Our results thus reveal a differential TIAR-mediated embryonic response following artificial or natural growth environment. Conclusions/Significance This study reports the importance of the tightly balanced expression of the RNA-binding protein TIAR for normal embryonic development, thereby emphasizing the role of post-transcriptional regulations in early embryonic programming. PMID:20596534

  6. RNA sequencing of creatine transporter (SLC6A8) deficient fibroblasts reveals impairment of the extracellular matrix.

    Science.gov (United States)

    Nota, Benjamin; Ndika, Joseph D T; van de Kamp, Jiddeke M; Kanhai, Warsha A; van Dooren, Silvy J M; van de Wiel, Mark A; Pals, Gerard; Salomons, Gajja S

    2014-09-01

    Creatine transporter (SLC6A8) deficiency is the most common cause of cerebral creatine syndromes, and is characterized by depletion of creatine in the brain. Manifestations of this X-linked disorder include intellectual disability, speech/language impairment, behavior abnormalities, and seizures. At the moment, no effective treatment is available. In order to investigate the molecular pathophysiology of this disorder, we performed RNA sequencing on fibroblasts derived from patients. The transcriptomes of fibroblast cells from eight unrelated individuals with SLC6A8 deficiency and three wild-type controls were sequenced. SLC6A8 mutations with different effects on the protein product resulted in different gene expression profiles. Differential gene expression analysis followed by gene ontology term enrichment analysis revealed that especially the expression of genes encoding components of the extracellular matrix and cytoskeleton are altered in SLC6A8 deficiency, such as collagens, keratins, integrins, and cadherins. This suggests an important novel role for creatine in the structural development and maintenance of cells. It is likely that the (extracellular) structure of brain cells is also impaired in SLC6A8-deficient patients, and future studies are necessary to confirm this and to reveal the true functions of creatine in the brain. © 2014 WILEY PERIODICALS, INC.

  7. Screening of Aptamers on Microfluidic Systems for Clinical Applications

    OpenAIRE

    Gwo-Bin Lee; Chao-Jyun Huang; Chen-Hsun Weng

    2012-01-01

    The use of microfluidic systems for screening of aptamers and their biomedical applications are reviewed in this paper. Aptamers with different nucleic acid sequences have been extensively studied and the results demonstrated a strong binding affinity to target molecules such that they can be used as promising candidate biomarkers for diagnosis and therapeutics. Recently, the aptamer screening protocol has been conducted with microfluidic-based devices. Furthermore, aptamer affinity screening...

  8. More DNA-Aptamers for Small Drugs: A Capture-SELEX Coupled with Surface Plasmon Resonance and High-Throughput Sequencing.

    Science.gov (United States)

    Spiga, Fabio M; Maietta, Paolo; Guiducci, Carlotta

    2015-05-11

    To address limitations in the production of DNA aptamers against small molecules, we introduce a DNA-based capture-SELEX (systematic evolution of ligands by exponential enrichment) protocol with long and continuous randomized library for more flexibility, coupled with in-stream direct-specificity monitoring via SPR and high throughput sequencing (HTS). Applying this capture-SELEX on tobramycin shows that target-specificity arises at cycle number 8, which is confirmed by sequence convergence in HTS analysis. Interestingly, HTS also shows that the most enriched sequences are already visible after only two capture-SELEX cycles. The best aptamers displayed K(D) of approximately 200 nM, similar to RNA and DNA-based aptamers previously selected for tobramycin. The lowest concentration of tobramycin detected on label-free SPR experiments with the selected aptamers is 20-fold smaller than the clinical range limit, demonstrating suitability for small-drug biosensing.

  9. Intra-accumbens injection of a dopamine aptamer abates MK-801-induced cognitive dysfunction in a model of schizophrenia.

    Directory of Open Access Journals (Sweden)

    Matthew R Holahan

    Full Text Available Systemic administration of the noncompetitive NMDA-receptor antagonist, MK-801, has been proposed to model cognitive deficits similar to those seen in patients with schizophrenia. The present work investigated the ability of a dopamine-binding DNA aptamer to regulate these MK-801-induced cognitive deficits when injected into the nucleus accumbens. Rats were trained to bar press for chocolate pellet rewards then randomly assigned to receive an intra-accumbens injection of a DNA aptamer (200 nM; n = 7, tris buffer (n = 6 or a randomized DNA oligonucleotide (n = 7. Animals were then treated systemically with MK-801 (0.1 mg/kg and tested for their ability to extinguish their bar pressing response. Two control groups were also included that did not receive MK-801. Data revealed that injection of Tris buffer or the random oligonucleotide sequence into the nucleus accumbens prior to treatment with MK-801 did not reduce the MK-801-induced extinction deficit. Animals continued to press at a high rate over the entire course of the extinction session. Injection of the dopamine aptamer reversed this MK-801-induced elevation in lever pressing to levels as seen in rats not treated with MK-801. Tests for activity showed that the aptamer did not impair locomotor activity. Results demonstrate the in vivo utility of DNA aptamers as tools to investigate neurobiological processes in preclinical animal models of mental health disease.

  10. Intra-accumbens injection of a dopamine aptamer abates MK-801-induced cognitive dysfunction in a model of schizophrenia.

    Science.gov (United States)

    Holahan, Matthew R; Madularu, Dan; McConnell, Erin M; Walsh, Ryan; DeRosa, Maria C

    2011-01-01

    Systemic administration of the noncompetitive NMDA-receptor antagonist, MK-801, has been proposed to model cognitive deficits similar to those seen in patients with schizophrenia. The present work investigated the ability of a dopamine-binding DNA aptamer to regulate these MK-801-induced cognitive deficits when injected into the nucleus accumbens. Rats were trained to bar press for chocolate pellet rewards then randomly assigned to receive an intra-accumbens injection of a DNA aptamer (200 nM; n = 7), tris buffer (n = 6) or a randomized DNA oligonucleotide (n = 7). Animals were then treated systemically with MK-801 (0.1 mg/kg) and tested for their ability to extinguish their bar pressing response. Two control groups were also included that did not receive MK-801. Data revealed that injection of Tris buffer or the random oligonucleotide sequence into the nucleus accumbens prior to treatment with MK-801 did not reduce the MK-801-induced extinction deficit. Animals continued to press at a high rate over the entire course of the extinction session. Injection of the dopamine aptamer reversed this MK-801-induced elevation in lever pressing to levels as seen in rats not treated with MK-801. Tests for activity showed that the aptamer did not impair locomotor activity. Results demonstrate the in vivo utility of DNA aptamers as tools to investigate neurobiological processes in preclinical animal models of mental health disease.

  11. Aptamer-targeted inhibition of mTOR in T cells enhances antitumor immunity.

    Science.gov (United States)

    Berezhnoy, Alexey; Castro, Iris; Levay, Agata; Malek, Thomas R; Gilboa, Eli

    2014-01-01

    Recent studies have underscored the importance of memory T cells in mediating protective immunity against pathogens and cancer. Pharmacological inhibition of regulators that mediate T cell differentiation promotes the differentiation of activated CD8(+) T cells into memory cells. Nonetheless, pharmacological agents have broad targets and can induce undesirable immunosuppressive effects. Here, we tested the hypothesis that aptamer-targeted siRNA inhibition of mTOR complex 1 (mTORC1) function in CD8(+) T cells can enhance their differentiation into memory T cells and potentiate antitumor immunity more effectively than the pharmacologic inhibitor rapamycin. To specifically target activated cells, we conjugated an siRNA targeting the mTORC1 component raptor to an aptamer that binds 4-1BB, a costimulatory molecule that is expressed on CD8(+) T cells following TCR stimulation. We found that systemic administration of the 4-1BB aptamer-raptor siRNA to mice downregulated mTORC1 activity in the majority of CD8(+) T cells, leading to the generation of a potent memory response that exhibited cytotoxic effector functions and enhanced vaccine-induced protective immunity in tumor-bearing mice. In contrast, while treatment with the general mTORC1 inhibitor rapamycin also enhanced antigen-activated CD8(+) T cell persistence, the cytotoxic effector functions of the reactivated memory cells were reduced and the alloreactivity of DCs was diminished. Consistent with the immunological findings, mice treated with rapamycin, but not with 4-1BB aptamer-raptor siRNA, failed to reject a subsequent tumor challenge.

  12. Aptamer-Functionalized Nano-Biosensors

    Directory of Open Access Journals (Sweden)

    Tai-Chia Chiu

    2009-12-01

    Full Text Available Nanomaterials have become one of the most interesting sensing materials because of their unique size- and shape-dependent optical properties, high surface energy and surface-to-volume ratio, and tunable surface properties. Aptamers are oligonucleotides that can bind their target ligands with high affinity. The use of nanomaterials that are bioconjugated with aptamers for selective and sensitive detection of analytes such as small molecules, metal ions, proteins, and cells has been demonstrated. This review focuses on recent progress in the development of biosensors by integrating functional aptamers with different types of nanomaterials, including quantum dots, magnetic nanoparticles (NPs, metallic NPs, and carbon nanotubes. Colorimetry, fluorescence, electrochemistry, surface plasmon resonance, surface-enhanced Raman scattering, and magnetic resonance imaging are common detection modes for a broad range of analytes with high sensitivity and selectivity when using aptamer bioconjugated nanomaterials (Apt-NMs. We highlight the important roles that the size and concentration of nanomaterials, the secondary structure and density of aptamers, and the multivalent interactions play in determining the specificity and sensitivity of the nanosensors towards analytes. Advantages and disadvantages of the Apt-NMs for bioapplications are focused.

  13. Identification of ssDNA aptamers specific to clinical isolates of Streptococcus mutans strains with different cariogenicity.

    Science.gov (United States)

    Cui, Wei; Liu, Jiaojiao; Su, Donghua; Hu, Danyang; Hou, Shuai; Hu, Tongnan; Yang, Jiyong; Luo, Yanping; Xi, Qing; Chu, Bingfeng; Wang, Chenglong

    2016-06-01

    Streptococcus mutans, a Gram-positive facultative anaerobic bacterium, is considered to be a major etiological factor for dental caries. In this study, plaques from dental enamel surfaces of caries-active and caries-free individuals were obtained and cultivated for S. mutans isolation. Morphology examination, biochemical characterization, and polymerase chain reaction were performed to identify S. mutans The cariogenicity of S. mutans strains isolated from clinical specimens was evaluated by testing the acidogenicity, aciduricity, extracellular polysaccharide production, and adhesion ability of the bacteria. Finally, subtractive SELEX (systematic evolution of ligands by exponential enrichment) technology targeting whole intact cells was used to screen for ssDNA aptamers specific to the strains with high cariogenicity. After nine rounds of subtractive SELEX, sufficient pool enrichment was achieved as shown by radioactive isotope analysis. The enriched pool was cloned and sequenced randomly, followed by MEME online and RNA structure software analysis of the sequences. Results from the flow cytometry indicated that aptamers H1, H16, H4, L1, L10, and H19 could discriminate highly cariogenic S. mutans strains from poorly cariogenic strains. Among these, Aptamer H19 had the strongest binding capacity with cariogenic S. mutans strains with a dissociation constant of 69.45 ± 38.53 nM. In conclusion, ssDNA aptamers specific to highly cariogenic clinical S. mutans strains were successfully obtained. These ssDNA aptamers might be used for the early diagnosis and treatment of dental caries.

  14. Nucleic acid aptamers: an emerging frontier in cancer therapy.

    Science.gov (United States)

    Zhu, Guizhi; Ye, Mao; Donovan, Michael J; Song, Erqun; Zhao, Zilong; Tan, Weihong

    2012-11-04

    The last two decades have witnessed the development and application of nucleic acid aptamers in a variety of fields, including target analysis, disease therapy, and molecular and cellular engineering. The efficient and widely applicable aptamer selection, reproducible chemical synthesis and modification, generally impressive target binding selectivity and affinity, relatively rapid tissue penetration, low immunogenicity, and rapid systemic clearance make aptamers ideal recognition elements for use as therapeutics or for in vivo delivery of therapeutics. In this feature article, we discuss the development and biomedical application of nucleic acid aptamers, with emphasis on cancer cell aptamer isolation, targeted cancer therapy, oncology biomarker identification and drug discovery.

  15. Function and dynamics of aptamers: A case study on the malachite green aptamer

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Tianjiao [Iowa State Univ., Ames, IA (United States)

    2008-01-01

    Aptamers are short single-stranded nucleic acids that can bind to their targets with high specificity and high affinity. To study aptamer function and dynamics, the malachite green aptamer was chosen as a model. Malachite green (MG) bleaching, in which an OH- attacks the central carbon (C1) of MG, was inhibited in the presence of the malachite green aptamer (MGA). The inhibition of MG bleaching by MGA could be reversed by an antisense oligonucleotide (AS) complementary to the MGA binding pocket. Computational cavity analysis of the NMR structure of the MGA-MG complex predicted that the OH- is sterically excluded from the C1 of MG. The prediction was confirmed experimentally using variants of the MGA with changes in the MG binding pocket. This work shows that molecular reactivity can be reversibly regulated by an aptamer-AS pair based on steric hindrance. In addition to demonstrate that aptamers could control molecular reactivity, aptamer dynamics was studied with a strategy combining molecular dynamics (MD) simulation and experimental verification. MD simulation predicted that the MG binding pocket of the MGA is largely pre-organized and that binding of MG involves reorganization of the pocket and a simultaneous twisting of the MGA terminal stems around the pocket. MD simulation also provided a 3D-structure model of unoccupied MGA that has not yet been obtained by biophysical measurements. These predictions were consistent with biochemical and biophysical measurements of the MGA-MG interaction including RNase I footprinting, melting curves, thermodynamic and kinetic constants measurement. This work shows that MD simulation can be used to extend our understanding of the dynamics of aptamer-target interaction which is not evident from static 3D-structures. To conclude, I have developed a novel concept to control molecular reactivity by an aptamer based on steric protection and a strategy to study the dynamics of aptamer-target interaction by combining MD

  16. Aptamer nanomedicine for cancer therapeutics: barriers and potential for translation.

    Science.gov (United States)

    Lao, Yeh-Hsing; Phua, Kyle K L; Leong, Kam W

    2015-03-24

    Aptamer nanomedicine, including therapeutic aptamers and aptamer nanocomplexes, is beginning to fulfill its potential in both clinical trials and preclinical studies. Especially in oncology, aptamer nanomedicine may perform better than conventional or antibody-based chemotherapeutics due to specificity compared to the former and stability compared to the latter. Many proof-of-concept studies on applying aptamers to drug delivery, gene therapy, and cancer imaging have shown promising efficacy and impressive safety in vivo toward translation. Yet, there remains ample room for improvement and critical barriers to be addressed. In this review, we will first introduce the recent progress in clinical trials of aptamer nanomedicine, followed by a discussion of the barriers at the design and in vivo application stages. We will then highlight recent advances and engineering strategies proposed to tackle these barriers. Aptamer cancer nanomedicine has the potential to address one of the most important healthcare issues of the society.

  17. Recent progresses in biomedical applications of aptamer-functionalized systems.

    Science.gov (United States)

    Ding, Fei; Gao, Yangguang; He, Xianran

    2017-09-15

    Aptamers, known as "chemical antibodies" are screened via a combinational technology of systematic evolution of ligands by exponential enrichment (SELEX). Due to their specific targeting ability, high binding affinity, low immunogenicity and easy modification, aptamer-functionalized systems have been extensively applied in various fields and exhibit favorable results. However, there is still a long way for them to be commercialized, and few aptamer-functionalized systems have yet successfully entered clinical and industrial use. Thus, it is necessary to overview the recent research progresses of aptamer-functionalized systems for the researchers to improve or design novel and better aptamer-functionalized systems. In this review, we first introduce the recent progresses of aptamer-functionalized systems' applications in biosensing, targeted drug delivery, gene therapy and cancer cell imaging, followed by a discussion of the challenges faced with extensive applications of aptamer-functionalized systems and speculation of the future prospects of them. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Generation of aptamer for biosensing applications

    Science.gov (United States)

    Gopinath, Subash C. B.; Hashim, U.; Arshad, M. K. Md.; Ruslinda, A. R.

    2016-07-01

    Systematic evolution of ligands by exponential enrichment (SELEX), an in vitro strategy which involves generation of aptamer. Aptamer is an artificial antibody, behave very similar to antibody and several instances reported to be better than antibodies. In this study, an attempt has been made to generate aptamer against factor IX, a potential candidate involve in human blood coagulation cascade. Totally, 10 selection cycles have been performed and molecules from 10th cycle have shown higher binding affinity with factor IX as 56 and 68% against the factor IX concentrations of 100 and 200 nM, respectively. With these higher binding affinities, it is clear that these molecules have higher potential for sensing applications.

  19. Developing Aptamers by Cell-Based SELEX.

    Science.gov (United States)

    Catuogno, Silvia; Esposito, Carla Lucia; de Franciscis, Vittorio

    2016-01-01

    The reliable targeting of cell surface disease-associated proteins is a major challenge in chemical biology and molecular medicine. In this regard, aptamers represent a very attractive and innovative class of ligand molecules. Aptamers are generated by a reiterated in vitro procedure, named SELEX (Systematic Evolution of Ligands by Exponential enrichment). In order to generate aptamers for heavily modified cell surface-bound proteins and transmembrane receptors, the SELEX procedure has been recently adapted to the use of living cells as complex targets (referred as "cell-SELEX"). Here we give an overview on the most recent advances in the field of cell-SELEX technology, providing a detailed description of the differential cell-SELEX approach that has been developed in our laboratory to identify specific signatures for human malignant glioma and non-small-cell lung cancer. The procedures used for the evaluation of binding specificity and for the preliminary identification of potential target receptors will be also described.

  20. Aptamer Based Microsphere Biosensor for Thrombin Detection

    Directory of Open Access Journals (Sweden)

    Xudong Fan

    2006-08-01

    Full Text Available We have developed an optical microsphere resonator biosensor using aptamer asreceptor for the measurement of the important biomolecule thrombin. The sphere surface ismodified with anti-thrombin aptamer, which has excellent binding affinity and selectivityfor thrombin. Binding of the thrombin at the sphere surface is monitored by the spectralposition of the microsphere’s whispering gallery mode resonances. A detection limit on theorder of 1 NIH Unit/mL is demonstrated. Control experiments with non-aptameroligonucleotide and BSA are also carried out to confirm the specific binding betweenaptamer and thrombin. We expect that this demonstration will lead to the development ofhighly sensitive biomarker sensors based on aptamer with lower cost and higher throughputthan current technology.

  1. Development of an aptamer-based concentration method for the detection of Trypanosoma cruzi in blood.

    Directory of Open Access Journals (Sweden)

    Rana Nagarkatti

    Full Text Available Trypanosoma cruzi, a blood-borne parasite, is the etiological agent of Chagas disease. T. cruzi trypomastigotes, the infectious life cycle stage, can be detected in blood of infected individuals using PCR-based methods. However, soon after a natural infection, or during the chronic phase of Chagas disease, the number of parasites in blood may be very low and thus difficult to detect by PCR. To facilitate PCR-based detection methods, a parasite concentration approach was explored. A whole cell SELEX strategy was utilized to develop serum stable RNA aptamers that bind to live T. cruzi trypomastigotes. These aptamers bound to the parasite with high affinities (8-25 nM range. The highest affinity aptamer, Apt68, also demonstrated high specificity as it did not interact with the insect stage epimastigotes of T. cruzi nor with other related trypanosomatid parasites, L. donovani and T. brucei, suggesting that the target of Apt68 was expressed only on T. cruzi trypomastigotes. Biotinylated Apt68, immobilized on a solid phase, was able to capture live parasites. These captured parasites were visible microscopically, as large motile aggregates, formed when the aptamer coated paramagnetic beads bound to the surface of the trypomastigotes. Additionally, Apt68 was also able to capture and aggregate trypomastigotes from several isolates of the two major genotypes of the parasite. Using a magnet, these parasite-bead aggregates could be purified from parasite-spiked whole blood samples, even at concentrations as low as 5 parasites in 15 ml of whole blood, as detected by a real-time PCR assay. Our results show that aptamers can be used as pathogen specific ligands to capture and facilitate PCR-based detection of T. cruzi in blood.

  2. Development of an Aptamer-Based Concentration Method for the Detection of Trypanosoma cruzi in Blood

    Science.gov (United States)

    Nagarkatti, Rana; Bist, Vaibhav; Sun, Sirena; Fortes de Araujo, Fernanda; Nakhasi, Hira L.; Debrabant, Alain

    2012-01-01

    Trypanosoma cruzi, a blood-borne parasite, is the etiological agent of Chagas disease. T. cruzi trypomastigotes, the infectious life cycle stage, can be detected in blood of infected individuals using PCR-based methods. However, soon after a natural infection, or during the chronic phase of Chagas disease, the number of parasites in blood may be very low and thus difficult to detect by PCR. To facilitate PCR-based detection methods, a parasite concentration approach was explored. A whole cell SELEX strategy was utilized to develop serum stable RNA aptamers that bind to live T. cruzi trypomastigotes. These aptamers bound to the parasite with high affinities (8–25 nM range). The highest affinity aptamer, Apt68, also demonstrated high specificity as it did not interact with the insect stage epimastigotes of T. cruzi nor with other related trypanosomatid parasites, L. donovani and T. brucei, suggesting that the target of Apt68 was expressed only on T. cruzi trypomastigotes. Biotinylated Apt68, immobilized on a solid phase, was able to capture live parasites. These captured parasites were visible microscopically, as large motile aggregates, formed when the aptamer coated paramagnetic beads bound to the surface of the trypomastigotes. Additionally, Apt68 was also able to capture and aggregate trypomastigotes from several isolates of the two major genotypes of the parasite. Using a magnet, these parasite-bead aggregates could be purified from parasite-spiked whole blood samples, even at concentrations as low as 5 parasites in 15 ml of whole blood, as detected by a real-time PCR assay. Our results show that aptamers can be used as pathogen specific ligands to capture and facilitate PCR-based detection of T. cruzi in blood. PMID:22927983

  3. An aptamer beacon responsive to botulinum toxins.

    Science.gov (United States)

    Bruno, John G; Richarte, Alicia M; Carrillo, Maria P; Edge, Allison

    2012-01-15

    Sixty candidate DNA aptamers were developed against botulinum neurotoxin (BoNT) type A light chain (LC) from ten rounds of selection, resulting in several identical sequences. Secondary structures of the identical aptamers were compared to structures of previously reported BoNT A DNA aptamers. A series of ten candidate loop structures were selected from this comparison as potential binding pockets and aptamer beacons. These candidate beacons were synthesized with 5'-TYE 665 and 3'-Iowa Black quencher labels for comparison of fluorescence levels as a function of BoNT A LC concentration. Only three of the ten candidates exhibited any fluorescence response to increasing levels of BoNT A LC. However, of the two most responsive candidates, one represented a subset loop of the larger more intensely fluorescent double-looped structure, designated Beacon 10. This beacon yielded a lower limit of detection of 1 ng/mL in buffer using a spectrofluorometer and a portable handheld fluorometer, but also responded substantially to BoNT A, B, E holotoxins and heavy or light chain components even in a dilute soil suspension, but not in 50% human serum. Beacon 10 did not respond strongly to a variety of other divergent peptides, suggesting that it is relatively specific to the level of botulinum toxins and is only useful for environmental testing. Beacon 10 also shared short sequence segments with other published BoNT aptamer DNA sequences, suggesting that these may be points of physical contact between the aptamers and BoNTs.

  4. DNA Aptamers to Human Immunodeficiency Virus Reverse Transcriptase Selected by a Primer-Free SELEX Method: Characterization and Comparison with Other Aptamers

    Science.gov (United States)

    Lai, Yi-Tak

    2012-01-01

    A 30-nucleotide DNA aptamer (5′-AGGAAGGCTTTAGGTCTGAGATCTCGGAAT-3′, denoted PF1) selected for high affinity to human immunodeficiency virus reverse transcriptase (HIV RT) using a primer-free SELEX (systematic evolution of ligands by exponential enrichment) method was characterized to determine features promoting tight binding. PF1's equilibrium dissociation constant for RT was ∼80 nM, over 10-fold lower than a random 30-mer. Changing the 2 terminal diguanosine repeats (underlined above) to diadenosine or dithymidine modestly decreased binding. Any changes to the 2 central diguanosines dramatically decreased binding. Binding was highly sensitive to length, with any truncations that deleted part of the 4 diguanosine motifs resulting in a 6-fold or more decrease in affinity. Even a construct with all the diguanosine motifs but lacking the 5′ terminal A and 3 nucleotides at the 3′ end showed ∼3-fold binding decrease. Changes to the nucleotides between the diguanosines, even those that did not alter PF1's low secondary structure (free energy of folding ΔG=−0.61 kcal/mol), dramatically decreased binding, suggesting sequence specificity. Despite the diguanosine motifs, circular dichroism (CD) spectra indicated that PF1 did not form a G-quartet. PF1 inhibited HIV RT synthesis with a half-maximal inhibitory value (IC50) of ∼60 nM. Larger, more structured RT DNA aptamers based on the HIV polypurine tract and those that formed G-quartets (denoted S4 and R1T) were more potent inhibitors, with IC50 values of ∼4 and ∼1 nM, respectively. An RNA pseudoknot aptamer (denoted 1.1) showed an IC50 near 4 nM. Competition binding assays with PF1 and several previously characterized RT aptamers indicated that they all bound at or near the primer–template pocket. These other more structured and typically larger aptamers bound more tightly than PF1 to RT based on filter binding assays. Results indicate that PF1 represents a new class of RT aptamers that are

  5. NMR monitoring of the SELEX process to confirm enrichment of structured RNA.

    Science.gov (United States)

    Amano, Ryo; Aoki, Kazuteru; Miyakawa, Shin; Nakamura, Yoshikazu; Kozu, Tomoko; Kawai, Gota; Sakamoto, Taiichi

    2017-03-21

    RNA aptamers are RNA molecules that bind to a target molecule with high affinity and specificity using uniquely-folded tertiary structures. RNA aptamers are selected from an RNA pool typically comprising up to 10(15) different sequences generated by iterative steps of selection and amplification known as Systematic Evolution of Ligands by EXponential enrichment (SELEX). Over several rounds of SELEX, the diversity of the RNA pool decreases and the aptamers are enriched. Hence, monitoring of the enrichment of these RNA pools is critical for the successful selection of aptamers, and several methods for monitoring them have been developed. In this study, we measured one-dimensional imino proton NMR spectra of RNA pools during SELEX. The spectrum of the initial RNA pool indicates that the RNAs adopt tertiary structures. The structural diversity of the RNA pools was shown to depend highly on the design of the primer-binding sequence. Furthermore, we demonstrate that enrichment of RNA aptamers can be monitored using NMR. The RNA pools can be recovered from the NMR tube after measurement of NMR spectra. We also can monitor target binding in the NMR tubes. Thus, we propose using NMR to monitor the enrichment of structured aptamers during the SELEX process.

  6. Evolution in a Test Tube: Exploring the Structure and Function of RNA Probes

    Science.gov (United States)

    2008-05-02

    Beacon Aptamers. Biochemical and Biophysical Research Communications 359: 94-101. 7 Nutiu, R. and Li, Y. (2003). Structure-Switching Signaling...Selection of RNA Beacon Aptamers. Biochemical and Biophysical Research Communications 359: 94-101. “Polymerase Chain Reaction”, Access Excellence

  7. Salvianolic Acid B Restored Impaired Barrier Function via Downregulation of MLCK by microRNA-1 in Rat Colitis Model.

    Science.gov (United States)

    Xiong, Yongjian; Wang, Jingyu; Chu, Hongwei; Chen, Dapeng; Guo, Huishu

    2016-01-01

    Salvianolic acid B (Sal B) is isolated from the traditional Chinese medical herb Salvia miltiorrhiza and is reported to have a wide range of therapeutic benefits. The aim of this study was to investigate the effects of Sal B on epithelial barrier dysfunction in rat colitis and to uncover related mechanisms. Rat colitis model was established by intracolonic administration of 2, 4, 6-trinitrobenzene sulfonic acid (TNBS). The intestinal barrier function was evaluated by measuring the serum recovery of fluorescein isothiocyanate-4 kD dextran in vivo and transepithelial electrical resistance in vitro respectively. The protein expression related to intestinal barrier function was studied using western blotting. The effects of Sal B on inflammatory responses, oxidative damage and colitis recurrence were also studied in this study. The intestinal barrier dysfunction in colitis was reversed by Sal B, accompanied with the decrease of tight junction proteins, and the effect could be blocked by microRNA-1(miR-1) inhibition. The inflammatory responses, oxidative damage and colitis recurrence were also decreased by Sal B. The colitis symptoms and recurrences were ameliorated by Sal B, and restoration of impaired barrier function via downregulation of MLCK by miR-1 maybe involved in this effect. This study provides some novel insights into both of the pathological mechanisms and treatment alternatives of inflammatory bowel disease.

  8. Salp15 binding to DC-SIGN inhibits cytokine expression by impairing both nucleosome remodeling and mRNA stabilization.

    Directory of Open Access Journals (Sweden)

    Joppe W R Hovius

    2008-02-01

    Full Text Available Ixodes ticks are major vectors for human pathogens, such as Borrelia burgdorferi, the causative agent of Lyme disease. Tick saliva contains immunosuppressive molecules that facilitate tick feeding and B. burgdorferi infection. We here demonstrate, to our knowledge for the first time, that the Ixodes scapularis salivary protein Salp15 inhibits adaptive immune responses by suppressing human dendritic cell (DC functions. Salp15 inhibits both Toll-like receptor- and B. burgdorferi-induced production of pro-inflammatory cytokines by DCs and DC-induced T cell activation. Salp15 interacts with DC-SIGN on DCs, which results in activation of the serine/threonine kinase Raf-1. Strikingly, Raf-1 activation by Salp15 leads to mitogen-activated protein kinase kinase (MEK-dependent decrease of IL-6 and TNF-alpha mRNA stability and impaired nucleosome remodeling at the IL-12p35 promoter. These data demonstrate that Salp15 binding to DC-SIGN triggers a novel Raf-1/MEK-dependent signaling pathway acting at both cytokine transcriptional and post-transcriptional level to modulate Toll-like receptor-induced DC activation, which might be instrumental to tick feeding and B. burgdorferi infection, and an important factor in the pathogenesis of Lyme disease. Insight into the molecular mechanism of immunosuppression by tick salivary proteins might provide innovative strategies to combat Lyme disease and could lead to the development of novel anti-inflammatory or immunosuppressive agents.

  9. In vitro analysis of riboswitch-Spinach aptamer fusions as metabolite-sensing fluorescent biosensors.

    Science.gov (United States)

    Kellenberger, Colleen A; Hammond, Ming C

    2015-01-01

    The development of fluorescent biosensors has been motivated by the interest to monitor and measure the levels of specific metabolites in live cells in real time. Common approaches include fusing a protein-based receptor to fluorescent proteins or synthesizing a small molecule reactive probe. Natural metabolite-sensing riboswitches also have been used in reporter-based systems that take advantage of ligand-dependent regulation of downstream gene expression. More recently, it has been shown that RNA-based fluorescent biosensors can be generated by fusing a riboswitch aptamer to the in vitro selected Spinach aptamer, which binds a cell-permeable and conditionally fluorescent molecule. Here, we describe methods to design, prepare, and analyze riboswitch-Spinach aptamer fusion RNAs for ligand-dependent activation of fluorescence in vitro. Examples of procedures to measure fluorescence activation, ligand binding selectivity and affinity, and binding kinetics are given for a cyclic di-GMP-responsive biosensor. The relative ease of in vitro RNA synthesis and purification should make this method accessible to other researchers interested in developing riboswitch-based fluorescent biosensors.

  10. Nucleic acid-based aptamers: applications, development and clinical trials.

    Science.gov (United States)

    Kanwar, Jagat R; Roy, Kislay; Maremanda, Nihal G; Subramanian, Krishnakumar; Veedu, Rakesh N; Bawa, Raj; Kanwar, Rupinder K

    2015-01-01

    Short single-stranded oligonucleotides called aptamers, often termed as chemical antibodies, have been developed as powerful alternatives to traditional antibodies with respect to their obvious advantages like high specificity and affinity, longer shelf-life, easier manufacturing protocol, freedom to introduce chemical modifications for further improvement, etc. Reiterative selection process of aptamers over 10-15 cycles starting from a large initial pool of random nucleotide sequences renders them with high binding affinity, thereby making them extremely specific for their targets. Aptamer-based detection systems are well investigated and likely to displace primitive detection systems. Aptamer chimeras (combination of aptamers with another aptamer or biomacromolecule or chemical moiety) have the potential activity of both the parent molecules, and thus hold the capability to perform diverse functions at the same time. Owing to their extremely high specificity and lack of immunogenicity or pathogenicity, a number of other aptamers have recently entered clinical trials and have garnered favorable attention from pharmaceutical companies. Promising results from the clinical trials provide new hope to change the conventional style of therapy. Aptamers have attained high therapeutic relevance in a short time as compared to synthetic drugs and/or other modes of therapy. This review follows the various trends in aptamer technology including production, selection, modifications and success in clinical fields. It focusses largely on the various applications of aptamers which mainly depend upon their selection procedures. The review also sheds light on various modifications and chimerizations that have been implemented in order to improve the stability and functioning of the aptamers, including introduction of locked nucleic acids (LNAs). The application of various aptamers in detection systems has been discussed elaborately in order to stress on their role as efficient

  11. Diagnosis of active TB using aptamers

    CSIR Research Space (South Africa)

    Khati, M

    2013-08-01

    Full Text Available ) and the 6-kDa early secreted antigen target (ESAT-6), which are potent T-cell antigens that are recognised by over 70% of TB patients. We then used these aptamers to develop a TB diagnostic tool that can be used at point-of-care for early and rapid detection...

  12. Deciphering the details of RNA aminoglycoside interactions: from atomistic models to biotechnological applications

    Energy Technology Data Exchange (ETDEWEB)

    Ilgu, Muslum [Iowa State Univ., Ames, IA (United States)

    2012-01-01

    A detailed study was done of the neomycin-B RNA aptamer for determining its selectivity and binding ability to both neomycin– and kanamycin-class aminoglycosides. A novel method to increase drug concentrations in cells for more efficiently killing is described. To test the method, a bacterial model system was adopted and several small RNA molecules interacting with aminoglycosides were cloned downstream of T7 RNA polymerase promoter in an expression vector. Then, the growth analysis of E. coli expressing aptamers was observed for 12-hour period. Our analysis indicated that aptamers helped to increase the intracellular concentration of aminoglycosides thereby increasing their efficacy.

  13. Highly purified spermatozoal RNA obtained by a novel method indicates an unusual 28S/18S rRNA ratio and suggests impaired ribosome assembly.

    Science.gov (United States)

    Cappallo-Obermann, Heike; Schulze, Wolfgang; Jastrow, Holger; Baukloh, Vera; Spiess, Andrej-Nikolai

    2011-11-01

    Human spermatozoal RNA features special characteristics such as a significantly reduced quantity within spermatozoa compared with somatic cells is described as being devoid of ribosomal RNAs and is difficult to isolate due to a massive excess of genomic DNA in the lysates. Using a novel two-round column-based protocol for human ejaculates delivering highly purified spermatozoal RNA, we uncovered a heterogeneous, but specific banding pattern in microelectrophoresis with 28S ribosomal RNA being indicative for the amount of round cell contamination. Ejaculates with different round cell quantities and density-purified spermatozoa revealed that 18S rRNA but not 28S rRNA is inherent to a pure spermatozoal fraction. Transmission electron microscopy showed monoribosomes and polyribosomes in spermatozoal cytoplasm, while immunohistochemical results suggest the presence of proteins from small and large ribosomal subunits in retained spermatozoal cytoplasm irrespective of 28S rRNA absence.

  14. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Science.gov (United States)

    Ruscito, Annamaria; DeRosa, Maria

    2016-05-01

    Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012) notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  15. Aptamers in Bordeaux, 24-25 June 2016.

    Science.gov (United States)

    Toulmé, Jean-Jacques; Giangrande, Paloma H; Mayer, Günter; Suess, Beatrix; Ducongé, Frédéric; Sullenger, Bruce; de Franciscis, Vittorio; Darfeuille, Fabien; Peyrin, Eric

    2017-01-20

    The symposium covered the many different aspects of the selection and the characterization of aptamers as well as their application in analytical, diagnostic and therapeutic areas. Natural and artificial riboswitches were discussed. Recent advances for the design of mutated polymerases and of chemically modified nucleic acid bases that provide aptamers with new properties were presented. The power of aptamer platforms for multiplex analysis of biomarkers of major human diseases was described. The potential of aptamers for the treatment of cancer or cardiovascular diseases was also presented. Brief summaries of the lectures presented during the symposium are given in this report. A second edition of "Aptamers in Bordeaux" will take place on September 2017 (http://www.aptamers-in-bordeaux.com/).

  16. Aptamers in Bordeaux, 24–25 June 2016

    Directory of Open Access Journals (Sweden)

    Jean-Jacques Toulmé

    2017-01-01

    Full Text Available The symposium covered the many different aspects of the selection and the characterization of aptamers as well as their application in analytical, diagnostic and therapeutic areas. Natural and artificial riboswitches were discussed. Recent advances for the design of mutated polymerases and of chemically modified nucleic acid bases that provide aptamers with new properties were presented. The power of aptamer platforms for multiplex analysis of biomarkers of major human diseases was described. The potential of aptamers for the treatment of cancer or cardiovascular diseases was also presented. Brief summaries of the lectures presented during the symposium are given in this report. A second edition of “Aptamers in Bordeaux” will take place on September 2017 (http://www.aptamers-in-bordeaux.com/.

  17. Development of universal antidotes to control aptamer activity.

    Science.gov (United States)

    Oney, Sabah; Lam, Ruby T S; Bompiani, Kristin M; Blake, Charlene M; Quick, George; Heidel, Jeremy D; Liu, Joanna Yi-Ching; Mack, Brendan C; Davis, Mark E; Leong, Kam W; Sullenger, Bruce A

    2009-10-01

    With an ever increasing number of people taking numerous medications, the need to safely administer drugs and limit unintended side effects has never been greater. Antidote control remains the most direct means to counteract acute side effects of drugs, but, unfortunately, it has been challenging and cost prohibitive to generate antidotes for most therapeutic agents. Here we describe the development of a set of antidote molecules that are capable of counteracting the effects of an entire class of therapeutic agents based upon aptamers. These universal antidotes exploit the fact that, when systemically administered, aptamers are the only free extracellular oligonucleotides found in circulation. We show that protein- and polymer-based molecules that capture oligonucleotides can reverse the activity of several aptamers in vitro and counteract aptamer activity in vivo. The availability of universal antidotes to control the activity of any aptamer suggests that aptamers may be a particularly safe class of therapeutics.

  18. Small-Molecule Binding Aptamers: Selection Strategies, Characterization, and Applications

    Directory of Open Access Journals (Sweden)

    Annamaria eRuscito

    2016-05-01

    Full Text Available Aptamers are single-stranded, synthetic oligonucleotides that fold into 3-dimensional shapes capable of binding non-covalently with high affinity and specificity to a target molecule. They are generated via an in vitro process known as the Systematic Evolution of Ligands by EXponential enrichment, from which candidates are screened and characterized, and then applied in aptamer-based biosensors for target detection. Aptamers for small molecule targets such as toxins, antibiotics, molecular markers, drugs, and heavy metals will be the focus of this review. Their accurate detection is ultimately needed for the protection and wellbeing of humans and animals. However, issues such as the drastic difference in size of the aptamer and small molecule make it challenging to select, characterize, and apply aptamers for the detection of small molecules. Thus, recent (since 2012 notable advances in small molecule aptamers, which have overcome some of these challenges, are presented here, while defining challenges that still exist are discussed

  19. Preparation of modified long-mer RNAs and analysis of FMN binding to the ypaA aptamer from B. subtilis.

    Science.gov (United States)

    Frommer, Jennifer; Hieronymus, Robert; Selvi Arunachalam, Tamil; Heeren, Sabine; Jenckel, Maria; Strahl, Anne; Appel, Bettina; Müller, Sabine

    2014-01-01

    In recent years, RNA has been shown to fulfil a number of cellular functions. This has led to much interest in elucidation of the structure of functional RNA molecules, and thus, in the preparation of suitably functionalized RNAs. The chemical synthesis of RNAs allows for the site-specific modification; however, is limited to sequences of about 60-70 nucleotides in length. At the example of the flavine mononucleotide (FMN) responsive aptamer of the ypaA riboswitch from B. subtilis, we demonstrate the highly efficient preparation of site-specifically modified long-mer RNAs. Our strategy consists of the chemical synthesis of fragments followed by enzymatic or chemical ligation. Splint ligation with T4 RNA ligase turned out to be most successful among the enyzymatic protocols. Highly efficient chemical ligation was performed by azide-alkyne cycloaddition of suitably modified RNA fragments. Wild-type and 2-aminopurine (2-AP)-modified variants of the ypaA aptamer were prepared. FMN binding to all synthesized ypaA aptamer variants is demonstrated. However, dissociation of FMN from its binding site by reduction of the isoalloxazin unit as demonstrated before for a small-hairpin-derived aptazyme could not be shown. This implies that either FMN is less accessible to reduction when it is bound to its natural aptamer; that reduced FMN remains bound to the aptamer; or that FMN upon reduction indeed is released from its binding site, without the aptamer folding back in the natural ligand-free state. The results of this study are of general interest to the preparation of site-specifically modified RNAs for investigation into structure and function.

  20. The optional long 5'-untranslated region of human ACAT1 mRNAs impairs the production of ACAT1 protein by promoting its mRNA decay

    Institute of Scientific and Technical Information of China (English)

    Xiaonan Zhao; Baoliang Song; Tayuan Chang; Boliang Li; Jia Chen; Lei Lei; Guangjing Hu; Ying Xiong; Jiajia Xu; Qin Li; Xinying Yang; Catherine C.Y.Chang

    2009-01-01

    We have previously reported that human ACAT1 mRNAs produce the 50 kDa protein using the AUG1397-1399 initiation codon,and also a minor 56 kDa isoform using the upstream in-frame GGC1274-1276initiation codon.The GGC1274-1276 codon is located at the optional long 5'-untranslated region(5'-UTR,nt 1-1396)of the mRNAs.The DNA sequences corresponding to this 5'-UTR are located in two different chromosomes,7 and 1.In the current work,we report that the optional long 5'-UTR significantly impairs the production of human ACAT1 protein initiated from the AUG1397-1399 codon,mainly by promoting its mRNA decay.The western blot analyses indicated that the optional long 5'-UTR potently impaired the production of different proteins initiated from the AUG1397-1399codon,meaning that this impairing effect was not influenced by the 3'-UTR or the coding sequence of ACAT1 mRNA.The results of reverse transcription-quantitative polymerase chain reaction demonstrated that this 5'-UTR dramatically reduced the contents of its linked mRNAs.Analyses of the protein to mRNA ratios showed that this 5'-UTR mainly decreased its mRNA stability rather than altering its translational efficiency.We next performed the plasmid transfection experiments and used actinomycin D to inhibit transcription.The results showed that this 5'-UTR promoted its mRNA decay.Additional transfection and nucleofection experiments using RNAs prepared in vitro illustrated that,in both the cytoplasm and the nucleus of cells,the optional long 5'-UTR-linked mRNAs decayed faster than those without the link.Overall,our study brings new insight to the regulation of the human ACAT1 gene expression at the post-transcription level.

  1. Aptamers Against Viral Hepatitis: from Rational Design to Practical Application

    Institute of Scientific and Technical Information of China (English)

    Hui FENG; Kang-hong HU

    2008-01-01

    Aptamers are short nucleic acids or peptides that strongly bind to a protein of interest and functionally inhibit a given target protein at the intracellular level. Besides high affinity and specificity, aptamers have several advantages over traditional antibodies. Hence, they have been broadly selected to develop antiviral agents for therapeutic applications against hepatitis B and C viruses (HBV, HCV). This review provides a summary of in vitro selection and characterization of aptamers against viral hepatitis, which is of practical significance in drug discovery.

  2. Dwarfism and impaired gut development in insulin-like growth factor II mRNA-binding protein 1-deficient mice

    DEFF Research Database (Denmark)

    Hansen, Thomas V O; Hammer, Niels A; Nielsen, Jacob

    2004-01-01

    Insulin-like growth factor II mRNA-binding protein 1 (IMP1) belongs to a family of RNA-binding proteins implicated in mRNA localization, turnover, and translational control. Mouse IMP1 is expressed during early development, and an increase in expression occurs around embryonic day 12.5 (E12.5). T...

  3. Cell-targeting aptamers act as intracellular delivery vehicles.

    Science.gov (United States)

    Gopinath, Subash C B; Lakshmipriya, Thangavel; Chen, Yeng; Arshad, M K Md; Kerishnan, Jesinda P; Ruslinda, A R; Al-Douri, Yarub; Voon, C H; Hashim, Uda

    2016-08-01

    Aptamers are single-stranded nucleic acids or peptides identified from a randomized combinatorial library through specific interaction with the target of interest. Targets can be of any size, from small molecules to whole cells, attesting to the versatility of aptamers for binding a wide range of targets. Aptamers show drug properties that are analogous to antibodies, with high specificity and affinity to their target molecules. Aptamers can penetrate disease-causing microbial and mammalian cells. Generated aptamers that target surface biomarkers act as cell-targeting agents and intracellular delivery vehicles. Within this context, the "cell-internalizing aptamers" are widely investigated via the process of cell uptake with selective binding during in vivo systematic evolution of ligands by exponential enrichment (SELEX) or by cell-internalization SELEX, which targets cell surface antigens to be receptors. These internalizing aptamers are highly preferable for the localization and functional analyses of multiple targets. In this overview, we discuss the ways by which internalizing aptamers are generated and their successful applications. Furthermore, theranostic approaches featuring cell-internalized aptamers are discussed with the purpose of analyzing and diagnosing disease-causing pathogens.

  4. Loss of the histone pre-mRNA processing factor stem-loop binding protein in Drosophila causes genomic instability and impaired cellular proliferation.

    Directory of Open Access Journals (Sweden)

    Harmony R Salzler

    Full Text Available BACKGROUND: Metazoan replication-dependent histone mRNAs terminate in a conserved stem-loop structure rather than a polyA tail. Formation of this unique mRNA 3' end requires Stem-loop Binding Protein (SLBP, which directly binds histone pre-mRNA and stimulates 3' end processing. The 3' end stem-loop is necessary for all aspects of histone mRNA metabolism, including replication coupling, but its importance to organism fitness and genome maintenance in vivo have not been characterized. METHODOLOGY/PRINCIPAL FINDINGS: In Drosophila, disruption of the Slbp gene prevents normal histone pre-mRNA processing and causes histone pre-mRNAs to utilize the canonical 3' end processing pathway, resulting in polyadenylated histone mRNAs that are no longer properly regulated. Here we show that Slbp mutants display genomic instability, including loss of heterozygosity (LOH, increased presence of chromosome breaks, tetraploidy, and changes in position effect variegation (PEV. During imaginal disc growth, Slbp mutant cells show defects in S phase and proliferate more slowly than control cells. CONCLUSIONS/SIGNIFICANCE: These data are consistent with a model in which changing the 3' end of histone mRNA disrupts normal replication-coupled histone mRNA biosynthesis and alters chromatin assembly, resulting in genomic instability, inhibition of cell proliferation, and impaired development.

  5. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    Science.gov (United States)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  6. Discoidin domain receptor 2-microRNA 196a-mediated negative feedback against excess type I collagen expression is impaired in scleroderma dermal fibroblasts.

    Science.gov (United States)

    Makino, Katsunari; Jinnin, Masatoshi; Aoi, Jun; Hirano, Ayaka; Kajihara, Ikko; Makino, Takamitsu; Sakai, Keisuke; Fukushima, Satoshi; Inoue, Yuji; Ihn, Hironobu

    2013-01-01

    Systemic sclerosis (SSc) is characterized by excess collagen deposition in the skin, due to intrinsic transforming growth factor-β (TGF-β) activation. We tried to determine the expression and the role of discoidin domain receptor 2 (DDR2) in SSc. The expression of DDR2 mRNA and protein was significantly decreased in SSc dermal fibroblasts, which was recovered by knocking down TGF-β. The knockdown of DDR2 in normal fibroblasts induced microRNA-196a expression, which led to type I collagen downregulation, indicating that DDR2 itself has a negative effect on microRNA-196a expression and inducible effect on collagen expression. In SSc fibroblasts, however, the DDR2 knockdown did not affect TGF-β signaling and microRNA-196a expression. The microRNA-196a levels were significantly decreased in normal fibroblasts treated with TGF-β and in SSc fibroblasts. Taken together our data indicate that, in SSc fibroblasts, intrinsic TGF-β stimulation induces type I collagen expression, and also downregulates DDR2 expression. This probably acts as a negative feedback mechanism against excess collagen expression, as a decreased DDR2 expression is supposed to stimulate the microRNA-196a expression and further change the collagen expression. However, in SSc fibroblasts the microRNA-196a expression was downregulated by TGF-β signaling. DDR2-microRNA-196a pathway may be a previously unreported negative feedback system, and its impairment may be involved in the pathogenesis of SSc.

  7. Chlorin e6 Conjugated Interleukin-6 Receptor Aptamers Selectively Kill Target Cells Upon Irradiation

    Directory of Open Access Journals (Sweden)

    Sven Kruspe

    2014-01-01

    Full Text Available Photodynamic therapy (PDT uses the therapeutic properties of light in combination with certain chemicals, called photosensitizers, to successfully treat brain, breast, prostate, and skin cancers. To improve PDT, current research focuses on the development of photosensitizers to specifically target cancer cells. In the past few years, aptamers have been developed to directly deliver cargo molecules into target cells. We conjugated the photosensitizer chlorin e6 (ce6 with a human interleukin-6 receptor (IL-6R binding RNA aptamer, AIR-3A yielding AIR-3A-ce6 for application in high efficient PDT. AIR-3A-ce6 was rapidly and specifically internalized by IL-6R presenting (IL-6R+ cells. Upon light irradiation, targeted cells were selectively killed, while free ce6 did not show any toxic effect. Cells lacking the IL-6R were also not affected by AIR-3A-ce6. With this approach, we improved the target specificity of ce6-mediated PDT. In the future, other tumor-specific aptamers might be used to selectively localize photosensitizers into cells of interest and improve the efficacy and specificity of PDT in cancer and other diseases.

  8. Ligand Binding and Conformational Changes in the Purine-Binding Riboswitch Aptamer Domains

    Science.gov (United States)

    Noeske, Jonas; Buck, Janina; Wöhnert, Jens; Schwalbe, Harald

    Riboswitches are highly structured mRNA elements that regulate gene expression upon specific binding of small metabolite molecules. The purine-binding riboswitches bind different purine ligands by forming both canonical Watson—Crick and non-canonical intermolecular base pairs, involving a variety of hydrogen bonds between the riboswitch aptamer domain and the purine ligand. Here, we summarize work on the ligand binding modes of both purine-binding aptamer domains, their con-formational characteristics in the free and ligand-bound forms, and their ligand-induced folding. The adenine- and guanine-binding riboswitch aptamer domains display different conformations in their free forms, despite nearly identical nucleotide loop sequences that form a loop—loop interaction in the ligand-bound forms. Interestingly, the stability of helix II is crucial for the formation of the loop—loop interaction in the free form. A more stable helix II in the guanine riboswitch leads to a preformed loop—loop interaction in its free form. In contrast, a less stable helix II in the adenine riboswitch results in a lack of this loop—loop interaction in the absence of ligand and divalent cations.

  9. Identification and expression of troponin T, a new marker on the surface of cultured tumor endothelial cells by aptamer ligand

    Science.gov (United States)

    Ara, Mst Naznin; Hyodo, Mamoru; Ohga, Noritaka; Akiyama, Kosuke; Hida, Kyoko; Hida, Yasuhiro; Shinohara, Nobuo; Harashima, Hideyoshi

    2014-01-01

    The identification of a specific biomarker involves the development of new clinical diagnostic tools, and an in-depth understanding of the disease at the molecular level. When new blood vessels form in tumor cells, endothelial cell production is induced, a process that plays a key role in disease progression and metastasis to distinct organs for solid tumor types. The present study reports on the identification of a new biomarker on primary cultured mouse tumor endothelial cells (mTECs) using our recently developed high-affinity DNA aptamer AraHH001 (Kd = 43 nmol/L) assisted proteomics approach. We applied a strategy involving aptamer-facilitated biomarker discovery. Biotin-tagged AraHH001 was incubated with lysates of mTECs and the aptamer-proteins were then conjugated with streptavidin magnetic beads. Finally, the bound proteins were separated by sodiumdodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with silver staining. We identified troponin T via matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, the molecular target of aptamer AraHH001, and its presence was confirmed by measuring mRNA, protein levels, western blot, immunostaining, a gel shift assay of AraHH001 with troponin T. We first report here on the discovery of troponin T on mTECs, a promising and interesting diagnostic tool in the development of antiangiogenic therapy techniques the involves the targeting of the tumor vasculature. PMID:24810801

  10. Inhibition of adhesion and metastasis of HepG2 hepatocellular carcinoma cells in vitro by DNA aptamer against sialyl Lewis X.

    Science.gov (United States)

    Wang, Xiao-Kang; Peng, Yan; Tao, Hao-Ran; Zhou, Fen-Fang; Zhang, Chi; Su, Fei; Wang, Shi-Pei; Liu, Qing; Xu, Li-Hua; Pan, Xue-Kai; Xie, Wei; Feng, Mao-Hui

    2017-06-01

    The sialyl Lewis X (SLe(x)) antigen encoded by the FUT7 gene is the ligand of endotheliam-selectin (E-selectin). The combination of SLe(x) antigen and E-selectin represents an important way for malignant tumor metastasis. In the present study, the effect of the SLe(x)-binding DNA aptamer on the adhesion and metastasis of hepatocellular carcinoma HepG2 cells in vitro was investigated. Reverse transcription-polymerase chain reaction (RT-PCR) and immunofluorescence staining were conducted to detect the expression of FUT7 at both transcriptional and translational levels. The SLe(x) expression in HepG2 cells treated with different concentrations of SLe(x)-binding DNA aptamer was detected by flow cytometry. Besides, the adhesion, migration, and invasion of HepG2 cells were measured by cell adhesion assay, and the Transwell migration and invasion assay. The results showed that the FUT7 expression was up-regulated at both mRNA and protein levels in HepG2 cells. SLe(x)-binding DNA aptamer could significantly decrease the expression of SLe(x) in HepG2 cells. The cell adhesion assay revealed that the SLe(x)-binding DNA aptamer could effectively inhibit the interactions between E-selectin and SLe(x) in the HepG2 cells. Additionally, SLe(x)-binding DNA aptamers at 20 nmol/L were found to have the similar effect to the monoclonal antibody CSLEX-1. The Transwell migration and invasion assay revealed that the number of penetrating cells on the down-side of Transwell membrane was significantly less in cells treated with 5, 10, 20 nmol/L SLe(x)-binding DNA aptamer than those in the negative control group (PHepG2 cells, suggesting that the SLe(x)-binding DNA aptamer may be used as a potential molecular targeted drug against metastatic hepatocellular carcinoma.

  11. Modern affinity reagents: Recombinant antibodies and aptamers.

    Science.gov (United States)

    Groff, Katherine; Brown, Jeffrey; Clippinger, Amy J

    2015-12-01

    Affinity reagents are essential tools in both basic and applied research; however, there is a growing concern about the reproducibility of animal-derived monoclonal antibodies. The need for higher quality affinity reagents has prompted the development of methods that provide scientific, economic, and time-saving advantages and do not require the use of animals. This review describes two types of affinity reagents, recombinant antibodies and aptamers, which are non-animal technologies that can replace the use of animal-derived monoclonal antibodies. Recombinant antibodies are protein-based reagents, while aptamers are nucleic-acid-based. In light of the scientific advantages of these technologies, this review also discusses ways to gain momentum in the use of modern affinity reagents, including an update to the 1999 National Academy of Sciences monoclonal antibody production report and federal incentives for recombinant antibody and aptamer efforts. In the long-term, these efforts have the potential to improve the overall quality and decrease the cost of scientific research. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Aptamer Stainings for Super-resolution Microscopy.

    Science.gov (United States)

    de Castro, Maria Angela Gomes; Rammner, Burkhard; Opazo, Felipe

    2016-01-01

    Fluorescence microscopy is an invaluable tool to visualize molecules in their biological context with ease and flexibility. However, studies using conventional light microscopy have been limited to the resolution that light diffraction allows (i.e., ~200 nm). This limitation has been recently circumvented by several types of advanced fluorescence microscopy techniques, which have achieved resolutions of up to ~10 nm. The resulting enhanced imaging precision has helped to find important cellular details that were not visible using diffraction-limited instruments. However, it has also revealed that conventional stainings using large affinity tags, such as antibodies, are not accurate enough for these imaging techniques. Since aptamers are substantially smaller than antibodies, they could provide a real advantage in super-resolution imaging. Here we compare the live staining of transferrin receptors (TfnR) obtained with different fluorescently labeled affinity probes: aptamers, specific monoclonal antibodies, or the natural receptor ligand transferrin. We observed negligible differences between these staining strategies when imaging is performed with conventional light microscopy (i.e., laser scanning confocal microscopy). However, a clear superiority of the aptamer tag over antibodies became apparent in super-resolved images obtained with stimulated emission depletion (STED) microscopy.

  13. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Directory of Open Access Journals (Sweden)

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  14. Aptamers as Both Drugs and Drug-Carriers

    Directory of Open Access Journals (Sweden)

    Md. Ashrafuzzaman

    2014-01-01

    Full Text Available Aptamers are short nucleic acid oligos. They may serve as both drugs and drug-carriers. Their use as diagnostic tools is also evident. They can be generated using various experimental, theoretical, and computational techniques. The systematic evolution of ligands by exponential enrichment which uses iterative screening of nucleic acid libraries is a popular experimental technique. Theory inspired methodology entropy-based seed-and-grow strategy that designs aptamer templates to bind specifically to targets is another one. Aptamers are predicted to be highly useful in producing general drugs and theranostic drugs occasionally for certain diseases like cancer, Alzheimer’s disease, and so on. They bind to various targets like lipids, nucleic acids, proteins, small organic compounds, and even entire organisms. Aptamers may also serve as drug-carriers or nanoparticles helping drugs to get released in specific target regions. Due to better target specific physical binding properties aptamers cause less off-target toxicity effects. Therefore, search for aptamer based drugs, drug-carriers, and even diagnostic tools is expanding fast. The biophysical properties in relation to the target specific binding phenomena of aptamers, energetics behind the aptamer transport of drugs, and the consequent biological implications will be discussed. This review will open up avenues leading to novel drug discovery and drug delivery.

  15. Screening of aptamers on microfluidic systems for clinical applications.

    Science.gov (United States)

    Weng, Chen-Hsun; Huang, Chao-Jyun; Lee, Gwo-Bin

    2012-01-01

    The use of microfluidic systems for screening of aptamers and their biomedical applications are reviewed in this paper. Aptamers with different nucleic acid sequences have been extensively studied and the results demonstrated a strong binding affinity to target molecules such that they can be used as promising candidate biomarkers for diagnosis and therapeutics. Recently, the aptamer screening protocol has been conducted with microfluidic-based devices. Furthermore, aptamer affinity screening by a microfluidic-based method has demonstrated remarkable advantages over competing traditional methods. In this paper, we first reviewed microfluidic systems which demonstrated efficient and rapid screening of a specific aptamer. Then, the clinical applications of screened aptamers, also performed by microfluidic systems, are further reviewed. These automated microfluidic systems can provide advantages over their conventional counterparts including more compactness, faster analysis, less sample/reagent consumption and automation. An aptamer-based compact microfluidic system for diagnosis may even lead to a point-of-care device. The use of microfluidic systems for aptamer screening and diagnosis is expected to continue growing in the near future and may make a substantial impact on biomedical applications.

  16. Screening of Aptamers on Microfluidic Systems for Clinical Applications

    Directory of Open Access Journals (Sweden)

    Gwo-Bin Lee

    2012-07-01

    Full Text Available The use of microfluidic systems for screening of aptamers and their biomedical applications are reviewed in this paper. Aptamers with different nucleic acid sequences have been extensively studied and the results demonstrated a strong binding affinity to target molecules such that they can be used as promising candidate biomarkers for diagnosis and therapeutics. Recently, the aptamer screening protocol has been conducted with microfluidic-based devices. Furthermore, aptamer affinity screening by a microfluidic-based method has demonstrated remarkable advantages over competing traditional methods. In this paper, we first reviewed microfluidic systems which demonstrated efficient and rapid screening of a specific aptamer. Then, the clinical applications of screened aptamers, also performed by microfluidic systems, are further reviewed. These automated microfluidic systems can provide advantages over their conventional counterparts including more compactness, faster analysis, less sample/reagent consumption and automation. An aptamer-based compact microfluidic system for diagnosis may even lead to a point-of-care device. The use of microfluidic systems for aptamer screening and diagnosis is expected to continue growing in the near future and may make a substantial impact on biomedical applications.

  17. Optimized light-directed synthesis of aptamer microarrays.

    Science.gov (United States)

    Franssen-van Hal, Nicole L W; van der Putte, Pepijn; Hellmuth, Klaus; Matysiak, Stefan; Kretschy, Nicole; Somoza, Mark M

    2013-06-18

    Aptamer microarrays are a promising high-throughput method for ultrasensitive detection of multiple analytes, but although much is known about the optimal synthesis of oligonucleotide microarrays used in hybridization-based genomics applications, the bioaffinity interactions between aptamers and their targets is qualitatively different and requires significant changes to synthesis parameters. Focusing on streptavidin-binding DNA aptamers, we employed light-directed in situ synthesis of microarrays to analyze the effects of sequence fidelity, linker length, surface probe density, and substrate functionalization on detection sensitivity. Direct comparison with oligonucleotide hybridization experiments indicates that aptamer microarrays are significantly more sensitive to sequence fidelity and substrate functionalization and have different optimal linker length and surface probe density requirements. Whereas microarray hybridization probes generate maximum signal with multiple deletions, aptamer sequences with the same deletion rate result in a 3-fold binding signal reduction compared with the same sequences synthesized for maximized sequence fidelity. The highest hybridization signal was obtained with dT 5mer linkers, and the highest aptamer signal was obtained with dT 11mers, with shorter aptamer linkers significantly reducing the binding signal. The probe hybridization signal was found to be more sensitive to molecular crowding, whereas the aptamer probe signal does not appear to be constrained within the density of functional surface groups commonly used to synthesize microarrays.

  18. Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood

    Energy Technology Data Exchange (ETDEWEB)

    Dougan, Hayes E-mail: dougan@triumf.ca; Lyster, Donald M.; Vo, Can V.; Stafford, Alan; Weitz, Jeffrey I.; Hobbs, John B

    2000-04-01

    We have investigated {sup 123}I and {sup 125}I DNA aptamer analogs of anticoagulant DNA aptamers to thrombin exosite 1 and exosite 2 for thrombus imaging potential. Two severe problems are rapid clearance from circulating blood and blood nuclease. With aptamers (unlike antisense) the nucleotide analogs used in polymerase chain reaction-selection cycles also must be used in the radiotracer. We investigated 3'-biotin-streptavidin (SA) bioconjugates of the aptamers to alleviate these problems. Blood nuclease assays and biodistribution analysis were used in the mouse and rabbit. We found that 3'-biotin protected the aptamers significantly from blood nuclease in vitro, but it did not slow in vivo clearance. In contrast, the 3'-biotin-SA bioconjugates were resistant to blood nuclease in vitro and were also longer-lived (10-20 times) in vivo. Bioconjugate aptamers retained affinity for thrombin. Two solutions emerge: 1) In noncirculating blood (within a thrombus) 3'-biotin extends aptamer lifetime, whereas 2) in circulating blood (the transport medium), where more aggressive clearance is encountered, 3'-SA extends aptamer lifetime.

  19. Label-Free Determination of the Dissociation Constant of Small Molecule-Aptamer Interaction by Isothermal Titration Calorimetry.

    Science.gov (United States)

    Vogel, Marc; Suess, Beatrix

    2016-01-01

    Isothermal titration calorimetry (ITC) is a powerful label-free technique to determine the binding constant as well as thermodynamic parameters of a binding reaction and is therefore well suited for the analysis of small molecule-RNA aptamer interaction. We will introduce you to the method and present a protocol for sample preparation and the calorimetric measurement. A detailed note section will point out useful tips and pitfalls.

  20. Human immunodeficiency virus trans-activator of transcription peptide detection via ribonucleic acid aptamer on aminated diamond biosensor

    Science.gov (United States)

    Rahim Ruslinda, A.; Wang, Xianfen; Ishii, Yoko; Ishiyama, Yuichiro; Tanabe, Kyosuke; Kawarada, Hiroshi

    2011-09-01

    The potential of ribonucleic acid (RNA) as both informational and ligand binding molecule have opened a scenario in the development of biosensors. An aminated diamond-based RNA aptasensor is presented for human immunodeficiency virus (HIV) trans-activator of transcription (Tat) peptide protein detection that not only gives a labeled or label-free detection method but also provides a reusable platform for a simple, sensitive, and selective detection of proteins. The immobilized procedure was based on the binding interaction between positively charged amine terminated diamond and the RNA aptamer probe molecules with the negatively charged surface carboxylic compound linker molecule such as terephthalic acid.

  1. Multiple RNA processing defects and impaired chloroplast function in plants deficient in the organellar protein-only RNase P enzyme.

    Directory of Open Access Journals (Sweden)

    Wenbin Zhou

    Full Text Available Transfer RNA (tRNA precursors undergo endoribonucleolytic processing of their 5' and 3' ends. 5' cleavage of the precursor transcript is performed by ribonuclease P (RNase P. While in most organisms RNase P is a ribonucleoprotein that harbors a catalytically active RNA component, human mitochondria and the chloroplasts (plastids and mitochondria of seed plants possess protein-only RNase P enzymes (PRORPs. The plant organellar PRORP (PRORP1 has been characterized to some extent in vitro and by transient gene silencing, but the molecular, phenotypic and physiological consequences of its down-regulation in stable transgenic plants have not been assessed. Here we have addressed the function of the dually targeted organellar PRORP enzyme in vivo by generating stably transformed Arabidopsis plants in which expression of the PRORP1 gene was suppressed by RNA interference (RNAi. PRORP1 knock-down lines show defects in photosynthesis, while mitochondrial respiration is not appreciably affected. In both plastids and mitochondria, the effects of PRORP1 knock-down on the processing of individual tRNA species are highly variable. The drastic reduction in the levels of mature plastid tRNA-Phe(GAA and tRNA-Arg(ACG suggests that these two tRNA species limit plastid gene expression in the PRORP1 mutants and, hence, are causally responsible for the mutant phenotype.

  2. A human microRNA precursor binding to folic acid discovered by small RNA transcriptomic SELEX.

    Science.gov (United States)

    Terasaka, Naohiro; Futai, Kazuki; Katoh, Takayuki; Suga, Hiroaki

    2016-12-01

    RNA aptamers are structured motifs that bind to specific molecules. A growing number of RNAs bearing aptamer elements, whose functions are modulated by direct binding of metabolites, have been found in living cells. Recent studies have suggested that more small RNAs binding to metabolites likely exist and may be involved in diverse cellular processes. However, conventional methods are not necessarily suitable for the discovery of such RNA aptamer elements in small RNAs with lengths ranging from 50 to 200 nucleotides, due to the far more abundant tRNAs in this size range. Here, we describe a new in vitro selection method to uncover naturally occurring small RNAs capable of binding to a ligand of interest, referred to as small RNA transcriptomic SELEX (smaRt-SELEX). By means of this method, we identified a motif in human precursor microRNA 125a (hsa-pre-miR-125a) that interacts with folic acid. Mutation studies revealed that the terminal loop region of hsa-pre-miR-125a is important for this binding interaction. This method has potential for the discovery of new RNA aptamer elements or catalytic motifs in biological small RNA fractions. © 2016 Terasaka et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. Aptamer-assembled nanomaterials for fluorescent sensing and imaging

    Directory of Open Access Journals (Sweden)

    Lu Danqing

    2017-01-01

    Full Text Available Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX, represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.

  4. Generating Cell Targeting Aptamers for Nanotheranostics Using Cell-SELEX.

    Science.gov (United States)

    Lyu, Yifan; Chen, Guang; Shangguan, Dihua; Zhang, Liqin; Wan, Shuo; Wu, Yuan; Zhang, Hui; Duan, Lian; Liu, Chao; You, Mingxu; Wang, Jie; Tan, Weihong

    2016-01-01

    Detecting and understanding changes in cell conditions on the molecular level is of great importance for the accurate diagnosis and timely therapy of diseases. Cell-based SELEX (Systematic Evolution of Ligands by EXponential enrichment), a foundational technology used to generate highly-specific, cell-targeting aptamers, has been increasingly employed in studies of molecular medicine, including biomarker discovery and early diagnosis/targeting therapy of cancer. In this review, we begin with a mechanical description of the cell-SELEX process, covering aptamer selection, identification and identification, and aptamer characterization; following this introduction is a comprehensive discussion of the potential for aptamers as targeting moieties in the construction of various nanotheranostics. Challenges and prospects for cell-SELEX and aptamer-based nanotheranostic are also discussed.

  5. High Efficiency Acetylcholinesterase Immobilization on DNA Aptamer Modified Surfaces

    Directory of Open Access Journals (Sweden)

    Orada Chumphukam

    2014-04-01

    Full Text Available We report here the in vitro selection of DNA aptamers for electric eel acetylcholinesterase (AChE. One selected aptamer sequence (R15/19 has a high affinity towards the enzyme (Kd = 157 ± 42 pM. Characterization of the aptamer showed its binding is not affected by low ionic strength (~20 mM, however significant reduction in affinity occurred at high ionic strength (~1.2 M. In addition, this aptamer does not inhibit the catalytic activity of AChE that we exploit through immobilization of the DNA on a streptavidin-coated surface. Subsequent immobilization of AChE by the aptamer results in a 4-fold higher catalytic activity when compared to adsorption directly on to plastic.

  6. Aptamer-assembled nanomaterials for fluorescent sensing and imaging

    Science.gov (United States)

    Lu, Danqing; He, Lei; Zhang, Ge; Lv, Aiping; Wang, Ruowen; Zhang, Xiaobing; Tan, Weihong

    2017-01-01

    Aptamers, which are selected in vitro by a technology known as the systematic evolution of ligands by exponential enrichment (SELEX), represent a crucial recognition element in molecular sensing. With advantages such as good biocompatibility, facile functionalization, and special optical and physical properties, various nanomaterials can protect aptamers from enzymatic degradation and nonspecific binding in living systems and thus provide a preeminent platform for biochemical applications. Coupling aptamers with various nanomaterials offers many opportunities for developing highly sensitive and selective sensing systems. Here, we focus on the recent applications of aptamer-assembled nanomaterials in fluorescent sensing and imaging. Different types of nanomaterials are examined along with their advantages and disadvantages. Finally, we look toward the future of aptamer-assembled nanomaterials.

  7. Prenatal Stress Impairs Spatial Learning and Memory Associated with Lower mRNA Level of the CAMKII and CREB in the Adult Female Rat Hippocampus.

    Science.gov (United States)

    Sun, Hongli; Wu, Haibin; Liu, Jianping; Wen, Jun; Zhu, Zhongliang; Li, Hui

    2017-02-25

    Prenatal stress (PS) results in various behavioral and emotional alterations observed in later life. In particular, PS impairs spatial learning and memory processes but the underlying mechanism involved in this pathogenesis still remains unknown. Here, we reported that PS lowered the body weight in offspring rats, particularly in female rats, and impaired spatial learning and memory of female offspring rats in the Morris water maze. Correspondingly, the decreased CaMKII and CREB mRNA in the hippocampus were detected in prenatally stressed female offspring, which partially explained the effect of PS on the spatial learning and memory. Our findings suggested that CaMKII and CREB may be involved in spatial learning and memory processes in the prenatally stressed adult female offspring.

  8. In Vivo Deletion of the Cebpa +37 kb Enhancer Markedly Reduces Cebpa mRNA in Myeloid Progenitors but Not in Non-Hematopoietic Tissues to Impair Granulopoiesis.

    Directory of Open Access Journals (Sweden)

    Hong Guo

    Full Text Available The murine Cebpa gene contains a +37 kb, evolutionarily conserved 440 bp enhancer that directs high-level expression to myeloid progenitors in transgenic mice. The enhancer is bound and activated by Runx1, Scl, GATA2, C/EBPα, c-Myb, Pu.1, and additional Ets factors in myeloid cells. CRISPR/Cas9-mediated replacement of the wild-type enhancer with a variant mutant in its seven Ets sites leads to 20-fold reduction of Cebpa mRNA in the 32Dcl3 myeloid cell line. To determine the effect of deleting the enhancer in vivo, we now characterize C57BL/6 mice in which loxP sites flank a 688 bp DNA segment containing the enhancer. CMV-Cre mediated germline deletion resulted in diminution of the expected number of viable Enh(f/f;CMV-Cre offspring, with 28-fold reduction in marrow Cebpa mRNA but normal levels in liver, lung, adipose, intestine, muscle, and kidney. Cre-transduction of lineage-negative marrow cells in vitro reduced Cebpa mRNA 12-fold, with impairment of granulocytic maturation, morphologic blast accumulation, and IL-3 dependent myeloid colony replating for >12 generations. Exposure of Enh(f/f;Mx1-Cre mice to pIpC led to 14-fold reduction of Cebpa mRNA in GMP or CMP, 30-fold reduction in LSK, and <2-fold reduction in the LSK/SLAM subset. FACS analysis of marrow from these mice revealed 10-fold reduced neutrophils, 3-fold decreased GMP, and 3-fold increased LSK cells. Progenitor cell cycle progression was mildly impaired. Granulocyte and B lymphoid colony forming units were reduced while monocytic and erythroid colonies were increased, with reduced Pu.1 and Gfi1 and increased Egr1 and Klf4 in GMP. Finally, competitive transplantation indicated preservation of functional long-term hematopoietic stem cells upon enhancer deletion and confirmed marrow-intrinsic impairment of granulopoiesis and B cell generation with LSK and monocyte lineage expansion. These findings demonstrate a critical role for the +37 kb Cebpa enhancer for hematopoietic

  9. In vitro RNA SELEX for the generation of chemically-optimized therapeutic RNA drugs.

    Science.gov (United States)

    Urak, Kevin T; Shore, Sabrina; Rockey, William M; Chen, Shi-Jie; McCaffrey, Anton P; Giangrande, Paloma H

    2016-07-01

    Aptamers are single-stranded DNA or RNA oligonucleotides that can bind with exquisitely high affinity and specificity to target molecules and are thus often referred to as 'nucleic acid' antibodies. Oligonucleotide aptamers are derived through a process of directed chemical evolution called SELEX (Systematic Evolution of Ligands by Exponential enrichment). This chemical equivalent of Darwinian evolution was first described in 1990 by Tuerk & Gold and Ellington & Szostak and has since yielded aptamers for a wide-range of applications, including biosensor technologies, in vitro diagnostics, biomarker discovery, and therapeutics. Since the inception of the original SELEX method, numerous modifications to the protocol have been described to fit the choice of target, specific conditions or applications. Technologies such as high-throughput sequencing methods and microfluidics have also been adapted for SELEX. In this chapter, we outline key steps in the SELEX process for enabling the rapid identification of RNA aptamers for in vivo applications. Specifically, we provide a detailed protocol for the selection of chemically-optimized RNA aptamers using the original in vitro SELEX methodology. In addition, methods for performing next-generation sequencing of the RNAs from each round of selection, based on Illumina sequencing technology, are discussed. Copyright © 2016. Published by Elsevier Inc.

  10. Comparison of a preQ1 riboswitch aptamer in metabolite-bound and free states with implications for gene regulation.

    Science.gov (United States)

    Jenkins, Jermaine L; Krucinska, Jolanta; McCarty, Reid M; Bandarian, Vahe; Wedekind, Joseph E

    2011-07-15

    Riboswitches are RNA regulatory elements that govern gene expression by recognition of small molecule ligands via a high affinity aptamer domain. Molecular recognition can lead to active or attenuated gene expression states by controlling accessibility to mRNA signals necessary for transcription or translation. Key areas of inquiry focus on how an aptamer attains specificity for its effector, the extent to which the aptamer folds prior to encountering its ligand, and how ligand binding alters expression signal accessibility. Here we present crystal structures of the preQ(1) riboswitch from Thermoanaerobacter tengcongensis in the preQ(1)-bound and free states. Although the mode of preQ(1) recognition is similar to that observed for preQ(0), surface plasmon resonance revealed an apparent K(D) of 2.1 ± 0.3 nm for preQ(1) but a value of 35.1 ± 6.1 nm for preQ(0). This difference can be accounted for by interactions between the preQ(1) methylamine and base G5 of the aptamer. To explore conformational states in the absence of metabolite, the free-state aptamer structure was determined. A14 from the ceiling of the ligand pocket shifts into the preQ(1)-binding site, resulting in "closed" access to the metabolite while simultaneously increasing exposure of the ribosome-binding site. Solution scattering data suggest that the free-state aptamer is compact, but the "closed" free-state crystal structure is inadequate to describe the solution scattering data. These observations are distinct from transcriptional preQ(1) riboswitches of the same class that exhibit strictly ligand-dependent folding. Implications for gene regulation are discussed.

  11. Synthesis of heterocycles: Indolo (2,1-a) isoquinolines, renewables, and aptamer ligands for cellular imaging

    Energy Technology Data Exchange (ETDEWEB)

    Beasley, Jonathan [Ames Laboratory (AMES), Ames, IA (United States)

    2013-01-01

    In this thesis, we explore both total syntheses and methodologies of several aromatic heterocyclic molecules. Extensions of the Kraus indole synthesis toward 2-substituted and 2,3-disubstituted indoles, as well as biologically attractive indolo[2,1-a]isoquinolines are described. Recent renewable efforts directed to commodity maleic acid and the first reported furan-based ionic liquids are described. Our total synthesis of mRNA aptamer ligand PDC-Gly, and its dye coupled forms, plus aminoglycoside dye coupled ligands used in molecular imaging, are described.

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Abnormal Changes of Brain Cortical Anatomy and the Association with Plasma MicroRNA107 Level in Amnestic Mild Cognitive Impairment

    Directory of Open Access Journals (Sweden)

    Tao eWang

    2016-05-01

    Full Text Available MicroRNA107 (Mir107 has been thought to relate to the brain structure phenotype of Alzheimer’s disease. In this study, we evaluated the cortical anatomy in amnestic mild cognitive impairment (aMCI and the relation between cortical anatomy and plasma levels of Mir107 and beta-site amyloid precursor protein cleaving enzyme 1 (BACE1. 20 aMCI and 24 cognitively normal control (NC subjects were recruited, and T1-weighted MR images were acquired. Cortical anatomical measurements, including cortical thickness (CT, surface area (SA, and local gyrification index (LGI, were assessed. Quantitative RT-PCR was used to examine plasma expression of Mir107, BACE1 mRNA. Thinner cortex was found in aMCI in areas associated with episodic memory and language, but with thicker cortex in other areas. SA decreased in aMCI in the areas associated with working memory and emotion. LGI showed a significant reduction in aMCI in the areas involved in language function. Changes in Mir107 and BACE1 messenger RNA plasma expression were correlated with changes in CT and SA. We found alterations in key left brain regions associated with memory, language, and emotion in aMCI that were significantly correlated with plasma expression of mir107 and BACE1 mRNA. This combination study of brain anatomical alterations and gene information may shed lights on our understanding of the pathology of AD.

  14. Efficient suppression of biofilm formation by a nucleic acid aptamer.

    Science.gov (United States)

    Ning, Yi; Cheng, Lijuan; Ling, Min; Feng, Xinru; Chen, Lingli; Wu, Minxi; Deng, Le

    2015-08-01

    Biofilms are microbial communities that are attached to a solid surface using extracellular polymeric substances. Motility and initial attachment mediated by flagella are required for biofilm formation. Therefore, blocking the motility of flagella is a potential strategy to inhibit biofilm formation. In this study, single-stranded DNA aptamers specific to the Salmonella choleraesuis were selected after 14 cycles of the systematic evolution of ligands by exponential enrichment. Among the selected aptamers, the aptamer 3 showed the highest affinity for S. choleraesuis with a dissociation constant (Kd) of 41 ± 2 nM. Aptamer 3, conjugated with magnetic beads, was then used to capture its binding target on the bacteria. After mass spectrometry and specific binding analysis, the flagellin was identified as the target captured by aptamer 3. Furthermore, inhibition experiments, inverted microscopy and atomic force microscopy demonstrated that aptamer 3 was able to control the biofilm formation and promote the inhibitory effect of an antibiotic on bacterial biofilms. Single-stranded DNA aptamers therefore have great potential as inhibitors of biofilm formation.

  15. Nanostructure shape effects on response of plasmonic aptamer sensors.

    Science.gov (United States)

    Balamurugan, Subramanian; Mayer, Kathryn M; Lee, Seunghyun; Soper, Steven A; Hafner, Jason H; Spivak, David A

    2013-09-01

    A localized surface plasmon resonance (LSPR) sensor surface was fabricated by the deposition of gold nanorods on a glass substrate and subsequent immobilization of the DNA aptamer, which specifically bind to thrombin. This LSPR aptamer sensor showed a response of 6-nm λ(max) shift for protein binding with the detection limit of at least 10 pM, indicating one of the highest sensitivities achieved for thrombin detection by optical extinction LSPR. We also tested the LSPR sensor fabricated using gold bipyramid, which showed higher refractive index sensitivity than the gold nanorods, but the overall response of gold bipyramid sensor appears to be 25% less than that of the gold nanorod substrate, despite the approximately twofold higher refractive index sensitivity. XPS analysis showed that this is due to the low surface density of aptamers on the gold bipyramid compared with gold nanorods. The low surface density of the aptamers on the gold bipyramid surface may be due to the effect of shape of the nanostructure on the kinetics of aptamer monolayer formation. The small size of aptamers relative to other bioreceptors is the key to achieving high sensitivity by biosensors on the basis of LSPR, demonstrated here for protein binding. The generality of aptamer sensors for protein detection using gold nanorod and gold nanobipyramid substrates is anticipated to have a large impact in the important development of sensors toward biomarkers, environmental toxins, and warfare agents.

  16. Aptamer-Gated Nanoparticles for Smart Drug Delivery

    Directory of Open Access Journals (Sweden)

    Huseyin Avni Oktem

    2011-08-01

    Full Text Available Aptamers are functional nucleic acid sequences which can bind specific targets. An artificial combinatorial methodology can identify aptamer sequences for any target molecule, from ions to whole cells. Drug delivery systems seek to increase efficacy and reduce side-effects by concentrating the therapeutic agents at specific disease sites in the body. This is generally achieved by specific targeting of inactivated drug molecules. Aptamers which can bind to various cancer cell types selectively and with high affinity have been exploited in a variety of drug delivery systems for therapeutic purposes. Recent progress in selection of cell-specific aptamers has provided new opportunities in targeted drug delivery. Especially functionalization of nanoparticles with such aptamers has drawn major attention in the biosensor and biomedical areas. Moreover, nucleic acids are recognized as an attractive building materials in nanomachines because of their unique molecular recognition properties and structural features. A active controlled delivery of drugs once targeted to a disease site is a major research challenge. Stimuli-responsive gating is one way of achieving controlled release of nanoparticle cargoes. Recent reports incorporate the structural properties of aptamers in controlled release systems of drug delivering nanoparticles. In this review, the strategies for using functional nucleic acids in creating smart drug delivery devices will be explained. The main focus will be on aptamer-incorporated nanoparticle systems for drug delivery purposes in order to assess the future potential of aptamers in the therapeutic area. Special emphasis will be given to the very recent progress in controlled drug release based on molecular gating achieved with aptamers.

  17. Aptamer modification improves the adenoviral transduction of malignant glioma cells.

    Science.gov (United States)

    Chen, Hao; Zheng, Xiaojing; Di, BingYan; Wang, Dongyang; Zhang, Yaling; Xia, Haibin; Mao, Qinwen

    2013-12-01

    Adenovirus has shown increasing promise in the gene-viral therapy for glioblastoma, a treatment strategy that relies on the delivery of viruses or transgenes into tumor cells. However, targeting of adenovirus to human glioblastoma remains a challenge due to the low expression level of coxsackie and adenovirus receptor (CAR) in glioma cells. Aptamers are small and highly structured single-stranded oligonucleotides that bind at high affinity to a target molecule, and are good candidates for targeted imaging and therapy. In this study, to construct an aptamer-modified Ad5, we first genetically modified the HVR5 of Ad hexon by biotin acceptor peptide (BAP), which would be metabolically biotinylated during production in HEK293 cells, and then attached the biotin labeled aptamer to the modified Ad through avidin–biotin binding. The aptamers used in this study includes AS1411 and GBI-10. The former is a DNA aptamer that can bind to nucleolin, a nuclear matrix protein found on the surface of cancer cells. The latter is a DNA aptamer that can recognize the extracellular matrix protein tenascin-C on the surface of human glioblastoma cells. To examine if aptamer-modification of the hexon protein could improve the adenoviral transduction efficiency, a glioblastoma cell line, U251, was transduced with aptamer-modified Ads. The transduction efficiency of AS1411- or GBI-10-modified Ad was approximately 4.1-fold or 5.2-fold higher than that of the control. The data indicated that aptamer modified adenovirus would be a useful tool for cancer gene therapy.

  18. Ligand binding by the tandem glycine riboswitch depends on aptamer dimerization but not double ligand occupancy.

    Science.gov (United States)

    Ruff, Karen M; Strobel, Scott A

    2014-11-01

    The glycine riboswitch predominantly exists as a tandem structure, with two adjacent, homologous ligand-binding domains (aptamers), followed by a single expression platform. The recent identification of a leader helix, the inclusion of which eliminates cooperativity between the aptamers, has reopened the debate over the purpose of the tandem structure of the glycine riboswitch. An equilibrium dialysis-based assay was combined with binding-site mutations to monitor glycine binding in each ligand-binding site independently to understand the role of each aptamer in glycine binding and riboswitch tertiary interactions. A series of mutations disrupting the dimer interface was used to probe how dimerization impacts ligand binding by the tandem glycine riboswitch. While the wild-type tandem riboswitch binds two glycine equivalents, one for each aptamer, both individual aptamers are capable of binding glycine when the other aptamer is unoccupied. Intriguingly, glycine binding by aptamer-1 is more sensitive to dimerization than glycine binding by aptamer-2 in the context of the tandem riboswitch. However, monomeric aptamer-2 shows dramatically weakened glycine-binding affinity. In addition, dimerization of the two aptamers in trans is dependent on glycine binding in at least one aptamer. We propose a revised model for tandem riboswitch function that is consistent with these results, wherein ligand binding in aptamer-1 is linked to aptamer dimerization and stabilizes the P1 stem of aptamer-2, which controls the expression platform.

  19. Aptamer-targeted DNA nanostructures for therapeutic delivery.

    Science.gov (United States)

    Charoenphol, Phapanin; Bermudez, Harry

    2014-05-05

    DNA-based nanostructures have been widely used in various applications due to their structural diversity, programmability, and uniform structures. Their intrinsic biocompatibility and biodegradability further motivates the investigation of DNA-based nanostructures as delivery vehicles. Incorporating AS1411 aptamers into DNA pyramids leads to enhanced intracellular uptake and selectively inhibits the growth of cancer cells, achieved without the use of transfection reagents. Furthermore, aptamer-displaying pyramids are found to be substantially more resistant to nuclease degradation than single-stranded aptamers. These findings, along with their modularity, reinforce the potential of DNA-based nanostructures for therapeutic applications.

  20. Biosensor platform based on carbon nanotubes covalently modified with aptamers

    Science.gov (United States)

    Komarov, I. A.; Rubtsova, E. I.; Golovin, A. V.; Bobrinetskiy, I. I.

    2016-12-01

    We developed a new platform for biosensing applications. Aptamers as sensitive agents have a great potential and gives us possibility to have highest possible selectivity among other sensing agents like enzymes or antibodies. We covalently bound aptamers to the functional groups of c-CNTs and then put this system on the surface of polymer substrate. Thus we got high sensitive flexible transparent biological sensors. We also suggest that by varying aptamer type we can make set of biosensors for disease detection which can be integrated into self-healthcare systems and gadgets.

  1. Aptamer-Based Electrochemical Sensing of Lysozyme

    Directory of Open Access Journals (Sweden)

    Alina Vasilescu

    2016-06-01

    Full Text Available Protein analysis and quantification are required daily by thousands of laboratories worldwide for activities ranging from protein characterization to clinical diagnostics. Multiple factors have to be considered when selecting the best detection and quantification assay, including the amount of protein available, its concentration, the presence of interfering molecules, as well as costs and rapidity. This is also the case for lysozyme, a 14.3-kDa protein ubiquitously present in many organisms, that has been identified with a variety of functions: antibacterial activity, a biomarker of several serious medical conditions, a potential allergen in foods or a model of amyloid-type protein aggregation. Since the design of the first lysozyme aptamer in 2001, lysozyme became one of the most intensively-investigated biological target analytes for the design of novel biosensing concepts, particularly with regards to electrochemical aptasensors. In this review, we discuss the state of the art of aptamer-based electrochemical sensing of lysozyme, with emphasis on sensing in serum and real samples.

  2. Graphene- and aptamer-based electrochemical biosensor.

    Science.gov (United States)

    Xu, Ke; Meshik, Xenia; Nichols, Barbara M; Zakar, Eugene; Dutta, Mitra; Stroscio, Michael A

    2014-05-23

    This study investigated the effectiveness of a graphene- and aptamer-based field-effect-transistor-like (FET-like) sensor in detecting lead and potassium ions. The sensor consists of a graphene-covered Si/SiO2 wafer with thrombin binding aptamer (TBA) attached to the graphene layer and terminated by a methylene blue (MB) molecule. K(+) and Pb(2+) both bind to TBA and cause a conformational change, which results in MB moving closer to the graphene surface and donating an electron. Thus, the abundance of K(+) and Pb(2+) can be determined by monitoring the current across the source and drain channel. Device transfer curves were obtained with ambipolar field effect observed. Current readings were taken for K(+) concentrations of 100 μM to 50 mM and Pb(2+) concentrations of 10 μM to 10 mM. As expected, I d decreased as ion concentration increased. In addition, there was a negative shift in V Dirac in response to increased ion concentration.

  3. Quinacrine impairs enterovirus 71 RNA replication by preventing binding of polypyrimidine-tract binding protein with internal ribosome entry sites.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Since the 1980s, epidemics of enterovirus 71 (EV71 and other enteroviruses have occurred in Asian countries and regions, causing a wide range of human diseases. No effective therapy is available for the treatment of these infections. Internal ribosome entry sites (IRESs are indispensable for the initiation of translation in enteroviruses. Several cellular factors, as well as the ribosome, are recruited to the conserved IRES during this process. Quinacrine intercalates into the RNA architecture and inhibits RNA transcription and protein synthesis, and a recent study showed that quinacrine inhibited encephalomyocarditis virus and poliovirus IRES-mediated translation in vitro without disrupting internal cellular IRES. Here, we report that quinacrine was highly active against EV71, protecting cells from EV71 infection. Replication of viral RNA, expression of viral capsid protein, and production of virus were all strongly inhibited by quinacrine. Interaction of the polypyrimidine tract-binding protein (PTB with the conserved IRES was prevented by quinacrine. Coxsackieviruses and echovirus were also inhibited by quinacrine in cultured cells. These results indicate that quinacrine may serve as a potential protective agent for use in the treatment of patients with chronic enterovirus infection.

  4. Aptamer Binding Studies Using MicroScale Thermophoresis.

    Science.gov (United States)

    Breitsprecher, Dennis; Schlinck, Nina; Witte, David; Duhr, Stefan; Baaske, Philipp; Schubert, Thomas

    2016-01-01

    The characterization and development of highly specific aptamers requires the analysis of the interaction strength between aptamer and target. MicroScale Thermophoresis (MST) is a rapid and precise method to quantify biomolecular interactions in solution at microliter scale. The basis of this technology is a physical effect referred to as thermophoresis, which describes the directed movement of molecules through temperature gradients. The thermophoretic properties of a molecule depend on its size, charge, and hydration shell. Since at least one of these parameters is altered upon binding of a ligand, this method can be used to analyze virtually any biomolecular interaction in any buffer or complex bioliquid. This section provides a detailed protocol describing how MST is used to obtain quantitative binding parameters for aptamer-target interactions. The two DNA-aptamers HD1 and HD22, which are targeted against human thrombin, are used as model systems to demonstrate a rapid and straightforward screening approach to determine optimal buffer conditions.

  5. Aptamer based electrochemical sensors for emerging environmental pollutants

    Directory of Open Access Journals (Sweden)

    Akhtar eHAYAT

    2014-06-01

    Full Text Available Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.

  6. Aptamer based electrochemical sensors for emerging environmental pollutants

    Science.gov (United States)

    Hayat, Akhtar; Marty, Jean Louis

    2014-06-01

    Environmental contaminants monitoring is one of the key issues in understanding and managing hazards to human health and ecosystems. In this context, aptamer based electrochemical sensors have achieved intense significance because of their capability to resolve a potentially large number of problems and challenges in environmental contamination. An aptasensor is a compact analytical device incorporating an aptamer (oligonulceotide) as the sensing element either integrated within or intimately associated with a physiochemical transducer surface. Nucleic acid is well known for the function of carrying and passing genetic information, however, it has found a key role in analytical monitoring during recent years. Aptamer based sensors represent a novelty in environmental analytical science and there are great expectations for their promising performance as alternative to conventional analytical tools. This review paper focuses on the recent advances in the development of aptamer based electrochemical sensors for environmental applications with special emphasis on emerging pollutants.

  7. Probing the Structure of DNA Aptamers with a Classic Heterocycle.

    Directory of Open Access Journals (Sweden)

    G. Reid Bishop

    2004-02-01

    Full Text Available DNA aptamers are synthetic, single-stranded DNA oligonucleotides selectedby SELEX methods for their binding with specific ligands. Here we present ethidiumbinding results for three related DNA aptamers (PDB code: 1OLD, 1DB6, and 2ARGthat bind L-argininamide (L-Arm. The ligand bound form of each aptamer's structurehas been reported and each are found to be composed primarily of two domainsconsisting of a stem helical region and a loop domain that forms a binding pocket for thecognate ligand. Previous thermodynamic experiments demonstrated that the DNAaptamer 1OLD undergoes a large conformational ordering upon binding to L-Arm. Herewe extend those linkage binding studies by examining the binding of the heterocyclicintercalator ethidium to each of the three aptamers by fluorescence and absorptionspectrophotometric titrations. Our results reveal that ethidium binds to each aptamer with∆Go's in the range of -8.7 to -9.4 kcal/mol. The stoichiometry of binding is 2:1 for eachaptamer and is quantitatively diminished in the presence of L-Arm as is the overallfluorescence intensity of ethidium. Together, these results demonstrate that a portion ofthe bound ethidium is excluded from the aptamer in the presence of a saturating amountof L-Arm. These results demonstrate the utility of ethidium and related compounds forthe probing of non-conventional DNA structures and reveal an interesting fundamentalthermodynamic linkage in DNA aptamers. Results are discussed in the context of thethermodynamic stability and structure of each of the aptamers examined.

  8. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    Science.gov (United States)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  9. CD28 Aptamers as Powerful Immune Response Modulators

    Directory of Open Access Journals (Sweden)

    Fernando Pastor

    2013-01-01

    Full Text Available CD28 is one of the main costimulatory receptors responsible for the proper activation of T lymphocytes. We have isolated two aptamers that bind to the CD28 receptor. As a monomer, one of them interfered with the binding of CD28 to its ligand (B7, precluding the costimulatory signal, whereas the other one was inactive. However, dimerization of any of the anti-CD28 aptamers was sufficient to provide an artificial costimulatory signal. No antibody has featured a dual function (i.e., the ability to work as agonist and antagonist to date. Two different agonistic structures were engineered for each anti-CD28 aptamer. One showed remarkably improved costimulatory properties, surpassing the agonistic effect of an anti-CD28 antibody. Moreover, we showed in vivo that the CD28 agonistic aptamer is capable of enhancing the cellular immune response against a lymphoma idiotype and of prolonging survival of mice which receive the aptamer together with an idiotype vaccine. The CD28 aptamers described in this work could be used to modulate the immune response either blocking the interaction with B7 or enhancing vaccine-induced immune responses in cancer immunotherapy.

  10. Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications

    Directory of Open Access Journals (Sweden)

    Lin Wen

    2017-07-01

    Full Text Available Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.

  11. APTAMER-BASED SERRS SENSOR FOR THROMBIN DETECTION

    Energy Technology Data Exchange (ETDEWEB)

    Cho, H; Baker, B R; Wachsmann-Hogiu, S; Pagba, C V; Laurence, T A; Lane, S M; Lee, L P; Tok, J B

    2008-07-02

    We describe an aptamer-based Surface Enhanced Resonance Raman Scattering (SERRS) sensor with high sensitivity, specificity, and stability for the detection of a coagulation protein, human a-thrombin. The sensor achieves high sensitivity and a limit of detection of 100 pM by monitoring the SERRS signal change upon the single step of thrombin binding to immobilized thrombin binding aptamer. The selectivity of the sensor is demonstrated by the specific discrimination of thrombin from other protein analytes. The specific recognition and binding of thrombin by the thrombin binding aptamer is essential to the mechanism of the aptamer-based sensor, as shown through measurements using negative control oligonucleotides. In addition, the sensor can detect 1 nM thrombin in the presence of complex biofluids, such as 10% fetal calf serum, demonstrating that the immobilized, 5{prime}-capped, 3{prime}-capped aptamer is sufficiently robust for clinical diagnostic applications. Furthermore, the proposed sensor may be implemented for multiplexed detection using different aptamer-Raman probe complexes.

  12. Aptamer-Modified Semiconductor Quantum Dots for Biosensing Applications.

    Science.gov (United States)

    Wen, Lin; Qiu, Liping; Wu, Yongxiang; Hu, Xiaoxiao; Zhang, Xiaobing

    2017-07-28

    Semiconductor quantum dots have attracted extensive interest in the biosensing area because of their properties, such as narrow and symmetric emission with tunable colors, high quantum yield, high stability and controllable morphology. The introduction of various reactive functional groups on the surface of semiconductor quantum dots allows one to conjugate a spectrum of ligands, antibodies, peptides, or nucleic acids for broader and smarter applications. Among these ligands, aptamers exhibit many advantages including small size, high chemical stability, simple synthesis with high batch-to-batch consistency and convenient modification. More importantly, it is easy to introduce nucleic acid amplification strategies and/or nanomaterials to improve the sensitivity of aptamer-based sensing systems. Therefore, the combination of semiconductor quantum dots and aptamers brings more opportunities in bioanalysis. Here we summarize recent advances on aptamer-functionalized semiconductor quantum dots in biosensing applications. Firstly, we discuss the properties and structure of semiconductor quantum dots and aptamers. Then, the applications of biosensors based on aptamer-modified semiconductor quantum dots by different signal transducing mechanisms, including optical, electrochemical and electrogenerated chemiluminescence approaches, is discussed. Finally, our perspectives on the challenges and opportunities in this promising field are provided.

  13. Rapid One-Step Selection Method for Generating Nucleic Acid Aptamers: Development of a DNA Aptamer against alpha-Bungarotoxin

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Shamaileh, Hadi A.; Edwards, Stacey L.

    2012-01-01

    Background: Nucleic acids based therapeutic approaches have gained significant interest in recent years towards the development of therapeutics against many diseases. Recently, research on aptamers led to the marketing of Macugen (R), an inhibitor of vascular endothelial growth factor (VEGF...... by PCR enrichment of the selected aptamers. One round of selection successfully identified a DNA aptamer sequence with a binding affinity of 7.58 mu M. Conclusion: We have demonstrated a one-step method for rapid production of nucleic acid aptamers. Although the reported binding affinity is in the low...... micromolar range, we believe that this could be further improved by using larger targets, increasing the stringency of selection and also by combining a capillary electrophoresis separation prior to the one-step selection. Furthermore, the method presented here is a user-friendly, cheap and an easy way...

  14. Cockayne syndrome: report of a Brazilian family with confirmation of impaired RNA synthesis after UV-irradiation

    Directory of Open Access Journals (Sweden)

    Karam Simone M.

    2000-01-01

    Full Text Available Cockayne syndrome (CS is an autosomal recessive disorder characterized by dwarfism, growth deficiency, neurological deterioration, skin photosensitivity and a characteristic progressive facial appearance. In the present study we report the first Brazilian CS family in which diagnosis was confirmed by the demonstration of decreased RNA synthesis in cultured fibroblasts exposed to UV-C radiation. Despite the progressive course of the disease and the unavailability of an effective treatment, diagnosis may be very important for the benefits to be gained by the afflicted family from genetic counseling and/or prenatal diagnosis.

  15. Molecule-binding dependent assembly of split aptamer and γ-cyclodextrin: A sensitive excimer signaling approach for aptamer biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Fen [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Hubei Key Laboratory of Mine Environmental Pollution Control and Remediation, Environmental Science and Engineering College, Hubei Polytechnic University, Huangshi 435003 (China); Lian, Yan; Li, Jishan; Zheng, Jing; Hu, Yaping; Liu, Jinhua; Huang, Jin [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Yang, Ronghua, E-mail: Yangrh@pku.edu.cn [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China)

    2013-10-17

    Graphical abstract: Adenosine-binding aptamer was splitted into two fragments P2 and P3 which labeled pyrene molecules, mainly produce monomer signal. γ-CD cavity brings P2 and P3 in close proximity, allowing for weak excimer emission. In the presence of target, P2 and P3 are expected to bind ATP and form an aptamer/target complex, leads to large increase of the pyrene excimer fluorescence. -- Highlights: •We assembled split aptamer and γ-cyclodextrin fluorescence biosensors for ATP detection. •The biosensor increased quantum yield and emission lifetime of the excimer. •Time-resolved fluorescence is effective for ATP assay in complicated environment. -- Abstract: A highly sensitive and selective fluorescence aptamer biosensors for the determination of adenosine triphosphate (ATP) was developed. Binding of a target with splitting aptamers labeled with pyrene molecules form stable pyrene dimer in the γ-cyclodextrin (γ-CD) cavity, yielding a strong excimer emission. We have found that inclusion of pyrene dimer in γ-cyclodextrin cavity not only exhibits additive increases in quantum yield and emission lifetime of the excimer, but also facilitates target-induced fusion of the splitting aptamers to form the aptamer/target complex. As proof-of-principle, the approach was applied to fluorescence detection of adenosine triphosphate. With an anti-ATP aptamer, the approach exhibits excimer fluorescence response toward ATP with a maximum signal-to-background ratio of 32.1 and remarkably low detection limit of 80 nM ATP in buffer solution. Moreover, due to the additive fluorescence lifetime of excimer induced by γ-cyclodextrin, time-resolved measurements could be conveniently used to detect as low as 0.5 μM ATP in blood serum quantitatively.

  16. Folding of the silver aptamer in a DNAzyme probed by 2-aminopurine fluorescence.

    Science.gov (United States)

    Saran, Runjhun; Yao, Lu; Hoang, Peter; Liu, Juewen

    2017-07-12

    The RNA-cleaving Ag10c DNAzyme was recently isolated via in vitro selection and it can bind two Ag(+) ions for activity. The Ag10c contains a well-defined Ag(+) binding aptamer as indicated by DMS footprinting. Since aptamer binding is often accompanied with conformational changes, we herein used 2-aminopurine (2AP) to probe its folding in the presence of Ag(+). The Ag10c was respectively labeled with 2AP at three different positions, both in the substrate strand and in the enzyme strand, one at a time. Ag(+)-induced folding was observed at the substrate cleavage junction and the A9 position of the enzyme strand, consistent with aptamer binding. The measured Kd at the A9 position was 18 μM Ag(+) with a Hill coefficient of 2.17, similar to those obtained from the previous cleavage activity based assays. However, labeling a 2AP at the A2 position inhibited the activity and folding. Compared to other metal ions, Ag(+) has a unique sigmoidal folding profile indicative of multiple silver binding cooperatively. This suggests that Ag(+) can induce a local folding in the enzyme loop and this folding is important for activity. This study provides important biophysical insights into this new DNAzyme, suggesting the possibility of designing folding-based biosensors for Ag(+). Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. A microfluidic surface enhanced Raman spectroscopic biosensor using aptamer functionalized nanopillars

    DEFF Research Database (Denmark)

    Yang, J.; Palla, M.; Bosco, F. G.

    2013-01-01

    This paper presents a microchip incorporating an aptamer-functionalized nanopillar substrate, enabling the specific detection of low-abundance biomolecules using surface enhanced Raman spectroscopy (SERS). In a temperature controlled microchamber, aptamers immobilized on the nanostructure surface...

  18. Aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) for electrochemical analysis of tumor biomarkers.

    Science.gov (United States)

    Wang, Pengjuan; Wan, Ying; Deng, Shengyuan; Yang, Shulin; Su, Yan; Fan, Chunhai; Aldalbahi, Ali; Zuo, Xiaolei

    2016-12-15

    Herein, an aptamer-initiated on-particle template-independent enzymatic polymerization (aptamer-OTEP) strategy for electrochemical aptasensor (E-aptasensor) is developed for analysis of cancer biomarker carcino-embryonic antigen (CEA). A pair of DNA aptamers is employed which can be specifically bond with CEA simultaneously. One of the aptamer is thiolated at 3'-terminal and immobilized onto the gold electrode as a capture probe, while the other one has a thiol group at its 5'-terminal and is modified onto the gold nanoparticles surface to form a nanoprobe. In the present of target, the two aptamers can "sandwich" the target, thus the nanoprobe is attached to the electrode. Then terminal deoxynucleotidyl transferase (TdT) is employed to catalyze the incorporation of biotin labeled dNTPs into the 3'-OH terminals of the DNA aptamer on the nanoprobe. The as-generated long DNA oligo tentacles allow specific binding of numerous avidin modified horseradish peroxidase (Av-HRP), resulting in tens of thousands of HRP catalyzed reduction of hydrogen peroxide and sharply increasing electrochemical signals. Taking advantage of the enzyme based nucleic acid amplification and nanoprobe, this strategy is demonstrated to possess the outstanding amplification efficiency.

  19. Single-molecule observations of RNA-RNA kissing interactions in a DNA nanostructure.

    Science.gov (United States)

    Takeuchi, Yosuke; Endo, Masayuki; Suzuki, Yuki; Hidaka, Kumi; Durand, Guillaume; Dausse, Eric; Toulmé, Jean-Jacques; Sugiyama, Hiroshi

    2016-01-01

    RNA molecules uniquely form a complex through specific hairpin loops, called a kissing complex. The kissing complex is widely investigated and used for the construction of RNA nanostructures. Molecular switches have also been created by combining a kissing loop and a ligand-binding aptamer to control the interactions of RNA molecules. In this study, we incorporated two kinds of RNA molecules into a DNA origami structure and used atomic force microscopy to observe their ligand-responsive interactions at the single-molecule level. We used a designed RNA aptamer called GTPswitch, which has a guanosine triphosphate (GTP) responsive domain and can bind to the target RNA hairpin named Aptakiss in the presence of GTP. We observed shape changes of the DNA/RNA strands in the DNA origami, which are induced by the GTPswitch, into two different shapes in the absence and presence of GTP, respectively. We also found that the switching function in the nanospace could be improved by using a cover strand over the kissing loop of the GTPswitch or by deleting one base from this kissing loop. These newly designed ligand-responsive aptamers can be used for the controlled assembly of the various DNA and RNA nanostructures.

  20. The application progress in cell-SELEX-based aptamers in cancer%Cell-SELEX技术在肿瘤诊治中的应用进展

    Institute of Scientific and Technical Information of China (English)

    吕彬

    2013-01-01

    Aptamers, selected by an in vitro process known as systematic evolution of ligands by exponential enrichment (SELEX), are single-stranded DNA or RNA oligonucleotides with high selectivity, affinity and stability. Aptamers that can bind whole cells, especially cancer cells, are generated by a method called cell-SELEX. Compared with antibodies, aptamers possess many advantages,including wide range of targets, quick and reproducible synthesis, nontoxicity and lack of immunogenicity,easy and controllable modification to fulfill the recognition of cancer cells. Aptamers conjugated nanomaterials gain more flexibility as cancer cell targeting tools. In this review, we discuss the application of cell-SELEX-based aptamers in novel cancer biomarkers identification,cancer imaging, cancer therapy and enhanced targeting when conjugated with nanomaterials.%核酸适配体是运用指数富集的配体系统进化(systematic evolution of ligand by exponential enrichment,SELEX)技术从人工体外合成的随机寡核苷酸序列库中,经过多轮筛选后得到的单链DNA或单链RNA,具有靶标广泛、制备方便、稳定性好、无免疫原性等优点.细胞SELEX(cell-SELEX)是指将整个细胞作为靶标筛选特异性DNA适配体的技术,尤其适用于肿瘤细胞的核酸适配体筛选.本文简要介绍cell-SELEX技术获得的核酸适配体在肿瘤标记发现、肿瘤成像、肿瘤治疗及与纳米材料结合后用于肿瘤靶向研究的应用进展.

  1. Modified AS1411 Aptamer Suppresses Hepatocellular Carcinoma by Up-Regulating Galectin-14

    OpenAIRE

    Cho, Yuri; Lee, Yun Bin; Lee, Jeong-Hoon; Lee, Dong Hyeon; Cho, Eun Ju; Yu, Su Jong; Kim, Yoon Jun; Kim, Jong In; Im, Jong Hun; Lee, Jung Hwan; Oh, Eun Ju; Yoon, Jung-Hwan

    2016-01-01

    Aptamers are small synthetic oligonucleotides that bind to target proteins with high specificity and affinity. AS1411 is an aptamer that binds to nucleolin, which is overexpressed in the cytoplasm and occurs on the surface of cancer cells. We investigated the therapeutic potential of aptamers in hepatocellular carcinoma (HCC) by evaluating anti-tumor effects and confirming the affinity and specificity of AS1411- and modified AS1411-aptamers in HCC cells. Cell growth was assessed using the MTS...

  2. Parasite Load Induces Progressive Spleen Architecture Breakage and Impairs Cytokine mRNA Expression in Leishmania infantum-Naturally Infected Dogs

    Science.gov (United States)

    Cavalcanti, Amanda S.; Ribeiro-Alves, Marcelo; Pereira, Luiza de O. R.; Mestre, Gustavo Leandro; Ferreira, Anna Beatriz Robottom; Morgado, Fernanda N.; Boité, Mariana C.; Cupolillo, Elisa; Moraes, Milton O.; Porrozzi, Renato

    2015-01-01

    Canine Visceral Leishmaniasis (CVL) shares many aspects with the human disease and dogs are considered the main urban reservoir of L. infantum in zoonotic VL. Infected dogs develop progressive disease with a large clinical spectrum. A complex balance between the parasite and the genetic/immunological background of the host are decisive for infection evolution and clinical outcome. This study comprised 92 Leishmania infected mongrel dogs of various ages from Mato Grosso, Brazil. Spleen samples were collected for determining parasite load, humoral response, cytokine mRNA expression and histopathology alterations. By real-time PCR for the ssrRNA Leishmania gene, two groups were defined; a low (lowP, n = 46) and a high parasite load groups (highP, n = 42). When comparing these groups, results show variable individual humoral immune response with higher specific IgG production in infected animals but with a notable difference in CVL rapid test optical densities (DPP) between highP and lowP groups. Splenic architecture disruption was characterized by disorganization of white pulp, more evident in animals with high parasitism. All cytokine transcripts in spleen were less expressed in highP than lowP groups with a large heterogeneous variation in response. Individual correlation analysis between cytokine expression and parasite load revealed a negative correlation for both pro-inflammatory cytokines: IFNγ, IL-12, IL-6; and anti-inflammatory cytokines: IL-10 and TGFβ. TNF showed the best negative correlation (r2 = 0.231; p<0.001). Herein we describe impairment on mRNA cytokine expression in leishmania infected dogs with high parasite load associated with a structural modification in the splenic lymphoid micro-architecture. We also discuss the possible mechanism responsible for the uncontrolled parasite growth and clinical outcome. PMID:25875101

  3. Parasite load induces progressive spleen architecture breakage and impairs cytokine mRNA expression in Leishmania infantum-naturally infected dogs.

    Directory of Open Access Journals (Sweden)

    Amanda S Cavalcanti

    Full Text Available Canine Visceral Leishmaniasis (CVL shares many aspects with the human disease and dogs are considered the main urban reservoir of L. infantum in zoonotic VL. Infected dogs develop progressive disease with a large clinical spectrum. A complex balance between the parasite and the genetic/immunological background of the host are decisive for infection evolution and clinical outcome. This study comprised 92 Leishmania infected mongrel dogs of various ages from Mato Grosso, Brazil. Spleen samples were collected for determining parasite load, humoral response, cytokine mRNA expression and histopathology alterations. By real-time PCR for the ssrRNA Leishmania gene, two groups were defined; a low (lowP, n = 46 and a high parasite load groups (highP, n = 42. When comparing these groups, results show variable individual humoral immune response with higher specific IgG production in infected animals but with a notable difference in CVL rapid test optical densities (DPP between highP and lowP groups. Splenic architecture disruption was characterized by disorganization of white pulp, more evident in animals with high parasitism. All cytokine transcripts in spleen were less expressed in highP than lowP groups with a large heterogeneous variation in response. Individual correlation analysis between cytokine expression and parasite load revealed a negative correlation for both pro-inflammatory cytokines: IFNγ, IL-12, IL-6; and anti-inflammatory cytokines: IL-10 and TGFβ. TNF showed the best negative correlation (r2 = 0.231; p<0.001. Herein we describe impairment on mRNA cytokine expression in leishmania infected dogs with high parasite load associated with a structural modification in the splenic lymphoid micro-architecture. We also discuss the possible mechanism responsible for the uncontrolled parasite growth and clinical outcome.

  4. Targeted delivery of anticancer drugs by aptamer AS1411 mediated Pluronic F127/cyclodextrin-linked polymer composite micelles.

    Science.gov (United States)

    Li, Xin; Yu, Yang; Ji, Qian; Qiu, Liyan

    2015-01-01

    Aptamers are single-stranded RNA or DNA ligands that can specifically bind to various molecular targets with high affinity. Owing to this unique character, they have become increasingly attractive in the field of drug delivery. In this study, we developed a multifunctional composite micelle (CM) with surface modification of aptamer AS1411 (Ap) for targeted delivery of doxorubicin (DOX) to human breast tumors. This binary mixed system consisting of AS1411 modified Pluronic F127 and beta-cyclodextrin-linked poly(ethylene glycol)-b-polylactide could enhance DOX-loading capacity and increase micelle stability. Cellular uptake of CM-Ap was found to be higher than that of untargeted CM due to the nucleolin-mediated endocytosis effect. In vivo study in MCF-7 tumor-bearing mice demonstrated that the AS1411-functionalized composite micelles showed prolonged circulation time in blood, enhanced accumulation in tumor, improved antitumor activity, and decreased cardiotoxicity. In conclusion, aptamer-conjugated multifunctional composite micelles could be a potential delivery vehicle for cancer therapy.

  5. General approach for engineering small-molecule-binding DNA split aptamers.

    Science.gov (United States)

    Kent, Alexandra D; Spiropulos, Nicholas G; Heemstra, Jennifer M

    2013-10-15

    Here we report a general method for engineering three-way junction DNA aptamers into split aptamers. Split aptamers show significant potential for use as recognition elements in biosensing applications, but reliable methods for generating these sequences are currently lacking. We hypothesize that the three-way junction is a "privileged architecture" for the elaboration of aptamers into split aptamers, as it provides two potential splitting sites that are distal from the target binding pocket. We propose a general method for split aptamer engineering that involves removing one loop region, then systematically modifying the number of base pairs in the remaining stem regions in order to achieve selective assembly only in the presence of the target small molecule. We screen putative split aptamer sequence pairs using split aptamer proximity ligation (StAPL) technology developed by our laboratory, but we validate that the results obtained using StAPL translate directly to systems in which the aptamer fragments are assembling noncovalently. We introduce four new split aptamer sequences, which triples the number of small-molecule-binding DNA split aptamers reported to date, and the methods described herein provide a reliable route for the engineering of additional split aptamers, dramatically advancing the potential substrate scope of DNA assembly based biosensors.

  6. Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods.

    Science.gov (United States)

    Bruno, John G; Kiel, Johnathan L

    2002-01-01

    Systematic evolution of ligands by exponential enrichment (SELEX) was used to develop DNA ligands (aptamers) to cholera whole toxin and staphylococcal enterotoxin B (SEB). Affinity selection of aptamers was accomplished by conjugating the biotoxins to tosyl-activated magnetic beads. The use of magnetic beads reduces the volumes needed to perform aptamer selection, thus obviating alcohol precipitation and allowing direct PCR amplification from the bead surface. Following five rounds of SELEX, 5'-biotinylated aptamers were bound to streptavidin-coated magnetic beads and used for the detection of ruthenium trisbypyridine [Ru(bpy)3(2+)]-labeled cholera toxin and SEB by an electrochemiluminescence methodology. A comparison of control (double-stranded) aptamer binding was made with aptamers that were heat denatured at 96 degrees C (single-stranded) and allowed to cool (conform) in the presence of biotoxin-conjugated magnetic beads. Results suggest that control aptamers performed equally well when compared to heat-denatured DNA aptamers in the cholera toxin electrochemiluminescence assay and a colorimetric microplate assay employing peroxidase-labeled cholera toxin and 5'-amino terminated aptamers conjugated to N-oxysuccinimide-activated microtiter wells. Interestingly, however, in the SEB electrochemiluminescence assay, double-stranded aptamers exceeded the performance of single-stranded aptamers. The detection limits of all aptamer assays were in the low nanogram to low picogram ranges.

  7. Aptamer based, non-PCR, non-serological detection of Chagas disease biomarkers in Trypanosoma cruzi infected mice.

    Directory of Open Access Journals (Sweden)

    Rana Nagarkatti

    Full Text Available Chagas disease affects about 5 million people across the world. The etiological agent, the intracellular parasite Trypanosoma cruzi (T. cruzi, can be diagnosed using microscopy, serology or PCR based assays. However, each of these methods has their limitations regarding sensitivity and specificity, and thus to complement these existing diagnostic methods, alternate assays need to be developed. It is well documented that several parasite proteins called T. cruzi Excreted Secreted Antigens (TESA, are released into the blood of an infected host. These circulating parasite antigens could thus be used as highly specific biomarkers of T. cruzi infection. In this study, we have demonstrated that, using a SELEx based approach, parasite specific ligands called aptamers, can be used to detect TESA in the plasma of T. cruzi infected mice. An Enzyme Linked Aptamer (ELA assay, similar to ELISA, was developed using biotinylated aptamers to demonstrate that these RNA ligands could interact with parasite targets. Aptamer L44 (Apt-L44 showed significant and specific binding to TESA as well as T. cruzi trypomastigote extract and not to host proteins or proteins of Leishmania donovani, a related trypanosomatid parasite. Our result also demonstrated that the target of Apt-L44 is conserved in three different strains of T. cruzi. In mice infected with T. cruzi, Apt-L44 demonstrated a significantly higher level of binding compared to non-infected mice suggesting that it could detect a biomarker of T. cruzi infection. Additionally, Apt-L44 could detect these circulating biomarkers in both the acute phase, from 7 to 28 days post infection, and in the chronic phase, from 55 to 230 days post infection. Our results show that Apt-L44 could thus be used in a qualitative ELA assay to detect biomarkers of Chagas disease.

  8. MicroRNA-497 impairs the growth of chemoresistant neuroblastoma cells by targeting cell cycle, survival and vascular permeability genes

    Science.gov (United States)

    Soriano, Aroa; París-Coderch, Laia; Jubierre, Luz; Martínez, Alba; Zhou, Xiangyu; Piskareva, Olga; Bray, Isabella; Vidal, Isaac; Almazán-Moga, Ana; Molist, Carla; Roma, Josep; Bayascas, José R.; Casanovas, Oriol; Stallings, Raymond L.; de Toledo, José Sánchez; Gallego, Soledad; Segura, Miguel F.

    2016-01-01

    Despite multimodal therapies, a high percentage of high-risk neuroblastoma (NB) become refractory to current treatments, most of which interfere with cell cycle and DNA synthesis or function, activating the DNA damage response (DDR). In cancer, this process is frequently altered by deregulated expression or function of several genes which contribute to multidrug resistance (MDR). MicroRNAs are outstanding candidates for therapy since a single microRNA can modulate the expression of multiple genes of the same or different pathways, thus hindering the development of resistance mechanisms by the tumor. We found several genes implicated in the MDR to be overexpressed in high-risk NB which could be targeted by microRNAs simultaneously. Our functional screening identified several of those microRNAs that reduced proliferation of chemoresistant NB cell lines, the best of which was miR-497. Low expression of miR-497 correlated with poor patient outcome. The overexpression of miR-497 reduced the proliferation of multiple chemoresistant NB cell lines and induced apoptosis in MYCN-amplified cell lines. Moreover, the conditional expression of miR-497 in NB xenografts reduced tumor growth and inhibited vascular permeabilization. MiR-497 targets multiple genes related to the DDR, cell cycle, survival and angiogenesis, which renders this molecule a promising candidate for NB therapy. PMID:26824183

  9. Functionalizing Liposomes with anti-CD44 Aptamer for Selective Targeting of Cancer Cells.

    Science.gov (United States)

    Alshaer, Walhan; Hillaireau, Hervé; Vergnaud, Juliette; Ismail, Said; Fattal, Elias

    2015-07-15

    CD44 receptor protein is found to be overexpressed by many tumors and is identified as one of the most common cancer stem cell surface markers including tumors affecting colon, breast, pancreas, and head and neck, making this an attractive receptor for therapeutic targeting. In this study, 2'-F-pyrimidine-containing RNA aptamer (Apt1), previously selected against CD44, was successfully conjugated to the surface of PEGylated liposomes using the thiol-maleimide click reaction. The conjugation of Apt1 to the surface of liposomes was confirmed by the change in size and zeta potential and by migration on agarose gel electrophoresis. The binding affinity of Apt1 was improved after conjugation compared to free-Apt1. The cellular uptake for Apt1-Lip was tested by flow cytometry and confocal imaging using the two CD44(+) cell lines, human lung cancer cells (A549) and human breast cancer cells (MDA-MB-231), and the CD44(-) cell line, mouse embryonic fibroblast cells (NIH/3T3). The results showed higher sensitivity and selectivity for Apt1-Lip compared to the blank liposomes (Mal-Lip). In conclusion, we demonstrate a successful conjugation of anti-CD44 aptamer to the surface of liposome and binding preference of Apt1-Lip to CD44-expressing cancer cells and conclude to a promising potency of Apt1-Lip as a specific drug delivery system.

  10. Development of aptamers for in vivo and in vitro biosensor applications

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm

    The nylon in the clothes we wear; the paracetamol in the painkillers we eat; and LEGO® blocks we may buy for our children – they all are manufactured from chemical material based on petroleum. Most of us are blissfully unaware of how our dependency on oil, transcends the use of fuel-based transpo......The nylon in the clothes we wear; the paracetamol in the painkillers we eat; and LEGO® blocks we may buy for our children – they all are manufactured from chemical material based on petroleum. Most of us are blissfully unaware of how our dependency on oil, transcends the use of fuel...... block chemicals are now being sustainably produced in bacterial cell-factories. The development of new bacterial cell-factories is a difficult and expensive process, in part due to time required to screen for and optimize productions strains. A new promising way of reducing the development time...... is generating new and faster ways of screening and optimizing using biosensors. In this thesis we develop new functional biological recognition modules for biosensors. These DNA- and RNA-based recognition modules are called aptamers and are developed to interact with targets of choice. Aptamers are developed...

  11. Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts

    Science.gov (United States)

    Lorenz, C.; Gesell, T.; Zimmermann, B.; Schoeberl, U.; Bilusic, I.; Rajkowitsch, L.; Waldsich, C.; von Haeseler, A.; Schroeder, R.

    2010-01-01

    An unexpectedly high number of regulatory RNAs have been recently discovered that fine-tune the function of genes at all levels of expression. We employed Genomic SELEX, a method to identify protein-binding RNAs encoded in the genome, to search for further regulatory RNAs in Escherichia coli. We used the global regulator protein Hfq as bait, because it can interact with a large number of RNAs, promoting their interaction. The enriched SELEX pool was subjected to deep sequencing, and 8865 sequences were mapped to the E. coli genome. These short sequences represent genomic Hfq-aptamers and are part of potential regulatory elements within RNA molecules. The motif 5′-AAYAAYAA-3′ was enriched in the selected RNAs and confers low-nanomolar affinity to Hfq. The motif was confirmed to bind Hfq by DMS footprinting. The Hfq aptamers are 4-fold more frequent on the antisense strand of protein coding genes than on the sense strand. They were enriched opposite to translation start sites or opposite to intervening sequences between ORFs in operons. These results expand the repertoire of Hfq targets and also suggest that Hfq might regulate the expression of a large number of genes via interaction with cis-antisense RNAs. PMID:20348540

  12. Osteomyelitis diagnosis by {sup 99m}Tc radiolabeled aptamers

    Energy Technology Data Exchange (ETDEWEB)

    Santos, S.R.; Ferreira, I.M.; Andrade, A.S.R., E-mail: sararoberta7@hotmail.com, E-mail: imendesf@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, A.L.B.; Cardoso, V.N.; Diniz, O.F., E-mail: brancodebarros@yahoo.com.br, E-mail: valbertcardoso@yahoo.com.br, E-mail: simoneodilia@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas

    2015-07-01

    Osteomyelitis, which is characterized by progressive inflammatory destruction and new opposition of bone, is still a difficult infection to treat. The clinical diagnosis in late stages is achieved easily, but an early diagnosis is more challenging. Staphylococcus aureus is a common agent found in osteomyelitis and bone prostheses infection. Diagnosis by scintigraphy has advantages because it is a non-invasive procedure and is able to perform an early diagnosis even before anatomic changes. Thus, nuclear medicine could contribute to an accurate diagnosis since specific radiopharmaceuticals were developed. In this study, aptamers selected to Staphylococcus aureus were labeled with {sup 99m}Tc and used for bacteria identification in an osteomyelitis experimental model. The aptamers selected to S. aureus were directly labelled with {sup 99m}Tc and were evaluated by biodistribution studies. Wistar rats with intraosseous infection in the right paw were used. A random aptamer labelled with {sup 99m}Tc was as control. Six animals were used in each group. The aptamers labeled with {sup 99m}Tc were able to identify the infection foci caused by S. aureus displaying a target/non-target ratio of 2,23 ± 0,20, after 3 h. The control group presented a target/non-target ratio 1,08 ± 0.23. The results indicated that the radiolabeled aptamers were able to identify specifically the infection foci and they should be further explored for infection diagnosis by scintigraphy. (author)

  13. MIPs and Aptamers for Recognition of Proteins in Biomimetic Sensing.

    Science.gov (United States)

    Menger, Marcus; Yarman, Aysu; Erdőssy, Júlia; Yildiz, Huseyin Bekir; Gyurcsányi, Róbert E; Scheller, Frieder W

    2016-07-18

    Biomimetic binders and catalysts have been generated in order to substitute the biological pendants in separation techniques and bioanalysis. The two major approaches use either "evolution in the test tube" of nucleotides for the preparation of aptamers or total chemical synthesis for molecularly imprinted polymers (MIPs). The reproducible production of aptamers is a clear advantage, whilst the preparation of MIPs typically leads to a population of polymers with different binding sites. The realization of binding sites in the total bulk of the MIPs results in a higher binding capacity, however, on the expense of the accessibility and exchange rate. Furthermore, the readout of the bound analyte is easier for aptamers since the integration of signal generating labels is well established. On the other hand, the overall negative charge of the nucleotides makes aptamers prone to non-specific adsorption of positively charged constituents of the sample and the "biological" degradation of non-modified aptamers and ionic strength-dependent changes of conformation may be challenging in some application.

  14. Reagentless, Structure-Switching, Electrochemical Aptamer-Based Sensors

    Science.gov (United States)

    Schoukroun-Barnes, Lauren R.; Macazo, Florika C.; Gutierrez, Brenda; Lottermoser, Justine; Liu, Juan; White, Ryan J.

    2016-06-01

    The development of structure-switching, electrochemical, aptamer-based sensors over the past ˜10 years has led to a variety of reagentless sensors capable of analytical detection in a range of sample matrices. The crux of this methodology is the coupling of target-induced conformation changes of a redox-labeled aptamer with electrochemical detection of the resulting altered charge transfer rate between the redox molecule and electrode surface. Using aptamer recognition expands the highly sensitive detection ability of electrochemistry to a range of previously inaccessible analytes. In this review, we focus on the methods of sensor fabrication and how sensor signaling is affected by fabrication parameters. We then discuss recent studies addressing the fundamentals of sensor signaling as well as quantitative characterization of the analytical performance of electrochemical aptamer-based sensors. Although the limits of detection of reported electrochemical aptamer-based sensors do not often reach that of gold-standard methods such as enzyme-linked immunosorbent assays, the operational convenience of the sensor platform enables exciting analytical applications that we address. Using illustrative examples, we highlight recent advances in the field that impact important areas of analytical chemistry. Finally, we discuss the challenges and prospects for this class of sensors.

  15. Reagentless, Structure-Switching, Electrochemical Aptamer-Based Sensors.

    Science.gov (United States)

    Schoukroun-Barnes, Lauren R; Macazo, Florika C; Gutierrez, Brenda; Lottermoser, Justine; Liu, Juan; White, Ryan J

    2016-06-12

    The development of structure-switching, electrochemical, aptamer-based sensors over the past ∼10 years has led to a variety of reagentless sensors capable of analytical detection in a range of sample matrices. The crux of this methodology is the coupling of target-induced conformation changes of a redox-labeled aptamer with electrochemical detection of the resulting altered charge transfer rate between the redox molecule and electrode surface. Using aptamer recognition expands the highly sensitive detection ability of electrochemistry to a range of previously inaccessible analytes. In this review, we focus on the methods of sensor fabrication and how sensor signaling is affected by fabrication parameters. We then discuss recent studies addressing the fundamentals of sensor signaling as well as quantitative characterization of the analytical performance of electrochemical aptamer-based sensors. Although the limits of detection of reported electrochemical aptamer-based sensors do not often reach that of gold-standard methods such as enzyme-linked immunosorbent assays, the operational convenience of the sensor platform enables exciting analytical applications that we address. Using illustrative examples, we highlight recent advances in the field that impact important areas of analytical chemistry. Finally, we discuss the challenges and prospects for this class of sensors.

  16. DNA aptamers as molecular probes for colorectal cancer study.

    Directory of Open Access Journals (Sweden)

    Kwame Sefah

    Full Text Available BACKGROUND: Understanding the molecular features of specific tumors can increase our knowledge about the mechanism(s underlying disease development and progression. This is particularly significant for colorectal cancer, which is a heterogeneous complex of diseases developed in a sequential manner through a multistep carcinogenic process. As such, it is likely that tumors with similar characteristics might originate in the same manner and have a similar molecular behavior. Therefore, specific mapping of the molecular features can be potentially useful for both tumor classification and the development of appropriate therapeutic regimens. However, this can only be accomplished by developing high-affinity molecular probes with the ability to recognize specific markers associated with different tumors. Aptamers can most easily meet this challenge based on their target diversity, flexible manipulation and ease of development. METHODOLOGY AND RESULTS: Using a method known as cell-based Systematic Evolution of Ligands by Exponential enrichment (cell-SELEX and colorectal cancer cultured cell lines DLD-1 and HCT 116, we selected a panel of target-specific aptamers. Binding studies by flow cytometry and confocal microscopy showed that these aptamers have high affinity and selectivity. Our data further show that these aptamers neither recognize normal colon cells (cultured and fresh, nor do they recognize most other cancer cell lines tested. CONCLUSION/SIGNIFICANCE: The selected aptamers can identify specific biomarkers associated with colorectal cancers. We believe that these probes could be further developed for early disease detection, as well as prognostic markers, of colorectal cancers.

  17. Engineered Aptamers to Probe Molecular Interactions on the Cell Surface.

    Science.gov (United States)

    Batool, Sana; Bhandari, Sanam; George, Shanell; Okeoma, Precious; Van, Nabeela; Zümrüt, Hazan E; Mallikaratchy, Prabodhika

    2017-08-29

    Significant progress has been made in understanding the nature of molecular interactions on the cell membrane. To decipher such interactions, molecular scaffolds can be engineered as a tool to modulate these events as they occur on the cell membrane. To guarantee reliability, scaffolds that function as modulators of cell membrane events must be coupled to a targeting moiety with superior chemical versatility. In this regard, nucleic acid aptamers are a suitable class of targeting moieties. Aptamers are inherently chemical in nature, allowing extensive site-specific chemical modification to engineer sensing molecules. Aptamers can be easily selected using a simple laboratory-based in vitro evolution method enabling the design and development of aptamer-based functional molecular scaffolds against wide range of cell surface molecules. This article reviews the application of aptamers as monitors and modulators of molecular interactions on the mammalian cell surface with the aim of increasing our understanding of cell-surface receptor response to external stimuli. The information gained from these types of studies could eventually prove useful in engineering improved medical diagnostics and therapeutics.

  18. Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics

    Science.gov (United States)

    2012-01-01

    Small organic molecules are challenging targets for an aptamer selection using the SELEX technology (SELEX—Systematic Evolution of Ligans by EXponential enrichment). Often they are not suitable for immobilization on solid surfaces, which is a common procedure in known aptamer selection methods. The Capture-SELEX procedure allows the selection of DNA aptamers for solute targets. A special SELEX library was constructed with the aim to immobilize this library on magnetic beads or other surfaces. For this purpose a docking sequence was incorporated into the random region of the library enabling hybridization to a complementary oligo fixed on magnetic beads. Oligonucleotides of the library which exhibit high affinity to the target and a secondary structure fitting to the target are released from the beads for binding to the target during the aptamer selection process. The oligonucleotides of these binding complexes were amplified, purified, and immobilized via the docking sequence to the magnetic beads as the starting point of the following selection round. Based on this Capture-SELEX procedure, the successful DNA aptamer selection for the aminoglycoside antibiotic kanamycin A as a small molecule target is described. PMID:23326761

  19. Aptamers: An in vitro Evolution of Therapeutic and Diagnostic Applications in Medicine

    Directory of Open Access Journals (Sweden)

    Basak KAYHAN

    2013-06-01

    Full Text Available Aptamers are nucleic acid oligomers with distinct conformational shapes that allow binding targets with high affinity and specificity. Selective Evolution of Ligands by Exponential Enrichment (SELEX; an in vitro selection process to develop aptamers, has been invented in 1990. Despite more than 20 years have passed after its discovery, products of SELEX technology are in use in medicine. In this review we discuss why we need aptamers not only in therapeutic but also in diagnostic applications; and also critical points in SELEX technology. Finally; we present the aptamers in use and some patented aptamers awaiting approval. [Dis Mol Med 2013; 1(3.000: 54-60

  20. Aptamer-Based Therapeutics: New Approaches to Combat Human Viral Diseases

    Directory of Open Access Journals (Sweden)

    Ka-To Shum

    2013-11-01

    Full Text Available Viruses replicate inside the cells of an organism and continuously evolve to contend with an ever-changing environment. Many life-threatening diseases, such as AIDS, SARS, hepatitis and some cancers, are caused by viruses. Because viruses have small genome sizes and high mutability, there is currently a lack of and an urgent need for effective treatment for many viral pathogens. One approach that has recently received much attention is aptamer-based therapeutics. Aptamer technology has high target specificity and versatility, i.e., any viral proteins could potentially be targeted. Consequently, new aptamer-based therapeutics have the potential to lead a revolution in the development of anti-infective drugs. Additionally, aptamers can potentially bind any targets and any pathogen that is theoretically amenable to rapid targeting, making aptamers invaluable tools for treating a wide range of diseases. This review will provide a broad, comprehensive overview of viral therapies that use aptamers. The aptamer selection process will be described, followed by an explanation of the potential for treating virus infection by aptamers. Recent progress and prospective use of aptamers against a large variety of human viruses, such as HIV-1, HCV, HBV, SCoV, Rabies virus, HPV, HSV and influenza virus, with particular focus on clinical development of aptamers will also be described. Finally, we will discuss the challenges of advancing antiviral aptamer therapeutics and prospects for future success.

  1. Aptamer-based therapeutics: new approaches to combat human viral diseases.

    Science.gov (United States)

    Shum, Ka-To; Zhou, Jiehua; Rossi, John J

    2013-11-25

    Viruses replicate inside the cells of an organism and continuously evolve to contend with an ever-changing environment. Many life-threatening diseases, such as AIDS, SARS, hepatitis and some cancers, are caused by viruses. Because viruses have small genome sizes and high mutability, there is currently a lack of and an urgent need for effective treatment for many viral pathogens. One approach that has recently received much attention is aptamer-based therapeutics. Aptamer technology has high target specificity and versatility, i.e., any viral proteins could potentially be targeted. Consequently, new aptamer-based therapeutics have the potential to lead a revolution in the development of anti-infective drugs. Additionally, aptamers can potentially bind any targets and any pathogen that is theoretically amenable to rapid targeting, making aptamers invaluable tools for treating a wide range of diseases. This review will provide a broad, comprehensive overview of viral therapies that use aptamers. The aptamer selection process will be described, followed by an explanation of the potential for treating virus infection by aptamers. Recent progress and prospective use of aptamers against a large variety of human viruses, such as HIV-1, HCV, HBV, SCoV, Rabies virus, HPV, HSV and influenza virus, with particular focus on clinical development of aptamers will also be described. Finally, we will discuss the challenges of advancing antiviral aptamer therapeutics and prospects for future success.

  2. A colorimetric detection method of pesticide acetamiprid by fine-tuning aptamer length.

    Science.gov (United States)

    Tian, Yu; Wang, Yuan; Sheng, Zhi; Li, Tingting; Li, Xu

    2016-11-15

    This work investigates the effect of shortening aptamer sequences on the colorimetric detection of acetamiprid using aptamer-wrapped gold nanoparticles (AuNPs). Truncated 37-mer and 25-mer aptamers were generated by deleting excess flanking nucleotides from parental 49-mer acetamiprid-target aptamer. In comparing the responses of the three sequences, truncated aptamers did not improve the ability to discriminate against other tested pesticides. However, comparison between 49-mer and other shorter aptamers showed that shortening aptamer sequences through removing excess flanking nucleotides outsides of binding region improved colorimetric sensitivity for acetamiprid by 3.3 fold. Due to excess bases, the target-bound aptamer might still adhere to AuNPs, resulting in incomplete dissociation of aptamer from AuNPs and therefore the suppression of aggregation responses. This work provides further insight to the effects of aptamer structure on detection of the target, as well as a method by fine-tuning aptamer length for rapid detection of pesticide residues in environments or food.

  3. A minimalist biosensor: Quantitation of cyclic di-GMP using the conformational change of a riboswitch aptamer.

    Science.gov (United States)

    Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C

    2015-01-01

    Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.

  4. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems

    Directory of Open Access Journals (Sweden)

    Feng Jiang

    2015-10-01

    Full Text Available Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX, are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems.

  5. Development of an aptamer-based affinity purification method for vascular endothelial growth factor

    Directory of Open Access Journals (Sweden)

    Maren Lönne

    2015-12-01

    Full Text Available Since aptamers bind their targets with high affinity and specificity, they are promising alternative ligands in protein affinity purification. As aptamers are chemically synthesized oligonucleotides, they can be easily produced in large quantities regarding GMP conditions allowing their application in protein production for therapeutic purposes. Several advantages of aptamers compared to antibodies are described in general within this paper. Here, an aptamer directed against the human Vascular Endothelial Growth Factor (VEGF was used as affinity ligand for establishing a purification platform for VEGF in small scale. The aptamer was covalently immobilized on magnetic beads in a controlled orientation resulting in a functional active affinity matrix. Target binding was optimized by introduction of spacer molecules and variation of aptamer density. Further, salt-induced target elution was demonstrated as well as VEGF purification from a complex protein mixture proving the specificity of protein-aptamer binding.

  6. Progress and Challenges in Developing Aptamer-Functionalized Targeted Drug Delivery Systems.

    Science.gov (United States)

    Jiang, Feng; Liu, Biao; Lu, Jun; Li, Fangfei; Li, Defang; Liang, Chao; Dang, Lei; Liu, Jin; He, Bing; Badshah, Shaikh Atik; Lu, Cheng; He, Xiaojuan; Guo, Baosheng; Zhang, Xiao-Bing; Tan, Weihong; Lu, Aiping; Zhang, Ge

    2015-01-01

    Aptamers, which can be screened via systematic evolution of ligands by exponential enrichment (SELEX), are superior ligands for molecular recognition due to their high selectivity and affinity. The interest in the use of aptamers as ligands for targeted drug delivery has been increasing due to their unique advantages. Based on their different compositions and preparation methods, aptamer-functionalized targeted drug delivery systems can be divided into two main categories: aptamer-small molecule conjugated systems and aptamer-nanomaterial conjugated systems. In this review, we not only summarize recent progress in aptamer selection and the application of aptamers in these targeted drug delivery systems but also discuss the advantages, challenges and new perspectives associated with these delivery systems.

  7. Affinity hydrogels for controlled protein release using nucleic acid aptamers and complementary oligonucleotides.

    Science.gov (United States)

    Soontornworajit, Boonchoy; Zhou, Jing; Snipes, Matthew P; Battig, Mark R; Wang, Yong

    2011-10-01

    Biomaterials for the precise control of protein release are important to the development of new strategies for treating human diseases. This study aimed to fundamentally understand aptamer--protein dissociation triggered by complementary oligonucleotides, and to apply this understanding to develop affinity hydrogels for controlled protein release. The results showed that the oligonucleotide tails of the aptamers played a critical role in inducing intermolecular hybridization and triggering aptamer--protein dissociation. In addition, the attachment of the oligonucleotide tails to the aptamers and the increase of hybridizing length could produce a synergistic effect on the dissociation of bound proteins from their aptamers. More importantly, pegylated complementary oligonucleotides could successfully trigger protein release from the aptamer-functionalized hydrogels at multiple time points. Based on these results, it is believed that aptamer-functionalized hydrogels and complementary oligonucleotides hold great potential of controlling the release of protein drugs to treat human diseases.

  8. Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer

    Directory of Open Access Journals (Sweden)

    Marlies Gijs

    2016-05-01

    Full Text Available Aptamers provide a potential source of alternative targeting molecules for existing antibody diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2 receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples. Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers with great potential for the diagnosis and possible treatment of HER2-positive cancer.

  9. Massively Parallel Interrogation of Aptamer Sequence, Structure and Function

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, N O; Tok, J B; Tarasow, T M

    2008-02-08

    Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. Methodology/Principal Findings. High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and interchip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  10. Selective Targeting to Glioma with Nucleic Acid Aptamers.

    Directory of Open Access Journals (Sweden)

    Shraddha Aptekar

    Full Text Available Malignant glioma is characterised by a rapid growth rate and high capacity for invasive infiltration to surrounding brain tissue; hence, diagnosis and treatment is difficult and patient survival is poor. Aptamers contribute a promising and unique technology for the in vitro imaging of live cells and tissues, with a potentially bright future in clinical diagnostics and therapeutics for malignant glioma. The binding selectivity, uptake capacity and binding target of two DNA aptamers, SA43 and SA44, were investigated in glioma cells and patient tissues. The binding assay showed that SA43 and SA44 bound with strong affinity (Kd, 21.56 ± 4.60 nM and Kd, 21.11 ± 3.30 nM respectively to the target U87MG cells. Quantitative analysis by flow cytometry showed that the aptamers were able to actively internalise in U87MG and 1321N1 glioma cells compared to the non-cancerous and non-glioma cell types. Confocal microscopy confirmed staining in the cytoplasm, and co-localisation studies with endoplasmic reticulum, Golgi apparatus and lysosomal markers suggested internalisation and compartmentalisation within the endomembrane system. Both aptamers selectively bound to Ku 70 and Ku 80 DNA repair proteins as determined by aptoprecipitation (AP followed by mass spectrometry analysis and confirmation by Western blot. In addition, aptohistochemical (AHC staining on paraffin embedded, formalin fixed patient tissues revealed that the binding selectivity was significantly higher for SA43 aptamer in glioma tissues (grade I, II, III and IV compared to the non-cancerous tissues, whereas SA44 did not show selectivity towards glioma tissues. The results indicate that SA43 aptamer can differentiate between glioma and non-cancerous cells and tissues and therefore, shows promise for histological diagnosis of glioma.

  11. Massively parallel interrogation of aptamer sequence, structure and function.

    Directory of Open Access Journals (Sweden)

    Nicholas O Fischer

    Full Text Available BACKGROUND: Optimization of high affinity reagents is a significant bottleneck in medicine and the life sciences. The ability to synthetically create thousands of permutations of a lead high-affinity reagent and survey the properties of individual permutations in parallel could potentially relieve this bottleneck. Aptamers are single stranded oligonucleotides affinity reagents isolated by in vitro selection processes and as a class have been shown to bind a wide variety of target molecules. METHODOLOGY/PRINCIPAL FINDINGS: High density DNA microarray technology was used to synthesize, in situ, arrays of approximately 3,900 aptamer sequence permutations in triplicate. These sequences were interrogated on-chip for their ability to bind the fluorescently-labeled cognate target, immunoglobulin E, resulting in the parallel execution of thousands of experiments. Fluorescence intensity at each array feature was well resolved and shown to be a function of the sequence present. The data demonstrated high intra- and inter-chip correlation between the same features as well as among the sequence triplicates within a single array. Consistent with aptamer mediated IgE binding, fluorescence intensity correlated strongly with specific aptamer sequences and the concentration of IgE applied to the array. CONCLUSION AND SIGNIFICANCE: The massively parallel sequence-function analyses provided by this approach confirmed the importance of a consensus sequence found in all 21 of the original IgE aptamer sequences and support a common stem:loop structure as being the secondary structure underlying IgE binding. The microarray application, data and results presented illustrate an efficient, high information content approach to optimizing aptamer function. It also provides a foundation from which to better understand and manipulate this important class of high affinity biomolecules.

  12. Reductions in laminin beta2 mRNA translation are responsible for impaired IGFBP-5-mediated mesangial cell migration in the presence of high glucose.

    Science.gov (United States)

    Schaeffer, Valerie; Hansen, Kim M; Morris, David R; Abrass, Christine K

    2010-02-01

    Insulin-like growth factor binding protein-5 (IGFBP-5) mediates mesangial cell migration through activation of cdc42, and laminin421 binding to alpha(6)beta(1)-integrin (Berfield AK, Hansen KM, Abrass CK. Am J Physiol Cell Physiol 291: C589-C599, 2006). Because glomerular expression of laminin beta(2) is reduced in diabetic rats (Abrass CK, Spicer D, Berfield AK, St. John PL, Abrahamson DR. Am J Pathol 151: 1131-1140, 1997), we directly examined the effect of hyperglycemia on mesangial cell migration and laminin beta2 expression. Migration mediated by IGFBP-5 is impaired in the presence of 25 mM glucose. This reduction in migration was found to result from a loss in mesangial cell synthesis of laminin421, and IGFBP-5-induced migration could be restored by replacing laminin421. Additional studies showed that there was selective reduction in mRNA translation of laminin beta2 in the presence of high glucose. Preserved synthesis of laminin beta1 indicates that not all proteins are reduced by high glucose and confirms prior data showing that laminin411 cannot substitute for laminin421 in IGFBP-5-mediated migration. Given the importance of mesangial migration in the reparative response to diabetes-associated mesangiolysis, these findings provide new insights into abnormalities associated with diabetic nephropathy and the potential importance of differential control of protein translation in determination of alterations of protein expression.

  13. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.

    Science.gov (United States)

    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua

    2016-08-01

    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Salvianolic acid B restored impaired barrier function via downregulation of MLCK by microRNA-1 in rat inflammatory bowel disease

    Directory of Open Access Journals (Sweden)

    Yongjian eXiong

    2016-05-01

    Full Text Available Salvianolic acid B (Sal B is isolated from the traditional Chinese medical herb Salvia miltiorrhiza and is reported to have a wide range of therapeutic benefits. The aim of this study was to investigate the effects of Sal B on epithelial barrier dysfunction in rat inflammatory bowel disease (IBD and to uncover related mechanisms. Rat IBD model was established by intracolonic administration of 2, 4, 6-trinitrobenzene sulfonic acid (TNBS. The intestinal barrier function was evaluated by measuring the serum recovery of fluorescein isothiocyanate-4 kD dextran in vivo and transepithelial electrical resistance in vitro respectively. The protein expression related to intestinal barrier function was studied using western blotting. Besides, the effects of Sal B on inflammatory responses, oxidative damage and IBD recurrence were also studied in this study. The intestinal barrier dysfunction in IBD was reversed by Sal B, accompanied with the decrease of tight junction proteins, and the effect could be blocked by microRNA-1(miR-1 inhibition. The inflammatory responses, oxidative damage and IBD recurrence were also decreased by Sal B. The IBD symptoms and recurrences were ameliorated by Sal B, and restoration of impaired barrier function via dowunregulation of MLCK by miR-1 maybe involved in this effect. This study provides some novel insights into the both of the pathological mechanisms and treatment alternatives of IBD.

  15. Global gene expression analysis of fission yeast mutants impaired in Ser-2 phosphorylation of the RNA pol II carboxy terminal domain.

    Directory of Open Access Journals (Sweden)

    Reza Saberianfar

    Full Text Available In Schizosaccharomyces pombe the nuclear-localized Lsk1p-Lsc1p cyclin dependent kinase complex promotes Ser-2 phosphorylation of the heptad repeats found within the RNA pol II carboxy terminal domain (CTD. Here, we first provide evidence supporting the existence of a third previously uncharacterized Ser-2 CTD kinase subunit, Lsg1p. As expected for a component of the complex, Lsg1p localizes to the nucleus, promotes Ser-2 phosphorylation of the CTD, and physically interacts with both Lsk1p and Lsc1p in vivo. Interestingly, we also demonstrate that lsg1Δ mutants--just like lsk1Δ and lsc1Δ strains--are compromised in their ability to faithfully and reliably complete cytokinesis. Next, to address whether kinase mediated alterations in CTD phosphorylation might selectively alter the expression of genes with roles in cytokinesis and/or the cytoskeleton, global gene expression profiles were analyzed. Mutants impaired in Ser-2 phosphorylation display little change with respect to the level of transcription of most genes. However, genes affecting cytokinesis--including the actin interacting protein gene, aip1--as well as genes with roles in meiosis, are included in a small subset that are differentially regulated. Significantly, genetic analysis of lsk1Δ aip1Δ double mutants is consistent with Lsk1p and Aip1p acting in a linear pathway with respect to the regulation of cytokinesis.

  16. Aptamer conjugated magnetic nanoparticles as nanosurgeons

    Science.gov (United States)

    Nair, Baiju G.; Nagaoka, Yutaka; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Sakthi Kumar, D.

    2010-11-01

    Magnetic nanoparticles have shown promise in the fields of targeted drug delivery, hyperthermia and magnetic resonance imaging (MRI) in cancer therapy. The ability of magnetic nanoparticles to undergo surface modification and the effect of external magnetic field in the dynamics of their movement make them an excellent nanoplatform for cancer destruction. Surgical removal of cancerous or unwanted cells selectively from the interior of an organ or tissue without any collateral damage is a serious problem due to the highly infiltrative nature of cancer. To address this problem in surgery, we have developed a nanosurgeon for the selective removal of target cells using aptamer conjugated magnetic nanoparticles controlled by an externally applied three-dimensional rotational magnetic field. With the help of the nanosurgeon, we were able to perform surgical actions on target cells in in vitro studies. LDH and intracellular calcium release assay confirmed the death of cancer cells due to the action of the nanosurgeon which in turn nullifies the possibility of proliferation by the removed cells. The nanosurgeon will be a useful tool in the medical field for selective surgery and cell manipulation studies. Additionally, this system could be upgraded for the selective removal of complex cancers from diverse tissues by incorporating various target specific ligands on magnetic nanoparticles.

  17. Bioactivity of 2′-deoxyinosine-incorporated aptamer AS1411

    OpenAIRE

    Xinmeng Fan; Lidan Sun; Yun Wu; Lihe Zhang; Zhenjun Yang

    2016-01-01

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2′-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2′-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2′-deoxyinosine at positions 12 and 24 (FAN-1224dI),...

  18. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    Science.gov (United States)

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  19. Periostin-Binding DNA Aptamer Treatment Ameliorates Peritoneal Dialysis-Induced Peritoneal Fibrosis

    Directory of Open Access Journals (Sweden)

    Bo Young Nam

    2017-06-01

    Full Text Available Peritoneal fibrosis is a major complication in peritoneal dialysis (PD patients, which leads to dialysis discontinuation. Periostin, increased by transforming growth factor β1 (TGF-β1 stimulation, induces the expression of extracellular matrix (ECM genes. Aberrant periostin expression has been demonstrated to be associated with PD-related peritoneal fibrosis. Therefore, the effect of periostin inhibition by an aptamer-based inhibitor on peritoneal fibrosis was evaluated. In vitro, TGF-β1 treatment upregulated periostin, fibronectin, α-smooth muscle actin (α-SMA, and Snail expression and reduced E-cadherin expression in human peritoneal mesothelial cells (HPMCs. Periostin small interfering RNA (siRNA treatment ameliorated the TGF-β1-induced periostin, fibronectin, α-SMA, and Snail expression and restored E-cadherin expression in HPMCs. Similarly, the periostin-binding DNA aptamer (PA also attenuated fibronectin, α-SMA, and Snail upregulation and E-cadherin downregulation in TGF-β1-stimulated HPMCs. In mice treated with PD solution for 4 weeks, the expression of periostin, fibronectin, α-SMA, and Snail was significantly increased in the peritoneum, whereas E-cadherin expression was significantly decreased. The thickness of the submesothelial layer and the intensity of Masson’s trichrome staining in the PD group were significantly increased compared to the untreated group. These changes were significantly abrogated by the intraperitoneal administration of PA. These findings suggest that PA can be a potential therapeutic strategy for peritoneal fibrosis in PD patients.

  20. Aptamer-Based Sensing Technology Towards Food Safety Analysis%面向食品安全分析的核酸适配体传感技术

    Institute of Scientific and Technical Information of China (English)

    梁淼; 刘锐; 苏荣欣; 齐崴; 王利兵; 何志敏

    2012-01-01

    Intense works have been undertaken towards development of analytical methods for the detection of risk factors in the food samples. Nucleic-acid aptamers, obtained through in vitro selection and amplification, are artificial single-stranded DNA or RNA sequences that could bind to a wide range of targets with extremely high specificity and stability. These advantages have motivated aptamers to find broad applications towards food safety analysis. In recent years, the combination of aptamers with novel nanomaterials has significantly improved the performance of aptamer-based analytical techniques. In this review, we summarize the recent development of aptamer-based sensors and detection methods, including optical, electrochemical and surface plasmon resonance methods, and highlight their potential application in food safety analysis. Also, the future perspectives of aptamer- based analytical techniques are concluded.%食品中危害因子的检测一直是国内外食品安全领域致力解决的重要问题。核酸适配体是一类通过体外筛选技术得到的单链DNA或RNA,具有特异性强、稳定性好和靶分子广等特点,因而被广泛用于食品安全检测领域。近年来,随着纳米传感技术的快速发展,互补结合适配体和纳米材料的特殊性质,可实现对靶标物质的超灵敏、高选择性及快速检测。本文总结了近年来筛选的食品危害因子适配体,综述了面向食品安全检测的基于适配体传感和纳米材料修饰的分析检测技术的进展,主要包括比色法、荧光法、电化学法以及表面等离子体共振技术,并探讨了适配体传感检测所存在的问题和未来的发展趋势。

  1. Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

    Science.gov (United States)

    Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

    2013-04-16

    In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA

  2. Immobilized aptamer paper spray ionization source for ion mobility spectrometry.

    Science.gov (United States)

    Zargar, Tahereh; Khayamian, Taghi; Jafari, Mohammad T

    2017-01-05

    A selective thin-film microextraction based on aptamer immobilized on cellulose paper was used as a paper spray ionization source for ion mobility spectrometry (PSI-IMS), for the first time. In this method, the paper is not only used as an ionization source but also it is utilized for the selective extraction of analyte, based on immobilized aptamer. This combination integrates both sample preparation and analyte ionization in a Whatman paper. To that end, an appropriate sample introduction system with a novel design was constructed for the paper spray ionization source. Using this system, a continuous solvent flow works as an elution and spray solvent simultaneously. In this method, analyte is adsorbed on a triangular paper with immobilized aptamer and then it is desorbed and ionized by elution solvent and applied high voltage on paper, respectively. The effects of different experimental parameters such as applied voltage, angle of paper tip, distance between paper tip and counter electrode, elution solvent type, and solvent flow rate were optimized. The proposed method was exhaustively validated in terms of sensitivity and reproducibility by analyzing the standard solutions of codeine and acetamiprid. The analytical results obtained are promising enough to ensure the use of immobilized aptamer paper-spray as both the extraction and ionization techniques in IMS for direct analysis of biomedicine. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Single-Round Patterned DNA Library Microarray Aptamer Lead Identification

    Directory of Open Access Journals (Sweden)

    Jennifer A. Martin

    2015-01-01

    Full Text Available A method for identifying an aptamer in a single round was developed using custom DNA microarrays containing computationally derived patterned libraries incorporating no information on the sequences of previously reported thrombin binding aptamers. The DNA library was specifically designed to increase the probability of binding by enhancing structural complexity in a sequence-space confined environment, much like generating lead compounds in a combinatorial drug screening library. The sequence demonstrating the highest fluorescence intensity upon target addition was confirmed to bind the target molecule thrombin with specificity by surface plasmon resonance, and a novel imino proton NMR/2D NOESY combination was used to screen the structure for G-quartet formation. We propose that the lack of G-quartet structure in microarray-derived aptamers may highlight differences in binding mechanisms between surface-immobilized and solution based strategies. This proof-of-principle study highlights the use of a computational driven methodology to create a DNA library rather than a SELEX based approach. This work is beneficial to the biosensor field where aptamers selected by solution based evolution have proven challenging to retain binding function when immobilized on a surface.

  4. Aptamer-based Field-Effect Biosensor for Tenofovir Detection

    Science.gov (United States)

    Aliakbarinodehi, N.; Jolly, P.; Bhalla, N.; Miodek, A.; De Micheli, G.; Estrela, P.; Carrara, S.

    2017-01-01

    During medical treatment it is critical to maintain the circulatory concentration of drugs within their therapeutic range. A novel biosensor is presented in this work to address the lack of a reliable point-of-care drug monitoring system in the market. The biosensor incorporates high selectivity and sensitivity by integrating aptamers as the recognition element and field-effect transistors as the signal transducer. The drug tenofovir was used as a model small molecule. The biointerface of the sensor is a binary self-assembled monolayer of specific thiolated aptamer and 6-mercapto-1-hexanol (MCH), whose ratio was optimized by electrochemical impedance spectroscopy measurements to enhance the sensitivity towards the specific target. Surface plasmon resonance, performed under different buffer conditions, shows optimum specific and little non-specific binding in phosphate buffered saline. The dose-response behavior of the field-effect biosensor presents a linear range between 1 nM and 100 nM of tenofovir and a limit of detection of 1.2 nM. Two non-specific drugs and one non-specific aptamer, tested as stringent control candidates, caused negligible responses. The applications were successfully extended to the detection of the drug in human serum. As demonstrated by impedance measurements, the aptamer-based sensors can be used for real-time drug monitoring. PMID:28294122

  5. Long Shelf Life of a Lyophilized DNA Aptamer Beacon Assay.

    Science.gov (United States)

    Bruno, John G

    2017-03-01

    An aptamer beacon previously developed to detect C-telopeptide (CTx) from human bone collagen breakdown was lyophilized and shown to give a "lights on" concentration-dependent spectral fluorescence response essentially identical to that of the fresh reagent despite storage in a dark dry environment for the past 5.5 years.

  6. Aptamer conjugated silver nanoparticles for the detection of interleukin 6

    Science.gov (United States)

    Locke, Andrea K.; Norwood, Nicole; Marks, Haley L.; Schechinger, Monika; Jackson, George W.; Graham, Duncan; Coté, Gerard L.

    2016-03-01

    The controlled assembly of plasmonic nanoparticles by a molecular binding event has emerged as a simple yet sensitive methodology for protein detection. Metallic nanoparticles (NPs) coated with functionalized aptamers can be utilized as biosensors by monitoring changes in particle optical properties, such as the LSPR shift and enhancement of the SERS spectra, in the presence of a target protein. Herein we test this method using two modified aptamers selected for the protein biomarker interleukin 6, an indicator of the dengue fever virus and other diseases including certain types of cancers, diabetes, and even arthritis. IL6 works by inducing an immunological response within the body that can be either anti-inflammatory or pro-inflammatory. The results show that the average hydrodynamic diameter of the NPs as measured by Dynamic Light Scattering was ~42 nm. After conjugation of the aptamers, the peak absorbance of the AgNPs shifted from 404 to 408 nm indicating a surface modification of the NPs due to the presence of the aptamer. Lastly, preliminary results were obtained showing an increase in SERS intensity occurs when the IL-6 protein was introduced to the conjugate solution but the assay will still need to be optimized in order for it to be able to monitor varying concentration changes within and across the desired range.

  7. Targeting Tumor Cell Invasion and Dissemination In Vivo by an Aptamer That Inhibits Urokinase-type Plasminogen Activator through a Novel Multifunctional Mechanism

    DEFF Research Database (Denmark)

    Botkjaer, Kenneth A; Deryugina, Elena I; Dupont, Daniel M

    2012-01-01

    , because the topology of the proteases' active sites are highly similar. In an effort to generate highly specific uPA inhibitors with new inhibitory modalities, we isolated uPA-binding RNA aptamers by screening a library of 35 nucleotides long 2'-fluoro-pyrimidine RNA molecules using a version of human pro...... in the chick embryo assay of cell escape from microtumors. Finally, upanap-126 significantly reduced the levels of tumor cell intravasation and dissemination in the chick embryo model of spontaneous metastasis. Together, our findings show that usage of upanap-126 represents a novel multifunctional mechanistic...

  8. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes.

    Science.gov (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon

    2015-06-15

    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Aptamer-based multiplexed proteomic technology for biomarker discovery.

    Directory of Open Access Journals (Sweden)

    Larry Gold

    Full Text Available BACKGROUND: The interrogation of proteomes ("proteomics" in a highly multiplexed and efficient manner remains a coveted and challenging goal in biology and medicine. METHODOLOGY/PRINCIPAL FINDINGS: We present a new aptamer-based proteomic technology for biomarker discovery capable of simultaneously measuring thousands of proteins from small sample volumes (15 µL of serum or plasma. Our current assay measures 813 proteins with low limits of detection (1 pM median, 7 logs of overall dynamic range (~100 fM-1 µM, and 5% median coefficient of variation. This technology is enabled by a new generation of aptamers that contain chemically modified nucleotides, which greatly expand the physicochemical diversity of the large randomized nucleic acid libraries from which the aptamers are selected. Proteins in complex matrices such as plasma are measured with a process that transforms a signature of protein concentrations into a corresponding signature of DNA aptamer concentrations, which is quantified on a DNA microarray. Our assay takes advantage of the dual nature of aptamers as both folded protein-binding entities with defined shapes and unique nucleotide sequences recognizable by specific hybridization probes. To demonstrate the utility of our proteomics biomarker discovery technology, we applied it to a clinical study of chronic kidney disease (CKD. We identified two well known CKD biomarkers as well as an additional 58 potential CKD biomarkers. These results demonstrate the potential utility of our technology to rapidly discover unique protein signatures characteristic of various disease states. CONCLUSIONS/SIGNIFICANCE: We describe a versatile and powerful tool that allows large-scale comparison of proteome profiles among discrete populations. This unbiased and highly multiplexed search engine will enable the discovery of novel biomarkers in a manner that is unencumbered by our incomplete knowledge of biology, thereby helping to advance the next

  10. Novel protein detection method based on proximity-dependent polymerase reaction and aptamers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    In recent years, specific detection of proteins is one of the hot issues about aptamers in proteomics.Here we reported a simple, sensitive and specific proximity-dependent protein assay with dual DNA aptamers. Thrombin was used as the model protein, and two aptamer probes with complementary sequence at 3'-end were designed for the two distinct epitopes of the protein. Association of the two aptamers with thrombin resulted in stable hybrids due to the proximity of 3'-end, then polymerase reaction was induced. The amount of obtained dsDNA was indicated using the fluorescence dye Sybr Green 1. The results showed that the initial velocity of polymerase reaction had a positive correlation with concentration of thrombin. The advantages of this dual-aptamer-based approach included simple and flexible design of aptamer probes, high selectivity and high sensitivity. The detection limit was 6.9pmol/L.

  11. Modeling the microscopic electrical properties of thrombin binding aptamer (TBA) for label-free biosensors

    Science.gov (United States)

    Alfinito, Eleonora; Reggiani, Lino; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele

    2017-02-01

    Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors (aptasensors), with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer aptamer (TBA), has been widely explored around the possibility of using it in aptasensors. This paper proposes a microscopic model of the electrical properties of TBA and of the aptamer-thrombin complex, combining information from both structure and function, following the issues addressed in an emerging branch of electronics known as proteotronics. The theoretical results are compared and validated with measurements reported in the literature. Finally, the model suggests resistance measurements as a novel tool for testing aptamer-target affinity.

  12. Comparison of In-Solution Biorecognition Properties of Aptamers against Ochratoxin A

    Science.gov (United States)

    McKeague, Maureen; Velu, Ranganathan; De Girolamo, Annalisa; Valenzano, Stefania; Pascale, Michelangelo; Smith, McKenzie; DeRosa, Maria C.

    2016-01-01

    Ochratoxin A (OTA) is a mycotoxin produced as a secondary metabolite by several species of Aspergillus and Penicillium and frequently found as a natural contaminant in a wide range of food commodities. Novel and robust biorecognition agents for detecting this molecule are required. Aptamers are artificial nucleic acid ligands able to bind with high affinity and specificity to a given target molecule. In the last few years, three separate research groups have selected aptamers for ochratoxin A. While each of these three families of aptamers have been incorporated into various methods for detecting OTA, it is unclear if each aptamer candidate is better suited for a particular application. Here, we perform the first head-to-head comparison of solution-based binding parameters for these groups of aptamers. Based on our results, we provide recommendations for the appropriate choice of aptamer for incorporation into solution-based biorecognition assays and applications. PMID:27854269

  13. Comparison of the 'chemical' and 'structural' approaches to the optimization of the thrombin-binding aptamer.

    Directory of Open Access Journals (Sweden)

    Olga Tatarinova

    Full Text Available Noncanonically structured DNA aptamers to thrombin were examined. Two different approaches were used to improve stability, binding affinity and biological activity of a known thrombin-binding aptamer. These approaches are chemical modification and the addition of a duplex module to the aptamer core structure. Several chemically modified aptamers and the duplex-bearing ones were all studied under the same conditions by a set of widely known and some relatively new methods. A number of the thrombin-binding aptamer analogs have demonstrated improved characteristics. Most importantly, the study allowed us to compare directly the two approaches to aptamer optimization and to analyze their relative advantages and disadvantages as well as their potential in drug design and fundamental studies.

  14. Modeling the microscopic electrical properties of thrombin binding aptamer (TBA) for label-free biosensors

    CERN Document Server

    Alfinito, Eleonora; Cataldo, Rosella; De Nunzio, Giorgio; Giotta, Livia; Guascito, Maria Rachele

    2016-01-01

    Aptamers are chemically produced oligonucleotides, able to bind a variety of targets such as drugs, proteins and pathogens with high sensitivity and selectivity. Therefore, aptamers are largely employed for producing label-free biosensors, with significant applications in diagnostics and drug delivery. In particular, the anti-thrombin aptamers are biomolecules of high interest for clinical use, because of their ability to recognize and bind the thrombin enzyme. Among them, the DNA 15-mer thrombin-binding aptamer (TBA), has been widely explored concerning both its structure, which was resolved with different techniques, and its function, especially about the possibility of using it as the active part of biosensors. This paper proposes a microscopic model of the electrical properties of TBA and the aptamer-thrombin complex, combining information from both structure and function. The novelty consists in describing both the aptamer alone and the complex as an impedance network, thus going deeper inside the issues...

  15. Mechanism of regulation of bcl-2 mRNA by nucleolin and A+U-rich element-binding factor 1 (AUF1).

    Science.gov (United States)

    Ishimaru, Daniella; Zuraw, Lisa; Ramalingam, Sivakumar; Sengupta, Tapas K; Bandyopadhyay, Sumita; Reuben, Adrian; Fernandes, Daniel J; Spicer, Eleanor K

    2010-08-27

    The antiapoptotic Bcl-2 protein is overexpressed in a variety of cancers, particularly leukemias. In some cell types this is the result of enhanced stability of bcl-2 mRNA, which is controlled by elements in its 3'-untranslated region. Nucleolin is one of the proteins that binds to bcl-2 mRNA, thereby increasing its half-life. Here, we examined the site on the bcl-2 3'-untranslated region that is bound by nucleolin as well as the protein binding domains important for bcl-2 mRNA recognition. RNase footprinting and RNA fragment binding assays demonstrated that nucleolin binds to a 40-nucleotide region at the 5' end of the 136-nucleotide bcl-2 AU-rich element (ARE(bcl-2)). The first two RNA binding domains of nucleolin were sufficient for high affinity binding to ARE(bcl-2). In RNA decay assays, ARE(bcl-2) transcripts were protected from exosomal decay by the addition of nucleolin. AUF1 has been shown to recruit the exosome to mRNAs. When MV-4-11 cell extracts were immunodepleted of AUF1, the rate of decay of ARE(bcl-2) transcripts was reduced, indicating that nucleolin and AUF1 have opposing roles in bcl-2 mRNA turnover. When the function of nucleolin in MV-4-11 cells was impaired by treatment with the nucleolin-targeting aptamer AS1411, association of AUF1 with bcl-2 mRNA was increased. This suggests that the degradation of bcl-2 mRNA induced by AS1411 results from both interference with nucleolin protection of bcl-2 mRNA and recruitment of the exosome by AUF1. Based on our findings, we propose a model that illustrates the opposing roles of nucleolin and AUF1 in regulating bcl-2 mRNA stability.

  16. In vitro Selection and Interaction Studies of a DNA Aptamer Targeting Protein A.

    Directory of Open Access Journals (Sweden)

    Regina Stoltenburg

    Full Text Available A new DNA aptamer targeting Protein A is presented. The aptamer was selected by use of the FluMag-SELEX procedure. The SELEX technology (Systematic Evolution of Ligands by EXponential enrichment is widely applied as an in vitro selection and amplification method to generate target-specific aptamers and exists in various modified variants. FluMag-SELEX is one of them and is characterized by the use of magnetic beads for target immobilization and fluorescently labeled oligonucleotides for monitoring the aptamer selection progress. Structural investigations and sequence truncation experiments of the selected aptamer for Protein A led to the conclusion, that a stem-loop structure at its 5'-end including the 5'-primer binding site is essential for aptamer-target binding. Extensive interaction analyses between aptamer and Protein A were performed by methods like surface plasmon resonance, MicroScale Thermophoresis and bead-based binding assays using fluorescence measurements. The binding of the aptamer to its target was thus investigated in assays with immobilization of one of the binding partners each, and with both binding partners in solution. Affinity constants were determined in the low micromolar to submicromolar range, increasing to the nanomolar range under the assumption of avidity. Protein A provides more than one binding site for the aptamer, which may overlap with the known binding sites for immunoglobulins. The aptamer binds specifically to both native and recombinant Protein A, but not to other immunoglobulin-binding proteins like Protein G and L. Cross specificity to other proteins was not found. The application of the aptamer is directed to Protein A detection or affinity purification. Moreover, whole cells of Staphylococcus aureus, presenting Protein A on the cell surface, could also be bound by the aptamer.

  17. Affinity Probe Capillary Electrophoresis Evaluation of Aptamer Binding to Campylobacter jejuni Bacteria

    Science.gov (United States)

    2009-11-01

    Affinity Probe Capillary Electrophoresis Evaluation of Aptamer Binding to Campylobacter jejuni Bacteria by Dimitra N. Stratis-Cullum, Sun...Aptamer Binding to Campylobacter jejuni Bacteria Dimitra N. Stratis-Cullum, Sun McMasters, and Paul M. Pellegrino Sensors and Electron Devices...To) 2007–2008 4. TITLE AND SUBTITLE Affinity Probe Capillary Electrophoresis Evaluation of Aptamer Binding to Campylobacter jejuni Bacteria 5a

  18. Aptamer-gelatin composite for a trigger release system mediated by oligonucleotide hybridization.

    Science.gov (United States)

    Soontornworajit, Boonchoy; Srakaew, Prangkamol; Naramitpanich, Pajaree

    2014-01-01

    Nucleic acid aptamers not only specifically bind to their target proteins with high affinity but also form intermolecular hybridization with their complementary oligonucleotides (CO). The hybridization can interrupt aptamer/protein interaction due to the changes of aptamer secondary structure which rely on hybridization length and base-pairing positions. Herein we aim to use this unique property of the aptamers, when combined with gelatin to develop a novel composite with desirable protein release profiles. Platelet-derived growth factor-BB (PDGF-BB) and its aptamer were used as target molecules. Prior to performing the release study, the effects of CO on aptamer-protein interaction were observed by surface plasmon resonance (SPR). The SPR sensorgram indicated that the aptamer dissociated from the bounded proteins when it hybridized with the CO. The aptamer was then immobilized onto streptavidin coated polystyrene particles via biotin/streptavidin interaction. Then, PDGF-BB and aptamer functionalized particles were mixed with gelatin solution and cast as small pieces of composite. The success of the composite preparation was confirmed by flow cytometry and microscopy. PDGF-BB release at several time points was quantified by ELISA. The results showed that the aptamer-gelatin composite could slow the release rate of the proteins from the composite due to strong binding of proteins and aptamers. Once the CO was added to the system, the release rate was significantly enhanced because the aptamer hybridized with the CO and lost its active secondary structure. Therefore, the proteins were triggered to release out from the composite. This work suggests a promising strategy for controlling the release of bioactive molecules in medical treatments.

  19. Trends in the Design and Development of Specific Aptamers Against Peptides and Proteins.

    Science.gov (United States)

    Tabarzad, Maryam; Jafari, Marzieh

    2016-04-01

    Aptamers are single stranded oligonucleotides, comparable to monoclonal antibodies (mAbs) in selectivity and affinity and have significant strategic properties in design, development and applications more than mAbs. Ease of design and development, simple chemical modification and the attachment of functional groups, easily handling and more adaptability with analytical methods, small size and adaptation with nanostructures are the valuable characteristics of aptamers in comparison to large protein based ligands. Among a broad range of targets that their specific aptamers developed, proteins and peptides have significant position according to the number of related studies performed so far. Since proteins control many of important physiological and pathological incidents in the living organisms, particularly human beings and because of the benefits of aptamers in clinical and analytical applications, aptamer related technologies in the field of proteins and peptides are under progress, exclusively. Currently, there is only one FDA approved therapeutic aptamer in the pharmaceutical market, which is specific to vascular endothelial growth factor and is prescribed for age related macular degenerative disease. Additionally, there are several aptamers in the different phases of clinical trials. Almost all of these aptamers are specific to clinically important peptide or protein targets. In addition, the application of protein specific aptamers in the design and development of targeted drug delivery systems and diagnostic biosensors is another interesting field of aptamer technology. In this review, significant efforts related to development and applications of aptamer technologies in proteins and peptides sciences were considered to emphasis on the importance of aptamers in medicinal and clinical applications.

  20. Development of a Quartz Crystal Microbalance Biosensor with Aptamers as Bio-recognition Element

    Directory of Open Access Journals (Sweden)

    Chunyan Yao

    2010-06-01

    Full Text Available The ultimate goal in any biosensor development project is its use for actual sample detection. Recently, there has been an interest in biosensors with aptamers as bio-recognition elements, but reported examples all deal with standards, not human serum. In order to verify the differences of aptamer-based biosensor and antibody-based biosensor in clinical detection, a comparison of the performance of aptamer-based and antibody-based quartz crystal microbalance (QCM biosensors for the detection of immunoglobulin E (IgE in human serum was carried out. Aptamers (or antibodies specific to IgE were immobilized on the gold surface of a quartz crystal. The frequency shifts of the QCM were measured. The linear range with the antibody (10–240 μg/L compared to that of the aptamer (2.5–200 μg/L, but a lower detection limit could be observed in the aptamer-based biosensor. The reproducibility of the two biosensors was comparable. The aptamers were equivalent or superior to antibodies in terms of specificity and sensitivity. In addition, the aptamer receptors could tolerate repeated affine layer regeneration after ligand binding and recycling of the biosensor with little loss of sensitivity. When stored for three weeks, the frequency shifts of the aptamer-coated crystals were all greater than 90% of those on the response at the first day.

  1. Robust aptamer sol-gel solid phase microextraction of very polar adenosine from human plasma.

    Science.gov (United States)

    Mu, Li; Hu, Xiangang; Wen, Jianping; Zhou, Qixing

    2013-03-01

    Conventional solid phase microextraction (SPME) has a limited capacity to extract very polar analytes, such as adenosine. To solve this problem, aptamer conjugating sol-gel methodology was coupled with an SPME fiber. According to the authors' knowledge, this is the first reported use of aptamer SPME. The fiber of aptamer sol-gel SPME with a mesoporous structure has high porosity, large surface area, and small water contact angle. Rather than employing direct entrapment, covalent immobilization was the dominant method of aptamer loading in sol-gel. Aptamer sol-gel fiber captured a specified analyte from among the analog molecules, thereby, exhibiting an excellent selective property. Compared with commercial SPME fibers, this aptamer fiber was suitable for extracting adenosine, presenting an extraction efficiency higher than 20-fold. The values of repeatability and reproducibility expressed by relative standard deviation were low (9.4%). Interestingly, the sol-gel network enhanced the resistance of aptamer SPME to both nuclease and nonspecific proteins. Furthermore, the aptamer sol-gel fiber was applied in human plasma with LOQ 1.5 μg/L, which is an acceptable level. This fiber also demonstrates durability and regeneration over 20-cycles without significant loss of efficiency. Given the various targets (from metal ions to biomacromolecules and cells) of aptamers, this methodology will extend the multi-domain applications of SPME.

  2. Selection and Identification of Chloramphenicol-Specific DNA Aptamers by Mag-SELEX.

    Science.gov (United States)

    Duan, Ye; Gao, Zhiqiang; Wang, Lihui; Wang, Huishan; Zhang, Hexiao; Li, Hao

    2016-12-01

    Chloramphenicol (CAP) has been widely used to treat bacterial infections in livestock and aquatic animals. To reduce the risk of CAP residues, an efficient technology to rapidly detect CAP residues in animal-sourced food is expressly needed. In this study, magnetic bead-based systematic evolution of ligands by exponential enrichment (Mag-SELEX) strategy was performed to select and identify CAP-specific single-stranded DNA (ssDNA) aptamers from a random oligonucleotide library. After nine rounds of selection, five potential ssDNA aptamers were selected. Low homology indicated that they might belong to different families. To identify an aptamer with the highest affinity for CAP, the dissociation constant (K d) values of these selected aptamers were determined. The lowest K d values of two potential aptamers (i.e., No. 4 and No. 5) were, respectively, 0.10162 ± 0.0111 and 0.03224 ± 0.00819 μM, which were much lower than previously reported lowest K d value (i.e., 0.766 μM) of CAP aptamer. Moreover, compared with No. 4, aptamer No. 5 had higher binding rate, which is quite different among those with CAP and with CAP's structural analogs (i.e., thiamphenicol (TAP) and florfenicol (FF)). These results indicated that the potential aptamer No. 5 with highest specificity and affinity for CAP would be an ideal aptamer for future detection of residual CAP in animal-sourced food.

  3. Aptamer-Functionalized Fluorescent Silica Nanoparticles for Highly Sensitive Detection of Leukemia Cells

    Science.gov (United States)

    Tan, Juntao; Yang, Nuo; Hu, Zixi; Su, Jing; Zhong, Jianhong; Yang, Yang; Yu, Yating; Zhu, Jianmeng; Xue, Dabin; Huang, Yingying; Lai, Zongqiang; Huang, Yong; Lu, Xiaoling; Zhao, Yongxiang

    2016-06-01

    A simple, highly sensitive method to detect leukemia cells has been developed based on aptamer-modified fluorescent silica nanoparticles (FSNPs). In this strategy, the amine-labeled Sgc8 aptamer was conjugated to carboxyl-modified FSNPs via amide coupling between amino and carboxyl groups. Sensitivity and specificity of Sgc8-FSNPs were assessed using flow cytometry and fluorescence microscopy. These results showed that Sgc8-FSNPs detected leukemia cells with high sensitivity and specificity. Aptamer-modified FSNPs hold promise for sensitive and specific detection of leukemia cells. Changing the aptamer may allow the FSNPs to detect other types of cancer cells.

  4. An aptamer that binds efficiently to the hemagglutinins of highly pathogenic avian influenza viruses (H5N1 and H7N7) and inhibits hemagglutinin-glycan interactions.

    Science.gov (United States)

    Suenaga, Emi; Kumar, Penmetcha K R

    2014-03-01

    Highly pathogenic avian influenza (HPAI) H5 and H7 viruses have ravaged the poultry industry in numerous countries in Asia, Europe, Africa and the Middle East, and have resulted in the deaths of millions of birds. Although HPAI H5N1 viruses currently remain avian viruses, they are continuously evolving and have the potential to become pandemic-type viruses capable of human-human transmission. To develop specific reagents to allow better preparedness against this threat, we selected an aptamer (8-3) from a completely random RNA pool that binds with high affinity (∼ KD 170pM) to the hemagglutinins (HAs) derived from HPAI H5N1 (A/H5N1/Vietnam/1194/2004 and A/H5N1/Indonesia/05/2005) and H7N7 (A/H7N7/Netherlands/219/2003) influenza A viruses. Aptamer 8-3 was able to efficiently distinguish HAs derived from subtypes of influenza A virus other than H5 and H7. Aptamer 8-3 was analyzed further to assess its ability to interfere with HA-glycan interactions using our previously established SPR-based competitive assay, and we found that aptamer 8-3 efficiently interferes with HA-glycan binding (EC50 ∼ 25 nM). To derive shorter variants for other applications, aptamer 8-3 was shortened to a 44-mer by deletion analyses. The shortened aptamer, 8-3S, retains the full-length aptamer's affinity and specificity for its cognate Has, and also interferes with HA-glycan interactions. These studies suggest that aptamer 8-3S should be studied further to explore its potential applications not only in surveillance and diagnosis, but also in the development of H5N1- and H7N7-specific virucidal products that interfere with virus-host interactions to contain future H5N1 and H7N7 pandemics. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  5. Selection of binding targets in parasites using phage-display and aptamer libraries in vivo and in vitro

    Directory of Open Access Journals (Sweden)

    Renata Rosito Tonelli

    2013-01-01

    Full Text Available Parasite infections are largely dependent on interactions between pathogen and different host cell populations to guarantee a successful infectious process. This is particularly true for obligatory intracellular parasites as Plasmodium, Toxoplasma, Leishmania, to name a few. Adhesion to and entry into the cell are essential steps requiring specific parasite and host cell molecules. The large amount of possible involved molecules poses additional difficulties for their identification by the classical biochemical approaches. In this respect, the search for alternative techniques should be pursued. Among them two powerful methodologies can be employed, both relying upon the construction of highly diverse combinatorial libraries of peptides or oligonucleotides that randomly bind with high affinity to targets on the cell surface and are selectively displaced by putative ligands. These are, respectively, the peptide-based phage display and the oligonucleotide-based aptamer techniques.The phage display technique has been extensively employed for the identification of novel ligands in vitro and in vivo in different areas such as cancer, vaccine development and epitope mapping. Particularly, phage display has been employed in the investigation of pathogen-host interactions. Although this methodology has been used for some parasites with encouraging results, in trypanosomatids its use is, as yet, scanty. RNA and DNA aptamers, developed by the SELEX process (Systematic Evolution of Ligands by Exponential Enrichment, were described over two decades ago and since then contributed to a large number of structured nucleic acids for diagnostic or therapeutic purposes or for the understanding of the cell biology. Similarly to the phage display technique scarce use of the SELEX process has been used in the probing of parasite-host interaction.In this review, an overall survey on the use of both phage display and aptamer technologies in different pathogenic

  6. High-resolution structures of two complexes between thrombin and thrombin-binding aptamer shed light on the role of cations in the aptamer inhibitory activity

    Science.gov (United States)

    Russo Krauss, Irene; Merlino, Antonello; Randazzo, Antonio; Novellino, Ettore; Mazzarella, Lelio; Sica, Filomena

    2012-01-01

    The G-quadruplex architecture is a peculiar structure adopted by guanine-rich oligonucleotidic sequences, and, in particular, by several aptamers, including the thrombin-binding aptamer (TBA) that has the highest inhibitory activity against human α-thrombin. A crucial role in determining structure, stability and biological properties of G-quadruplexes is played by ions. In the case of TBA, K+ ions cause an enhancement of the aptamer clotting inhibitory activity. A detailed picture of the interactions of TBA with the protein and with the ions is still lacking, despite the importance of this aptamer in biomedical field for detection and inhibition of α-thrombin. Here, we fill this gap by presenting a high-resolution crystallographic structural characterization of the thrombin–TBA complex formed in the presence of Na+ or K+ and a circular dichroism study of the structural stability of the aptamer both free and complexed with α-thrombin, in the presence of the two ionic species. The results indicate that the different effects exerted by Na+ and K+ on the inhibitory activity of TBA are related to a subtle perturbation of a few key interactions at the protein–aptamer interface. The present data, in combination with those previously obtained on the complex between α-thrombin and a modified aptamer, may allow the design of new TBA variants with a pharmacological performance enhancement. PMID:22669903

  7. Selective Aptamers for Detection of Estradiol and Ethynylestradiol in Natural Waters

    KAUST Repository

    Akki, Spurti U.

    2015-08-18

    © 2015 American Chemical Society. We used in vitro selection to identify new DNA aptamers for two endocrine-disrupting compounds often found in treated and natural waters, 17β-estradiol (E2) and 17α-ethynylestradiol (EE). We used equilibrium filtration to determine aptamer sensitivity/selectivity and dimethyl sulfate (DMS) probing to explore aptamer binding sites. The new E2 aptamers are at least 74-fold more sensitive for E2 than is a previously reported DNA aptamer, with dissociation constants (Kd values) of 0.6 μM. Similarly, the EE aptamers are highly sensitive for EE, with Kd of 0.5-1.0 μM. Selectivity values indicate that the E2 aptamers bind E2 and a structural analogue, estrone (E1), equally well and are up to 74-fold selective over EE. One EE aptamer is 53-fold more selective for EE over E2 or E1, but the other binds EE, E2, and E1 with similar affinity. The new aptamers do not lose sensitivity or selectivity in natural water from a local lake, despite the presence of natural organic matter (∼4 mg/L TOC). DMS probing suggests that E2 binding occurs in relatively flexible single-stranded DNA regions, an important finding for rational redesign of aptamers and their incorporation into sensing platforms. This is the first report of aptamers with strong selectivity for E2 and E1 over EE, or with strong selectivity for EE over E2 and E1. Such selectivity is important for achieving the goal of creating practically useful DNA-based sensors that can distinguish structurally similar estrogenic compounds in natural waters.

  8. Rupture of DNA aptamer: New insights from simulations

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay [Department of Physics, Banaras Hindu University, Varanasi 221 005 (India)

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single molecule experiments.

  9. Using atomic force microscopy and surface plasmon resonance to detect specific interactions between ricin and anti-ricin aptamers

    Science.gov (United States)

    Nucleic acid aptamers have been widely used as binding reagents for the label free detections of biomolecules. Compare to antibodies, aptamers have demonstrated advantages such as easy synthesis, low cost, and better stability. Therefore, aptamers can be integrated into various detection platforms ...

  10. Selection of an aptamer antidote to the anticoagulant drug bivalirudin.

    Science.gov (United States)

    Martin, Jennifer A; Parekh, Parag; Kim, Youngmi; Morey, Timothy E; Sefah, Kwame; Gravenstein, Nikolaus; Dennis, Donn M; Tan, Weihong

    2013-01-01

    Adverse drug reactions, including severe patient bleeding, may occur following the administration of anticoagulant drugs. Bivalirudin is a synthetic anticoagulant drug sometimes employed as a substitute for heparin, a commonly used anticoagulant that can cause a condition called heparin-induced thrombocytopenia (HIT). Although bivalrudin has the advantage of not causing HIT, a major concern is lack of an antidote for this drug. In contrast, medical professionals can quickly reverse the effects of heparin using protamine. This report details the selection of an aptamer to bivalirudin that functions as an antidote in buffer. This was accomplished by immobilizing the drug on a monolithic column to partition binding sequences from nonbinding sequences using a low-pressure chromatography system and salt gradient elution. The elution profile of binding sequences was compared to that of a blank column (no drug), and fractions with a chromatographic difference were analyzed via real-time PCR (polymerase chain reaction) and used for further selection. Sequences were identified by 454 sequencing and demonstrated low micromolar dissociation constants through fluorescence anisotropy after only two rounds of selection. One aptamer, JPB5, displayed a dose-dependent reduction of the clotting time in buffer, with a 20 µM aptamer achieving a nearly complete antidote effect. This work is expected to result in a superior safety profile for bivalirudin, resulting in enhanced patient care.

  11. Selection of an aptamer antidote to the anticoagulant drug bivalirudin.

    Directory of Open Access Journals (Sweden)

    Jennifer A Martin

    Full Text Available Adverse drug reactions, including severe patient bleeding, may occur following the administration of anticoagulant drugs. Bivalirudin is a synthetic anticoagulant drug sometimes employed as a substitute for heparin, a commonly used anticoagulant that can cause a condition called heparin-induced thrombocytopenia (HIT. Although bivalrudin has the advantage of not causing HIT, a major concern is lack of an antidote for this drug. In contrast, medical professionals can quickly reverse the effects of heparin using protamine. This report details the selection of an aptamer to bivalirudin that functions as an antidote in buffer. This was accomplished by immobilizing the drug on a monolithic column to partition binding sequences from nonbinding sequences using a low-pressure chromatography system and salt gradient elution. The elution profile of binding sequences was compared to that of a blank column (no drug, and fractions with a chromatographic difference were analyzed via real-time PCR (polymerase chain reaction and used for further selection. Sequences were identified by 454 sequencing and demonstrated low micromolar dissociation constants through fluorescence anisotropy after only two rounds of selection. One aptamer, JPB5, displayed a dose-dependent reduction of the clotting time in buffer, with a 20 µM aptamer achieving a nearly complete antidote effect. This work is expected to result in a superior safety profile for bivalirudin, resulting in enhanced patient care.

  12. Bioactivity of 2′-deoxyinosine-incorporated aptamer AS1411

    Science.gov (United States)

    Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2016-01-01

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2′-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2′-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2′-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2′-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2′-deoxyinosine moieties in interactive binding processes. PMID:27194215

  13. Bioactivity of 2'-deoxyinosine-incorporated aptamer AS1411.

    Science.gov (United States)

    Fan, Xinmeng; Sun, Lidan; Wu, Yun; Zhang, Lihe; Yang, Zhenjun

    2016-05-19

    Aptamers can be chemically modified to enhance nuclease resistance and increase target affinity. In this study, we performed chemical modification of 2'-deoxyinosine in AS1411, an anti-proliferative G-rich oligodeoxynucleotide aptamer, which binds selectively to the nucleolin protein. Its function was augmented when 2'-deoxyinosine was incorporated at positions 12, 13, 15, and 24 of AS1411, respectively. In addition, double incorporation of 2'-deoxyinosine at positions 12 and 24 (FAN-1224dI), 13 and 24 (FAN-1324dI), and 15 and 24 (FAN-1524dI) promoted G-quartet formation, as well as inhibition of DNA replication and tumor cell growth, and induced S-phase cell cycle arrest. In further animal experiments, FAN-1224dI, FAN-1324dI and FAN-1524dI resulted in enhanced treatment effects than AS1411 alone. These results suggested that the position and number of modification substituents in AS1411 are critical parameters to improve the diagnostic and therapeutic function of the aptamer. Structural investigations of the FAN-1524dI/nucleolin complex structure, using molecular dynamics simulation, revealed the critical interactions involving nucleolin and 2'-dI incorporated AS1411 compared with AS1411 alone. These findings augment understanding of the role of 2'-deoxyinosine moieties in interactive binding processes.

  14. Grafting aptamers onto gold nanostars increases in vitro efficacy in a wide range of cancer cell types.

    Science.gov (United States)

    Dam, Duncan Hieu M; Culver, Kayla S B; Odom, Teri W

    2014-02-03

    We report the design of a nanoconstruct that can function as a cell-type independent agent by targeting the ubiquitous protein nucleolin. Gold nanostars (AuNS) loaded with high densities of nucleolin-specific DNA aptamer AS1411 (Apt-AuNS) produced anticancer effects in a panel of 12 cancer lines containing four representative subcategories. We found that the nanoconstructs could be internalized by cancer cells and trafficked to perinuclear regions. Apt-AuNS resulted in downregulation of antiapoptotic Bcl-2 mRNA expression by ca. 200% compared to cells without the nanoconstructs. The caspase 3/7 activity (apoptosis) and cell death in cancer cells treated with Apt-AuNS increased by 1.5 times and by ca. 17%, respectively, compared to cells treated with free AS1411 at over 10 times the concentration. Moreover, light-triggered release of aptamer from the AuNS further enhanced the in vitro efficacy of the nanoconstructs in the cancer line panel with a 2-fold increase in caspase activity and a 40% decrease in cell viability compared to treatment with Apt-AuNS only. In contrast, treatments of the nanoconstructs with or without light-triggered release on a panel of normal cell lines had no adverse effects.

  15. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  16. Development of a thermal-stable structure-switching cocaine-binding aptamer.

    Science.gov (United States)

    Shoara, Aron A; Reinstein, Oren; Borhani, Okty Abbasi; Martin, Taylor R; Slavkovic, Sladjana; Churcher, Zachary R; Johnson, Philip E

    2017-08-21

    We have developed a new cocaine-binding aptamer variant that has a significantly higher melt temperature when bound to a ligand than the currently used sequence. Retained in this new construct is the ligand-induced structure-switching binding mechanism that is important in biosensing applications of the cocaine-binding aptamer. Isothermal titration calorimetry methods show that the binding affinity of this new sequence is slightly tighter than the existing cocaine-binding aptamer. The improved thermal performance, a Tm increase of 4 °C for the cocaine-bound aptamer and 9 °C for the quinine-bound aptamer, was achieved by optimizing the DNA sequence in stem 2 of the aptamer to have the highest stability based on the nearest neighbor thermodynamic parameters and confirmed by UV and fluorescence spectroscopy. The sequences in stem 1 and stem 3 were unchanged in order to retain the structure switching and ligand binding functions. The more favorable thermal stability characteristics of the OR3 aptamer should make it a useful construct for sensing applications employing the cocaine-binding aptamer system. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Aptamer-functionalized porous phospholipid nanoshells for direct measurement of Hg(2+) in urine.

    Science.gov (United States)

    Li, Zhen; Muhandiramlage, Thusitha P; Keogh, John P; Hall, Henry K; Aspinwall, Craig A

    2015-01-01

    A porous phospholipid nanoshell (PPN) sensor functionalized with a specific aptamer sensor agent was prepared for rapid detection of Hg(2+) in human urine with minimal sample preparation. Aptamer sensors provide an important class of optical transducers that can be readily and reproducibly synthesized. A key limitation of aptamer sensors, and many other optical sensors, is the potential of biofouling or biodegradation when used in complex biological matrices such as serum or urine, particularly when high levels of nucleases are present. We prepared Hg(2+)-responsive, PPN-encapsulated aptamer sensors that overcome these limitations. PPNs provide a protective barrier to encapsulate the aptamer sensor in an aqueous environment free of diffusional restrictions encountered with many polymer nanomaterials. The unique porous properties of the PPN membrane enable ready and rapid transfer of small molecular weight ions and molecules into the sensor interior while minimizing the macromolecular interactions between the transducer and degradants or interferents in the exterior milieu. Using Hg(2+)-responsive, PPN-encapsulated aptamer sensors, we were able to detect sub-100 ppb (chronic threshold limit from urine test) Hg(2+) in human urine with no sample preparation, whereas free aptamer sensors yielded inaccurate results due to interferences from the matrix. The PPN architecture provides a new platform for construction of aptamer-functionalized sensors that target low molecular weight species in complex matrices, beyond the Hg(2+) demonstrated here.

  18. Modular Assembly of Cell-targeting Devices Based on an Uncommon G-quadruplex Aptamer

    DEFF Research Database (Denmark)

    Opazo, Felipe; Eiden, Laura; Hansen, Line

    2015-01-01

    Aptamers are valuable tools that provide great potential to develop cost-effective diagnostics and therapies in the biomedical field. Here, we report a novel DNA aptamer that folds into an unconventional G-quadruplex structure able to recognize and enter specifically into human Burkitt's lymphoma...

  19. A replaceable liposomal aptamer for the ultrasensitive and rapid detection of biotin

    Science.gov (United States)

    Sung, Tzu-Cheng; Chen, Wen-Yih; Shah, Pramod; Chen, Chien-Sheng

    2016-02-01

    Biotin is an essential vitamin which plays an important role for maintaining normal physiological function. A rapid, sensitive, and simple method is necessary to monitor the biotin level. Here, we reported a replacement assay for the detection of biotin using a replaceable liposomal aptamer. Replacement assay is a competitive assay where a sample analyte replaces the labeled competitor of analyte out of its biorecognition element on a surface. It is user friendly and time-saving because of washing free. We used aptamer as a competitor, not a biorecognition element as tradition. To label aptamers, we used cholesterol-conjugated aptamers to tag signal-amplifying-liposomes. Without the need of conjugation procedure, aptamers can be easily incorporated into the surface of dye-encapsulating liposomes. Two aptamers as competitors of biotin, ST-21 and ST-21M with different affinities to streptavidin, were studied in parallel for the detection of biotin using replacement assays. ST-21 and ST-21M aptamers reached to limits of detection of 1.32 pg/80 μl and 0.47 pg/80 μl, respectively. The dynamic ranges of our assays using ST-21 and ST-21M aptamers were seven and four orders of magnitude, respectively. This assay can be completed in 20 minutes without washing steps. These results were overall better than previous reported assays.

  20. DNA aptamer beacon assay for C-telopeptide and handheld fluorometer to monitor bone resorption.

    Science.gov (United States)

    Bruno, John Gordon; Carrillo, Maria P; Phillips, Taylor; Hanson, Douglas; Bohmann, Jonathan A

    2011-09-01

    A novel DNA aptamer beacon is described for quantification of a 26-amino acid C-telopeptide (CTx) of human type I bone collagen. One aptamer sequence and its reverse complement dominated the aptamer pool (31.6% of sequenced clones). Secondary structures of these aptamers were examined for potential binding pockets. Three-dimensional computer models which analyzed docking topologies and binding energies were in agreement with empirical fluorescence experiments used to select one candidate loop for beacon assay development. All loop structures from the aptamer finalists were end-labeled with TYE 665 and Iowa Black quencher for comparison of beacon fluorescence levels as a function of CTx concentration. The optimal beacon, designated CTx 2R-2h yielded a low ng/ml limit of detection using a commercially available handheld fluorometer. The CTx aptamer beacon bound full-length 26-amino acid CTx peptide, but not a shorter 8-amino acid segment of CTx peptide which is a common target for commercial CTx ELISA kits. The prototype assay was shown to detect CTx peptide from human urine after creatinine and urea were removed by size-exclusion chromatography to prevent nonspecific denaturing of the aptamer beacon. This work demonstrates the potential of aptamer beacons to be utilized for rapid and sensitive bone health monitoring in a handheld or point-of-care format.

  1. DNA aptamer release from the DNA-SWNT hybrid by protein recognition.

    Science.gov (United States)

    Yoo, Chang-Hyuk; Jung, Seungwon; Bae, Jaehyun; Kim, Gunn; Ihm, Jisoon; Lee, Junghoon

    2016-02-14

    Here we show the formation of the complex between a DNA aptamer and a single-walled carbon nanotube (SWNT) and its reaction with its target protein. The aptamer, which is specifically bound with thrombin, the target protein in this study, easily wraps and disperses the SWNT by noncovalent π-π stacking.

  2. Nucleic Acid Aptamers Against Biotoxins: A New Paradigm Toward the Treatment and Diagnostic Approach

    DEFF Research Database (Denmark)

    Lauridsen, Lasse Holm; Veedu, Rakesh N.

    2012-01-01

    to combat these problems. Fully sequestered in vitro, aptamers eliminate the need for a living host. Furthermore, one of the key advantages of using aptamers instead of antibodies is that they can be selected against very weakly immunogenic and cytotoxic substances. In this review, we focus on nucleic acid...

  3. Shortening full-length aptamer by crawling base deletion – Assisted by Mfold web server application

    Directory of Open Access Journals (Sweden)

    Subash C.B. Gopinath

    2017-06-01

    Full Text Available Systematic Evolution of Ligands by EXponential enrichment (SELEX is the method to select the specific aptamer against a wide range of targets. For this process, the initial library usually has a length of random sequences from ∼25 and it reaches over 100 bases. The lengthy sequences have disadvantages such as difficult to prepare, less stable and expensive. It is wise to prefer shorter version of aptamer for a wide range of applications including drug delivery process. It is a common practice to shorten the full-length aptamer by mapping analyses and it is tedious. Here, we used a crawling method to shorten the aptamer by different sequential deletion of bases from both 5′ and 3′ ends, assisted by Mfold web server application. Two different kinds of aptamer with varied lengths (randomized region of 30 and 74 bases were desired for this study, generated against Influenza A/Panama/2007/1999 (H3N2 and gD protein of Herpes Simplex Virus-1. It was found that shortening the aptamer length by crawling pattern is possible with the assistance of Mfold web server application. The obtained results resemble the shortened aptamer derived by mapping analyses. The proposed strategy is recommended to predict the shorter aptamer without involving any wet experimental section.

  4. Cell-SELEX-based selection of aptamers that recognize distinct targets on metastatic colorectal cancer cells.

    Science.gov (United States)

    Li, Wan-Ming; Bing, Tao; Wei, Jia-Yi; Chen, Zhe-Zhou; Shangguan, Di-Hua; Fang, Jin

    2014-08-01

    The development of diagnostic/therapeutic strategies against metastasis-related molecular targets is critical for improving the survival rate of cancer patients. Subtractive Cell-SELEX was performed using highly metastatic colorectal cancer (CRC) LoVo cells and non-metastatic HCT-8 cells as the target and negative cells, respectively, for the selection of metastatic-specific aptamers. This process generated seven aptamers that displayed highly specific binding to the target cells with Kds in the nanomolar range. Based on the distinct chemical/biological properties of their individual cell surface targets, the aptamers were separately functionalized: the receptor-targeting aptamer W14 was used as a carrier for doxorubicin, resulting in the specific delivery of the drug to the target cells and a significant reduction of its cytotoxicity to non-target cells, and the non-receptor-binding aptamer W3 was used as a molecular probe conjugated to quantum dots for the targeted imaging of metastatic cancer cell lines, spontaneous lung metastasis murine tissue, and metastatic CRC patient tissues. In addition, these aptamers can be used in combination due to their lack of detectable mutual-binding interference. The study demonstrates that a panel of aptamers that recognize distinct features of target molecules can be obtained through single Cell-SELEX selection, and the selected aptamers may be individually functionalized for specific applications and/or utilized in combination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Selection and identification of DNA aptamers against okadaic acid for biosensing application.

    Science.gov (United States)

    Eissa, Shimaa; Ng, Andy; Siaj, Mohamed; Tavares, Ana C; Zourob, Mohammed

    2013-12-17

    This work describes the selection and identification of DNA aptamers that bind with high affinity and specificity to okadaic acid (OA), a lipophilic marine biotoxin that accumulates in shellfish. The aptamers selected using systematic evolution of ligands by exponential enrichment (SELEX) exhibited dissociation constants in the nanomolar range. The aptamer with the highest affinity was then used for the fabrication of a label-free electrochemical biosensor for okadaic acid detection. The aptamer was first immobilized on the gold electrode by a self-assembly approach through Au-S interaction. The binding of okadaic acid to the aptamer immobilized on the electrode surface induces an alteration of the aptamer conformation causing a significant decrease in the electron-transfer resistance monitored by electrochemical impedance spectroscopy. The aptasensor showed a linear range for the concentrations of OA between 100 pg/mL and 60 ng/mL with a detection limit of 70 pg/mL. The dissociation constant of okadaic acid with the aptamer immobilized on the electrode surface showed good agreement with that determined using fluorescence assay in solution. Moreover, the aptasensor did not show cross-reactivity toward toxins with structures similar to okadaic acid such as dinophysis toxin-1 and 2 (DTX-1, DTX-2). Further biosensing applications of the selected aptamers are expected to offer promising alternatives to the traditional analytical and immunological methods for OA detection.

  6. Combining aptamers and in silico interaction studies to decipher the function of hypothetical proteins

    DEFF Research Database (Denmark)

    Suravajhala, Prashanth; Burri, Harsha Vardhan Reddy; Heiskanen, Arto

    2014-01-01

    We present the potential role of aptamers in elucidating the function of hypothetical proteins, as well as the possibilities provided by bioinformatics for establishing a benchmark for aptamer-protein prediction methods. With these future perspectives, the role of hypothetical proteins as target ...

  7. Observation of long-range tertiary interactions during ligand binding by the TPP riboswitch aptamer.

    Science.gov (United States)

    Duesterberg, Van K; Fischer-Hwang, Irena T; Perez, Christian F; Hogan, Daniel W; Block, Steven M

    2015-12-28

    The thiamine pyrophosphate (TPP) riboswitch is a cis-regulatory element in mRNA that modifies gene expression in response to TPP concentration. Its specificity is dependent upon conformational changes that take place within its aptamer domain. Here, the role of tertiary interactions in ligand binding was studied at the single-molecule level by combined force spectroscopy and Förster resonance energy transfer (smFRET), using an optical trap equipped for simultaneous smFRET. The 'Force-FRET' approach directly probes secondary and tertiary structural changes during folding, including events associated with binding. Concurrent transitions observed in smFRET signals and RNA extension revealed differences in helix-arm orientation between two previously-identified ligand-binding states that had been undetectable by spectroscopy alone. Our results show that the weaker binding state is able to bind to TPP, but is unable to form a tertiary docking interaction that completes the binding process. Long-range tertiary interactions stabilize global riboswitch structure and confer increased ligand specificity.

  8. Selection and characterization of DNA aptamers against Staphylococcus aureus enterotoxin C1.

    Science.gov (United States)

    Huang, Yukun; Chen, Xiujuan; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Wei, Xinlin; Wang, Yuanfeng

    2015-01-01

    Enterotoxins from pathogenic bacteria are known as the main reason that can cause the bacterial foodborne diseases. In this study, aptamers that bound to Staphylococcus aureus enterotoxin C1 (SEC1) with high affinity and selectivity were generated in vitro by twelve rounds of selection based on magnetic separation technology, with a low-level dissociation constant (Kd) value of 65.14 ± 11.64 nmol/L of aptamer C10. Aptamer-based quantification of SEC1 in the food sample by a graphene oxide (GO)-based method was implemented to investigate the potential of the aptamer against SEC1 with a limit of detection of 6 ng/mL. On the basis of this work, biosensors using the selected SEC1 aptamers as new molecular recognition elements could be applied for innovative determinations of SEC1.

  9. Antidote control of aptamer therapeutics: the road to a safer class of drug agents.

    Science.gov (United States)

    Bompiani, K M; Woodruff, R S; Becker, R C; Nimjee, S M; Sullenger, B A

    2012-08-01

    Aptamers, or nucleic acid ligands, have gained clinical interest over the past 20 years due to their unique characteristics, which are a combination of the best facets of small molecules and antibodies. The high binding affinity and specificity of aptamers allows for isolation of an artificial ligand for theoretically any therapeutic target of interest. Chemical manipulations of aptamers also allow for fine-tuning of their bioavailability, and antidote control greatly expands their clinical use. Here we review the various methods of antidote control of aptamer therapeutics--matched oligonucleotide antidotes and universal antidotes. We also describe the development, recent progress, and potential future therapeutic applications of these types of aptamer-antidote pairs.

  10. DNA nanostructure-decorated surfaces for enhanced aptamer-target binding and electrochemical cocaine sensors.

    Science.gov (United States)

    Wen, Yanli; Pei, Hao; Wan, Ying; Su, Yan; Huang, Qing; Song, Shiping; Fan, Chunhai

    2011-10-01

    The sensitivity of aptamer-based electrochemical sensors is often limited by restricted target accessibility and surface-induced perturbation of the aptamer structure, which arise from imperfect packing of probes on the heterogeneous and locally crowded surface. In this study, we have developed an ultrasensitive and highly selective electrochemical aptamer-based cocaine sensor (EACS), based on a DNA nanotechnology-based sensing platform. We have found that the electrode surface decorated with an aptamer probe-pendant tetrahedral DNA nanostructure greatly facilitates cocaine-induced fusion of the split anticocaine aptamer. This novel design leads to a sensitive cocaine sensor with a remarkably low detection limit of 33 nM. It is also important that the tetrahedra-decorated surface is protein-resistant, which not only suits the enzyme-based signal amplification scheme employed in this work, but ensures high selectivity of this sensor when deployed in sera or other adulterated samples.

  11. Selection of Aptamers Against Whole Living Cells: From Cell-SELEX to Identification of Biomarkers.

    Science.gov (United States)

    Quang, Nam Nguyen; Miodek, Anna; Cibiel, Agnes; Ducongé, Frédéric

    2017-01-01

    Aptamer selection protocols, named cell-SELEX, have been developed to target trans-membrane proteins using whole living cells as target. This technique presents several advantages. (1) It does not necessitate the use of purified proteins. (2) Aptamers are selected against membrane proteins in their native conformation. (3) Cell-SELEX can be performed to identify aptamers against biomarkers differentially expressed between different cell lines without prior knowledge of the targets. (4) Aptamers identified by cell-SELEX can be further used to purify their targets and to identify new biomarkers. Here, we provide a protocol of cell-SELEX including the preparation of an oligonucleotide library, next-generation sequencing and radioactive binding assays. Furthermore, we also provide a protocol to purify and identify the target of these aptamers. These protocols could be useful for the discovery of lead therapeutic compounds and diagnostic cell-surface biomarkers.

  12. The research progress of the correlation between miRNA and cerebral DTI in patients with mild cognitive impairment%轻度认知障碍病人miRNA与脑DTI的相关性研究

    Institute of Scientific and Technical Information of China (English)

    王芳芳; 张冰

    2016-01-01

    Mild cognitive impairment (MCI) is a transitional state between normal aging and Alzheimer’s disease (AD), and most MCI will progress to AD. The miRNA can influence the progress of the AD through a variety of pathological processes, including Aβ generation, immune inflammatory response and synaptic plasticity. However, it is still unknown whether the mild alteration of miRNA in peripheral blood is related to the specificity damage in the brain with MCI due to AD. The magnetic resonance diffusion tensor imaging (DTI) is a sensitive and specific method to detect the integrity of the neuronal fibers. It has been reported that the unique disrupted mode of neuronal fibers integrity could predict the MCI progress to AD. Further, it has been demonstrated that the DTI-FA value decreased in the frontal-striatum in miRNA gene carriers with cognitive impairment, which was associated with the level of cognitive impairment. Therefore, combining miRNA associated pathological changes with brain magnetic resonance DTI may become a specific method for early diagnosis of MCI due to AD.%轻度认知障碍(MCI)是正常老化与阿尔茨海默病(AD)之间的过渡状态,多数进展为AD。微小RNA (miRNA)可以通过影响Aβ生成、免疫炎症反应、突触可塑性等多种病理生理过程来影响AD的进程。但外周血miRNA反映的轻微病理改变是否与AD源性MCI脑内的特异性损伤有关目前尚不清楚。脑MR扩散张量成像(DTI)是检测神经纤维连接完整性损伤的敏感和特异的方法,有研究发现脑内特异性的纤维束损伤模式可以预测MCI向AD进展。也有研究证实认知障碍相关miRNA危险基因携带者脑中额叶-纹状体中的DTI-FA值下降。因此,结合DTI与miRNA相关的病理改变有可能成为早期诊断AD源性MCI的特异性方法。

  13. Aptamer conjugated paclitaxel and magnetic fluid loaded fluorescently tagged PLGA nanoparticles for targeted cancer therapy

    Energy Technology Data Exchange (ETDEWEB)

    Aravind, Athulya; Nair, Remya; Raveendran, Sreejith; Veeranarayanan, Srivani; Nagaoka, Yutaka; Fukuda, Takahiro; Hasumura, Takahashi; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Sakthi Kumar, D., E-mail: sakthi@toyo.jp

    2013-10-15

    Controlled and targeted drug delivery is an essential criterion in cancer therapy to reduce the side effects caused by non-specific drug release and toxicity. Targeted chemotherapy, sustained drug release and optical imaging have been achieved using a multifunctional nanocarrier constructed from poly (D, L-lactide-co-glycolide) nanoparticles (PLGA NPs), an anticancer drug paclitaxel (PTX), a fluorescent dye Nile red (NR), magnetic fluid (MF) and aptamers (Apt, AS1411, anti-nucleolin aptamer). The magnetic fluid and paclitaxel loaded fluorescently labeled PLGA NPs (MF-PTX-NR-PLGA NPs) were synthesized by a single-emulsion technique/solvent evaporation method using a chemical cross linker bis (sulfosuccinimidyl) suberate (BS3) to enable binding of aptamer on to the surface of the nanoparticles. Targeting aptamers were then introduced to the particles through the reaction with the cross linker to target the nucleolin receptors over expressed on the cancer cell surface. Specific binding and uptake of the aptamer conjugated magnetic fluid loaded fluorescently tagged PLGA NPs (Apt-MF-NR-PLGA NPs) to the target cancer cells induced by aptamers was observed using confocal microscopy. Cytotoxicity assay conducted in two cell lines (L929 and MCF-7) confirmed that targeted MCF-7 cancer cells were killed while control cells were unharmed. In addition, aptamer mediated delivery resulting in enhanced binding and uptake to the target cancer cells exhibited increased therapeutic effect of the drug. Moreover, these aptamer conjugated magnetic polymer vehicles apart from actively transporting drugs into specifically targeted tumor regions can also be used to induce hyperthermia or for facilitating magnetic guiding of particles to the tumor regions. - Highlights: • Aptamer escorted, theranostic biodegradable PLGA carriers were developed. • Can target cancer cells, control drug release, image and magnetically guide. • Highly specific to the targeted cancer cells thus delivering

  14. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering

    Energy Technology Data Exchange (ETDEWEB)

    Ardjomandi, N.; Huth, J. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Stamov, D.R. [JPK Instruments AG, Berlin (Germany); Henrich, A. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Klein, C. [Dental Practice Zahngesundheit Waiblingen, Waiblingen (Germany); Wendel, H.-P. [Department of Thoracic, Cardiac and Vascular Surgery, University Hospital, Tübingen (Germany); Reinert, S. [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany); Alexander, D., E-mail: dorothea.alexander@med.uni-tuebingen.de [Department of Oral and Maxillofacial Surgery, University Hospital Tübingen (Germany)

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. - Highlights: • Covalent binding of aptamer 74 on PLGA-coated β-tricalcium phosphate constructs. • AFM analysis of rupture forces between aptamer 74 and jaw periosteal cells. • Analysis of jaw periosteal cell functions on aptamer coated β-TCP constructs.

  15. Development of an aptamer beacon for detection of interferon-gamma.

    Science.gov (United States)

    Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

    2010-03-01

    Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

  16. Detrimental ELAVL-1/HuR-dependent GSK3β mRNA stabilization impairs resolution in acute respiratory distress syndrome

    Science.gov (United States)

    Hoffman, Olivia; Burns, Nana; Vadász, István; Eltzschig, Holger K.; Edwards, Michael G.

    2017-01-01

    A hallmark of acute respiratory distress syndrome (ARDS) is accumulation of protein-rich edema in the distal airspaces and its removal is critical for patient survival. Previous studies have shown a detrimental role of Glycogen Synthase Kinase (GSK) 3β during ARDS via inhibition of alveolar epithelial protein transport. We hypothesized that post-transcriptional regulation of GSK3β could play a functional role in ARDS resolution. To address this hypothesis, we performed an in silico analysis to identify regulatory genes whose expression correlation to GSK3β messenger RNA utilizing two lung cancer cell line array datasets. Among potential regulatory partners of GSK3β, these studies identified the RNA-binding protein ELAVL-1/HuR (Embryonic Lethal, Abnormal Vision, Drosophila-Like) as a central component in a likely GSK3β signaling network. ELAVL-1/HuR is a RNA-binding protein that selectively binds to AU-rich elements of mRNA and enhances its stability thereby increasing target gene expression. Subsequent studies with siRNA suppression of ELAVL-1/HuR demonstrated deceased GSK3β mRNA and protein expression and improved clearance of FITC-albumin in A549 cells. Conversely, stabilization of ELAVL-1/HuR with the proteasome inhibitor MG-132 resulted in induction of GSK3β at mRNA and protein level and attenuated FITC-albumin clearance. Utilizing ventilator-induced lung injury or intra-tracheal installation of hydrochloric acid to induce ARDS in mice, we observed increased mRNA and protein expression of ELAVL-1/HuR and GSK3β. Together, our findings indicate a previously unknown interaction between GSK3β and ELAV-1 during ARDS, and suggest the inhibition of the ELAV-1- GSK3β pathways as a novel ARDS treatment approach. PMID:28196122

  17. Analysis and Identification of Aptamer-Compound Interactions with a Maximum Relevance Minimum Redundancy and Nearest Neighbor Algorithm

    Directory of Open Access Journals (Sweden)

    ShaoPeng Wang

    2016-01-01

    Full Text Available The development of biochemistry and molecular biology has revealed an increasingly important role of compounds in several biological processes. Like the aptamer-protein interaction, aptamer-compound interaction attracts increasing attention. However, it is time-consuming to select proper aptamers against compounds using traditional methods, such as exponential enrichment. Thus, there is an urgent need to design effective computational methods for searching effective aptamers against compounds. This study attempted to extract important features for aptamer-compound interactions using feature selection methods, such as Maximum Relevance Minimum Redundancy, as well as incremental feature selection. Each aptamer-compound pair was represented by properties derived from the aptamer and compound, including frequencies of single nucleotides and dinucleotides for the aptamer, as well as the constitutional, electrostatic, quantum-chemical, and space conformational descriptors of the compounds. As a result, some important features were obtained. To confirm the importance of the obtained features, we further discussed the associations between them and aptamer-compound interactions. Simultaneously, an optimal prediction model based on the nearest neighbor algorithm was built to identify aptamer-compound interactions, which has the potential to be a useful tool for the identification of novel aptamer-compound interactions. The program is available upon the request.

  18. Aptamer-loaded Gold Nanoconstructs for Targeted Cancer Therapy

    Science.gov (United States)

    Dam, Duncan Hieu Minh

    Traditional cancer treatments, including chemotherapy, often cause severe side effects in patients. Targeted therapy where tumor cells are targeted via biomarkers overexpressed on the cell surface has been shown to reduce such adverse effects. Monoclonal antibodies (mAbs) are currently the most common chemotherapeutic agents that bind with high affinity to these cancer markers. However, poor intratumoral uptake of mAb and release of drugs from mAb carriers have been the biggest challenge for this delivery method. As a result, recent work has focused on other strategies to improve the efficacy of drug delivery in targeted therapy. Among potential carriers for drug delivery, gold nanoparticles (AuNPs) have emerged as one of the most promising vehicles. This thesis describes the development of a drug delivery nanoconstruct that can both target cancer cells and induce therapeutic effects. The nanoconstructs are composed of gold nanostars (AuNS) as delivery vehicles loaded with the DNA aptamer AS1411 that can target the ubiquitous shuttle protein nucleolin (NCL) in various cancer cell types. The gold nanocarrier stabilizes the oligonucleotides for intracellular delivery and promotes high loading densities of the oligonucleotide drugs. We have investigated the interactions of the nanoconstruct with different subcellular compartments of the cancer cells. This physical phenomenon has shown to correlate with the biological activities such as apoptosis and cell death that happen in the cancer cells after incubation with the nanoconstructs. A thorough screening of the nanoconstructs in 13 different cancer cell lines is conducted to narrow down the potential targets for in vivo study. Before testing the in vivo efficacy, we evaluate the toxicity of the nanoconstructs in non-tumor animals, which confirms its safety for further in vivo applications. The accumulation of the nanoconstructs in two different cancerous tumors, however, suggests that further optimization of the design

  19. 适配子识别技术在真菌毒素快速分析中的应用%Application of Aptamer Identification Technology in Rapid Analysis of Mycotoxins

    Institute of Scientific and Technical Information of China (English)

    杨锡辉; 孔维军; 杨美华; 赵明; 欧阳臻

    2013-01-01

    适配子是近几年来通过指数富集配基的系统进化技术(SELEX)体外筛选得到的一类与目标分子高特异性结合的寡聚核苷酸片段.适配子作为一个优于抗体的新型识别分子,已在食品快速检验、环境检测、新药研发、临床诊断和治疗以及毒理研究等领域展示了良好的应用前景.本文阐述了适配子识别靶物质的结构基础及其特性,归纳了目前已筛选出的真菌毒素适配子序列,总结了适配子在真菌毒素前处理,适配子光学分析技术和电化学分析技术在单种和多种真菌毒素检测中的应用突破,并展望了适配子识别技术在真菌毒素分析领域的发展趋势.%Aptamers are oligonucleotides fragments, such as ribonucleic acid ( RNA) and single-strand deoxyribonucleicacid ( ssDNA) or peptide molecules that can bind to their targets with high affinity and speci?ficity. For generation of artificial ligands, they are isolated from combinatorial libraries of synthetic nucleic acid by exponential enrichment, via an in vitro iterative process of adsorption, recovery and reamplification known as systematic evolution of ligands by exponential enrichment (SELEX). As new recognition molecules, aptamers display better prospects than antibodies in the fields of rapid analysis of food analysis, environmental monitoring, new drug development, clinical diagnosis and treatment, toxicological studies, etc. The structural bases, characteristics of combination between aptamers and analytes are elaborated in this article. Also, aptamer sequences of mytoxins are listed. Furhter, the application of aptamers identification technology for the rapid analysis of mycotoxins is summarized. These analytical applications involve extraction and purification of the sample, aptamer based optical analysis techniques and electrochemical analysis techniques for the rapid detection of single mycotoxin and simultaneous detection of various mycotoxins. Finally, the future

  20. Development, screening, and analysis of DNA aptamer libraries potentially useful for diagnosis and passive immunity of arboviruses

    Directory of Open Access Journals (Sweden)

    Bruno John G

    2012-11-01

    Full Text Available Abstract Background Nucleic acid aptamers have long demonstrated the capacity to bind viral envelope proteins and to inhibit the progression of pathogenic virus infections. Here we report on initial efforts to develop and screen DNA aptamers against recombinant envelope proteins or synthetic peptides and whole inactivated viruses from several virulent arboviruses including Chikungunya, Crimean-Congo hemorrhagic fever (CCHF, dengue, tickborne encephalitis and West Nile viruses. We also analyzed sequence data and secondary structures for commonalities that might reveal consensus binding sites among the various aptamers. Some of the highest affinity and most specific aptamers in the down-selected libraries were demonstrated to have diagnostic utility in lateral flow chromatographic assays and in a fluorescent aptamer-magnetic bead sandwich assay. Some of the reported aptamers may also be able to bind viral envelope proteins in vivo and therefore may have antiviral potential in passive immunity or prophylactic applications. Results Several arbovirus DNA aptamer sequences emerged multiple times in the various down selected aptamer libraries thereby suggesting some consensus sequences for binding arbovirus envelope proteins. Screening of aptamers by enzyme-linked aptamer sorbent assay (ELASA was useful for ranking relative aptamer affinities against their cognate viral targets. Additional study of the aptamer sequences and secondary structures of top-ranked anti-arboviral aptamers suggest potential virus binding motifs exist within some of the key aptamers and are highlighted in the supplemental figures for this article. One sequence segment (ACGGGTCCGGACA emerged 60 times in the anti-CCHF aptamer library, but nowhere else in the anti-arbovirus library and only a few other times in a larger library of aptamers known to bind bacteria and rickettsia or other targets. Diagnostic utility of some of the aptamers for arbovirus detection in lateral flow

  1. Visual Impairment

    Science.gov (United States)

    ... Surgery? Choosing the Right Sport for You Shyness Visual Impairment KidsHealth > For Teens > Visual Impairment Print A A ... with the brain, making vision impossible. What Is Visual Impairment? Many people have some type of visual problem ...

  2. Development of an efficient targeted cell-SELEX procedure for DNA aptamer reagents.

    Directory of Open Access Journals (Sweden)

    Susanne Meyer

    Full Text Available BACKGROUND: DNA aptamers generated by cell-SELEX offer an attractive alternative to antibodies, but generating aptamers to specific, known membrane protein targets has proven challenging, and has severely limited the use of aptamers as affinity reagents for cell identification and purification. METHODOLOGY: We modified the BJAB lymphoblastoma cell line to over-express the murine c-kit cell surface receptor. After six rounds of cell-SELEX, high-throughput sequencing and bioinformatics analysis, we identified aptamers that bound BJAB cells expressing c-kit but not wild-type BJAB controls. One of these aptamers also recognizes c-kit endogenously expressed by a mast cell line or hematopoietic progenitor cells, and specifically blocks binding of the c-kit ligand stem cell factor (SCF. This aptamer enables better separation by fluorescence-activated cell sorting (FACS of c-kit(+ hematopoietic progenitor cells from mixed bone marrow populations than a commercially available antibody, suggesting that this approach may be broadly useful for rapid isolation of affinity reagents suitable for purification of other specific cell types. CONCLUSIONS/SIGNIFICANCE: Here we describe a novel procedure for the efficient generation of DNA aptamers that bind to specific cell membrane proteins and can be used as high affinity reagents. We have named the procedure STACS (Specific TArget Cell-SELEX.

  3. Surface biofunctionalization of β-TCP blocks using aptamer 74 for bone tissue engineering.

    Science.gov (United States)

    Ardjomandi, N; Huth, J; Stamov, D R; Henrich, A; Klein, C; Wendel, H-P; Reinert, S; Alexander, D

    2016-10-01

    Successful bone regeneration following oral and maxillofacial surgeries depends on efficient functionalization strategies that allow the recruitment of osteogenic progenitor cells at the tissue/implant interface. We have previously identified aptamer 74, which exhibited a binding affinity for osteogenically induced jaw periosteal cells (JPCs). In the present study, this aptamer was used for the surface biofunctionalization of β-tricalcium phosphate (β-TCP) blocks. Atomic force microscopy (AFM) measurements showed increased binding activity of aptamer 74 towards osteogenically induced JPCs compared to untreated controls. The immobilization efficiency of aptamer 74 was analyzed using the QuantiFluor ssDNA assay for 2D surfaces and by amino acid analysis for 3D β-TCP constructs. Following the successful immobilization of aptamer 74 in 2D culture wells and on 3D constructs, in vitro assays showed no significant differences in cell proliferation compared to unmodified surfaces. Interestingly, JPC mineralization was significantly higher on the 2D surfaces and higher cell adhesion was detected on the 3D constructs with immobilized aptamer. Herein, we report an established, biocompatible β-TCP matrix with surface immobilization of aptamer 74, which enhances properties such as cell adhesion on 3D constructs and mineralization on 2D surfaces. Further studies need to be performed to improve the immobilization efficiency and to develop a suitable approach for JPC mineralization growing within 3D β-TCP constructs. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Tumor targeting with a (99m)Tc-labeled AS1411 aptamer in prostate tumor cells.

    Science.gov (United States)

    Noaparast, Zohreh; Hosseinimehr, Seyed Jalal; Piramoon, Majid; Abedi, Seyed Mohammad

    2015-01-01

    AS1411, a 26-base guanine-rich oligonucleotide aptamer, has high affinity to nucleolin, mainly on tumor cell surfaces. In this study, a modified AS1411 was labeled with (99m)Tc and evaluated as a potential tumor-targeting agent for imaging. The AS1411 aptamer was conjugated with HYNIC and labeled with (99m)Tc in the presence a co-ligand. Radiochemical purity and stability testing of the (99m)Tc-HYNIC-AS1411 aptamer were carried out with thin layer chromatography and a size-exclusion column in normal saline and human serum. Cellular nucleolin-specific binding, cellular internalization in DU-145 cells, as high levels of nucleolin expression, were performed. Additionally, biodistribution in normal mice and DU-145 tumour-bearing mice was assessed. Radiolabeling of the aptamer resulted in a reasonable yield and radiochemical purity after purification. The aptamer was stable in normal saline and human serum, and cellular experiments demonstrated specific binding of the AS1411 aptamer to the nucleolin protein. Based on biodistribution assessment of (99m)Tc-HYNIC-AS1411, rapid blood clearance was seen after injection and it appears that the excretion route was via the urinary system at 1 h post-injection. Tumours also showed a higher accumulation of radioactivity with this labeled aptamer. (99m)Tc-AS1411 can be a potential tool for the molecular imaging of nucleolin-overexpressing cancers.

  5. Application of capillary electrophoresis to the development and evaluation of aptamer affinity probes

    Science.gov (United States)

    Sooter, Letha J.; McMasters, Sun; Stratis-Cullum, Dimitra N.

    2007-09-01

    Nucleic acid aptamers can exhibit high binding affinities for a wide variety of targets and have received much attention as molecular recognition elements for enhanced biosensor performance. These aptamers recognize target molecules through a combination of conformational dependent non-covalent interactions in aqueous media which can be investigated using capillary electrophoresis-based methods. In this paper we report on the results of our studies of the relative binding affinity of Campylobacter jejuni aptamers using a capillary electrophoretic immunoassay. Our results show preferential binding to C. jejuni over other common food pathogen bacteria. Capillary electrophoresis can also be used to develop new aptamer recognition elements using an in vitro selection process known as systematic evolution of ligand by exponential enrichment (SELEX). Recently, this process has been adapted to use capillary electrophoresis in an attempt to shorten the overall selection process. This smart selection of nucleic acid aptamers from a large diversity of a combinatorial DNA library is under optimization for the development of aptamers which bind to Army-relevant targets. This paper will include a discussion of the establishment of CE-SELEX methods for the future development of smart aptamer probes.

  6. Tuning riboswitch-mediated gene regulation by rational control of aptamer ligand binding properties.

    Science.gov (United States)

    Rode, Ambadas B; Endoh, Tamaki; Sugimoto, Naoki

    2015-01-12

    Riboswitch-mediated control of gene expression depends on ligand binding properties (kinetics and affinity) of its aptamer domain. A detailed analysis of interior regions of the aptamer, which affect the ligand binding properties, is important for both understanding natural riboswitch functions and for enabling rational design of tuneable artificial riboswitches. Kinetic analyses of binding reaction between flavin mononucleotide (FMN) and several natural and mutant aptamer domains of FMN-specific riboswitches were performed. The strong dependence of the dissociation rate (52.6-fold) and affinity (100-fold) on the identities of base pairs in the aptamer stem suggested that the stem region, which is conserved in length but variable in base-pair composition and context, is the tuning region of the FMN-specific aptamer. Synthetic riboswitches were constructed based on the same aptamer domain by rationally modifying the tuning regions. The observed 9.31-fold difference in the half-maximal effective concentration (EC50) corresponded to a 11.6-fold difference in the dissociation constant (K(D)) of the aptamer domains and suggested that the gene expression can be controlled by rationally adjusting the tuning regions.

  7. Aptamer-based surface plasmon resonance sensing of glycated human blood proteins

    Science.gov (United States)

    Reaver, Nathan G. F.; Zheng, Rui; Kim, Dong-Shik; Cameron, Brent D.

    2013-02-01

    The concentration ratio of glycated to non-glycated forms of various blood proteins can be used as a diagnostic measure in diabetes to determine a history of glycemic compliance. Depending on a protein's half-life in blood, compliance can be assessed from a few days to several months in the past, which can then be used to provide additional therapeutic guidance. Current glycated protein detection methods are limited in their ability to measure multiple proteins, and are susceptible to interference from other blood pathologies. In this study, we developed and characterized DNA aptamers for use in Surface Plasmon Resonance (SPR) sensors to assess the blood protein hemoglobin. The aptamers were developed by way of a modified Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process which selects DNA sequences that have a high binding affinity to a specific protein. DNA products resulting from this process are sequenced and identified aptamers are then synthesized. The SELEX process was performed to produce aptamers for a glycated form of hemoglobin. Equilibrium dissociation constants for the binding of the identified aptamer to glycated hemoglobin, hemoglobin, and fibrinogen were calculated from fitted Langmuir isotherms obtained through SPR. These constants were determined to be 94 nM, 147 nM, and 244 nM respectively. This aptamer can potentially be used to create a SPR aptamer based biosensor for detection of glycated hemoglobin, a technology that has the potential to deliver low-cost and immediate glycemic compliance assessment in either a clinical or home setting.

  8. RAGE-Aptamer Blocks the Development and Progression of Experimental Diabetic Nephropathy.

    Science.gov (United States)

    Matsui, Takanori; Higashimoto, Yuichiro; Nishino, Yuri; Nakamura, Nobutaka; Fukami, Kei; Yamagishi, Sho-Ichi

    2017-06-01

    The interaction of advanced glycation end products (AGEs) and their receptor (RAGE) plays a central role in diabetic nephropathy. We screened DNA aptamers directed against RAGE (RAGE-aptamers) in vitro and examined the effects on the development and progression of diabetic nephropathy in streptozotocin-induced diabetic rats. RAGE-aptamer bound to RAGE with a Kd of 5.68 nmol/L and resultantly blocked the binding of AGEs to RAGE. When diabetic rats received continuous intraperitoneal injection of RAGE-aptamer from week 7 to 11 of diabetes, the increases in renal NADPH oxidase activity, oxidative stress generation, AGE, RAGE, inflammatory and fibrotic gene and protein levels, macrophage and extracellular matrix accumulation, and albuminuria were significantly suppressed, which were associated with improvement of podocyte damage. Two-week infusion of RAGE-aptamer just after the induction of diabetes also inhibited the AGE-RAGE-oxidative stress system and MCP-1 levels in the kidneys of 8-week-old diabetic rats and simultaneously ameliorated podocyte injury and albuminuria. Moreover, RAGE-aptamer significantly suppressed the AGE-induced oxidative stress generation and inflammatory and fibrotic reactions in human cultured mesangial cells. The findings suggest that continuous infusion of RAGE-aptamer could attenuate the development and progression of experimental diabetic nephropathy by blocking the AGE-RAGE axis. © 2017 by the American Diabetes Association.

  9. Development of a fraction collection approach in capillary electrophoresis SELEX for aptamer selection.

    Science.gov (United States)

    Luo, Zhaofeng; Zhou, Hongmin; Jiang, Hao; Ou, Huichao; Li, Xin; Zhang, Liyun

    2015-04-21

    Aptamers have attracted much attention due to their ability to bind to target molecules with high affinity and specificity. The development of an approach capable of efficiently generating aptamers through systematic evolution of ligands by exponential enrichment (SELEX) is particularly challenging. Herein, a fraction collection approach in capillary electrophoresis SELEX (FCE-SELEX) for the partition of a bound DNA-target complex is developed. By integrating fraction collection with a facile oil seal method for avoiding contamination while amplifying the bound DNA-target complex, in a single round of selection, a streptavidin-binding aptamer (SBA) has been generated. The affinity of aptamer SBA-36 for streptavidin (SA) is determined as 30.8 nM by surface plasmon resonance (SPR). Selectivity and biotin competition experiments demonstrate that the SBA-36 aptamer selected by FCE-SELEX is as efficient as those from other methods. Based on the ability of fraction collection in partition and collection of the aptamer-target complex from the original DNA library, FCE-SELEX can be a universal tool for the development of aptamers.

  10. Development of an Efficient Targeted Cell-SELEX Procedure for DNA Aptamer Reagents

    Science.gov (United States)

    Nie, Jeff; Stewart, Ron; McIntosh, Brian E.; Conti, Lisa R.; Ahmad, Kareem M.; Soh, H. Tom; Thomson, James A.

    2013-01-01

    Background DNA aptamers generated by cell-SELEX offer an attractive alternative to antibodies, but generating aptamers to specific, known membrane protein targets has proven challenging, and has severely limited the use of aptamers as affinity reagents for cell identification and purification. Methodology We modified the BJAB lymphoblastoma cell line to over-express the murine c-kit cell surface receptor. After six rounds of cell-SELEX, high-throughput sequencing and bioinformatics analysis, we identified aptamers that bound BJAB cells expressing c-kit but not wild-type BJAB controls. One of these aptamers also recognizes c-kit endogenously expressed by a mast cell line or hematopoietic progenitor cells, and specifically blocks binding of the c-kit ligand stem cell factor (SCF). This aptamer enables better separation by fluorescence-activated cell sorting (FACS) of c-kit+ hematopoietic progenitor cells from mixed bone marrow populations than a commercially available antibody, suggesting that this approach may be broadly useful for rapid isolation of affinity reagents suitable for purification of other specific cell types. Conclusions/Significance Here we describe a novel procedure for the efficient generation of DNA aptamers that bind to specific cell membrane proteins and can be used as high affinity reagents. We have named the procedure STACS (Specific TArget Cell-SELEX). PMID:23967247

  11. Screening and identification of DNA aptamers against T-2 toxin assisted by graphene oxide.

    Science.gov (United States)

    Chen, Xiujuan; Huang, Yukun; Duan, Nuo; Wu, Shijia; Xia, Yu; Ma, Xiaoyuan; Zhu, Changqing; Jiang, Yuan; Wang, Zhouping

    2014-10-22

    A high-affinity ssDNA aptamer that specifically binds to T-2 toxin was generated by the systemic evolution of ligands by exponential enrichment (SELEX) procedure assisted by graphene oxide (GO). After 10 rounds of selection against T-2 toxin, a highly enriched ssDNA pool was sequenced and the representative aptamers were subjected to binding assays to evaluate their affinity and specificity. Circular dichroism spectroscopy was also used to study the inherent interaction of T-2 toxin and the preferred aptamer Seq.16, which demonstrated a low dissociation constant (Kd) of 20.8 ± 3.1 nM and excellent selectivity for T-2 toxin. Using the selected aptamer Seq.16 as the recognition element, an aptamer-based fluorescent bioassay was developed for the measurement of T-2 in beer samples with a linear range from 0.5 to 37.5 μM (R(2) = 0.988) and a limit of detection (LOD) of 0.4 μM. The results indicate that GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins, offering a promising application for aptamer-based biosensors.

  12. Fabrication of endothelial progenitor cell capture surface via DNA aptamer modifying dopamine/polyethyleneimine copolymer film

    Science.gov (United States)

    Li, Xin; Deng, Jinchuan; Yuan, Shuheng; Wang, Juan; Luo, Rifang; Chen, Si; Wang, Jin; Huang, Nan

    2016-11-01

    Endothelial progenitor cells (EPCs) are mainly located in bone marrow and circulate, and play a crucial role in repairmen of injury endothelium. One of the most promising strategies of stents designs were considered to make in-situ endothelialization in vivo via EPC-capture biomolecules on a vascular graft to capture EPCs directly from circulatory blood. In this work, an EPC specific aptamer with a 34 bases single strand DNA sequence was conjugated onto the stent surface via dopamine/polyethyleneimine copolymer film as a platform and linker. The assembled density of DNA aptamer could be regulated by controlling dopamine percentage in this copolymer film. X-ray photoelectron spectroscopy (XPS), water contact angle (WCA) and fluorescence test confirmed the successful immobilization of DNA aptamer. To confirm its biofunctionality and cytocompatibility, the capturing cells ability of the aptamer modified surface and the effects on the growth behavior of human umbilical vein endothelial cells (HUVECs), smooth muscle cells (SMCs) were investigated. The aptamer functionalized sample revealed a good EPC-capture ability, and had a cellular friendly feature for both EPC and EC growth, while not stimulated the hyperplasia of SMCs. And, the co-culture experiment of three types of cells confirmed the specificity capturing of EPCs to aptamer modified surface, rather than ECs and SMCs. These data suggested that this aptamer functionalized surface may have a large potentiality for the application of vascular grafts with targeted endothelialization.

  13. Cofactors in the RNA World

    Science.gov (United States)

    Ditzler, Mark A.

    2014-01-01

    RNA world theories figure prominently in many scenarios for the origin and early evolution of life. These theories posit that RNA molecules played a much larger role in ancient biology than they do now, acting both as the dominant biocatalysts and as the repository of genetic information. Many features of modern RNA biology are potential examples of molecular fossils from an RNA world, such as the pervasive involvement of nucleotides in coenzymes, the existence of natural aptamers that bind these coenzymes, the existence of natural ribozymes, a biosynthetic pathway in which deoxynucleotides are produced from ribonucleotides, and the central role of ribosomal RNA in protein synthesis in the peptidyl transferase center of the ribosome. Here, we uses both a top-down approach that evaluates RNA function in modern biology and a bottom-up approach that examines the capacities of RNA independent of modern biology. These complementary approaches exploit multiple in vitro evolution techniques coupled with high-throughput sequencing and bioinformatics analysis. Together these complementary approaches advance our understanding of the most primitive organisms, their early evolution, and their eventual transition to modern biochemistry.

  14. Recognition of Bungarus multicinctus venom by a DNA aptamer against β-bungarotoxin.

    Directory of Open Access Journals (Sweden)

    Fengping Ye

    Full Text Available Antibody-based technology is the main method for diagnosis and treatment of snake bite envenoming currently. However, the development of an antibody, polyclonal or monoclonal, is a complicated and costly procedure. Aptamers are single stranded oligonucleotides that recognize specific targets such as proteins and have shown great potential over the years as diagnostic and therapeutic agents. In contrast to antibodies, aptamers can be selected in vitro without immunization of animals, and synthesized chemically with extreme accuracy, low cost and high degree of purity. In this study we firstly report on the identification of DNA aptamers that bind to β-bungarotoxin (β-BuTx, a neurotoxin from the venom of Bungarus multicinctus. A plate-SELEX method was used for the selection of β-BuTx specific aptamers. After 10 rounds of selection, four aptamer candidates were obtained, with the dissociation constant ranged from 65.9 nM to 995 nM measured by fluorescence spectroscopy. Competitive binding assays using both the fluorescently labeled and unlabeled aptamers revealed that the four aptamers bound to the same binding site of β-BuTx. The best binder, βB-1, bound specifically to β-BuTx, but not to BSA, casein or α-Bungarotoxin. Moreover, electrophoretic mobility shift assay and enzyme-linked aptamer assay demonstrated that βB-1 could discriminate B. multicinctus venom from other snake venoms tested. The results suggest that aptamer βB-1 can serve as a useful tool for the design and development of drugs and diagnostic tests for β-BuTx poisoning and B. multicinctus bites.

  15. Evaluation of antithrombotic activity of thrombin DNA aptamers by a murine thrombosis model.

    Directory of Open Access Journals (Sweden)

    Elena Zavyalova

    Full Text Available Aptamers are nucleic acid based molecular recognition elements with a high potential for the theranostics. Some of the aptamers are under development for therapeutic applications as promising antithrombotic agents; and G-quadruplex DNA aptamers, which directly inhibit the thrombin activity, are among them. RA-36, the 31-meric DNA aptamer, consists of two thrombin binding pharmacophores joined with the thymine linker. It has been shown earlier that RA-36 directly inhibits thrombin in the reaction of fibrinogen hydrolysis, and also it inhibits plasma and blood coagulation. Studies of both inhibitory and anticoagulation effects had indicated rather high species specificity of the aptamer. Further R&D of RA-36 requires exploring its efficiency in vivo. Therefore the development of a robust and adequate animal model for effective physiological studies of aptamers is in high current demand. This work is devoted to in vivo study of the antithrombotic effect of RA-36 aptamer. A murine model of thrombosis has been applied to reveal a lag and even prevention of thrombus formation when RA-36 was intravenous bolus injected in high doses of 1.4-7.1 µmol/kg (14-70 mg/kg. A comparative study of RA-36 aptamer and bivalirudin reveals that both direct thrombin inhibitors have similar antithrombotic effects for the murine model of thrombosis; though in vitro bivalirudin has anticoagulation activity several times higher compared to RA-36. The results indicate that both RA-36 aptamer and bivalirudin are direct thrombin inhibitors of different potency, but possible interactions of the thrombin-inhibitor complex with other components of blood coagulation cascade level the physiological effects for both inhibitors.

  16. Evaluation of antithrombotic activity of thrombin DNA aptamers by a murine thrombosis model.

    Science.gov (United States)

    Zavyalova, Elena; Samoylenkova, Nadezhda; Revishchin, Alexander; Golovin, Andrey; Pavlova, Galina; Kopylov, Alexey

    2014-01-01

    Aptamers are nucleic acid based molecular recognition elements with a high potential for the theranostics. Some of the aptamers are under development for therapeutic applications as promising antithrombotic agents; and G-quadruplex DNA aptamers, which directly inhibit the thrombin activity, are among them. RA-36, the 31-meric DNA aptamer, consists of two thrombin binding pharmacophores joined with the thymine linker. It has been shown earlier that RA-36 directly inhibits thrombin in the reaction of fibrinogen hydrolysis, and also it inhibits plasma and blood coagulation. Studies of both inhibitory and anticoagulation effects had indicated rather high species specificity of the aptamer. Further R&D of RA-36 requires exploring its efficiency in vivo. Therefore the development of a robust and adequate animal model for effective physiological studies of aptamers is in high current demand. This work is devoted to in vivo study of the antithrombotic effect of RA-36 aptamer. A murine model of thrombosis has been applied to reveal a lag and even prevention of thrombus formation when RA-36 was intravenous bolus injected in high doses of 1.4-7.1 µmol/kg (14-70 mg/kg). A comparative study of RA-36 aptamer and bivalirudin reveals that both direct thrombin inhibitors have similar antithrombotic effects for the murine model of thrombosis; though in vitro bivalirudin has anticoagulation activity several times higher compared to RA-36. The results indicate that both RA-36 aptamer and bivalirudin are direct thrombin inhibitors of different potency, but possible interactions of the thrombin-inhibitor complex with other components of blood coagulation cascade level the physiological effects for both inhibitors.

  17. Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST).

    Science.gov (United States)

    Entzian, Clemens; Schubert, Thomas

    2016-03-15

    Aptamers are potent and versatile binding molecules recognizing various classes of target molecules. Even challenging targets such as small molecules can be identified and bound by aptamers. Studying the interaction between aptamers and drugs, antibiotics or metabolites in detail is however difficult due to the lack of sophisticated analysis methods. Basic binding parameters of these small molecule-aptamer interactions such as binding affinity, stoichiometry and thermodynamics are elaborately to access using the state of the art technologies. The innovative MicroScale Thermophoresis (MST) is a novel, rapid and precise method to characterize these small molecule-aptamer interactions in solution at microliter scale. The technology is based on the movement of molecules through temperature gradients, a physical effect referred to as thermophoresis. The thermophoretic movement of a molecule depends - besides on its size - on charge and hydration shell. Upon the interaction of a small molecule and an aptamer, at least one of these parameters is altered, leading to a change in the movement behavior, which can be used to quantify molecular interactions independent of the size of the target molecule. The MST offers free choice of buffers, even measurements in complex bioliquids are possible. The dynamic affinity range covers the pM to mM range and is therefore perfectly suited to analyze small molecule-aptamer interactions. This section describes a protocol how quantitative binding parameters for aptamer-small molecule interactions can be obtained by MST. This is demonstrated by mapping down the binding site of the well-known ATP aptamer DH25.42 to a specific region at the adenine of the ATP molecule.

  18. In vitro selection, characterization, and biosensing application of high-affinity cylindrospermopsin-targeting aptamers.

    Science.gov (United States)

    Elshafey, Reda; Siaj, Mohamed; Zourob, Mohammed

    2014-09-16

    Contamination of freshwater with cyanotoxin cylindrospermopsin (CYN) represents a significant global concern for public health. The sensitive detection of CYN is necessary to effectively manage and control the treatment of water resources. Here we report a novel, highly sensitive label-free aptasensor for CYN analysis, using aptamers as specific receptors. We have selected the DNA aptamers from a diverse random library using the in vitro screening SELEX approach. The aptamers exhibited high affinity for CYN with Kd of nanomolar range. One aptamer exhibited conformational change upon CYN recognition (CD analysis) and was used to fabricate the label-free impedimetric aptasensor for CYN. A self-assembled monolayer from a disulfide-derivatized aptamer was formed on a gold electrode to fabricate the aptasensor. Upon CYN capturing to the aptasensor surface, a marked drop in the electron transfer resistance was obtained, which was used as the principle of detection of CYN. This resulted from the aptamer's conformational change induced by CYN recognition. The present aptasensor could detect CYN with the limit of detection as low as 100 pM and a wide linear range of 0.1 to 80 nM. When mounted on the gold surface, the aptamer exhibited a lower dissociation constant for CYN than that observed in the fluorescence assay, implying that the anchoring of the aptamer on the Au surface improved its affinity to CYN. Moreover, the aptasensor showed high specificity toward other coexistent cyanobacterial toxins of microcystin-LR and Anatoxin-a. Further biosensor designs will be generated using those aptamers for simple and sensitive CYN monitoring.

  19. Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform

    Directory of Open Access Journals (Sweden)

    Myeong-Sub Song

    2017-05-01

    Full Text Available In this paper, a Whole-Bacteria SELEX (WB-SELEX strategy was adopted to isolate specific aptamers against Shigella sonnei. Real-time PCR amplification and post-SELEX experiment revealed that the selected aptmers possessed a high binding affinity and specificity for S. sonnei. Of the 21 aptamers tested, the C(t values of the SS-3 and SS-4 aptamers (Ct = 13.89 and Ct = 12.23, respectively had the lowest value compared to other aptamer candidates. The SS-3 and SS-4 aptamers also displayed a binding affinity (KD of 39.32 ± 5.02 nM and 15.89 ± 1.77 nM, respectively. An aptamer-based fluorescent biosensor assay was designed to detect and discriminate S. sonnei cells using a sandwich complex pair of SS-3 and SS-4. The detection of S. sonnei by the aptamer based fluorescent biosensor platform consisted of three elements: (1 5’amine-SS-4 modification in a 96-well type microtiter plate surface (N-oxysuccinimide, NOS as capture probes; (2 the incubation with S. sonnei and test microbes in functionalized 96 assay wells in parallel; (3 the readout of fluorescent activity using a Cy5-labeled SS-3 aptamer as the detector. Our platform showed a significant ability to detect and discriminate S. sonnei from other enteric species such as E. coli, Salmonella typhimurium and other Shigella species (S. flexneri, S. boydii. In this study, we demonstrated the feasibility of an aptamer sensor platform to detect S. sonnei in a variety of foods and pave the way for its use in diagnosing shigellosis through multiple, portable designs.

  20. Aptamer contained triple-helix molecular switch for rapid fluorescent sensing of acetamiprid.

    Science.gov (United States)

    Liu, Xin; Li, Ying; Liang, Jing; Zhu, Wenyue; Xu, Jingyue; Su, Ruifang; Yuan, Lei; Sun, Chunyan

    2016-11-01

    In this study, an aptamer-based fluorescent sensing platform using triple-helix molecular switch (THMS) was developed for the pesticide screening represented by acetamiprid. The THMS was composed of two tailored DNA probes: a label-free central target specific aptamer sequence flanked by two arm segments acting as a recognition probe; a hairpin-shaped structure oligonucleotide serving as a signal transduction probe (STP), labeled with a fluorophore and a quencher at the 3' and 5'-end, respectively. In the absence of acetamiprid, complementary bindings of two arm segments of the aptamers with the loop sequence of STP enforce the formation of THMS with the "open" configuration of STP, and the fluorescence of THMS is on. In the presence of target acetamiprid, the aptamer-target binding results in the formation of a structured aptamer/target complex, which disassembles the THMS and releases the STP. The free STP is folded to a stem loop structure, and the fluorescence is quenched. The quenched fluorescence intensity was proportional to the concentration of acetamiprid in the range from 100 to 1200nM, with the limit of detection (LOD) as low as 9.12nM. In addition, this THMS-based method has been successfully used to test and quantify acetamiprid in Chinese cabbage with satisfactory recoveries, and the results were in full agreement with those from LC-MS. The aptamer-based THMS presents distinct advantages, including high stability, remarkable sensitivity, and preservation of the affinity and specificity of the original aptamer. Most importantly, this strategy is convenient and generalizable by virtue of altering the aptamer sequence without changing the triple-helix structure. So, it is expected that this aptamer-based fluorescent assay could be extensively applied in the field of food safety inspection.

  1. Identification of several circulating microRNAs from a genome-wide circulating microRNA expression profile as potential biomarkers for impaired glucose metabolism in polycystic ovarian syndrome.

    Science.gov (United States)

    Jiang, Linlin; Huang, Jia; Chen, Yaxiao; Yang, Yabo; Li, Ruiqi; Li, Yu; Chen, Xiaoli; Yang, Dongzi

    2016-07-01

    This study aimed to detect serum microRNAs (miRNAs) differentially expressed between polycystic ovary syndrome (PCOS) patients with impaired glucose metabolism (IGM), PCOS patients with normal glucose tolerance (NGT), and healthy controls. A TaqMan miRNA array explored serum miRNA profiles as a pilot study, then selected miRNAs were analyzed in a validation cohort consisting of 65 PCOS women with IGM, 65 PCOS women with NGT, and 45 healthy women The relative expression of miR-122, miR-193b, and miR-194 was up-regulated in PCOS patients compared with controls, whereas that of miR-199b-5p was down-regulated. Furthermore, miR-122, miR-193b, and miR-194 were increased in the PCOS-IGM group compared with the PCOS-NGT group. Multiple linear regression analyses revealed that miR-193b and body mass index contributed independently to explain 43.7 % (P ovarian follicle development pathways, including the insulin signaling pathway, the neurotrophin signaling pathway, the PI3K-AKT signaling pathway, and regulation of actin cytoskeleton. This study expands our knowledge of the serum miRNA expression profiles of PCOS patients with IGM and the predicted target signal pathways involved in disease pathophysiology.

  2. Molecular Interplay between microRNA-34a and Sirtuin1 in Hyperglycemia-Mediated Impaired Angiogenesis in Endothelial Cells: Effects of Metformin.

    Science.gov (United States)

    Arunachalam, Gnanapragasam; Lakshmanan, Arun Prasath; Samuel, Samson Mathews; Triggle, Chris R; Ding, Hong

    2016-02-01

    Impaired angiogenesis is a prominent risk factor that contributes to the development of diabetes-associated cardiovascular disease. MicroRNAs (miRNAs), small noncoding RNAs, are implicated as important regulators of vascular function, including endothelial cell differentiation, proliferation, and angiogenesis. In silico analysis and in vitro studies indicate that silent information regulator 1 (SIRT1) is a potential target for endothelial cell-specific miRNAs. In this study, we investigated the molecular crosstalk between miR-34a, the protein product of SIRT1 (sirtuin1), and the antidiabetic drug, metformin, in hyperglycemia-mediated impaired angiogenesis in mouse microvascular endothelial cells (MMECs). MMECs were cultured, transfected with either a miR-34a inhibitor or mimic in normal glucose (11 mM) or high glucose (HG, 40 mM) in the presence or absence of metformin. The expression of miR-34a, sirtuin1, and their signaling targets was evaluated. miR-34a expression is upregulated in a hyperglycemic milieu and parallels changes in the expression of sirtuin1, post-translational modification of endothelial nitric oxide synthase (phospho/acetylation), as well as an impairment in angiogenesis. The presence of metformin, or the inhibition of miR-34a using an anti-miR-34a inhibitor, increases the expression of sirtuin1 and attenuates the impairment in angiogenesis in HG-exposed MMECs. In contrast, overexpression of a miR-34a mimic prevents metformin-mediated protection. These data indicate that miR-34a, via the regulation of sirtuin1 expression, has an anti-angiogenic action in MMECs, which can be modulated by metformin. In summary, miR-34a represents both a target whereby metformin mediates its vasculoprotective actions and also a potential therapeutic target for the prevention/treatment of diabetic vascular disease.

  3. Molecular Diagnostic and Drug Delivery Agents based on Aptamer-Nanomaterial Conjugates

    Science.gov (United States)

    Lee, Jung Heon; Yigit, Mehmet V.; Mazumdar, Debapriya; Lu, Yi

    2010-01-01

    Recent progress in an emerging area of designing aptamer and nanomaterial conjugates as molecular diagnostic and drug delivery agents in biomedical applications is summarized. Aptamers specific for a wide range of targets are first introduced and compared to antibodies. Methods of integrating these aptamers with a variety of nanomaterials, such as gold nanoparticles, quantum dots, carbon nanotubes, and superparamagnetic iron oxide nanoparticles, each with unique optical, magnetic, and electrochemical properties, are reviewed. Applications of these systems as fluorescent, colorimetric, magnetic resonance imaging, and electrochemical sensors in medical diagnostics are given, along with new applications as smart drug delivery agents. PMID:20338204

  4. Aptamers: Novel Molecules as Diagnostic Markers in Bacterial and Viral Infections?

    Directory of Open Access Journals (Sweden)

    Flávia M. Zimbres

    2013-01-01

    Full Text Available Worldwide the entire human population is at risk of infectious diseases of which a high degree is caused by pathogenic protozoans, worms, bacteria, and virus infections. Moreover the current medications against pathogenic agents are losing their efficacy due to increasing and even further spreading drug resistance. Therefore, there is an urgent need to discover novel diagnostic as well as therapeutic tools against infectious agents. In view of that, the Systematic Evolution of Ligands by Exponential Enrichment (SELEX represents a powerful technology to target selectively pathogenic factors as well as entire bacteria or viruses. SELEX uses a large combinatorial oligonucleic acid library (DNA or RNA which is processed a by high-flux in vitro screen of iterative cycles. The selected ligands, termed aptamers, are characterized by high specificity and affinity to their target molecule, which are already exploited in diagnostic and therapeutic applications. In this minireview we will discuss the current status of the SELEX technique applied on bacterial and viral pathogens.

  5. Engineering of Targeted Nanoparticles for Cancer Therapy Using Internalizing Aptamers Isolated by Cell-Uptake Selection

    Science.gov (United States)

    Xiao, Zeyu; Levy-Nissenbaum, Etgar; Alexis, Frank; Lupták, Andrej; Teply, Benjamin A.; Chan, Juliana M.; Shi, Jinjun; Digga, Elise; Cheng, Judy; Langer, Robert; Farokhzad, Omid C.

    2012-01-01

    One of the major challenges in the development of targeted nanoparticles (NPs) for cancer therapy is to discover targeting ligands that allow for differential binding and uptake by the target cancer cells. Using prostate cancer (PCa) as a model disease, we developed a cell-uptake selection strategy to isolate PCa-specific internalizing 2'-Omethyl RNA aptamers (Apts) for NP incorporation. Twelve cycles of selection and counter-selection were done to obtain a panel of internalizing Apts, which can distinguish PCa cells from non-prostate and normal prostate cells. After Apt characterization, size minimization, and conjugation of the Apts with fluorescently-labeled polymeric NPs, the NP-Apt bioconjugates exhibit PCa specificity and enhancement in cellular uptake when compared to non-targeted NPs lacking the internalizing Apts. Furthermore, when docetaxel, a chemotherapeutic agent used for the treatment of PCa, was encapsulated within the NP-Apt, a significant improvement in cytotoxicity was achieved in targeted PCa cells. Rather than isolating high-affinity Apts as reported in previous selection processes, our selection strategy was designed to enrich cancer-cell specific internalizing Apts. A similar cell-uptake selection strategy may be used to develop specific internalizing ligands for a myriad of other diseases and can potentially facilitate delivering various molecules, including drugs and siRNAs, into cells. PMID:22214176

  6. High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency.

    Science.gov (United States)

    Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua

    2016-09-22

    The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.

  7. Thermodynamic and kinetic characterization of ligand binding to the purine riboswitch aptamer domain.

    Science.gov (United States)

    Gilbert, Sunny D; Stoddard, Colby D; Wise, Sarah J; Batey, Robert T

    2006-06-09

    Riboswitches are cis-acting genetic regulatory elements found commonly in bacterial mRNAs that consist of a metabolite-responsive aptamer domain coupled to a regulatory switch. Purine riboswitches respond to intracellular concentrations of either adenine or guanine/hypoxanthine to control gene expression. The aptamer domain of the purine riboswitch contains a pyrimidine residue (Y74) that forms a Watson-Crick base-pairing interaction with the bound purine nucleobase ligand that discriminates between adenine and guanine. We sought to understand the structural basis of this specificity and the mechanism of ligand recognition by the purine riboswitch. Here, we present the 2,6-diaminopurine-bound structure of a C74U mutant of the xpt-pbuX guanine riboswitch, along with a detailed thermodynamic and kinetic analysis of nucleobase recognition by both the native and mutant riboswitches. These studies demonstrate clearly that the pyrimidine at position 74 is the sole determinant of purine riboswitch specificity. In addition, the mutant riboswitch binds adenine and adenine derivatives well compared with the guanine-responsive riboswitch. Under our experimental conditions, 2,6-diaminopurine binds the RNA with DeltaH=-40.3 kcal mol(-1), DeltaS=-97.6 cal mol(-1)K(-1), and DeltaG=-10.73 kcal mol(-1). A kinetic determination of the slow rate (0.15 x 10(5)M(-1)s(-1) and 2.1 x 10(5)mM(-1)s(-1) for 2-aminopurine binding the adenine-responsive mutant riboswitch and 7-deazaguanine-binding guanine riboswitch, respectively) of association under varying experimental conditions allowed us to propose a mechanism for ligand recognition by the purine riboswitch. A conformationally dynamic unliganded state for the binding pocket is stabilized first by the Watson-Crick base pairing between the ligand and Y74, and by the subsequent ordering of the J2/3 loop, enclosing the ligand within the three-way junction.

  8. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  9. Impairment of the tRNA-splicing endonuclease subunit 54 (tsen54) gene causes neurological abnormalities and larval death in zebrafish models of pontocerebellar hypoplasia.

    Science.gov (United States)

    Kasher, Paul R; Namavar, Yasmin; van Tijn, Paula; Fluiter, Kees; Sizarov, Aleksander; Kamermans, Maarten; Grierson, Andrew J; Zivkovic, Danica; Baas, Frank

    2011-04-15

    Pontocerebellar hypoplasia (PCH) represents a group (PCH1-6) of neurodegenerative autosomal recessive disorders characterized by hypoplasia and/or atrophy of the cerebellum, hypoplasia of the ventral pons, progressive microcephaly and variable neocortical atrophy. The majority of PCH2 and PCH4 cases are caused by mutations in the TSEN54 gene; one of the four subunits comprising the tRNA-splicing endonuclease (TSEN) complex. We hypothesized that TSEN54 mutations act through a loss of function mechanism. At 8 weeks of gestation, human TSEN54 is expressed ubiquitously in the brain, yet strong expression is seen within the telencephalon and metencephalon. Comparable expression patterns for tsen54 are observed in zebrafish embryos. Morpholino (MO) knockdown of tsen54 in zebrafish embryos results in loss of structural definition in the brain. This phenotype was partially rescued by co-injecting the MO with human TSEN54 mRNA. A developmental patterning defect was not associated with tsen54 knockdown; however, an increase in cell death within the brain was observed, thus bearing resemblance to PCH pathophysiology. Additionally, N-methyl-N-nitrosourea mutant zebrafish homozygous for a tsen54 premature stop-codon mutation die within 9 days post-fertilization. To determine whether a common disease pathway exists between TSEN54 and other PCH-related genes, we also monitored the effects of mitochondrial arginyl-tRNA synthetase (rars2; PCH1 and PCH6) knockdown in zebrafish. Comparable brain phenotypes were observed following the inhibition of both genes. These data strongly support the hypothesis that TSEN54 mutations cause PCH through a loss of function mechanism. Also we suggest that a common disease pathway may exist between TSEN54- and RARS2-related PCH, which may involve a tRNA processing-related mechanism.

  10. Electrochemical Impedance Spectroscopic Sensing of Methamphetamine by a Specific Aptamer

    Directory of Open Access Journals (Sweden)

    Omid Mashinchian

    2012-05-01

    Full Text Available Introduction: Electrochemical impedance spectroscopy (EIS is a simple and highly sensitive technique that can be used for evaluation of the aptamer-target interaction even in a label-free approach. Methods: To pursue the effectiveness of EIS, in the current study, the folding properties of specific aptamer for methamphetamine (METH (i.e., aptaMETH were evaluated in the presence of METH and amphetamine (Amph. Folded and unfolded aptaMETH was mounted on the gold electrode surface and the electron charge transfer was measured by EIS. Results: The Ret of methamphetamine-aptaMETH was significantly increased in comparison with other folding conditions, indicating specific detection of METH by aptaMETH. Conclusion: Based on these findings, methamphetamine-aptaMETH on the gold electrode surface displayed the most interfacial electrode resistance and thus the most folding situation. This clearly indicates that the aptaMETH can profoundly and specifically pinpoint METH; as a result we suggest utilization of this methodology for fast and cost-effective identification of METH.

  11. Harnessing Aptamers to Overcome Challenges in Gluten Detection.

    Science.gov (United States)

    Miranda-Castro, Rebeca; de-los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

    2016-04-20

    Celiac disease is a lifelong autoimmune disorder triggered by foods containing gluten, the storage protein in wheat, rye, and barley. The rapidly escalating number of patients diagnosed with this disease poses a great challenge to both food industry and authorities to guarantee food safety for all. Therefore, intensive efforts are being made to establish minimal disease-eliciting doses of gluten and consequently to improve gluten-free labeling. These efforts depend to a high degree on the availability of methods capable of detecting the protein in food samples at levels as low as possible. Current analytical approaches rely on the use of antibodies as selective recognition elements. With limited sensitivity, these methods exhibit some deficiencies that compromise the accuracy of the obtained results. Aptamers provide an ideal alternative for designing biosensors for fast and selective measurement of gluten in foods. This article highlights the challenges in gluten detection, the current status of the use of aptamers for solving this problem, and what remains to be done to move these systems into commercial applications.

  12. Miniaturized Aptamer-Based Assays for Protein Detection

    Directory of Open Access Journals (Sweden)

    Alessandro Bosco

    2016-09-01

    Full Text Available The availability of devices for cancer biomarker detection at early stages of the disease is one of the most critical issues in biomedicine. Towards this goal, to increase the assay sensitivity, device miniaturization strategies empowered by the employment of high affinity protein binders constitute a valuable approach. In this work we propose two different surface-based miniaturized platforms for biomarker detection in body fluids: the first platform is an atomic force microscopy (AFM-based nanoarray, where AFM is used to generate functional nanoscale areas and to detect biorecognition through careful topographic measurements; the second platform consists of a miniaturized electrochemical cell to detect biomarkers through electrochemical impedance spectroscopy (EIS analysis. Both devices rely on robust and highly-specific protein binders as aptamers, and were tested for thrombin detection. An active layer of DNA-aptamer conjugates was immobilized via DNA directed immobilization on complementary single-stranded DNA self-assembled monolayers confined on a nano/micro area of a gold surface. Results obtained with these devices were compared with the output of surface plasmon resonance (SPR assays used as reference. We succeeded in capturing antigens in concentrations as low as a few nM. We put forward ideas to push the sensitivity further to the pM range, assuring low biosample volume (μL range assay conditions.

  13. Screening and Initial Binding Assessment of Fumonisin B1 Aptamers

    Directory of Open Access Journals (Sweden)

    Maria C. DeRosa

    2010-11-01

    Full Text Available Fumonisins are mycotoxins produced by Fusarium verticillioides and F. proliferatum, fungi that are ubiquitous in corn (maize. Insect damage and some other environmental conditions result in the accumulation of fumonisins in corn-based products worldwide. Current methods of fumonisin detection rely on the use of immunoaffinity columns and high-performance liquid chromatography (HPLC. The use of aptamers offers a good alternative to the use of antibodies in fumonisin cleanup and detection due to lower costs and improved stability. Aptamers are single-stranded oligonucleotides that are selected using Systematic Evolution of Ligands by EXponential enrichment (SELEX for their ability to bind to targets with high affinity and specificity. Sequences obtained after 18 rounds of SELEX were screened for their ability to bind to fumonisin B1. Six unique sequences were obtained, each showing improved binding to fumonisin B1 compared to controls. Sequence FB1 39 binds to fumonisin with a dissociation constant of 100 ± 30 nM and shows potential for use in fumonisin biosensors and solid phase extraction columns.

  14. Screening and initial binding assessment of fumonisin b(1) aptamers.

    Science.gov (United States)

    McKeague, Maureen; Bradley, Charlotte R; De Girolamo, Annalisa; Visconti, Angelo; Miller, J David; Derosa, Maria C

    2010-01-01

    Fumonisins are mycotoxins produced by Fusarium verticillioides and F. proliferatum, fungi that are ubiquitous in corn (maize). Insect damage and some other environmental conditions result in the accumulation of fumonisins in corn-based products worldwide. Current methods of fumonisin detection rely on the use of immunoaffinity columns and high-performance liquid chromatography (HPLC). The use of aptamers offers a good alternative to the use of antibodies in fumonisin cleanup and detection due to lower costs and improved stability. Aptamers are single-stranded oligonucleotides that are selected using Systematic Evolution of Ligands by EXponential enrichment (SELEX) for their ability to bind to targets with high affinity and specificity. Sequences obtained after 18 rounds of SELEX were screened for their ability to bind to fumonisin B(1). Six unique sequences were obtained, each showing improved binding to fumonisin B(1) compared to controls. Sequence FB(1) 39 binds to fumonisin with a dissociation constant of 100 ± 30 nM and shows potential for use in fumonisin biosensors and solid phase extraction columns.

  15. Electrochemical Impedance Spectroscopic Sensing of Methamphetamine by a Specific Aptamer

    Science.gov (United States)

    Ebrahimi, Mohsen; Johari-Ahar, Mohammad; Hamzeiy, Hossein; Barar, Jaleh; Mashinchian, Omid; Omidi, Yadollah

    2012-01-01

    Introduction Electrochemical impedance spectroscopy (EIS) is a simple and highly sensitive technique that can be used for evaluation of the aptamer-target interaction even in a label-free approach. Methods To pursue the effectiveness of EIS, in the current study, the folding properties of specific aptamer for methamphetamine (METH) (i.e., aptaMETH) were evaluated in the presence of METH and amphetamine (Amph). Folded and unfolded aptaMETH was mounted on the gold electrode surface and the electron charge transfer was measured by EIS. Results The Ret of methamphetamine-aptaMETH was significantly increased in comparison with other folding conditions, indicating specific detection of METH by aptaMETH. Conclusion Based on these findings, methamphetamine-aptaMETH on the gold electrode surface displayed the most interfacial electrode resistance and thus the most folding situation. This clearly indicates that the aptaMETH can profoundly and specifically pinpoint METH; as a result we suggest utilization of this methodology for fast and cost-effective identification of METH. PMID:23678446

  16. From the RNA world to the clinic.

    Science.gov (United States)

    Sullenger, Bruce A; Nair, Smita

    2016-06-17

    The study of RNA has continually emphasized the structural and functional versatility of RNA molecules. This versatility has inspired translational and clinical researchers to explore the utility of RNA-based therapeutic agents for a wide variety of medical applications. Several RNA therapeutics, with diverse modes of action, are being evaluated in large late-stage clinical trials, and many more are in early clinical development. Hundreds of patients are enrolled in large trials testing messenger RNAs to combat cancer, small interfering RNAs to treat renal and hepatic disorders, and aptamers to combat ocular and cardiovascular disease. Results from these studies are generating considerable interest among the biomedical community and the public and will be important for the future development of this emerging class of therapeutic agents.

  17. Partial tandem duplication of mtDNA-tRNA(Phe) impairs mtDNA translation in late-onset mitochondrial myopathy.

    Science.gov (United States)

    Arzuffi, Paola; Lamperti, Costanza; Fernandez-Vizarra, Erika; Tonin, Paola; Morandi, Lucia; Zeviani, Massimo

    2012-01-01

    An 80-year-old woman (PI) has been suffering of late onset progressive weakness and wasting of lower-limb muscles, accompanied by high creatine kinase levels in blood. A muscle biopsy, performed at 63 years, showed myopathic features with partial deficiency of cytochrome c oxidase. A second biopsy taken 7 years later confirmed the presence of a mitochondrial myopathy but also of vacuolar degeneration and other morphological features resembling inclusion body myopathy. Her 46-year-old daughter (PII) and 50-year-old son (PIII) are clinically normal, but the creatine kinase levels were moderately elevated and the EMG was consistently myopathic in both. Analysis of mitochondrial DNA sequence revealed in all three patients a novel, homoplasmic 15 bp tandem duplication adjacent to the 5' end of mitochondrial tRNA(Phe) gene, encompassing the first 11 nucleotides of this gene and the four terminal nucleotides of the adjacent D-loop region. Both mutant fibroblasts and cybrids showed low oxygen consumption rate, reduced mitochondrial protein synthesis, and decreased mitochondrial tRNA(Phe) amount. These findings are consistent with an unconventional pathogenic mechanism causing the tandem duplication to interfere with the maturation of the mitochondrial tRNA(Phe) transcript.

  18. Increased expression of microRNA-221 inhibits PAK1 in endothelial progenitor cells and impairs its function via c-Raf/MEK/ERK pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiaoping; Mao, Haian [Department of Nuclear Medicine, Shanghai 10th People’s Hospital, Tongji University School of Medicine, Shanghai 200072 (China); Chen, Jin-yuan [Department of Gastrointestinal Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang 524001 (China); Wen, Shengjun [Department of Anatomy and neurobiology, School of Medicine, Tongji University, Shanghai 200072 (China); Li, Dan; Ye, Meng [Department of Nuclear Medicine, Shanghai 10th People’s Hospital, Tongji University School of Medicine, Shanghai 200072 (China); Lv, Zhongwei, E-mail: zhongweilv126@126.com [Department of Nuclear Medicine, Shanghai 10th People’s Hospital, Tongji University School of Medicine, Shanghai 200072 (China)

    2013-02-15

    Highlights: ► MicroRNA-221 is upregulated in the endothelial progenitor cells of atherosclerosis patients. ► PAK1 is a direct target of microRNA-221. ► MicroRNA-221 inhibits EPCs proliferation through c-Raf/MEK/ERK pathway. -- Abstract: Coronary artery disease (CAD) is associated with high mortality and occurs via endothelial injury. Endothelial progenitor cells (EPCs) restore the integrity of the endothelium and protect it from atherosclerosis. In this study, we compared the expression of microRNAs (miRNAs) in EPCs in atherosclerosis patients and normal controls. We found that miR-221 expression was significantly up-regulated in patients compared with controls. We predicted and identified p21/Cdc42/Rac1-activated kinase 1 (PAK1) as a novel target of miR-221 in EPCs. We also demonstrated that miR-221 targeted a putative binding site in the 3′UTR of PAK1, and absence of this site was inversely associated with miR-221 expression in EPCs. We confirmed this relationship using a luciferase reporter assay. Furthermore, overexpression of miR-221 in EPCs significantly decreased EPC proliferation, in accordance with the inhibitory effects induced by decreased PAK1. Overall, these findings demonstrate that miR-221 affects the MEK/ERK pathway by targeting PAK1 to inhibit the proliferation of EPCs.

  19. Mutation in WDR4 impairs tRNA m(7)G46 methylation and causes a distinct form of microcephalic primordial dwarfism.

    Science.gov (United States)

    Shaheen, Ranad; Abdel-Salam, Ghada M H; Guy, Michael P; Alomar, Rana; Abdel-Hamid, Mohamed S; Afifi, Hanan H; Ismail, Samira I; Emam, Bayoumi A; Phizicky, Eric M; Alkuraya, Fowzan S

    2015-09-28

    Primordial dwarfism is a state of extreme prenatal and postnatal growth deficiency, and is characterized by marked clinical and genetic heterogeneity. Two presumably unrelated consanguineous families presented with an apparently novel form of primordial dwarfism in which severe growth deficiency is accompanied by distinct facial dysmorphism, brain malformation (microcephaly, agenesis of corpus callosum, and simplified gyration), and severe encephalopathy with seizures. Combined autozygome/exome analysis revealed a novel missense mutation in WDR4 as the likely causal variant. WDR4 is the human ortholog of the yeast Trm82, an essential component of the Trm8/Trm82 holoenzyme that effects a highly conserved and specific (m(7)G46) methylation of tRNA. The human mutation and the corresponding yeast mutation result in a significant reduction of m(7)G46 methylation of specific tRNA species, which provides a potential mechanism for primordial dwarfism associated with this lesion, since reduced m(7)G46 modification causes a growth deficiency phenotype in yeast. Our study expands the number of biological pathways underlying primordial dwarfism and adds to a growing list of human diseases linked to abnormal tRNA modification.

  20. Efficient isolation and elution of cellular proteins using aptamer-mediated protein precipitation assay.

    Science.gov (United States)

    Kim, Kiseok; Lee, SeungJin; Ryu, Sungho; Han, Dongil

    2014-05-23

    Protein precipitation is one of the most widely used methods for antigen detection and purification in biological research. We developed a reproducible aptamer-mediated magnetic protein precipitation method that is able to efficiently capture, purify and isolate the target proteins. We discovered DNA aptamers having individually high affinity and specificity against human epidermal growth factor receptor (EGFR) and human insulin receptor (INSR). Using aptamers and magnetic beads, we showed it is highly efficient technique to enrich endogenous proteins complex and is applicable to identify physiologically relevant protein-protein interactions with minimized nonspecific binding of proteins. The results presented here indicate that aptamers would be applicable as a useful and cost-effective tool to identify the presence of the particular target protein with their specific protein partners.