Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features.

Science.gov (United States)

Hammond, R W

2003-06-01

Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

Diversity of Papaya ringspot virus isolates in Puerto Rico

Science.gov (United States)

Papaya ringspot virus (PRSV) devastates papaya production worldwide. In Puerto Rico, papaya fields can be completely infected with PRSV within a year of planting. Information about the diversity of the Puerto Rican PRSV population is relevant in order to establish a control strategy in the island. T...

Preliminary X-ray Data Analysis of Crystalline Hibiscus Chlorotic Ringspot Virus

Energy Technology Data Exchange (ETDEWEB)

Cheng, A.; Speir, J; Yuan, Y; Johnson, J; Wong, S

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3Synchrotron .2 A resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 . Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

Molecular characterization of Prunus necrotic ringspot virus isolated from rose in Brazil

Directory of Open Access Journals (Sweden)

Thor Vinícius Martins Fajardo

2015-12-01

Full Text Available ABSTRACT: There is no molecular characterization of Brazilian isolates of Prunus necrotic ringspot virus (PNRSV, except for those infecting peach. In this research, the causal agent of rose mosaic was determined and the movement (MP and coat (CP protein genes of a PNRSV isolate from rose were molecularly characterized for the first time in Brazil. The nucleotide and deduced amino acid sequences of MP and CP complete genes were aligned and compared with other isolates. Molecular analysis of the MP and CP nucleotide sequences of a Brazilian PNRSV isolate from rose and others from this same host showed highest identities of 96.7% and 98.6%, respectively, and Rose-Br isolate was classified in PV32 group.

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.

Science.gov (United States)

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2012-05-01

We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús

2010-07-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

Recognition of cis-acting sequences in RNA 3 of Prunus necrotic ringspot virus by the replicase of Alfalfa mosaic virus.

Science.gov (United States)

Aparicio, F; Sánchez-Navarro, J A; Olsthoorn, R C; Pallás, V; Bol, J F

2001-04-01

Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) belong to the genera ALFAMOVIRUS: and ILARVIRUS:, respectively, of the family BROMOVIRIDAE: Initiation of infection by AMV and PNRSV requires binding of a few molecules of coat protein (CP) to the 3' termini of the inoculum RNAs and the CPs of the two viruses are interchangeable in this early step of the replication cycle. CIS:-acting sequences in PNRSV RNA 3 that are recognized by the AMV replicase were studied in in vitro replicase assays and by inoculation of AMV-PNRSV RNA 3 chimeras to tobacco plants and protoplasts transformed with the AMV replicase genes (P12 plants). The results showed that the AMV replicase recognized the promoter for minus-strand RNA synthesis in PNRSV RNA 3 but not the promoter for plus-strand RNA synthesis. A chimeric RNA with PNRSV movement protein and CP genes accumulated in tobacco, which is a non-host for PNRSV.

DIAGNOSTICS OF VIRUS PHYTOPATHOGENS FRUIT TREE PLUM POX VIRUS, PRUNUS NECROTIC RINGSPOT VIRUS AND PRUNUS DWARF VIRUS BY BIOLOGICAL AND MOLECULAR DIAGNOSTICS

OpenAIRE

Július Rozák; Zdenka Gálová

2013-01-01

The aim of this study was to determine the incidence of viral phytopathogen Plum pox virus, Prunus necrotic ringspot virus and Prunus dwarf virus in selected localities of Slovakia and diagnose them using a molecular and biological methods. Forty samples of fruit trees of the genus Prunus, twenty samples from intensive plantings and twenty samples from wild subject were analysed. Biological diagnostic by using biological indicators Prunus persica cv. GF 305, Prunus serrulata cv. Schirofugen a...

Adaptive covariation between the coat and movement proteins of prunus necrotic ringspot virus.

Science.gov (United States)

Codoñer, Francisco M; Fares, Mario A; Elena, Santiago F

2006-06-01

The relative functional and/or structural importance of different amino acid sites in a protein can be assessed by evaluating the selective constraints to which they have been subjected during the course of evolution. Here we explore such constraints at the linear and three-dimensional levels for the movement protein (MP) and coat protein (CP) encoded by RNA 3 of prunus necrotic ringspot ilarvirus (PNRSV). By a maximum-parsimony approach, the nucleotide sequences from 46 isolates of PNRSV varying in symptomatology, host tree, and geographic origin have been analyzed and sites under different selective pressures have been identified in both proteins. We have also performed covariation analyses to explore whether changes in certain amino acid sites condition subsequent variation in other sites of the same protein or the other protein. These covariation analyses shed light on which particular amino acids should be involved in the physical and functional interaction between MP and CP. Finally, we discuss these findings in the light of what is already known about the implication of certain sites and domains in structure and protein-protein and RNA-protein interactions.

Incidence of Prunus necrotic ringspot virus in Jordan

Directory of Open Access Journals (Sweden)

N. Salem

2003-12-01

Full Text Available A survey of Prunus necrotic ringspot virus (PNRSV incidence in Jordan stone-fruit growing areas was conducted during 2000–2002. A total of 2552 samples were collected from 72 commercial orchards, a mother block, 15 nurseries, and a varietal collection. A total of 208 almond, 451 apricot, 149 cherry, 250 nectarine, 1016 peach, and 478 plum trees were tested individually for PNRSV by the double-antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA. Around 15% of tested samples were infected with PNRSV. The virus incidence in almond, nectarine, plum, peach, cherry, and apricot was 24, 16, 16, 14, 13, and 10% of tested trees respectively. The level of viral infection was highest in the mother block (19%, and lowest in the samples from the nurseries (10%.

Hibiscus Chlorotic Ringspot Virus Coat Protein Is Essential for Cell-to-Cell and Long-Distance Movement but Not for Viral RNA Replication

Science.gov (United States)

Niu, Shengniao; Gil-Salas, Francisco M.; Tewary, Sunil Kumar; Samales, Ashwin Kuppusamy; Johnson, John; Swaminathan, Kunchithapadam; Wong, Sek-Man

2014-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP) functions on virus replication and movement in kenaf (Hibiscus cannabinus L.), two HCRSV mutants, designated as p2590 (A to G) in which the first start codon ATG was replaced with GTG and p2776 (C to G) in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G) were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G) was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G) inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro. PMID:25402344

Hibiscus chlorotic ringspot virus coat protein is essential for cell-to-cell and long-distance movement but not for viral RNA replication.

Directory of Open Access Journals (Sweden)

Shengniao Niu

Full Text Available Hibiscus chlorotic ringspot virus (HCRSV is a member of the genus Carmovirus in the family Tombusviridae. In order to study its coat protein (CP functions on virus replication and movement in kenaf (Hibiscus cannabinus L., two HCRSV mutants, designated as p2590 (A to G in which the first start codon ATG was replaced with GTG and p2776 (C to G in which proline 63 was replaced with alanine, were constructed. In vitro transcripts of p2590 (A to G were able to replicate to a similar level as wild type without CP expression in kenaf protoplasts. However, its cell-to-cell movement was not detected in the inoculated kenaf cotyledons. Structurally the proline 63 in subunit C acts as a kink for β-annulus formation during virion assembly. Progeny of transcripts derived from p2776 (C to G was able to move from cell-to-cell in inoculated cotyledons but its long-distance movement was not detected. Virions were not observed in partially purified mutant virus samples isolated from 2776 (C to G inoculated cotyledons. Removal of the N-terminal 77 amino acids of HCRSV CP by trypsin digestion of purified wild type HCRSV virions resulted in only T = 1 empty virus-like particles. Taken together, HCRSV CP is dispensable for viral RNA replication but essential for cell-to-cell movement, and virion is required for the virus systemic movement. The proline 63 is crucial for HCRSV virion assembly in kenaf plants and the N-terminal 77 amino acids including the β-annulus domain is required in T = 3 assembly in vitro.

Rapid Detection of Prunus Necrotic Ringspot Virus by Reverse Transcription-cross-priming Amplification Coupled with Nucleic Acid Test Strip Cassette.

Science.gov (United States)

Huo, Ya-Yun; Li, Gui-Fen; Qiu, Yan-Hong; Li, Wei-Min; Zhang, Yong-Jiang

2017-11-23

Prunus necrotic ringspot virus (PNRSV) is one of the most devastating viruses to Prunus spp. In this study, we developed a diagnostic system RT-CPA-NATSC, wherein reverse transcription-cross-priming amplification (RT-CPA) is coupled with nucleic acid test strip cassette (NATSC), a vertical flow (VF) visualization, for PNRSV detection. The RT-CPA-NATSC assay targets the encoding gene of the PNRSV coat protein with a limit of detection of 72 copies per reaction and no cross-reaction with the known Prunus pathogenic viruses and viroids, demonstrating high sensitivity and specificity. The reaction is performed on 60 °C and can be completed less than 90 min with the prepared template RNA. Field sample test confirmed the reliability of RT-CPA-NATSC, indicating the potential application of this simple and rapid detection method in routine test of PNRSV.

Survey of Prunus necrotic ringspot virus in Rose and Its Variability in Rose and Prunus spp.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2001-01-01

ABSTRACT A survey for viruses in rose propagated in Europe resulted in detection of only Prunus necrotic ringspot virus (PNRSV) among seven viruses screened. Four percent of cut-flower roses from different sources were infected with PNRSV. Progression of the disease under greenhouse conditions was very slow, which should make this virus easy to eradicate through sanitary selection. Comparison of the partial coat protein gene sequences for three representative rose isolates indicated that they do not form a distinct phylogenetic group and show close relations to Prunus spp. isolates. However, a comparison of the reactivity of monoclonal antibodies raised against these isolates showed that the most prevalent PNRSV serotype in rose was different from the most prevalent serotype in Prunus spp. All of the 27 rose isolates tested infected P. persica seedlings, whereas three of the four PNRSV isolates tested from Prunus spp. were poorly infectious in Rosa indica plants. These data suggest adaptation of PNRSV isolates from Prunus spp., but not from rose, to their host plants. The test methodologies developed here to evaluate PNRSV pathogenicity in Prunus spp. and rose could also help to screen for resistant genotypes.

Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

Science.gov (United States)

Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

2012-10-01

The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1998-09-01

A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

Science.gov (United States)

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Whole-Genome Characterization of Prunus necrotic ringspot virus Infecting Sweet Cherry in China.

Science.gov (United States)

Wang, Jiawei; Zhai, Ying; Zhu, Dongzi; Liu, Weizhen; Pappu, Hanu R; Liu, Qingzhong

2018-03-01

Prunus necrotic ringspot virus (PNRSV) causes yield loss in most cultivated stone fruits, including sweet cherry. Using a small RNA deep-sequencing approach combined with end-genome sequence cloning, we identified the complete genomes of all three PNRSV strands from PNRSV-infected sweet cherry trees and compared them with those of two previously reported isolates. Copyright © 2018 Wang et al.

Molecular Variability Among Isolates of Prunus Necrotic Ringspot Virus from Different Prunus spp.

Science.gov (United States)

Aparicio, F; Myrta, A; Di Terlizzi, B; Pallás, V

1999-11-01

ABSTRACT Viral sequences amplified by polymerase chain reaction from 25 isolates of Prunus necrotic ringspot virus (PNRSV), varying in the symptomatology they cause in six different Prunus spp., were analyzed for restriction fragment polymorphisms. Most of the isolates could be discriminated by using a combination of three different restriction enzymes. The nucleotide sequences of the RNA 4 of 15 of these isolates were determined. Sequence comparisons and phylogenetic analyses of the RNA 4 and coat proteins (CPs) revealed that all of the isolates clustered into three different groups, represented by three previously sequenced PNRSV isolates: PV32, PE5, and PV96. The PE5-type group was characterized by a 5' untranslated region that was clearly different from that of the other two groups. The PV32-type group was characterized by an extra hexanucleotide consisting of a duplication of the six immediately preceding nucleotides. Although most of the variability was observed in the first third of the CP, the amino acid residues in this region, which were previously thought to be functionally important in the replication cycle of the virus, were strictly conserved. No clear correlation with the type of symptom or host specificity could be observed. The validity of this grouping was confirmed when other isolates recently characterized by other authors were included in these analyses.

Variability and molecular typing of the woody-tree infecting prunus necrotic ringspot ilarvirus.

Science.gov (United States)

Vasková, D; Petrzik, K; Karesová, R

2000-01-01

The 3'-part of the movement protein gene, the intergenic region and the complete coat protein gene of sixteen isolates of Prunus necrotic ringspot virus (PNRSV) from five different host species from the Czech Republic were sequenced in order to search for the bases of extensive variability of viroses caused by this pathogen. According to phylogenetic analyses all the 46 isolates sequenced to date split into three main groups, which correlated to a certain extend with their geographic origin. Modelled serological properties showed that all the new isolates belong to one serotype.

Blueberry (Vaccinium corymbosum)-Virus Diseases

Science.gov (United States)

At least six viruses have been found in highbush blueberry plantings in the Pacific Northwest: Blueberry mosaic virus, Blueberry red ringspot virus, Blueberry scorch virus, Blueberry shock virus, Tobacco ringspot virus, and Tomato ringspot virus. Six other virus and virus-like diseases of highbush b...

Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

Science.gov (United States)

Sánchez-Navarro, J A; Pallás, V

1997-01-01

The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

Tests for Transmission of Prunus Necrotic Ringspot and Two Nepoviruses by Criconemella xenoplax.

Science.gov (United States)

Yuan, W Q; Barnett, O W; Westcott, S W; Scott, S W

1990-10-01

In two of three trials, detectable color reactions in ELISA for Prunus necrotic ringspot virus (PNRSV) were observed for Criconemella xenoplax handpicked from the root zone of infected peach trees. Criconemella xenoplax (500/pot) handpicked from root zones of peach trees infected with PNRSV failed to transmit the virus to cucumber or peach seedlings. The nematode also failed to transmit tomato ringspot (TomRSV) or tobacco ringspot viruses between cucumbers, although Xiphinema americanum transmitted TomRSV under the same conditions. Plants of peach, cucumber, Chenopodium quinoa, and Catharanthus roseus were not infected by PNRSV when grown in soil containing C. xenoplax collected from root zones of PNRSV-infected trees. Shirofugen cherry scions budded on Mazzard cherry seedling rootstocks remained symptomless when transplanted into root zones of PNRSV-infected trees. Virus transmission was not detected by ELISA when C. xenoplax individuals were observed to feed on cucumber root explants that were infected with PNRSV and subsequently fed on roots of Prunus besseyi in agar cultures. Even if virus transmission by C. xenoplax occurs via contamination rather than by a specific mechanism, it must be rare.

Vertical transmission of Prunus necrotic ringspot virus: hitch-hiking from gametes to seedling.

Science.gov (United States)

Amari, Khalid; Burgos, Lorenzo; Pallás, Vicente; Sánchez-Pina, Maria Amelia

2009-07-01

The aim of this work was to follow Prunus necrotic ringspot virus (PNRSV) infection in apricot reproductive tissues and transmission of the virus to the next generation. For this, an analysis of viral distribution in apricot reproductive organs was carried out at different developmental stages. PNRSV was detected in reproductive tissues during gametogenesis. The virus was always present in the nucellus and, in some cases, in the embryo sac. Studies within infected seeds at the embryo globular stage revealed that PNRSV infects all parts of the seed, including embryo, endosperm and testa. In the torpedo and bent cotyledon developmental stages, high concentrations of the virus were detected in the testa and endosperm. At seed maturity, PNRSV accumulated slightly more in the embryo than in the cotyledons. In situ hybridization showed the presence of PNRSV RNA in embryos obtained following hand-pollination of virus-free pistils with infected pollen. Interestingly, tissue-printing from fruits obtained from these pistils showed viral RNA in the periphery of the fruits, whereas crosses between infected pistils and infected pollen resulted in a total invasion of the fruits. Taken together, these results shed light on the vertical transmission of PNRSV from gametes to seedlings.

Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

Energy Technology Data Exchange (ETDEWEB)

Ramalho, T.O.; Figueira, A.R.; Sotero, A.J. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Wang, R. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Geraldino Duarte, P.S. [Universidade Federal de Lavras, Departamento de Fitopatologia, Caixa Postal 3037, CEP 37200-000 Lavras, MG (Brazil); Farman, M. [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States); Goodin, M.M., E-mail: mgoodin@uky.edu [Department of Plant Pathology, University of Kentucky, Lexington, KY 40546 (United States)

2014-09-15

The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays.

Characterization of Coffee ringspot virus-Lavras: A model for an emerging threat to coffee production and quality

International Nuclear Information System (INIS)

Ramalho, T.O.; Figueira, A.R.; Sotero, A.J.; Wang, R.; Geraldino Duarte, P.S.; Farman, M.; Goodin, M.M.

2014-01-01

The emergence of viruses in Coffee (Coffea arabica and Coffea canephora), the most widely traded agricultural commodity in the world, is of critical concern. The RNA1 (6552 nt) of Coffee ringspot virus is organized into five open reading frames (ORFs) capable of encoding the viral nucleocapsid (ORF1p), phosphoprotein (ORF2p), putative cell-to-cell movement protein (ORF3p), matrix protein (ORF4p) and glycoprotein (ORF5p). Each ORF is separated by a conserved intergenic junction. RNA2 (5945 nt), which completes the bipartite genome, encodes a single protein (ORF6p) with homology to RNA-dependent RNA polymerases. Phylogenetic analysis of L protein sequences firmly establishes CoRSV as a member of the recently proposed Dichorhavirus genus. Predictive algorithms, in planta protein expression, and a yeast-based nuclear import assay were used to determine the nucleophillic character of five CoRSV proteins. Finally, the temperature-dependent ability of CoRSV to establish systemic infections in an initially local lesion host was quantified. - Highlights: • We report genome sequence determination for Coffee ringspot virus (CoRSV). • CoRSV should be considered a member of the proposed Dichorhavirus genus. • We report temperature-dependent systemic infection of an initially local lesion host. • We report in planta protein and localization data for five CoRSV proteins. • In silico predictions of the CoRSV proteins were validated using in vivo assays

The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA.

Science.gov (United States)

Aparicio, Frederic; Vilar, Marçal; Perez-Payá, Enrique; Pallás, Vicente

2003-08-15

Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg(2+), lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera.

The coat protein of prunus necrotic ringspot virus specifically binds to and regulates the conformation of its genomic RNA

International Nuclear Information System (INIS)

Aparicio, Frederic; Vilar, Marcal; Perez-Paya, Enrique; Pallas, Vicente

2003-01-01

Binding of coat protein (CP) to the 3' nontranslated region (3'-NTR) of viral RNAs is a crucial requirement to establish the infection of Alfamo- and Ilarviruses. In vitro binding properties of the Prunus necrotic ringspot ilarvirus (PNRSV) CP to the 3'-NTR of its genomic RNA using purified E. coli- expressed CP and different synthetic peptides corresponding to a 26-residue sequence near the N-terminus were investigated by electrophoretic mobility shift assays. PNRSV CP bound to, at least, three different sites existing on the 3'-NTR. Moreover, the N-terminal region between amino acid residues 25 to 50 of the protein could function as an independent RNA-binding domain. Single exchange of some arginine residues by alanine eliminated the RNA-interaction capacity of the synthetic peptides, consistent with a crucial role for Arg residues common to many RNA-binding proteins possessing Arg-rich domains. Circular dichroism spectroscopy revealed that the RNA conformation is altered when amino-terminal CP peptides bind to the viral RNA. Finally, mutational analysis of the 3'-NTR suggested the presence of a pseudoknotted structure at this region on the PNRSV RNA that, when stabilized by the presence of Mg 2+ , lost its capability to bind the coat protein. The existence of two mutually exclusive conformations for the 3'-NTR of PNRSV strongly suggests a similar regulatory mechanism at the 3'-NTR level in Alfamo- and Ilarvirus genera

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

Science.gov (United States)

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Line 63-1: A New Virus-resistant Transgenic Papaya

NARCIS (Netherlands)

Tennant, P.; Souza, M.T.; Fitch, M.M.; Manshardt, R.; Slightom, J.L.; Gonsalves, D.

2005-01-01

The disease resistance of a transgenic line expressing the coat protein (CP) gene of the mild strain of the papaya ringspot virus (PRSV) from Hawaii was further analyzed against PRSV isolates from Hawaii and other geographical regions. Line 63-1 originated from the same transformation experiment

Seasonal variation of Prunus necrotic ringspot virus concentration in almond, peach, and plum cultivars

Directory of Open Access Journals (Sweden)

N. Salem

2003-08-01

Full Text Available Levels of Prunus necrotic ringspot virus (PNRSV infection in almond, peach, and plum cultivars over the course of an entire year were determined by testing different plant parts of naturally infected trees, using the double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA. The data showed that spring was the best time of year for PNRSV detection in flowers, active growing buds, and young leaves. PNRSV detection was less reliable during the summer months. Young leaves of all cultivars were the most reliable source for distinguishing between healthy and infected plants, while flowers and buds yielded high values in some cultivars but not in others. Seasonal fluctuations in virus concentration did not follow the same pattern in all cultivars. It is therefore impossible to distinguish between infected and healthy trees on the basis of one single sampling time for all cultivars.

Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

Science.gov (United States)

Boulila, Moncef

2010-06-01

To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

Interaction effect of gamma rays and thermal neutrons on the inactivation of odontoglossum ringspot virus isolated from orchid

International Nuclear Information System (INIS)

Mori, Itsuhiko; Inouye, Narinobu.

1977-01-01

The effect of gamma rays or thermal neutrons and their interaction effects on the inactivation of the infectivity of Odontoglossum ringspot virus (ORSV) in buffered crude sap of the plant tissue were studied. The inactivation effect of gamma ray on ORSV varied in different ionic strength of the phosphate buffer solutions. Borax enhanced this effect. In interaction effect of gamma and neutron irradiation, irradiation orders, that is, n → γ and γ → n, gave different inactivation pattern. (author)

Quantitative autoradiography at electronic microscopy level of tobacco cells (Nicotiana tabacum L.) infected by pepper ringspot virus

International Nuclear Information System (INIS)

Lage, G.

1980-06-01

RNA replication of the pepper ringspot virus, its translocation and its association with mitochondria are studied. Some basic aspects of the research are first examined: actinomycin D (AMD) effects on parts of the nucleolus, nucleus and cytoplasm of healthy - and infected cells; comparative study between the circle method and the planimetry method to determine the cell areas; determination of the proportion between the silver grain densities of nucleulus, nucleus and cytoplasm of the cells treated with AMD; determination of the HD (Half-Distance) for the working conditions. Use of the mathemathical model proposed by NADLER gives basic information with respect to the translocation and association of the virus with the mitochondria in the host cells: in the mitochondria associated system the silver grains covering the two components are predominantly constituted by the RNA of the radioactive virus (78%); the time necessary for the RNA synthesis, the virus maturity and its translocation to the mitochondria, (checked by U-5- 3 H treatment) can be shorter than 5 hours. (M.A.) [pt

Prunus necrotic ringspot virus Early Invasion and Its Effects on Apricot Pollen Grain Performance.

Science.gov (United States)

Amari, Khalid; Burgos, Lorenzo; Pallas, Vicente; Sanchez-Pina, María Amelia

2007-08-01

ABSTRACT The route of infection and the pattern of distribution of Prunus necrotic ringspot virus (PNRSV) in apricot pollen were studied. PNRSV was detected both within and on the surface of infected pollen grains. The virus invaded pollen during its early developmental stages, being detected in pollen mother cells. It was distributed uniformly within the cytoplasm of uni- and bicellular pollen grains and infected the generative cell. In mature pollen grains, characterized by their triangular shape, the virus was located mainly at the apertures, suggesting that PNRSV distribution follows the same pattern as the cellular components required for pollen tube germination and cell wall tube synthesis. PNRSV also was localized inside pollen tubes, especially in the growth zone. In vitro experiments demonstrated that infection with PNRSV decreases the germination percentage of pollen grains by more than half and delays the growth of pollen tubes by approximately 24 h. However, although PNRSV infection affected apricot pollen grain performance during germination, the presence of the virus did not completely prevent fertilization, because the infected apricot pollen tubes, once germinated, were able to reach the apricot embryo sacs, which, in the climatic conditions of southeastern Spain, mature later than in other climates. Thus, infected pollen still could play an important role in the vertical transmission of PNRSV in apricot.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

OpenAIRE

Herranz, M. Carmen; Sánchez Navarro, Jesús A.; Saurí Peris, Ana; Mingarro Muñoz, Ismael; Pallás Benet, Vicente

2005-01-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive c...

The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3.

Science.gov (United States)

Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T

2001-01-01

In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.

The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

Science.gov (United States)

Rosner, A; Maslenin, L; Spiegel, S

1997-09-01

The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

Incidence of viruses in highbush blueberry (Vaccinium corymbosum L. in Serbia

Directory of Open Access Journals (Sweden)

Jevremović Darko

2016-01-01

Full Text Available A large-scale survey for highbush blueberry (Vaccinium corymbosum L. viruses in Serbia was performed from 2011 to 2015. A total of 81 leaf samples from 15 locations were collected and analyzed for the presence of 8 viruses. Serological ELISA assay was performed to determine the presence of: Blueberry scorch virus (BlScV, Blueberry shock virus (BlShV, Blueberry shoestring virus (BSSV, Blueberry leaf mottle virus (BLMoV, Tobacco ringspot virus (TRSV and Tomato ringspot virus (ToRSV. All samples were tested for the presence of Blueberry red ringspot virus (BRRV by PCR and for Blueberry mosaic-associated virus (BlMaV by RT-PCR test. The analyses confirmed the presence of BlMaV in 8 (9.9% samples and BRRV in 1 (1.2% sample. No BlScV, BlShV, BLMoV, BSSV, TRSV or ToRSV viruses were detected in any of the analyzed samples.

Biomass, virus concentration, and symptomatology of cucurbits infected by mild and severe strains of Papaya ringspot virus

Directory of Open Access Journals (Sweden)

Pacheco Davi Andrade

2003-01-01

Full Text Available Pre-immunization with mild strains of Papaya ringspot virus - type W (PRWV-W has allowed the mosaic disease to be controlled in different cucurbit species, with increases in marketable fruit yield. The objective of this study was to compare virus concentration, biomass and symptomatology of 'Caserta' zucchini squash, 'Menina Brasileira' long-neck squash and 'Crimson Sweet' watermelon plants infected by three mild strains and one severe strain of PRSV-W. Plants were inoculated at the cotyledonary stage, under greenhouse conditions, sampled at 7, 14, 21, 28 and 35 days after inoculation (DAI, and analyzed by PTA-ELISA. The severity of the symptoms was scored according to a scale from 1 to 5, and the fresh and dry biomass of the aerial part of the plants were evaluated at 40 DAI. Concentrations of the mild strains, based on absorbance values of the PTA-ELISA, were lower than the concentration of the severe strain for all species. The mild strains did not cause mosaic in infected plants of all species. Plants of zucchini squash and watermelon infected by the severe strain exhibited severe mosaic symptoms, but the same was not noticed for infected long-neck squash plants. Biomass values from zucchini squash and watermelon plants infected by the mild strains were 1.7 % to 12.4 % lower as compared to healthy plants. Biomass values of zucchini squash and watermelon plants infected by the severe strain presented greater reduction, varying from 29 % to 74 %. However, biomass values of long-neck squash plants infected by the mild and severe strains were similar for all treatments.

Rapid detection of Prunus necrotic ringspot virus using magnetic nanoparticle-assisted reverse transcription loop-mediated isothermal amplification.

Science.gov (United States)

Zong, Xiaojuan; Wang, Wenwen; Wei, Hairong; Wang, Jiawei; Chen, Xin; Xu, Li; Zhu, Dongzi; Tan, Yue; Liu, Qingzhong

2014-11-01

Prunus necrotic ringspot virus (PNRSV) has seriously reduced the yield of Prunus species worldwide. In this study, a highly efficient and specific two-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) was developed to detect PNRSV. Total RNA was extracted from sweet cherry leaf samples using a commercial kit based on a magnetic nanoparticle technique. Transcripts were used as the templates for the assay. The results of this assay can be detected using agarose gel electrophoresis or by assessing in-tube fluorescence after adding SYBR Green I. The assay is highly specific for PNRSV, and it is more sensitive than reverse-transcription polymerase chain reaction (RT-PCR). Restriction enzyme digestion verified further the reliability of this RT-LAMP assay. To our knowledge, this is the first report of the application of RT-LAMP to PNRSV detection in Prunus species. Copyright © 2014 Elsevier B.V. All rights reserved.

Oxidative stress induction by Prunus necrotic ringspot virus infection in apricot seeds.

Science.gov (United States)

Amari, Khalid; Díaz-Vivancos, Pedro; Pallás, Vincente; Sánchez-Pina, María Amelia; Hernández, José Antonio

2007-10-01

Prunus necrotic ringspot rvirus (PNRSV) was able to invade the immature apricot seed including the embryo. The amount of virus was very high inside the embryo compared with that present in the cotyledons. PNRSV infection produced an oxidative stress in apricot seeds as indicated by the increase in lipid peroxidation, measured as thiobarbituric acid-reactive substances. This lipid peroxidation increase was parallelled with an imbalance in the seed antioxidant enzymes. A significant decrease in the ascorbate-GSH cycle enzymes as well as in peroxidase (POX) activity took place in infected seeds, suggesting a low capability to eliminate H2O2. No changes in superoxide dismutase (SOD) or catalase activity were observed. A significant decrease in polyphenoloxidase (PPO) activity was also observed. Native PAGE revealed the presence of three different SOD activity bands in apricot seeds: a Mn-containing SOD and two CuZn-containing SODs. Only an isozyme with catalase, glutathione reductase (GR) or PPO activity was detected in both healthy and infected apricot seeds. Regarding POX staining, three bands with POX activity were detected in native gels in both healthy and infected seeds. The gel results emphasise that the drop detected in POX, GR and PPO activities in PNRSV-infected apricot seeds by kinetic analyses was also evident from the results obtained by native PAGE. The oxidative stress and the imbalance in the antioxidant systems from PNRSV-infected apricot seeds resemble the hypersensitive response observed in some virus-host interactions. This defence mechanism would inactivate PNRSV during seed formation and/or the storage period or even during seed germination. Those results can explain the decrease in seed germination and the low transmission of PNRSV by seeds in apricot trees.

Systemic transport of Alfalfa mosaic virus can be mediated by the movement proteins of several viruses assigned to five genera of the 30K family.

Science.gov (United States)

Fajardo, Thor V M; Peiró, Ana; Pallás, Vicente; Sánchez-Navarro, Jesús

2013-03-01

We previously showed that the movement protein (MP) gene of Alfalfa mosaic virus (AMV) is functionally exchangeable for the cell-to-cell transport of the corresponding genes of Tobacco mosaic virus (TMV), Brome mosaic virus, Prunus necrotic ringspot virus, Cucumber mosaic virus and Cowpea mosaic virus. We have analysed the capacity of the heterologous MPs to systemically transport the corresponding chimeric AMV genome. All MPs were competent in systemic transport but required the fusion at their C terminus of the coat protein-interacting C-terminal 44 aa (A44) of the AMV MP. Except for the TMV MP, the presence of the hybrid virus in upper leaves correlated with the capacity to move locally. These results suggest that all the MPs assigned to the 30K superfamily should be exchangeable not only for local virus movement but also for systemic transport when the A44 fragment is present.

Interaction in vitro between the proteinase of Tomato ringspot virus (genus Nepovirus) and the eukaryotic translation initiation factor iso4E from Arabidopsis thaliana.

Science.gov (United States)

Léonard, Simon; Chisholm, Joan; Laliberté, Jean-François; Sanfaçon, Hélène

2002-08-01

Eukaryotic initiation factor eIF(iso)4E binds to the cap structure of mRNAs leading to assembly of the translation complex. This factor also interacts with the potyvirus VPg and this interaction has been correlated with virus infectivity. In this study, we show an interaction between eIF(iso)4E and the proteinase (Pro) of a nepovirus (Tomato ringspot virus; ToRSV) in vitro. The ToRSV VPg did not interact with eIF(iso)4E although its presence on the VPg-Pro precursor increased the binding affinity of Pro for the initiation factor. A major determinant of the interaction was mapped to the first 93 residues of Pro. Formation of the complex was inhibited by addition of m(7)GTP (a cap analogue), suggesting that Pro-containing molecules compete with cellular mRNAs for eIF(iso)4E binding. The possible implications of this interaction for translation and/or replication of the virus genome are discussed.

Identification of Cherry green ring mottle virus on Sweet Cherry Trees in Korea

Directory of Open Access Journals (Sweden)

In-Sook Cho

2013-12-01

Full Text Available During the 2012 growing season, 154 leaf samples were collected from sweet cherry trees in Hwaseong, Pyeongtaek, Gyeongju, Kimcheon, Daegu, Yeongju and Eumseong and tested for the presence of Cherry green ring mottle virus (CGRMV. PCR products of the expected size (807 bp were obtained from 6 samples. The PCR products were cloned and sequenced. The nucleotide sequences of the clones showed over 88% identities to published coat protein sequences of CGRMV isolates in the GenBank database. The sequences of CGRMV isolates, CGR-KO 1−6 shared 98.8 to 99.8% nucleotide and 99.6 to 100% amino acid similarities. Phylogenetic analysis indicated that the Korean CGRMV isolates belong to the group II of CGRMV coat protein genes. The CGRMV infected sweet cherry trees were also tested for Apple chlorotic leaf spot virus (ACLSV, Apple mosaic virus (ApMV, Cherry necrotic rusty mottle virus (CNRMV, Cherry mottle leaf virus (CMLV, Cherry rasp leaf virus (CRLV, Cherry leafroll virus (CLRV, Cherry virus A (CVA, Little cherry virus 1 (LChV1, Prune dwarf virus (PDV and Prunus necrotic ringspot virus (PNRSV by RT-PCR. All of the tested trees were also infected with ACLSV.

Seleção de linhagens de melancia resistentes ao Watermelon mosaic virus e ao Papaya ringspot virus Selection of resistant watermelon lines to Watermelon mosaic virus and Papaya ringspot virus

Directory of Open Access Journals (Sweden)

José Evando Aguiar Beserra Júnior

2007-10-01

Full Text Available Foram avaliadas 20 linhagens de melancia, provenientes do cruzamento da cultivar comercial suscetível Crimson Sweet e da introdução PI 595201 resistente ao Watermelon mosaic virus (WMV e Papaya ringspot virus (PRSV-W. As linhagens, e os parentais foram inoculados com o WMV ou com o PRSV-W em casa-de-vegetação distintas. Aos 35 e 49 dias após a primeira inoculação (DAI, as plantas foram avaliadas por meio de uma escala de notas, em que 1 (ausência de sintomas a 5 (intenso mosaico e deformações foliares. Pelos resultados infere-se que, aos 35 DAI, as linhagens 1, 2 e 20 apresentaram resistência tanto para o WMV como para o PRSV-W, com médias de 1,95, 1,80 e 2,25 para o WMV, e de 2,50, 2,30 e 2,50 para o PRSV-W, respectivamente. As linhagens 5, 7 e 13 foram resistentes somente ao WMV e as plantas das linhagens 3, 10 e 18 para o PRSV-W. A reação das linhagens permaneceu em geral pouco alterada aos 49 DAI. A existência de linhagens resistentes somente ao WMV e somente ao PRSV-W, ao lado de linhagens resistentes a ambos os vírus, é indicativo de que as resistências ao WMV e ao PRSV-W não são controladas pelos mesmos genes.Twenty advanced watermelon breeding lines, derived from the cross between cv. Crimson Sweet (susceptible and PI 595201 (resistant to WMV and PRSV-W, were screened for resistance to both potyviruses. The twenty lines, among with Crimson Sweet and PI 595201, were inoculated with either WMV or PRSV-W, in two different greenhouse trials. Plants were evaluated for symptoms 35 and 49 days after the first inoculation (DAI, using a scale from 1 (no symptoms to 5 (severe mosaic and foliar distortion. Evaluations at 35 DAI indicated that lines 1, 2 and 20 had good levels of resistance to both WMV and PRSV-W, with ratings of 1,95, 1,80 and 2,25 for WMV, and of 2,50, 2,30 and 2,50 for PRSV-W, respectively. Lines 5, 7 and 13 were resistant to WMV only, whereas lines 3, 10 and 18 were resistant to PRSV-W only. The reaction of

Sour and duke cherry viruses in South-West Europe

Directory of Open Access Journals (Sweden)

Rodrigo PÉREZ-SÁNCHEZ

2017-05-01

Full Text Available This study investigated the phytosanitary status of sour and duke cherry genetic resources in the Iberian Peninsula, and the incidence and leaf symptoms induced by the Prunus necrotic ringspot virus (PNRSV, Prune dwarf virus (PDV and Apple chlorotic leaf spot virus (ACLSV. Young leaf samples were taken from 204 sour and duke cherry trees belonging to ten cultivars, and were assayed by DAS-ELISA. Samples positive for any of the three viruses were also tested by RT-PCR. To associate the leaf symptoms with virus presence, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA and RT-PCR results indicated that 63% of the cherry trees were infected by at least one of these viruses. PNRSV occurred in all cultivars sampled and presented the highest infection rate (46%, followed by PDV (31% and ACLSV (6%. Many trees, (60 to 100%, were asymptomatic while harbouring single and mixed virus infections. The leaf symptoms associated with the viruses included chlorotic and dark brown necrotic ringspots on secondary veins and interveinal regions, for PNRSV, generalized chlorosis around the midveins, for PDV, chlorotic and reddish necrotic ringspots, for ACLSV, and generalized interveinal chlorosis, for mixed PNRSV and PDVinfections.

Plant growth retardation and conserved miRNAs are correlated to Hibiscus chlorotic ringspot virus infection.

Science.gov (United States)

Gao, Ruimin; Wan, Zi Yi; Wong, Sek-Man

2013-01-01

Virus infection may cause a multiplicity of symptoms in their host including discoloration, distortion and growth retardation. Hibiscus chlorotic ringspot virus (HCRSV) infection was studied using kenaf (Hibiscus cannabinus L.), a non-wood fiber-producing crop in this study. Infection by HCRSV reduced the fiber yield and concomitant economic value of kenaf. We investigated kenaf growth retardation and fluctuations of four selected miRNAs after HCRSV infection. Vegetative growth (including plant height, leaf size and root development) was severely retarded. From the transverse and radial sections of the mock and HCRSV-infected kenaf stem, the vascular bundles of HCRSV-infected plants were severely disrupted. In addition, four conserved plant developmental and defence related microRNAs (miRNAs) (miR165, miR167, miR168 and miR171) and their respective target genes phabulosa (PHB), auxin response factor 8 (ARF8), argonaute 1 (AGO1) and scarecrow-like protein 1 (SCL1) displayed variation in expression levels after HCRSV infection. Compared with the mock inoculated kenaf plants, miR171 and miR168 and their targets SCL1 and AGO1 showed greater fluctuations after HCRSV infection. As HCRSV upregulates plant SO transcript in kenaf and upregulated AGO1 in HCRSV-infected plants, the expression level of AGO1 transcript was further investigated under sulfite oxidase (SO) overexpression or silencing condition. Interestingly, the four selected miRNAs were also up- or down-regulated upon overexpression or silencing of SO. Plant growth retardation and fluctuation of four conserved miRNAs are correlated to HCRSV infection.

HERANÇA DA RESISTÊNCIA AO Papaya ringspot virus EM MELANCIA

Directory of Open Access Journals (Sweden)

LINDOMAR MARIA DA SILVEIRA

2015-01-01

Full Text Available Aiming to study the genetic control of Papaya ringspot virus, type watermelon (PRSV-W in watermelon, the cultivar Crimson Sweet (P1 – susceptible and L26 derived from PI 244019 (P2 – resistant, as well as the resulting populations F1, F2, RC11 and RC21 of the cross of both lines were evaluated. The trials were carried out in a greenhouse, and the evaluations were done using artificial inoculations with PRSV-W isolates. The seedling symptoms were recorded using a graded scale, and the serological evaluation was done with specific antiserum using indirect ELISA. The estimated variances of the populations were used to obtain the genetic (σ 2 G, the environmental (σ 2 E, phenotypic (σ 2 F2, additive (σ 2 A and dominance (σ 2 D variances as well as the broad (h2 a and narrow sense (h2 r heritabilities. The hypothesis of monogenic inheritance was tested under different presumed average degrees of dominance as well as using the maximum likelihood. The distribution of resistant plants in the segregating populations was different from a distribution based on monogenic inheritance for all presumed average degrees of dominance, therefore, the hypothesis of monogenic inheritance was rejected indicating that this character in the line L26 is controlled by more than one major gene with the presence of modifiers. The additive-dominant model was adequate to explain the type of gene action involved, and the epistatic effects were not important in the expression of the resistance. The estimated average degree of dominance indicated complete dominance. The broad sense heritabilities for the two variables analyzed were intermediate.

Detection of selected plant viruses by microarrays

OpenAIRE

HRABÁKOVÁ, Lenka

2013-01-01

The main aim of this master thesis was the simultaneous detection of four selected plant viruses ? Apple mosaic virus, Plum pox virus, Prunus necrotic ringspot virus and Prune harf virus, by microarrays. The intermediate step in the process of the detection was optimizing of multiplex polymerase chain reaction (PCR).

RNA-binding properties and mapping of the RNA-binding domain from the movement protein of Prunus necrotic ringspot virus.

Science.gov (United States)

Herranz, M Carmen; Pallás, Vicente

2004-03-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Emerging viruses in the genus Comovirus

Czech Academy of Sciences Publication Activity Database

Petrzik, Karel; Koloniuk, Igor

2010-01-01

Roč. 40, č. 2 (2010), s. 290-292 ISSN 0920-8569 R&D Projects: GA ČR GA522/07/0053 Institutional research plan: CEZ:AV0Z50510513 Keywords : Capsid proteins * plant virus * Radish mosaic virus * Turnip ringspot virus Subject RIV: EE - Microbiology, Virology Impact factor: 1.693, year: 2010

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

Science.gov (United States)

Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

2017-01-01

PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV using amplicon next generation sequencing.

Directory of Open Access Journals (Sweden)

Wycliff M Kinoti

Full Text Available PCR amplicon next generation sequencing (NGS analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

Main viruses in sweet cherry plantations of Central-Western Spain

Directory of Open Access Journals (Sweden)

Rodrigo Pérez Sánchez

2015-02-01

Full Text Available Sweet cherry trees (Prunus avium L. are susceptible to a range of diseases, but there have been no studies to date about the viral infection of sweet cherry trees in Spain. To determine the phytosanitary status of Spanish sweet cherry plantations, the incidence and leaf symptoms induced by Prune dwarf (PDV, Prunus necrotic ringspot (PNRSV and Apple chlorotic leaf spot (ACLSV viruses were investigated during 2009. Young leaf samples were taken from 350 sweet cherry trees, corresponding to 17 cultivars, and were analysed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA. To associate the leaf symptoms with the virus, 50 mature leaves from each infected tree were visually inspected during the summer. The ELISA results revealed that 72 % of sweet cherry trees were infected by at least one of the viruses. PDV occurred in all sampled cultivars and presented the highest infection rate, followed by ACLSV and PNRSV. A high number of trees showed asymptomatic, in both single and mixed infections. The leaf symptoms associated with the viruses involved generalized chlorosis around the midvein (PDV, chlorotic and dark brown necrotic ringspots on both secondary veins and intervein regions (PNRSV, chlorotic and reddish necrotic ringspots (ACLSV and generalized interveinal chlorosis (PDV-PNRSV.

Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

NARCIS (Netherlands)

Amaral, P.P.R.; Resende, de R.O.; Souza, M.T.

2006-01-01

Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da

Virus Diseases Infecting Almond Germplasm in Lebanon

OpenAIRE

Adeeb Saad; Yusuf Abou-Jawdah; Zahi Kanaan-Atallah

2000-01-01

Cultivated and wild almond species were surveyed for virus diseases. Four viruses infected cultivated almonds (Prunus dulcis): Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Apple chlorotic leaf spot virus (ACLSV) and Apple mosaic virus (ApMV). Only ACLSV and ApMV were detected on wild almonds, (Prunus orientalis and P. korschinskii). The occurence of PNRSV or PDV on seeds used for the production of rootstocks, on seedlings in nurseries, and on mother plants reve...

Identification et distribution géographique des virus responsables ...

African Journals Online (AJOL)

Ringspot Virus (PRSV), Watermelon Mosaic Virus (WMV) et Zucchini Yellow Mosaic Virus (ZYMV)) a été menée dans 18 parcelles de Cucumis sativus, Cucurbita maxima et Cucurbita pepo localisées à Abidjan,. Bouaké, Daloa, Korhogo, Man, San Pedro et Yamoussoukro. Les tests sérologiques DAS-ELISA réalisés sur.

Genomic segments RNA1 and RNA2 of Prunus necrotic ringspot virus codetermine viral pathogenicity to adapt to alternating natural Prunus hosts.

Science.gov (United States)

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2013-05-01

Prunus necrotic ringspot virus (PNRSV) affects Prunus fruit production worldwide. To date, numerous PNRSV isolates with diverse pathological properties have been documented. To study the pathogenicity of PNRSV, which directly or indirectly determines the economic losses of infected fruit trees, we have recently sequenced the complete genome of peach isolate Pch12 and cherry isolate Chr3, belonging to the pathogenically aggressive PV32 group and mild PV96 group, respectively. Here, we constructed the Chr3- and Pch12-derived full-length cDNA clones that were infectious in the experimental host cucumber and their respective natural Prunus hosts. Pch12-derived clones induced much more severe symptoms than Chr3 in cucumber, and the pathogenicity discrepancy between Chr3 and Pch12 was associated with virus accumulation. By reassortment of genomic segments, swapping of partial genomic segments, and site-directed mutagenesis, we identified the 3' terminal nucleotide sequence (1C region) in RNA1 and amino acid K at residue 279 in RNA2-encoded P2 as the severe virulence determinants in Pch12. Gain-of-function experiments demonstrated that both the 1C region and K279 of Pch12 were required for severe virulence and high levels of viral accumulation. Our results suggest that PNRSV RNA1 and RNA2 codetermine viral pathogenicity to adapt to alternating natural Prunus hosts, likely through mediating viral accumulation.

Coated microneedle arrays for transcutaneous delivery of live virus vaccines.

Science.gov (United States)

Vrdoljak, Anto; McGrath, Marie G; Carey, John B; Draper, Simon J; Hill, Adrian V S; O'Mahony, Conor; Crean, Abina M; Moore, Anne C

2012-04-10

Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses must retain infectivity to be effective. Microneedles offer an effective and painless method for delivery of vaccines directly into skin that in the future could provide solutions to current vaccination issues. Here we investigated methods of coating live recombinant adenovirus and modified vaccinia virus Ankara (MVA) vectors onto solid microneedle arrays. An effective spray-coating method, using conventional pharmaceutical processes, was developed, in tandem with suitable sugar-based formulations, which produces arrays with a unique coating of viable virus in a dry form around the shaft of each microneedle on the array. Administration of live virus-coated microneedle arrays successfully resulted in virus delivery, transcutaneous infection and induced an antibody or CD8(+) T cell response in mice that was comparable to that obtained by needle-and-syringe intradermal immunization. To our knowledge, this is the first report of successful vaccination with recombinant live viral vectored vaccines coated on microneedle delivery devices. Copyright © 2011 Elsevier B.V. All rights reserved.

Coated microneedle arrays for transcutaneous delivery of live virus vaccines

Science.gov (United States)

Vrdoljak, Anto; McGrath, Marie G.; Carey, John B.; Draper, Simon J.; Hill, Adrian V.S.; O’Mahony, Conor; Crean, Abina M.; Moore, Anne C.

2016-01-01

Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses must retain infectivity to be effective. Microneedles offer an effective and painless method for delivery of vaccines directly into skin that in the future could provide solutions to current vaccination issues. Here we investigated methods of coating live recombinant adenovirus and modified vaccinia virus Ankara (MVA) vectors onto solid microneedle arrays. An effective spray-coating method, using conventional pharmaceutical processes, was developed, in tandem with suitable sugar-based formulations, which produces arrays with a unique coating of viable virus in a dry form around the shaft of each microneedle on the array. Administration of live virus-coated microneedle arrays successfully resulted in virus delivery, transcutaneous infection and induced an antibody or CD8+ T cell response in mice that was comparable to that obtained by needle-and-syringe intradermal immunization. To our knowledge, this is the first report of successful vaccination with recombinant live viral vectored vaccines coated on microneedle delivery devices. PMID:22245683

Infection of potato mesophyll protoplasts with five plant viruses.

Science.gov (United States)

Barker, H; Harrison, B D

1982-12-01

Methods are described for preparing potato mesophyll protoplasts that are suitable for infection with inocula of virus nucleoprotein or RNA. The protoplasts could be infected with four sap-transmissible viruses (tobacco mosaic, tobacco rattle, tobacco ringspot and tomato black ring viruses) and with potato leafroll virus, which is not saptransmissible. No differences were observed in ability to infect protoplasts with potato leafroll virus strains differing either in virulence in intact plants or in aphid transmissibility.

Rapid detection of fifteen known soybean viruses by dot-immunobinding assay.

Science.gov (United States)

Ali, Akhtar

2017-11-01

A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012-2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time. Copyright © 2017 Elsevier B.V. All rights reserved.

Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2000-05-01

We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

A remarkable synergistic effect at the transcriptomic level in peach fruits doubly infected by prunus necrotic ringspot virus and peach latent mosaic viroid.

Science.gov (United States)

Herranz, Mari Carmen; Niehl, Annette; Rosales, Marlene; Fiore, Nicola; Zamorano, Alan; Granell, Antonio; Pallas, Vicente

2013-05-28

Microarray profiling is a powerful technique to investigate expression changes of large amounts of genes in response to specific environmental conditions. The majority of the studies investigating gene expression changes in virus-infected plants are limited to interactions between a virus and a model host plant, which usually is Arabidopsis thaliana or Nicotiana benthamiana. In the present work, we performed microarray profiling to explore changes in the expression profile of field-grown Prunus persica (peach) originating from Chile upon single and double infection with Prunus necrotic ringspot virus (PNRSV) and Peach latent mosaic viroid (PLMVd), worldwide natural pathogens of peach trees. Upon single PLMVd or PNRSV infection, the number of statistically significant gene expression changes was relatively low. By contrast, doubly-infected fruits presented a high number of differentially regulated genes. Among these, down-regulated genes were prevalent. Functional categorization of the gene expression changes upon double PLMVd and PNRSV infection revealed protein modification and degradation as the functional category with the highest percentage of repressed genes whereas induced genes encoded mainly proteins related to phosphate, C-compound and carbohydrate metabolism and also protein modification. Overrepresentation analysis upon double infection with PLMVd and PNRSV revealed specific functional categories over- and underrepresented among the repressed genes indicating active counter-defense mechanisms of the pathogens during infection. Our results identify a novel synergistic effect of PLMVd and PNRSV on the transcriptome of peach fruits. We demonstrate that mixed infections, which occur frequently in field conditions, result in a more complex transcriptional response than that observed in single infections. Thus, our data demonstrate for the first time that the simultaneous infection of a viroid and a plant virus synergistically affect the host transcriptome in

Inhibition of the host proteasome facilitates papaya ringspot virus accumulation and proteosomal catalytic activity is modulated by viral factor HcPro.

Directory of Open Access Journals (Sweden)

Nandita Sahana

Full Text Available The ubiquitin/26S proteasome system plays an essential role not only in maintaining protein turnover, but also in regulating many other plant responses, including plant-pathogen interactions. Previous studies highlighted different roles of the 20S proteasome in plant defense during virus infection, either indirectly through viral suppressor-mediated degradation of Argonaute proteins, affecting the RNA interference pathway, or directly through modulation of the proteolytic and RNase activity of the 20S proteasome, a component of the 20S proteasome, by viral proteins, affecting the levels of viral proteins and RNAs. Here we show that MG132, a cell permeable proteasomal inhibitor, caused an increase in papaya ringspot virus (PRSV accumulation in its natural host papaya (Carica papaya. We also show that the PRSV HcPro interacts with the papaya homologue of the Arabidopsis PAA (α1 subunit of the 20S proteasome, but not with the papaya homologue of Arabidopsis PAE (α5 subunit of the 20S proteasome, associated with the RNase activity, although the two 20S proteasome subunits interacted with each other. Mutated forms of PRSV HcPro showed that the conserved KITC54 motif in the N-terminal domain of HcPro was necessary for its binding to PAA. Co-agroinfiltration assays demonstrated that HcPro expression mimicked the action of MG132, and facilitated the accumulation of bothtotal ubiquitinated proteins and viral/non-viral exogenous RNA in Nicotiana benthamiana leaves. These effects were not observed by using an HcPro mutant (KITS54, which impaired the HcPro - PAA interaction. Thus, the PRSV HcPro interacts with a proteasomal subunit, inhibiting the action of the 20S proteasome, suggesting that HcPro might be crucial for modulating its catalytic activities in support of virus accumulation.

Next generation sequencing and molecular analysis of artichoke Italian latent virus.

Science.gov (United States)

Elbeaino, Toufic; Belghacem, Imen; Mascia, Tiziana; Gallitelli, Donato; Digiaro, Michele

2017-06-01

Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.

Application of Transgenic Technologies to Papaya: Developments and Biosafety Assessments in Thailand

Czech Academy of Sciences Publication Activity Database

Kertbundit, Sunee; Juříček, Miloslav

2010-01-01

Roč. 4, č. 1 (2010), s. 52-57 ISSN 1749-0413 Institutional research plan: CEZ:AV0Z50380511 Keywords : coat protein-mediated resistance * GMO * Papaya ringspot virus Subject RIV: EF - Botanics http://home.ueb.cas.cz/publikace/2010_Kertbundit_TransgenicPlantJournal_52.pdf

The molecular variability analysis of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus sheds light on the minimal requirements for the synthesis of its subgenomic RNA.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente

2002-01-01

The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement.

Science.gov (United States)

Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente

2005-08-15

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.

Mutational analysis of the RNA-binding domain of the Prunus necrotic ringspot virus (PNRSV) movement protein reveals its requirement for cell-to-cell movement

International Nuclear Information System (INIS)

Carmen Herranz, Ma; Sanchez-Navarro, Jesus-Angel; Sauri, Ana; Mingarro, Ismael; Pallas, Vicente

2005-01-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed

A novel, polymer-coated oncolytic measles virus overcomes immune suppression and induces robust antitumor activity

Directory of Open Access Journals (Sweden)

Kaname Nosaki

2016-01-01

Full Text Available Although various therapies are available to treat cancers, including surgery, chemotherapy, and radiotherapy, cancer has been the leading cause of death in Japan for the last 30 years, and new therapeutic modalities are urgently needed. As a new modality, there has recently been great interest in oncolytic virotherapy, with measles virus being a candidate virus expected to show strong antitumor effects. The efficacy of virotherapy, however, was strongly limited by the host immune response in previous clinical trials. To enhance and prolong the antitumor activity of virotherapy, we combined the use of two newly developed tools: the genetically engineered measles virus (MV-NPL and the multilayer virus-coating method of layer-by-layer deposition of ionic polymers. We compared the oncolytic effects of this polymer-coated MV-NPL with the naked MV-NPL, both in vitro and in vivo. In the presence of anti-MV neutralizing antibodies, the polymer-coated virus showed more enhanced oncolytic activity than did the naked MV-NPL in vitro. We also examined antitumor activities in virus-treated mice. Complement-dependent cytotoxicity and antitumor activities were higher in mice treated with polymer-coated MV-NPL than in mice treated with the naked virus. This novel, polymer-coated MV-NPL is promising for clinical cancer therapy in the future.

40 CFR 174.512 - Coat Protein of Potato Virus Y; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Potato Virus Y...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.512 Coat Protein of Potato Virus Y; exemption from the requirement of a tolerance. Residues of Coat Protein of Potato Virus Y are exempt from...

40 CFR 174.531 - Coat protein of plum pox virus; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of plum pox virus...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.531 Coat protein of plum pox virus; exemption from the requirement of a tolerance. Residues of the coat protein of plum pox virus in or on the...

Sequence similarity between the cp gene and the transgene in transgenic papayas = Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

NARCIS (Netherlands)

Souza, M.T.; Teixeira, M.; Gonsalves, D.

2005-01-01

The Papaya ringspot virus (PRSV) coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89%) to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in

Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus.

Science.gov (United States)

Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin

2018-06-01

In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

Extensive literature search for preparatory work to support pan European pest risk assessment: Trichilogaster acaciaelongifoliae RC/EFS/ALPHA/2014/07

NARCIS (Netherlands)

Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Helsen, H.H.M.; Hoffman, M.H.A.; Hop, M.E.C.M.

2014-01-01

The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

Extensive literature search on cropping practices of host plants of some harmful organisms listed in Annex II A II of Directive 2000/29/EC

NARCIS (Netherlands)

Derkx, M.P.M.; Brouwer, J.H.D.; Breda, van P.J.M.; Heijerman-Peppelman, G.; Heijne, B.; Hop, M.E.C.M.; Wubben, C.F.M.

2014-01-01

The European Commission is currently seeking advice from EFSA (Mandate M-2012-0272) to assess for Arabis mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tomato black ring virus, Strawberry mild yellow edge virus, Strawberry crinkle virus, Daktulosphaira vitifoliae,

Fabrication and characterization of gold nano-wires templated on virus-like arrays of tobacco mosaic virus coat proteins

International Nuclear Information System (INIS)

Wnęk, M; Stockley, P G; Górzny, M Ł; Evans, S D; Ward, M B; Brydson, R; Wälti, C; Davies, A G

2013-01-01

The rod-shaped plant virus tobacco mosaic virus (TMV) is widely used as a nano-fabrication template, and chimeric peptide expression on its major coat protein has extended its potential applications. Here we describe a simple bacterial expression system for production and rapid purification of recombinant chimeric TMV coat protein carrying C-terminal peptide tags. These proteins do not bind TMV RNA or form disks at pH 7. However, they retain the ability to self-assemble into virus-like arrays at acidic pH. C-terminal peptide tags in such arrays are exposed on the protein surface, allowing interaction with target species. We have utilized a C-terminal His-tag to create virus coat protein-templated nano-rods able to bind gold nanoparticles uniformly. These can be transformed into gold nano-wires by deposition of additional gold atoms from solution, followed by thermal annealing. The resistivity of a typical annealed wire created by this approach is significantly less than values reported for other nano-wires made using different bio-templates. This expression construct is therefore a useful additional tool for the creation of chimeric TMV-like nano-rods for bio-templating. (paper)

Fabrication and characterization of gold nano-wires templated on virus-like arrays of tobacco mosaic virus coat proteins

Science.gov (United States)

Wnęk, M.; Górzny, M. Ł.; Ward, M. B.; Wälti, C.; Davies, A. G.; Brydson, R.; Evans, S. D.; Stockley, P. G.

2013-01-01

The rod-shaped plant virus tobacco mosaic virus (TMV) is widely used as a nano-fabrication template, and chimeric peptide expression on its major coat protein has extended its potential applications. Here we describe a simple bacterial expression system for production and rapid purification of recombinant chimeric TMV coat protein carrying C-terminal peptide tags. These proteins do not bind TMV RNA or form disks at pH 7. However, they retain the ability to self-assemble into virus-like arrays at acidic pH. C-terminal peptide tags in such arrays are exposed on the protein surface, allowing interaction with target species. We have utilized a C-terminal His-tag to create virus coat protein-templated nano-rods able to bind gold nanoparticles uniformly. These can be transformed into gold nano-wires by deposition of additional gold atoms from solution, followed by thermal annealing. The resistivity of a typical annealed wire created by this approach is significantly less than values reported for other nano-wires made using different bio-templates. This expression construct is therefore a useful additional tool for the creation of chimeric TMV-like nano-rods for bio-templating.

Natural supramolecular building blocks: from virus coat proteins to viral nanoparticles.

Science.gov (United States)

Liu, Zhi; Qiao, Jing; Niu, Zhongwei; Wang, Qian

2012-09-21

Viruses belong to a fascinating class of natural supramolecular structures, composed of multiple copies of coat proteins (CPs) that assemble into different shapes with a variety of sizes from tens to hundreds of nanometres. Because of their advantages including simple/economic production, well-defined structural features, unique shapes and sizes, genetic programmability and robust chemistries, recently viruses and virus-like nanoparticles (VLPs) have been used widely in biomedical applications and materials synthesis. In this critical review, we highlight recent advances in the use of virus coat proteins (VCPs) and viral nanoparticles (VNPs) as building blocks in self-assembly studies and materials development. We first discuss the self-assembly of VCPs into VLPs, which can efficiently incorporate a variety of different materials as cores inside the viral protein shells. Then, the self-assembly of VNPs at surfaces or interfaces is summarized. Finally, we discuss the co-assembly of VNPs with different functional materials (178 references).

Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses.

Science.gov (United States)

Dardick, Christopher

2007-08-01

Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

Presence and Distribution of Oilseed Pumpkin Viruses and Molecular Detection of Zucchini Yellow Mosaic Virus

Directory of Open Access Journals (Sweden)

Ana Vučurović

2009-01-01

Full Text Available Over the past decade, intensive spread of virus infections of oilseed pumpkin has resulted in significant economic losses in pumpkin crop production, which is currently expanding in our country. In 2007 and 2008, a survey for the presence and distribution of oilseed pumpkin viruses was carried out in order to identify viruses responsible for epidemics and incidences of very destructive symptoms on cucurbit leaves and fruits. Monitoring andcollecting samples of oil pumpkin, as well as other species such as winter and butternut squash and buffalo and bottle gourd with viral infection symptoms, was conducted in several localities of Vojvodina Province. The collected plant samples were tested by DAS-ELISA using polyclonal antisera specific for the detection of six most economically harmful pumpkin viruses: Cucumber mosaic virus (CMV, Zucchini yellow mosaic virus (ZYMV, Watermelon mosaic virus (WMW, Squash mosaic virus (SqMV, Papaya ringspot virus (PRSV and Tobaccoringspot virus (TRSV that are included in A1 quarantine list of harmful organisms in Serbia.Identification of viruses in the collected samples indicated the presence of three viruses, ZYMV, WMV and CMV, in individual and mixed infections. Frequency of the identified viruses varied depending on locality and year of investigations. In 2007, WMV was the most frequent virus (94.2%, while ZYMV was prevalent (98.04% in 2008. High frequency of ZYMV determined in both years of investigation indicated the need for its rapid and reliable molecular detection. During this investigation, a protocol for ZYMVdetection was developed and optimized using specific primers CPfwd/Cprev and commercial kits for total RNA extraction, as well as for RT-PCR. In RT-PCR reaction using these primers, a DNA fragment of approximately 1100 bp, which included coat protein gene, was amplified in the samples of infected pumkin leaves. Although serological methods are still useful for large-scale testing of a great number of

Cell-to-cell movement of Alfalfa mosaic virus can be mediated by the movement proteins of Ilar-, bromo-, cucumo-, tobamo- and comoviruses and does not require virion formation.

Science.gov (United States)

Sánchez-Navarro, Jesús A; Carmen Herranz, María; Pallás, Vicente

2006-03-01

RNA 3 of Alfalfa mosaic virus (AMV) encodes the movement protein (MP) and coat protein (CP). Chimeric RNA 3 with the AMV MP gene replaced by the corresponding MP gene of Prunus necrotic ringspot virus, Brome mosaic virus, Cucumber mosaic virus or Cowpea mosaic virus efficiently moved from cell-to-cell only when the expressed MP was extended at its C-terminus with the C-terminal 44 amino acids of AMV MP. MP of Tobacco mosaic virus supported the movement of the chimeric RNA 3 whether or not the MP was extended with the C-terminal AMV MP sequence. The replacement of the CP gene in RNA 3 by a mutant gene encoding a CP defective in virion formation did not affect cell-to-cell transport of the chimera's with a functional MP. A GST pull-down technique was used to demonstrate for the first time that the C-terminal 44 amino acids of the MP of a virus belonging to the family Bromoviridae interact specifically with AMV virus particles. Together, these results demonstrate that AMV RNA 3 can be transported from cell-to-cell by both tubule-forming and non-tubule-forming MPs if a specific MP-CP interaction occurs.

Characterization of a Non-Canonical Signal Peptidase Cleavage Site in a Replication Protein from Tomato Ringspot Virus.

Directory of Open Access Journals (Sweden)

Ting Wei

Full Text Available The NTB-VPg polyprotein from tomato ringspot virus is an integral membrane replication protein associated with endoplasmic reticulum membranes. A signal peptidase (SPase cleavage was previously detected in the C-terminal region of NTB-VPg downstream of a 14 amino acid (aa-long hydrophobic region (termed TM2. However, the exact location of the cleavage site was not determined. Using in vitro translation assays, we show that the SPase cleavage site is conserved in the NTB-VPg protein from various ToRSV isolates, although the rate of cleavage varies from one isolate to another. Systematic site-directed mutagenesis of the NTB-VPg SPase cleavage sites of two ToRSV isolates allowed the identification of sequences that affect cleavage efficiency. We also present evidence that SPase cleavage in the ToRSV-Rasp2 isolate occurs within a GAAGG sequence likely after the AAG (GAAG/G. Mutation of a downstream MAAV sequence to AAAV resulted in SPase cleavage at both the natural GAAG/G and the mutated AAA/V sequences. Given that there is a distance of seven aa between the two cleavage sites, this indicates that there is flexibility in the positioning of the cleavage sites relative to the inner surface of the membrane and the SPase active site. SPase cleavage sites are typically located 3-7 aa downstream of the hydrophobic region. However, the NTB-VPg GAAG/G cleavage site is located 17 aa downstream of the TM2 hydrophobic region, highlighting unusual features of the NTB-VPg SPase cleavage site. A putative 11 aa-long amphipathic helix was identified immediately downstream of the TM2 region and five aa upstream of the GAAG/G cleavage site. Based on these results, we present an updated topology model in which the hydrophobic and amphipathic domains form a long tilted helix or a bent helix in the membrane lipid bilayer, with the downstream cleavage site(s oriented parallel to the membrane inner surface.

Prediction of protein-protein interactions in dengue virus coat proteins guided by low resolution cryoEM structures

Directory of Open Access Journals (Sweden)

Srinivasan Narayanaswamy

2010-06-01

Full Text Available Abstract Background Dengue virus along with the other members of the flaviviridae family has reemerged as deadly human pathogens. Understanding the mechanistic details of these infections can be highly rewarding in developing effective antivirals. During maturation of the virus inside the host cell, the coat proteins E and M undergo conformational changes, altering the morphology of the viral coat. However, due to low resolution nature of the available 3-D structures of viral assemblies, the atomic details of these changes are still elusive. Results In the present analysis, starting from Cα positions of low resolution cryo electron microscopic structures the residue level details of protein-protein interaction interfaces of dengue virus coat proteins have been predicted. By comparing the preexisting structures of virus in different phases of life cycle, the changes taking place in these predicted protein-protein interaction interfaces were followed as a function of maturation process of the virus. Besides changing the current notion about the presence of only homodimers in the mature viral coat, the present analysis indicated presence of a proline-rich motif at the protein-protein interaction interface of the coat protein. Investigating the conservation status of these seemingly functionally crucial residues across other members of flaviviridae family enabled dissecting common mechanisms used for infections by these viruses. Conclusions Thus, using computational approach the present analysis has provided better insights into the preexisting low resolution structures of virus assemblies, the findings of which can be made use of in designing effective antivirals against these deadly human pathogens.

40 CFR 174.514 - Coat Protein of Watermelon Mosaic Virus-2 and Zucchini Yellow Mosaic Virus; exemption from the...

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat Protein of Watermelon Mosaic Virus-2 and Zucchini Yellow Mosaic Virus; exemption from the requirement for a tolerance. 174.514 Section 174.514 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

The sequencing of the complete genome of a Tomato black ring virus (TBRV) and of the RNA2 of three Grapevine chrome mosaic virus (GCMV) isolates from grapevine reveals the possible recombinant origin of GCMV.

Science.gov (United States)

Digiaro, M; Yahyaoui, E; Martelli, G P; Elbeaino, T

2015-02-01

The complete genome of a Tomato black ring virus isolate (TBRV-Mirs) (RNA1, 7,366 nt and RNA2, 4,640 nt) and the RNA2 sequences (4,437; 4,445; and 4,442 nts) of three Grapevine chrome mosaic virus isolates (GCMV-H6, -H15, and -H27) were determined. All RNAs contained a single open reading frame encoding polyproteins of 254 kDa (p1) and 149 kDa (p2) for TBRV-Mirs RNA1 and RNA2, respectively, and 146 kDa for GCMV RNA2. p1 of TBRV-Mirs showed the highest identity with TBRV-MJ (94 %), Beet ringspot virus (BRSV, 82 %), and Grapevine Anatolian ringspot virus (GARSV, 66 %), while p2 showed the highest identity with TBRV isolates MJ (89 %) and ED (85 %), followed by BRSV (65 %), GCMV (58 %), and GARSV (57 %). The amino acid identity of RNA2 sequences of four GCMV isolates (three from this study and one from GenBank) ranged from 91 to 98 %, the homing protein being the most variable. The RDP3 program predicted putative intra-species recombination events for GCMV-H6 and recognized GCMV as a putative inter-species recombinant between GARSV and TBRV. In both cases, the recombination events were at the movement protein level.

Detection and isolation of nepoviruses on strawberry in the Czech Republic.

Science.gov (United States)

Honetslegrová, J; Spak, J

1995-06-01

Arabis mosaic, strawberry latent ringspot, tomato black ring and raspberry ringspot nepoviruses were monitored using double sandwich enzyme-linked immunosorbent assay (DAS-ELISA) in 18 cultivars of strawberry Fragaria x ananassa Duch. in the Czech Republic. Arabis mosaic and strawberry latent ringspot viruses were detected, isolated and characterized on differential host plants and by electron microscopy. Both viruses were purified and antisera to them were prepared.

Different virucidal activities of hyperbranched quaternary ammonium coatings on poliovirus and influenza virus

NARCIS (Netherlands)

Tuladhar, E.; Koning, de M.C.; Fundeanu, I.; Beumer, R.R.; Duizer, E.

2012-01-01

Virucidal activity of immobilized quaternary ammonium compounds (IQACs) coated onto glass and plastic surfaces was tested against enveloped influenza A (H1N1) virus and nonenveloped poliovirus Sabin1. The IQACs tested were virucidal against the influenza virus within 2 min, but no virucidal effect

Induction of cinnamate 4-hydroxylase and phenylpropanoids in virus-infected cucumber and melon plants.

OpenAIRE

Belles Albert, José Mª; López-Gresa, María Pilar; Fayos, J.; Pallás Benet, Vicente; Rodrigo Bravo, Ismael; Conejero Tomás, Vicente

2008-01-01

[EN] In the present work, we have looked for the nature of the phenylpropanoids biosynthesized during the plant-pathogen reaction of two systems, Cucumis sativus and Cucumis melo infected with either prunus necrotic ringspot virus (PNRSV) or melon necrotic spot virus (MNSV), respectively. An accumulation of p-coumaric, caffeic and/or ferulic acids was observed in infected plant extracts hydrolysed with P-glucosidase or esterase. Analysis of undigested samples by HPLC/ESI revealed that these c...

An umbra-like virus of papaya discovered in Ecuador: detection, occurrence and phylogenetic relatedness

Science.gov (United States)

Double-stranded RNA (dsRNA) extractions from papaya leaves infected with Papaya ringspot virus (PRSV) revealed the presence of an unusual 4kb band, in addition to the presumed PRSV-associated 10kb band. Partial sequence of RT-PCR products from the 4kb dsRNA revealed homology to genomes of several me...

Characteristics of rose mosaic diseases

Directory of Open Access Journals (Sweden)

Marek S. Szyndel

2013-12-01

Full Text Available Presented review of rose diseases, associated with the mosaic symptoms, includes common and yellow rose mosaic, rose ring pattern, rose X disease, rose line pattern, yellow vein mosaic and rose mottle mosaic disease. Based on symptomatology and graft transmissibility of causing agent many of those rose disorders are called "virus-like diseases" since the pathogen has never been identified. However, several viruses were detected and identified in roses expressing mosaic symptoms. Currently the most prevalent rose viruses are Prunus necrotic ringspot virus - PNRSV, Apple mosaic virus - ApMV (syn. Rose mosaic virus and Arabis mosaic virus - ArMV Symptoms and damages caused by these viruses are described. Tomato ringspot virus, Tobacco ringspot virus and Rose mottle mosaic virus are also mentioned as rose pa thogcns. Methods of control of rose mosaic diseases are discussed.

Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector.

Science.gov (United States)

Doumayrou, Juliette; Sheber, Melissa; Bonning, Bryony C; Miller, W Allen

2016-11-18

Understanding the molecular mechanisms involved in plant virus-vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP) are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus , Luteoviridae ) and Pea enation mosaic virus 2 (PEMV2, Umbravirus , Tombusviridae ) are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum , and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum . Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

Avaliação de genótipos de melancia para resistência ao Papaya ringspot vírus, estirpe melancia Evaluation of watermelon genotypes for resistance to Papaya ringspot virus, type watermelon

Directory of Open Access Journals (Sweden)

Jairo V Vieira

2010-03-01

Full Text Available Verificou-se a eficiência de duas metodologias de avaliação em nove genótipos de melancia da resistência a três isolados de Papaya ringspot virus, estirpe melancia (PRSV-W, de três regiões brasileiras. O delineamento do experimento foi em blocos casualizados com quatro repetições. Cada parcela foi composta de um vaso com 5 kg de substrato com cinco plantas de melancia por vaso. Aos 10 e 13 dias após a semeadura, três isolados do PRSV-W coletados nos estados de Goiás, Pernambuco e São Paulo, foram inoculados mecanicamente. Aos 27 e 37 dias após a semeadura foram feitas avaliações visuais de sintomas de vírus. A confirmação da presença ou não do vírus nas plantas inoculadas foi feita através do teste sorológico Das-Elisa, utilizando anti-soro policlonal. Foram realizadas análises de variância, estimadas as herdabilidades, calculadas as correlações entre os caracteres, e efetuadas comparações das médias dos genótipos e dos diferentes inóculos. Pelo comportamento diferenciado dos genótipos em relação aos isolados avaliados, conclui-se que isolados provenientes de diferentes regiões devem ser testados nos programas de melhoramento de melancia. Os altos valores de herdabilidade para a maioria dos caracteres indicam que a característica em estudo está sob o controle de poucos loci e que, portanto, a possibilidade de seleção de materiais resistentes é alta. Em geral, os genótipos mostraram um nível de tolerância superior ao da cultivar predominante no mercado brasileiro (Crimson Sweet. Portanto, podem servir de base para a produção de cultivares mais tolerantes ao PRSV-W.The aim of this study was to assess the resistance of nine watermelon genotypes against three PRSV-W isolates originated from three Brazilian States (São Paulo, Goiás and Pernambuco. The experiment was carried out at Embrapa Hortaliças, Brasilia, Brazil, in April 2004. Nine watermelon genotypes were appraised, in a randomizated block

Expression of tomato yellow leaf curl virus coat protein using baculovirus expression system and evaluation of its utility as a viral antigen.

Science.gov (United States)

Elgaied, Lamiaa; Salem, Reda; Elmenofy, Wael

2017-08-01

DNA encoding the coat protein (CP) of an Egyptian isolate of tomato yellow leaf curl virus (TYLCV) was inserted into the genome of Autographa californica nucleopolyhedrovirus (AcNPV) under the control of polyhedrin promoter. The generated recombinant baculovirus construct harboring the coat protein gene was characterized using PCR analysis. The recombinant coat protein expressed in infected insect cells was used as a coating antigen in an indirect Enzyme-linked immunosorbent assay (ELISA) and dot blot to test its utility for the detection of antibody generated against TYLCV virus particles. The results of ELISA and dot blot showed that the TYLCV-antibodies reacted positively with extracts of infected cells using the recombinant virus as a coating antigen with strong signals as well as the TYLCV infected tomato and beat plant extracts as positive samples. Scanning electron microscope examination showed that the expressed TYLCV coat protein was self-assembled into virus-like particles (VLPs) similar in size and morphology to TYLCV virus particles. These results concluded that, the expressed coat protein of TYLCV using baculovirus vector system is a reliable candidate for generation of anti-CP antibody for inexpensive detection of TYLCV-infected plants using indirect CP-ELISA or dot blot with high specificity.

Ability of Aphis gossypii and Myzus persicae to Transmit Cucumber mosaic virus in Single and Mixed Infection with Two Potyviruses to Zucchini Squash Eficiência dos afídeos Aphis gossypii e Myzus persicae na transmissão do Cucumber mosaic virus em infecção simples e mista com dois Potyvirus para abobrinha de moita

Directory of Open Access Journals (Sweden)

Zayame Vegette Pinto

2008-06-01

Full Text Available The main objective of this work was to investigate the ability of Aphis gossypii and Myzus persicae to transmit Cucumber mosaic virus (CMV singly and mixed with two potyviruses (Papaya ringspot virus - type W, PRSV-W and Zucchini yellow mosaic virus, ZYMV, to zucchini squash plants (Cucurbita pepo. The results showed that the potyviruses in general were more efficiently transmitted by both species of aphids as compared to CMV. The transmission of PRSV-W, ZYMV and CMV separately was more efficient than in mixture.O objetivo desse trabalho foi estudar a eficiência de Aphis gossypii e Myzus persicae na transmissão do vírus do mosaico do pepino (Cucumber mosaic virus, CMV, isoladamente e em mistura com duas espécies de potyvirus (Vírus do mosaico do mamoeiro = Papaya ringspot virus - type W, PRSV-W e Vírus do mosaico amarelo da abobrinha = Zucchini yellow mosaic virus, ZYMV, para planta-testes de abobrinha de moita (Cucurbita pepo. Os dois potyvirus em geral foram transmitidos com mais eficiência pelas duas espécies de afídeos do que o CMV. A transmissão do PRSV-W, ZYMV e CMV, separadamente, foi mais eficiente do que em mistura.

Mesoporous Silicon with Modified Surface for Plant Viruses and Their Protein Particle Sensing

Directory of Open Access Journals (Sweden)

Kae Dal Kwack

2008-10-01

Full Text Available Changes in electric parameters of a mesoporous silicon treated by a plasma chemical etching with fluorine and hydrogen ions, under the adsorption of NEPO (Nematodetransmitted Polyhedral plant viruses such as TORSV (Tomato Ringspot Virus, GFLV (Grapevine Fan Leaf Virus and protein macromolecule from TORSV particles are described. The current response to the applied voltage is measured for each virus particle to investigate the material parameters which are sensitive to the adsorbed particles. The peculiar behaviors of the response are modeled by the current-voltage relationship in a MOSFET. This model explains the behavior well and the double gate model of the MOSFET informs that the mesoporous silicon is a highly sensitive means of detecting the viruses in the size range less than 50 nm.

Are PEI-coated SWCNTs conjugated with hepatitis A virus? A chemical study with SEM, Z-potential, EDXD and RT-PCR

International Nuclear Information System (INIS)

Carbone, M; Valentini, F; Palleschi, G; Caminiti, R; Petrinca, A R; Donia, D; Divizia, M

2010-01-01

The conjugation between nanotubes, coated with different doses of polyethylene imine (PEI) and hepatitis A virus (HAV) was investigated by scanning electron microscopy, Z-potential, thermogravimetric and differential thermal analysis, transmission electron microscopy, energy dispersive x-ray diffraction (EDXD) and reverse transcript polymerase chain reaction (RT-PCR). For the first time, to our knowledge, evidence is obtained that conjugation between the nanotubes and the HAV occurs and that it has an (at least a partial) electrostatic character. Since all components of the conjugated systems, nanotubes, coating material and virus are characterized by different peak shapes in the selected q range, it was possible to infer that conjugation occurred. RT-PCR measurements confirmed that the conjugation of the coated nanotubes and HAV occurred and the result was stable. This opens up the prospect of probing the coated nanotubes as intra-cellular carriers in transfection processes of the virus. Further biological applications will concern a possible vaccine especially for non-replicative viruses.

Role of Pea Enation Mosaic Virus Coat Protein in the Host Plant and Aphid Vector

Directory of Open Access Journals (Sweden)

Juliette Doumayrou

2016-11-01

Full Text Available Understanding the molecular mechanisms involved in plant virus–vector interactions is essential for the development of effective control measures for aphid-vectored epidemic plant diseases. The coat proteins (CP are the main component of the viral capsids, and they are implicated in practically every stage of the viral infection cycle. Pea enation mosaic virus 1 (PEMV1, Enamovirus, Luteoviridae and Pea enation mosaic virus 2 (PEMV2, Umbravirus, Tombusviridae are two RNA viruses in an obligate symbiosis causing the pea enation mosaic disease. Sixteen mutant viruses were generated with mutations in different domains of the CP to evaluate the role of specific amino acids in viral replication, virion assembly, long-distance movement in Pisum sativum, and aphid transmission. Twelve mutant viruses were unable to assemble but were able to replicate in inoculated leaves, move long-distance, and express the CP in newly infected leaves. Four mutant viruses produced virions, but three were not transmissible by the pea aphid, Acyrthosiphon pisum. Three-dimensional modeling of the PEMV CP, combined with biological assays for virion assembly and aphid transmission, allowed for a model of the assembly of PEMV coat protein subunits.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

Science.gov (United States)

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Survival of Newcastle disease virus (NDV) strain V4- UPM coated on ...

African Journals Online (AJOL)

STORAGESEVER

2008-08-04

Aug 4, 2008 ... Results showed that the virus coated onto the carrier foods offal without additive remained stable at ≥ MID value for ≈3 ... meat (Shane, 1984). Velogenic .... the byproducts of food processing that is expected to eliminate any ...

Partial characterization of the lettuce infectious yellows virus genomic RNAs, identification of the coat protein gene and comparison of its amino acid sequence with those of other filamentous RNA plant viruses.

Science.gov (United States)

Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W

1994-07-01

Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.

Polyclonal Antibodies to a Recombinant Coat Protein of Potato Virus A

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Velemínský, Jiří

2002-01-01

Roč. 46, - (2002), s. 147-151 ISSN 0001-723X R&D Projects: GA ČR GA310/00/0381 Institutional research plan: CEZ:AV0Z5038910 Keywords : Potato virus A * recombinant coat protein * Escherichia coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.660, year: 2002

Efisiensi Tular Benih Squash mosaic virus pada Cucurbitaceae

Directory of Open Access Journals (Sweden)

Susanti Mugi Lestari

2014-09-01

Full Text Available Infection of viruses on Cucurbitaceae may cause high yield and economic losses. Squash mosaic virus is a seed borne virus and among the most important virus infecting Cucurbitaceae. The aims of these research was to detect infection of several viruses on Cucurbitaceae and to examine seed transmission efficiency of SqMV. Detection of Cucumber mosaic virus (CMV, Squash mosaic virus (SqMV, Watermelon mosaic virus-2 (WMV-2, Zucchini yellow mosaic virus (ZYMV, and Tobacco ringspot virus (TRSV from field samples and seeds was conducted using Indirect-ELISA method. Infection of CMV, SqMV and ZYMV was detected from field samples. Seed transmission of SqMV on commercial seeds of bottle gourd, watermelon, zucchini, cabocha, cucumber, and melon was 13, 13, 33, 73, 100, and 100%, respectively. Seed transmission of ZYMV was only occurred on bottle gourd and zucchini, i.e. 13.3% and 26.67%, respectively. Infection of SqMV through F2 seed was determined from cucumber, bottle gourd, and melon, i.e. 93, 100, and 100%, respectively. Therefore, the status of SqMV as quarantine pest should be evaluated since SqMV was already found in West Java.

Phylogenetic analysis of Tomato mosaic virus from Hemerocallis sp. and Impatiens hawkeri Análise filogenética de Tomato mosaic virus isolado de Hemerocallis sp. e Impatiens hawkeri

Directory of Open Access Journals (Sweden)

Lígia Maria Lembo Duarte

2007-12-01

Full Text Available The culture and commercialization of ornamental plants have considerably increased in the last years. To supply the commercial demand, several Hemerocallis and Impatiens varieties have been bred for appreciated qualities such as flowers with a diversity of shapes and colors. With the aim of characterizing the tobamovirus isolated from Hemerocallis sp. (tobamo-H and Impatiens hawkeri (tobamo-I from the USA and São Paulo, respectively, as well as to establish phylogenetic relationships between them and other Tobamovirus species, the viruses were submitted to RNA extraction, RT-PCR amplification, coat-protein gene sequencing and phylogenetic analyses. Comparison of tobamovirus homologous sequences yielded values superior to 98.5% of identity with Tomato mosaic virus (ToMV isolates at the nucleotide level. In relation to tobamo-H, 100% of identity with ToMV from tomatoes from Australia and Peru was found. Based on maximum likelihood (ML analysis it was suggested that tobamo-H and tobamo-I share a common ancestor with ToMV, Tobacco mosaic virus, Odontoglossum ringspot virus and Pepper mild mottle virus. The tree topology reconstructed under ML methodology shows a monophyletic group, supported by 100% of bootstrap, consisting of various ToMV isolates from different hosts, including some ornamentals, from different geographical locations. The results indicate that Hemerocallis sp. and I. hawkeri are infected by ToMV. This is the first report of the occurrence of this virus in ornamental species in Brazil.O cultivo e comercialização de plantas ornamentais têm aumentado consideravelmente nos últimos anos. Para suprir a demanda comercial, diversas variedades de Hemerocallis sp. e Impatiens hawkeri têm sido desenvolvidas pelas qualidades apreciáveis como flores com diversidade de formas e cores. Com o objetivo de caracterizar o tobamovirus isolado de Hemerocallis sp. (tobamo-H e Impatiens hawkeri (tobamo-I provenientes dos EUA e São Paulo

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

Ilarviruses of Prunus spp.: a continued concern for fruit trees.

Science.gov (United States)

Pallas, V; Aparicio, F; Herranz, M C; Amari, K; Sanchez-Pina, M A; Myrta, A; Sanchez-Navarro, J A

2012-12-01

Prunus spp. are affected by a large number of viruses, causing significant economic losses through either direct or indirect damage, which results in reduced yield and fruit quality. Among these viruses, members of the genus Ilarvirus (isometric labile ringspot viruses) occupy a significant position due to their distribution worldwide. Although symptoms caused by these types of viruses were reported early in the last century, their molecular characterization was not achieved until the 1990s, much later than for other agronomically relevant viruses. This was mainly due to the characteristic liability of virus particles in tissue extracts. In addition, ilarviruses, together with Alfalfa mosaic virus, are unique among plant viruses in that they require a few molecules of the coat protein in the inoculum in order to be infectious, a phenomenon known as genome activation. Another factor that has made the study of this group of viruses difficult is that infectious clones have been obtained only for the type member of the genus, Tobacco streak virus. Four ilarviruses, Prunus necrotic ringspot virus, Prune dwarf virus, Apple mosaic virus, and American plum line pattern virus, are pathogens of the main cultivated fruit trees. As stated in the 9th Report of the International Committee on Taxonomy of Viruses, virions of this genus are "unpromising subjects for the raising of good antisera." With the advent of molecular approaches for their detection and characterization, it has been possible to get a more precise view of their prevalence and genome organization. This review updates our knowledge on the incidence, genome organization and expression, genetic diversity, modes of transmission, and diagnosis, as well as control of this peculiar group of viruses affecting fruit trees.

The 96th Amino Acid of the Coat Protein of Cucumber Green Mottle Mosaic Virus Affects Virus Infectivity

Directory of Open Access Journals (Sweden)

Zhenwei Zhang

2017-12-01

Full Text Available Cucumber green mottle mosaic virus (CGMMV is one of the most devastating viruses infecting members of the family Cucurbitaceae. The assembly initiation site of CGMMV is located in the coding region of the coat protein, which is not only involved in virion assembly but is also a key factor determining the long-distance movement of the virus. To understand the effect of assembly initiation site and the adjacent region on CGMMV infectivity, we created a GTT deletion mutation in the GAGGTTG assembly initiation site of the infectious clone of CGMMV, which we termed V97 (deletion mutation at residue 97 of coat protein, followed by the construction of the V94A and T104A mutants. We observed that these three mutations caused mosaic after Agrobacterium-mediated transformation in Nicotiana benthamiana, albeit with a significant delay compared to the wild type clone. The mutants also had a common spontaneous E96K mutation in the coat protein. These results indicated that the initial assembly site and the sequence of the adjacent region affected the infectivity of the virus and that E96 might play an essential role in this process. We constructed two single point mutants—E96A and E96K—and three double mutants—V94A-E96K, V97-E96K and T104A-E96K—to further understand the role of E96 in CGMMV pathogenesis. After inoculation in N. benthamiana, E96A showed delayed systemic symptoms, but the E96K and three double mutants exhibited typical symptoms of mosaic at seven days post-infection. Then, sap from CGMMV-infected N. benthamiana leaves was mechanically inoculated on watermelon plants. We confirmed that E96 affected CGMMV infection using double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA, reverse transcription-polymerase chain reaction (RT-PCR, and sequencing, which further confirmed the successful infection of the related mutants, and that E96K can compensate the effect of the V94, V97, and T104 mutations on virus infectivity. In

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

Science.gov (United States)

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Stability of Newcastle Disease Virus Strain V4-UPM Coated on ...

African Journals Online (AJOL)

Protection of village chickens against Newcastle disease (ND) is considered feasible through food-delivered vaccines. Vaccine virus strain V4-UPM coated on cassava granules with or without additive (2% gelatin) was tested for stability at room temperature (RT) for 8 weeks and 40oC for 12 hours at weekly and two hourly ...

Cross-reacting and heterospecific monoclonal antibodies produced against arabis mosaic nepovirus.

Science.gov (United States)

Frison, E A; Stace-Smith, R

1992-10-01

Monoclonal antibodies (MAbs) were produced against arabis mosaic nepovirus (AMV). A hybridoma screening procedure was applied which involved the testing of culture supernatants, before the hybridomas were cloned to single cell lines, for their reaction with eight nepoviruses [AMV, cherry leafroll virus (CLRV), grapevine fanleaf virus (GFLV), peach rosette mosaic virus, raspberry ringspot virus (RRSV), tobacco ringspot virus, tomato black ring virus (TBRV) and tomato ringspot virus]. In addition to AMV-specific MAbs, this screening technique has allowed the selection of two cross-reacting MAbs: one reacting with AMV and GFLV, and one reacting with AMV and RRSV. This is the first report of MAbs cross-reacting with these nepoviruses. In addition, five heterospecific MAbs (HS-MAbs) could be selected: two reacting with RRSV, two with CLRV and one with TBRV. The usefulness of the screening technique that was applied for the selection of cross-reacting MAbs and HS-MAbs, and the potential use of such antibodies are discussed.

Expression and the antigenicity of recombinant coat proteins of tungro viruses expressed in Escherichia coli.

Science.gov (United States)

Yee, Siew Fung; Chu, Chia Huay; Poili, Evenni; Sum, Magdline Sia Henry

2017-02-01

Rice tungro disease (RTD) is a recurring disease affecting rice farming especially in the South and Southeast Asia. The disease is commonly diagnosed by visual observation of the symptoms on diseased plants in paddy fields and by polymerase chain reaction (PCR). However, visual observation is unreliable and PCR can be costly. High-throughput as well as relatively cheap detection methods are important for RTD management for screening large number of samples. Due to this, detection by serological assays such as immunoblotting assays and enzyme-linked immunosorbent assay are preferred. However, these serological assays are limited by lack of continuous supply of antibodies as reagents due to the difficulty in preparing sufficient purified virions as antigens. This study aimed to generate and evaluate the reactivity of the recombinant coat proteins of Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV) as alternative antigens to generate antibodies. The genes encoding the coat proteins of both viruses, RTBV (CP), and RTSV (CP1, CP2 and CP3) were cloned and expressed as recombinant fusion proteins in Escherichia coli. All of the recombinant fusion proteins, with the exception of the recombinant fusion protein of the CP2 of RTSV, were reactive against our in-house anti-tungro rabbit serum. In conclusion, our study showed the potential use of the recombinant fusion coat proteins of the tungro viruses as alternative antigens for production of antibodies for diagnostic purposes. Copyright © 2016 Elsevier B.V. All rights reserved.

Protective hybrid coating containing silver, copper and zinc cations effective against human immunodeficiency virus and other enveloped viruses

Czech Academy of Sciences Publication Activity Database

Hodek, Jan; Zajícová, V.; Lovětinská-Šlamborová, I.; Stibor, I.; Müllerová, J.; Weber, Jan

2016-01-01

Roč. 16, Apr 1 (2016), č. článku 56. ISSN 1471-2180 R&D Projects: GA MŠk(CZ) LK11207 Institutional support: RVO:61388963 Keywords : hybrid coating * virucidal effect * HIV * enveloped viruses Subject RIV: EE - Microbiology, Virology Impact factor: 2.644, year: 2016 http://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-016-0675-x

Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

Science.gov (United States)

Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

2007-04-01

Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

Simultaneous detection of six stone fruit viruses by non-isotopic molecular hybridization using a unique riboprobe or 'polyprobe'.

Science.gov (United States)

Herranz, M Carmen; Sanchez-Navarro, Jesus A; Aparicio, Frederic; Pallás, Vicente

2005-03-01

A new strategy for the simultaneous detection of plant viruses by molecular hybridization has been developed. Two, four or six viral sequences were fused in tandem and transcribed to render unique riboprobes and designated as 'polyprobes'. The 'polyprobe four' (poly 4) covered the four ilarviruses affecting stone fruit trees including apple mosaic virus (ApMV), prunus necrotic ringspot virus (PNRSV), prune dwarf virus (PDV), and American plum line pattern virus (APLPV) whereas the 'polyprobe two' (poly 2) was designed to detect simultaneously, plum pox virus (PPV) and apple chlorotic leaf spot virus (ACLSV), the two more important viruses affecting these trees. Finally, a 'polyprobe six' (poly 6) was generated to detect any of the six viruses. The three polyprobes were comparable to the individual riboprobes in terms of end-point dilution limit and specificity. The validation of the new simultaneous detection strategy was confirmed by the analysis of 46 field samples from up to seven different hosts collected from 10 different geographical areas.

Production of Polyclonal Antibodies to a Recombinant Coat Protein of Potato mop-top virus

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Rosecká, Pavla; Dědič, P.; Filigarová, Marie

2003-01-01

Roč. 151, č. 4 (2003), s. 195-200 ISSN 0931-1785 R&D Projects: GA ČR GA522/01/1121 Institutional research plan: CEZ:AV0Z5038910 Keywords : potato mop-top virus * recombinant coat protein * Escherichia Coli Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.557, year: 2003

Plant virus cell-to-cell movement is not dependent on the transmembrane disposition of its movement protein.

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-06-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement.

The movement protein and coat protein of alfalfa mosaic virus accumulate in structurally modified plasmodesmata

NARCIS (Netherlands)

van der Wel, N. N.; Goldbach, R. W.; van Lent, J. W.

1998-01-01

In systemically infected tissues of Nicotiana benthamiana, alfalfa mosaic virus (AMV) coat protein (CP) and movement protein (MP) are detected in plasmodesmata in a layer of three to four cells at the progressing front of infection. Besides the presence of these viral proteins, the plasmodesmata are

AcEST: DK949550 [AcEST

Lifescience Database Archive (English)

Full Text Available 40 Definition tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus Align length 103 Score... alignments: (bits) Value tr|Q27K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspo... 35 4.8 >tr|Q27...K40|Q27K40_9TOMB P23 protein OS=Hibiscus chlorotic ringspot virus PE=4 SV=1 Lengt

Plant Virus Cell-to-Cell Movement Is Not Dependent on the Transmembrane Disposition of Its Movement Protein▿ †

Science.gov (United States)

Martínez-Gil, Luis; Sánchez-Navarro, Jesús A.; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael

2009-01-01

The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement. PMID:19321624

Coat protein deletion mutants elicit more severe symptoms than wild-type virus in multiple cereal hosts

Science.gov (United States)

The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...

Managing thrips and tospoviruses in tomato

Science.gov (United States)

Tomato spotted wilt virus and more recently emerged Tomato chlorotic spot virus and Groundnut ringspot virus are all transmitted by thrips, making managment complex. All three viruses and the thrips vector are major pests of tomato in Florida. Current management tools for these viruses and the th...

Wheat streak mosaic virus coat protein is a determinant for vector transmission by the wheat curl mite

Science.gov (United States)

Wheat streak mosaic virus (WSMV; genus Tritimovirus; family Potyviridae), is transmitted by the wheat curl mite (Aceria tosichella Keifer). The requirement of coat protein (CP) for WSMV transmission by the wheat curl mite was examined using a series of viable deletion and point mutations. Mite trans...

40 CFR 174.516 - Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Coat protein of cucumber mosaic virus; exemption from the requirement of a tolerance. 174.516 Section 174.516 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance...

Occurrence of nepoviruses in Rubus species in the Czech Republic.

Science.gov (United States)

Spak, J; Kubelková, D; Honetslegrová-Fránová, J

1997-06-01

The occurrence of arabis mosaic virus (AMV), raspberry ringspot virus (RRV), tomato black ring virus (TBRV), strawberry latent ringspot virus (SLRV) and cherry leaf roll virus (CLRV) in cultivated and wild plants of raspberry and blackberry has been studied in the Czech Republic in 1993-1996. Five hundred and seventy samples were collected at 51 localities and assayed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). The results represent the first evidence on the occurrence of AMV, RRV, TBRV and SLRV in cultivated Rubus species in the Czech Republic. Isolates AMV M20 and TBRV ML15 which were successfully transmitted by mechanical inoculation and characterized by reactions of differential host plants and by electron microscopy are the first isolates from Rubus from this territory. CLRV was not detected in either cultivated or wild Rubus species.

The prehistory of potyviruses: their initial radiation was during the dawn of agriculture.

Science.gov (United States)

Gibbs, Adrian J; Ohshima, Kazusato; Phillips, Matthew J; Gibbs, Mark J

2008-06-25

Potyviruses are found world wide, are spread by probing aphids and cause considerable crop damage. Potyvirus is one of the two largest plant virus genera and contains about 15% of all named plant virus species. When and why did the potyviruses become so numerous? Here we answer the first question and discuss the other. We have inferred the phylogenies of the partial coat protein gene sequences of about 50 potyviruses, and studied in detail the phylogenies of some using various methods and evolutionary models. Their phylogenies have been calibrated using historical isolation and outbreak events: the plum pox virus epidemic which swept through Europe in the 20th century, incursions of potyviruses into Australia after agriculture was established by European colonists, the likely transport of cowpea aphid-borne mosaic virus in cowpea seed from Africa to the Americas with the 16th century slave trade and the similar transport of papaya ringspot virus from India to the Americas. Our studies indicate that the partial coat protein genes of potyviruses have an evolutionary rate of about 1.15x10(-4) nucleotide substitutions/site/year, and the initial radiation of the potyviruses occurred only about 6,600 years ago, and hence coincided with the dawn of agriculture. We discuss the ways in which agriculture may have triggered the prehistoric emergence of potyviruses and fostered their speciation.

Development of ZYMV-resistant watermelon lines using molecular markers for the eukaryotic elongation factor eIF4E together with phenotypic evaluation

Science.gov (United States)

The aphid-transmitted potyviruses of watermelon, including papaya ringspot virus (PRSV), watermelon mosaic virus (WMV), and zucchini yellow mosaic virus (ZYMV) cause serious damage to the watermelon crop throughout the world. The United States Plant Introduction (PI) 595203 is resistant to ZYMV-FL a...

Výskyt virů v odrůdách rybízu

Czech Academy of Sciences Publication Activity Database

Špak, Josef; Přibylová, Jaroslava; Kubelková, Darina; Sedlák, J.; Paprštein, F.; Svobodová, L.

2010-01-01

Roč. 9, č. 8 (2010), s. 14-16 ISSN 1213-7596 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Currant * Blackcurrant reversion virus * Gooseberry vein banding associated virus * Strawberry latent ringspot virus Subject RIV: EE - Microbiology, Virology

Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

Science.gov (United States)

Sasaya, T; Ishikawa, K; Koganezawa, H

2001-06-01

A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

Solution structures of potato virus X and narcissus mosaic virus from Raman optical activity

DEFF Research Database (Denmark)

Blanch, Ewan W.; Robinson, David J.; Hecht, Lutz

2002-01-01

Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar to that of to......Potato virus X (PVX) and narcissus mosaic virus (NMV) were studied using vibrational Raman optical activity (ROA) in order to obtain new information on the structures of their coat protein subunits. The ROA spectra of the two intact virions are very similar to each other and similar...

First Report of Blueberry red ringspot virus in Highbush Blueberry in the Czech Republic

Czech Academy of Sciences Publication Activity Database

Přibylová, Jaroslava; Špak, Josef; Kubelková, Darina; Petrzik, Karel

2010-01-01

Roč. 94, č. 8 (2010), s. 1071-1071 ISSN 0191-2917 R&D Projects: GA MŠk(CZ) OC09022 Institutional research plan: CEZ:AV0Z50510513 Keywords : Virus * small fruits * pathogen detection Subject RIV: EE - Microbiology, Virology

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

Science.gov (United States)

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein

International Nuclear Information System (INIS)

Andret-Link, Peggy; Schmitt-Keichinger, Corinne; Demangeat, Gerard; Komar, Veronique; Fuchs, Marc

2004-01-01

The viral determinants involved in the specific transmission of Grapevine fanleaf virus (GFLV) by its nematode vector Xiphinema index are located within the 513 C-terminal residues of the RNA2-encoded polyprotein, that is, the 9 C-terminal amino acids of the movement protein (2B MP ) and contiguous 504 amino acids of the coat protein (2C CP ) [Virology 291 (2001) 161]. To further delineate the viral determinants responsible for the specific spread, the four amino acids that are different within the 9 C-terminal 2B MP residues between GFLV and Arabis mosaic virus (ArMV), another nepovirus which is transmitted by Xiphinema diversicaudatum but not by X. index, were subjected to mutational analysis. Of the recombinant viruses derived from transcripts of GFLV RNA1 and RNA2 mutants that systemically infected herbaceous host plants, all with the 2C CP of GFLV were transmitted by X. index unlike none with the 2C CP of ArMV, regardless of the mutations within the 2B MP C-terminus. These results demonstrate that the coat protein is the sole viral determinant for the specific spread of GFLV by X. index

WATERMELON MOSAIC VIRUS OF PUMPKIN (Cucurbita maxima FROM SULAWESI: IDENTIFICATION, TRANSMISSION, AND HOST RANGE

Directory of Open Access Journals (Sweden)

Wasmo Wakmana

2016-10-01

Full Text Available A mosaic disease of pumpkin (Cucurbita maxima was spread widely in Sulawesi. Since the virus had not yet been identified, a study was conducted to identify the disease through mechanical inoculation, aphid vector transmission, host range, and electron microscopic test. Crude sap of infected pumpkin leaf samples was rubbed on the cotyledons of healthy pumpkin seedlings for mechanical inoculation. For insect transmission, five infective aphids were infected per seedling. Seedlings of eleven different species were inoculated mechanically for host range test. Clarified sap was examined under the electron microscope. Seeds of two pumpkin fruits from two different infected plants were planted and observed for disease transmission up to one-month old seedlings. The mosaic disease was transmitted mechanically from crude sap of different leaf samples to healthy pumpkin seedlings showing mosaic symptoms. The virus also infected eight cucurbits, i.e., cucumber (Cucumis sativus, green melon (Cucumis melo, orange/rock melon (C. melo, zucchini (Cucurbita pepo, pumpkin (Cucurbita maxima, water melon (Citrulus vulgaris, Bennicosa hispida, and blewah (Cucurbita sp.. Aphids  transmitted the disease from one to other pumpkin seedlings. The virus was not transmitted by seed. The mosaic disease of pumpkin at Maros, South Sulawesi, was associated with flexious particles of approximately 750 nm length, possibly a potyvirus, such as water melon mosaic virus rather than papaya ringspot virus or zucchini yellow mosaic virus.

Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

Science.gov (United States)

Wai, T; Grumet, R

1995-09-01

The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

Science.gov (United States)

Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

2013-10-01

A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

Role of alfalfa mosaic virus coat protein in regulation of the balance between viral plus and minus strand RNA synthesis

NARCIS (Netherlands)

van der Kuyl, A. C.; Neeleman, L.; Bol, J. F.

1991-01-01

Replication of wild type RNA 3 of alfalfa mosaic virus (AIMV) and mutants with frameshifts in the P3 or coat protein (CP) genes was studied in protoplasts from tobacco plants transformed with DNA copies of AIMV RNAs 1 and 2. Accumulation of viral plus and minus strand RNAs was monitored with

Differential Life History Trait Associations of Aphids with Nonpersistent Viruses in Cucurbits.

Science.gov (United States)

Angelella, G M; Egel, D S; Holland, J D; Nemacheck, J A; Williams, C E; Kaplan, I

2015-06-01

The diversity of vectors and fleeting nature of virus acquisition and transmission renders nonpersistent viruses a challenge to manage. We assessed the importance of noncolonizing versus colonizing vectors with a 2-yr survey of aphids and nonpersistent viruses on commercial pumpkin farms. We quantified aphid alightment using pan traps, while testing leaf samples with multiplex RT-PCR targeting cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and papaya ringspot virus (PRSV). Overall, we identified 53 aphid species (3,899 individuals), from which the melon aphid, Aphis gossypii Glover, a pumpkin-colonizing species, predominated (76 and 37% of samples in 2010 and 2011, respectively). CMV and ZYMV were not detected, but WMV and PRSV were prevalent, both regionally (WMV: 28/29 fields, PRSV: 21/29 fields) and within fields (infection rates = 69 and 55% for WMV in 2010 and 2011; 28 and 25% for PRSV in 2010 and 2011). However, early-season samples showed extremely low infection levels, suggesting cucurbit viruses are not seed-transmitted and implicating aphid activity as a causal factor driving virus spread. Interestingly, neither noncolonizer and colonizer alightment nor total aphid alightment were good predictors of virus presence, but community analyses revealed species-specific relationships. For example, cowpea aphid (Aphis craccivora Koch) and spotted alfalfa aphid (Therioaphis trifolii Monell f. maculata) were associated with PRSV infection, whereas the oleander aphid (Aphis nerii Bover de Fonscolombe) was associated with WMV spread within fields. These outcomes highlight the need for tailored management plans targeting key vectors of nonpersistent viruses in agricultural systems. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Production of Polyclonal Antibodies to the Recombinant Potato virus M (PVM) Non-structural Triple Gene Block Protein 1 and Coat Protein

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Dědič, P.

2012-01-01

Roč. 160, č. 5 (2012), s. 251-254 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus M * recombinant protein * coat protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.000, year: 2012

Post-transcriptional gene silencing is involved in resistance of transgenic papayas to Papaya Ringspot Virus

Czech Academy of Sciences Publication Activity Database

Ruanjan, P.; Kertbundit, Sunee; Juříček, Miloslav

2007-01-01

Roč. 51, č. 3 (2007), s. 517-520 ISSN 0006-3134 Grant - others:BIOTEC, NASDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : Carica papaya * reverse transcription PCR * COAT PROTEIN GENE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

Immunity to potato mop-top virus in Nicotiana benthamiana plants expressing the coat protein gene is effective against fungal inoculation of the virus.

Science.gov (United States)

Reavy, B; Arif, M; Kashiwazaki, S; Webster, K D; Barker, H

1995-01-01

Nicotiana benthamiana stem tissue was transformed with Agrobacterium tumefaciens harboring a binary vector containing the potato mop-top virus (PMTV) coat protein (CP) gene. PMTV CP was expressed in large amounts in some of the primary transformants. The five transgenic lines which produced the most CP were selected for resistance testing. Flowers on transformed plants were allowed to self-fertilize. Transgenic seedlings selected from the T1 seed were mechanically inoculated with two strains of PMTV. Virus multiplication, assayed by infectivity, was detected in only one transgenic plant of 98 inoculated. T1 plants were also highly resistant to graft inoculation; PMTV multiplied in only one plant of 45 inoculated. Transgenic T1 seedlings were challenged in a bait test in which they were grown in soil containing viruliferous spores of the vector fungus Spongospora subterranea. In these tests only two plants out of 99 became infected. Of the five transgenic lines tested, plants of three lines were immune to infection following manual, graft, or fungal inoculation.

Molecular identification based on coat protein sequences of the Barley yellow dwarf virus from Brazil

Directory of Open Access Journals (Sweden)

Talita Bernardon Mar

2013-12-01

Full Text Available Yellow dwarf disease, one of the most important diseases of cereal crops worldwide, is caused by virus species belonging to the Luteoviridae family. Forty-two virus isolates obtained from oat (Avena sativa L., wheat (Triticum aestivum L., barley (Hordeum vulgare L., corn (Zea mays L., and ryegrass (Lolium multiflorum Lam. collected between 2007 and 2008 from winter cereal crop regions in southern Brazil were screened by polymerase chain reaction (PCR with primers designed on ORF 3 (coat protein - CP for the presence of Barley yellow dwarf virus and Cereal yellow dwarf virus (B/CYDV. PCR products of expected size (~357 bp for subgroup II and (~831 bp for subgroup I were obtained for three and 39 samples, respectively. These products were cloned and sequenced. The subgroup II 3' partial CP amino acid deduced sequences were identified as BYDV-RMV (92 - 93 % of identity with "Illinois" Z14123 isolate. The complete CP amino acid deduced sequences of subgroup I isolates were confirmed as BYDV-PAV (94 - 99 % of identity and established a very homogeneous group (identity higher than 99 %. These results support the prevalence of BYDV-PAV in southern Brazil as previously diagnosed by Enzyme-Linked Immunosorbent Assay (ELISA and suggest that this population is very homogeneous. To our knowledge, this is the first report of BYDV-RMV in Brazil and the first genetic diversity study on B/CYDV in South America.

Preparation of (Ga1−xZnx)(N1−xOx) Photocatalysts from the Reaction of NH3 with Ga2O3/ZnO and ZnGa2O4: In Situ Time-Resolved XRD and XAFS Studies

Energy Technology Data Exchange (ETDEWEB)

Chen, H.; Wen , W; Wang, Q; Hanson, J; Muckerman, J; Fujita, E; Frenkel, A; Rodriguez, J

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 A resolution Ad allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 A. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.

Complete genome sequences of blueberry red ringspot virus (Caulimoviridae) isolates from the Czech Republic and Slovenia

Czech Academy of Sciences Publication Activity Database

Petrzik, Karel; Přibylová, Jaroslava; Mavrič-Pleško, I.; Špak, Josef

2011-01-01

Roč. 156, č. 10 (2011), s. 1901-1903 ISSN 0304-8608 Institutional research plan: CEZ:AV0Z50510513 Keywords : Complete genome * blueberry virus * highbush blueberry Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

Production of polyclonal antisera using recombinant coat proteins of Grapevine leafroll-associated virus 2 and Grapevine virus B Produção de anti-soros policlonais a partir de proteínas capsidiais recombinantes de Grapevine leafroll-associated virus 2 e Grapevine virus B

Directory of Open Access Journals (Sweden)

Paula Radaelli

2008-10-01

Full Text Available The objective of this work was to produce and characterize specific antisera against Brazilian isolates of Grapevine leafroll-associated virus 2 (GLRaV-2 and Grapevine virus B (GVB, developed from expressed coat proteins (CPs in Escherichia coli, and to test their possible use for the detection of these two viruses in diseased grapevines. The coat protein (CP genes were RT-PCR-amplified, cloned and sequenced. The CP genes were subsequently subcloned, and the recombinant plasmids were used to transform E. coli cells and express the coat proteins. The recombinant coat proteins were purified, and their identities were confirmed by SDS-PAGE and Western blot and used for rabbit immunizations. Antisera raised against these proteins were able to recognize the corresponding recombinant proteins in Western blots and to detect GLRaV-2 and GVB in infected grapevine tissues, by indirect ELISA, discriminating healthy and infected grapevines with absorbances (A405 of 0.08/1.15 and 0.12/1.30, respectively. Expressing CP genes can yield high amount of viral protein with high antigenicity, and GLRaV-2 and GVB antisera obtained in this study can allow reliable virus disease diagnosis.O objetivo deste trabalho foi produzir e caracterizar anti-soros específicos contra isolados brasileiros do Vírus do enrolamento-da-folha da videira 2 (GLRaV-2 e do Vírus B da videira (GVB, desenvolvidos a partir das proteínas capsidiais expressas em Escherichia coli, e testar seu possível uso para a detecção destes dois vírus em videiras infectadas. Os genes da proteína capsidial (CP foram amplificados via RT-PCR, clonados e seqüenciados. Foram, subseqüentemente, subclonados, e os plasmídeos recombinantes foram empregados na transformação das células de E. coli e na expressão das proteínas capsidiais. As proteínas capsidiais recombinantes foram purificadas, e suas identidades foram confirmadas em SDS-PAGE e "Western blot" e utilizadas para imunizar coelhos. Os anti

Transdermal influenza immunization with vaccine-coated microneedle arrays.

Directory of Open Access Journals (Sweden)

Dimitrios G Koutsonanos

Full Text Available Influenza is a contagious disease caused by a pathogenic virus, with outbreaks all over the world and thousands of hospitalizations and deaths every year. Due to virus antigenic drift and short-lived immune responses, annual vaccination is required. However, vaccine coverage is incomplete, and improvement in immunization is needed. The objective of this study is to investigate a novel method for transdermal delivery using metal microneedle arrays (MN coated with inactivated influenza virus to determine whether this route is a simpler and safer approach than the conventional immunization, capable to induce robust immune responses and confer protection against lethal virus challenge.Inactivated A/Aichi/2/68 (H3N2 influenza virus was coated on metal microneedle arrays and applied to mice as a vaccine in the caudal dorsal skin area. Substantial antibody titers with hemagglutination inhibition activity were detected in sera collected two and four weeks after a single vaccine dose. Challenge studies in mice with 5 x LD(50 of mouse adapted Aichi virus demonstrated complete protection. Microneedle vaccination induced a broad spectrum of immune responses including CD4+ and CD8+ responses in the spleen and draining lymph node, a high frequency of antigen-secreting cells in the lung and induction of virus-specific memory B-cells. In addition, the use of MN showed a dose-sparing effect and a strong Th2 bias when compared to an intramuscular (IM reference immunization.The present results show that delivery of inactivated influenza virus through the skin using metal microneedle arrays induced strong humoral and cellular immune responses capable of conferring protection against virus challenge as efficiently as intramuscular immunization, which is the standard vaccination route. In view of the convenience of delivery and the potential for self-administration, vaccine-coated metal microneedles may provide a novel and highly effective immunization method.

The 42-kDa coat protein of Andean potato mottle virus acts as a transcriptional activator in yeast

Directory of Open Access Journals (Sweden)

Vidal M.S.

2002-01-01

Full Text Available Interactions of viral proteins play an important role in the virus life cycle, especially in capsid assembly. Andean potato mottle comovirus (APMoV is a plant RNA virus with a virion formed by two coat proteins (CP42 and CP22. Both APMoV coat protein open reading frames were cloned into pGBT9 and pGAD10, two-hybrid system vectors. HF7c yeast cells transformed with the p9CP42 construct grew on yeast dropout selection media lacking tryptophan and histidine. Clones also exhibited ß-galactosidase activity in both qualitative and quantitative assays. These results suggest that CP42 protein contains an amino acid motif able to activate transcription of His3 and lacZ reporter genes in Saccharomyces cerevisiae. Several deletions of the CP42 gene were cloned into the pGBT9 vector to locate the region involved in this activation. CP42 constructions lacking 12 residues from the C-terminal region and another one with 267 residues deleted from the N-terminus are still able to activate transcription of reporter genes. However, transcription activation was not observed with construction p9CP42deltaC57, which does not contain the last 57 amino acid residues. These results demonstrate that a transcription activation domain is present at the C-terminus of CP42 between residues 267 and 374.

Marburg virus VP35 can both fully coat the backbone and cap the ends of dsRNA for interferon antagonism.

Directory of Open Access Journals (Sweden)

Shridhar Bale

2012-09-01

Full Text Available Filoviruses, including Marburg virus (MARV and Ebola virus (EBOV, cause fatal hemorrhagic fever in humans and non-human primates. All filoviruses encode a unique multi-functional protein termed VP35. The C-terminal double-stranded (dsRNA-binding domain (RBD of VP35 has been implicated in interferon antagonism and immune evasion. Crystal structures of the VP35 RBD from two ebolaviruses have previously demonstrated that the viral protein caps the ends of dsRNA. However, it is not yet understood how the expanses of dsRNA backbone, between the ends, are masked from immune surveillance during filovirus infection. Here, we report the crystal structure of MARV VP35 RBD bound to dsRNA. In the crystal structure, molecules of dsRNA stack end-to-end to form a pseudo-continuous oligonucleotide. This oligonucleotide is continuously and completely coated along its sugar-phosphate backbone by the MARV VP35 RBD. Analysis of dsRNA binding by dot-blot and isothermal titration calorimetry reveals that multiple copies of MARV VP35 RBD can indeed bind the dsRNA sugar-phosphate backbone in a cooperative manner in solution. Further, MARV VP35 RBD can also cap the ends of the dsRNA in solution, although this arrangement was not captured in crystals. Together, these studies suggest that MARV VP35 can both coat the backbone and cap the ends, and that for MARV, coating of the dsRNA backbone may be an essential mechanism by which dsRNA is masked from backbone-sensing immune surveillance molecules.

Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing.

Science.gov (United States)

Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A

2013-08-01

Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Natural minus-strand RNAs of alfalfa mosaic virus as in vitro templates for viral RNA polymerase. 3'-Terminal non-coded guanosine and coat protein are insufficient factors for full-size plus-strand synthesis

NARCIS (Netherlands)

Houwing, C.J.; Huis in 't Veld, M.; Zuidema, D.; Graaff, de M.; Jaspars, E.M.J.

2001-01-01

Replication complexes of alfalfa mosaic virus produce in vivo large quantities of plus-strand RNAs, but this production is fully dependent on the presence of coat protein. In order to study this process of RNA-dependent and coat protein-regulated RNA synthesis we have isolated the three natural

The effect of surface demineralization of cortical bone allograft on the properties of recombinant adeno-associated virus coatings.

Science.gov (United States)

Yazici, Cemal; Yanoso, Laura; Xie, Chao; Reynolds, David G; Samulski, R Jude; Samulski, Jade; Yannariello-Brown, Judith; Gertzman, Arthur A; Zhang, Xinping; Awad, Hani A; Schwarz, Edward M

2008-10-01

Freeze-dried recombinant adeno-associated virus (rAAV) coated structural allografts have emerged as an approach to engender necrotic cortical bone with host factors that will persist for weeks following surgery to facilitate revascularization, osteointegration, and remodeling. However, one major limitation is the nonporous cortical surface that prohibits uniform distribution of the rAAV coating prior to freeze-drying. To overcome this we have developed a demineralization method to increase surface absorbance while retaining the structural integrity of the allograft. Demineralized bone wafers (DBW) made from human femoral allograft rings demonstrated a significant 21.1% (73.6+/-3.9% versus 52.5+/-2.6%; pcoating versus mineralized controls. Co-incubation of rAAV-luciferase (rAAV-Luc) coated DBW with a monolayer of C3H10T1/2 cells in culture led to peak luciferase levels that were not significantly different from soluble rAAV-Luc controls (p>0.05), although the peaks occurred at 60h and 12h, respectively. To assess the transduction efficiency of rAAV-Luc coated DBW in vivo, we first performed a dose response with allografts containing 10(7), 10(9) or 10(10) particles that were surgically implanted into the quadriceps of mice, and assayed by in vivo bioluminescence imaging (BLI) on days 1, 3, 5, 7, 10, 14, and 21. The results demonstrated a dose response in which the DBW coated with 10(10) rAAV-Luc particles achieved peak gene expression levels on day 3, which persisted until day 21, and was significantly greater than the 10(7) dose throughout this time period (pcoated with 10(10) rAAV-Luc particles failed to demonstrate any significant differences in transduction kinetics or efficiency in vivo. Thus, surface demineralization of human cortical bone allograft increases its absorbance for uniform rAAV coating, without affecting vector transduction efficiency.

The Generation of Turnip Crinkle Virus-Like Particles in Plants by the Transient Expression of Wild-Type and Modified Forms of Its Coat Protein.

Science.gov (United States)

Saunders, Keith; Lomonossoff, George P

2015-01-01

Turnip crinkle virus (TCV), a member of the genus carmovirus of the Tombusviridae family, has a genome consisting of a single positive-sense RNA molecule that is encapsidated in an icosahedral particle composed of 180 copies of a single type of coat protein. We have employed the CPMV-HT transient expression system to investigate the formation of TCV-like particles following the expression of the wild-type coat protein or modified forms of it that contain either deletions and/or additions. Transient expression of the coat protein in plants results in the formation of capsid structures that morphologically resemble TCV virions (T = 3 structure) but encapsidate heterogeneous cellular RNAs, rather than the specific TCV coat protein messenger RNA. Expression of an amino-terminal deleted form of the coat protein resulted in the formation of smaller T = 1 structures that are free of RNA. The possibility of utilizing TCV as a carrier for the presentation of foreign proteins on the particle surface was also explored by fusing the sequence of GFP to the C-terminus of the coat protein. The expression of coat protein-GFP hybrids permitted the formation of VLPs but the yield of particles is diminished compared to the yield obtained with unmodified coat protein. Our results confirm the importance of the N-terminus of the coat protein for the encapsidation of RNA and show that the coat protein's exterior P domain plays a key role in particle formation.

Genetic diversity and molecular evolution of Ornithogalum mosaic virus based on the coat protein gene sequence

Directory of Open Access Journals (Sweden)

Fangluan Gao

2018-03-01

Full Text Available Ornithogalum mosaic virus (OrMV has a wide host range and affects the production of a variety of ornamentals. In this study, the coat protein (CP gene of OrMVwas used to investigate the molecular mechanisms underlying the evolution of this virus. The 36 OrMV isolates fell into two groups which have significant subpopulation differentiation with an FST value of 0.470. One isolate was identified as a recombinant and the other 35 recombination-free isolates could be divided into two major clades under different evolutionary constraints with dN/dS values of 0.055 and 0.028, respectively, indicating a role of purifying selection in the differentiation of OrMV. In addition, the results from analysis of molecular variance (AMOVA indicated that the effect of host species on the genetic divergence of OrMV is greater than that of geography. Furthermore, OrMV isolates from the genera Ornithogalum, Lachenalia and Diuri tended to group together, indicating that OrMV diversification was maintained, in part, by host-driven adaptation.

Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

International Nuclear Information System (INIS)

Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

1994-01-01

The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

Virus-membrane interactions : spectroscopic studies

NARCIS (Netherlands)

Datema, K.P.

1987-01-01

In this thesis some new aspects of the infection process of nonenveloped viruses are reported. The interaction of a rod-shaped (TMV) and three spherical (CCMV, BMV, SBMV) plant viruses, of the filamentous bacteriophage M13, and of their coat proteins with membranes have been investigated. A

Field and laboratory investigations of inactivation of viruses (PRD1 and MS2) attached to iron oxide-coated quartz san

Science.gov (United States)

Ryan, Joseph N.; Harvey, Ronald W.; Metge, David W.; Elimelech, Menachem; Navigato, Theresa; Pieper, Ann P.

2002-01-01

Field and laboratory experiments were conducted to investigate inactivation of viruses attached to mineral surfaces. In a natural gradient transport field experiment, bacteriophage PRD1, radiolabeled with 32P, was injected into a ferric oxyhydroxide-coated sand aquifer with bromide and linear alkylbenzene sulfonates. In a zone of the aquifer contaminated by secondary sewage infiltration, small fractions of infective and 32P-labeled PRD1 broke through with the bromide tracer, followed by the slow release of 84% of the 32P activity and only 0.011% of the infective PRD1. In the laboratory experiments, the inactivation of PRD1, labeled with 35S (protein capsid), and MS2, dual radiolabeled with 35S (protein capsid) and 32P (nucleic acid), was monitored in the presence of groundwater and sediment from the contaminated zone of the field site. Release of infective viruses decreased at a much faster rate than release of the radiolabels, indicating that attached viruses were undergoing surface inactivation. Disparities between 32P and35S release suggest that the inactivated viruses were released in a disintegrated state. Comparison of estimated solution and surface inactivation rates indicates solution inactivation is ∼3 times as fast as surface inactivation. The actual rate of surface inactivation may be substantially underestimated owing to slow release of inactivated viruses.

Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

Science.gov (United States)

Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

2013-10-01

A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

SPECIFICITY OF THE PRECIPITIN REACTION IN TOBACCO MOSAIC DISEASE.

Science.gov (United States)

Beale, H P

1931-09-30

1. Leaf extracts of Sudan grass, Hippeastrum equestre Herb., lily, and Abutilon striatum Dicks. (A. Thompsoni hort.), each affected with its respective mosaic disease, and peach affected with yellows disease, were tested for their ability to precipitate antiserum for virus extract of tobacco mosaic disease. No precipitate occurred. 2. Nicotiana glutinosa L., N. rustica L., and Martynia louisiana Mill. were added to the list of hosts of tobacco mosaic virus which have been tested with antiserum for the same virus in N. tabacum L. var. Turkish. The object was to determine the presence or absence of material reacting with the specific precipitins such as that already demonstrated in extracts of tomato, pepper, and petunia affected with the same virus. The presence of specific substances was demonstrated in every case. 3. The viruses of ringspot and cucumber mosaic diseases were multiplied in Turkish tobacco and leaf extracts of the affected plants were used in turn as antigens in precipitin tests with antiserum for tobacco mosaic virus extract of Turkish tobacco. A slight precipitation resulted in the tubes containing undiluted antiserum and virus extract such as occurs when juice from normal tobacco is used with undiluted antiserum. No precipitate was demonstrable that was specific for virus extracts of tobacco affected with either ringspot or cucumber mosaic disease. 4. The results favor the interpretation that the specific antigenic substance in virus extract of tobacco mosaic disease is foreign antigenic material, possibly virus itself, not altered host protein.

Fungal transmission of plant viruses.

Science.gov (United States)

Campbell, R N

1996-01-01

Thirty soilborne viruses or virus-like agents are transmitted by five species of fungal vectors. Ten polyhedral viruses, of which nine are in the family Tombusviridae, are acquired in the in vitro manner and do not occur within the resting spores of their vectors, Olpidium brassicae and O. bornovanus. Fungal vectors for other viruses in the family should be sought even though tombusviruses are reputed to be soil transmitted without a vector. Eighteen rod-shaped viruses belonging to the furo- and bymovirus groups and to an unclassified group are acquired in the in vivo manner and survive within the resting spores of their vector, O. brassicae, Polymyxa graminis, P. betae, and Spongospora subterranea. The viral coat protein has an essential role in in vitro transmission. With in vivo transmission a site in the coat protein-read through protein (CP-RT) of beet necrotic yellow vein furovirus determines vector transmissibility as does a site in a similar 98-kDa polyprotein of barley mild mosaic bymovirus. The mechanisms by which virions move (or are moved) into and out of the protoplasm of zoospores or of thalli needs study.

Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

Science.gov (United States)

Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

2002-01-01

Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

Science.gov (United States)

Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

2008-01-01

During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

Quantification of Paratrichodorus allius in DNA extracted from soil using TaqMan probe and SYBR green real-time PCR assays

Science.gov (United States)

The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...

Dicty_cDB: VHC788 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 8 AF404509 |AF404509.2 Blueberry red ringspot virus, complete genome. 42 1.5 3 AC162792 |AC162792.5 Mus musc...8934 |AP008934.1 Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete genome. 40 0.74

Biochemical analysis of NSs from different tospoviruses

OpenAIRE

Hedil, Marcio; Ronde, de, Dryas; Kormelink, Richard

2017-01-01

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asi...

Characterization of cowpea chlorotic mottle virus and its assembly

NARCIS (Netherlands)

Verduin, B.J.M.

1978-01-01

This thesis decribes the conditions for isolation of cowpea chlorotic mottle virus (CCMV), its ribonucleic acid (RNA) and the coat protein, the characterization of the virus and its constituents (chapter 3, 4 and 5) and the dissociation and assembly behaviour of the virus (chapter 6 and

Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

Directory of Open Access Journals (Sweden)

Athar Alishiri

2013-09-01

Full Text Available The incidence and distribution of Tobacco mosaic virus (TMV and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100% among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population.

Localization of the N-terminal domain of cauliflower mosaic virus coat protein precursor

International Nuclear Information System (INIS)

Champagne, Julie; Benhamou, Nicole; Leclerc, Denis

2004-01-01

Cauliflower mosaic virus (CaMV) open reading frame (ORF) IV encodes a coat protein precursor (pre-CP) harboring an N-terminal extension that is cleaved off by the CaMV-encoded protease. In transfected cells, pre-CP is present in the cytoplasm, while the processed form (p44) of CP is targeted to the nucleus, suggesting that the N-terminal extension might be involved in keeping the pre-CP in the cytoplasm for viral assembly. This study reports for the first time the intracellular localization of the N-terminal extension during CaMV infection in Brassica rapa. Immunogold-labeling electron microscopy using polyclonal antibodies directed to the N-terminal extension of the pre-CP revealed that this region is closely associated with viral particles present in small aggregates, which we called small bodies, adjacent to the main inclusion bodies typical of CaMV infection. Based on these results, we propose a model for viral assembly of CaMV

Correlation between particle multiplicity and location on virion RNA of the assembly initiation site for viruses of the tobacco mosaic virus group.

Science.gov (United States)

Fukuda, M; Meshi, T; Okada, Y; Otsuki, Y; Takebe, I

1981-07-01

The initiation site for reconstitution on genome RNA was determined by electron microscopic serology for a watermelon strain of cucumber green mottle mosaic virus (CGMMV-W), which is chemically and serologically related to tobacco mosaic virus (TMV). The initiation site was located at the same position as that of the cowpea strain, a virus that produces short rods of encapsidated subgenomic messenger RNA for the coat protein (a two-component TMV), being about 320 nucleotides away from the 3' terminus, and hence within the coat protein cistron. Although CGMMV-W was until now believed to be a single-component TMV, the location of the initiation site indicated the presence of short rods containing coat protein messenger RNA in CGMMV-W-infected tissue, as in the case for the cowpea strain. We found such short rods in CGMMV-W-infected tissue. The results confirmed our previous hypothesis that the site of the initiation region for reconstitution determines the rod multiplicity of TMV. The finding of the second two-component TMV, CGMMV, indicates that the cowpea strain of TMV is not unique in being a two-component virus and that the location of the assembly initiation site on the genome RNA can be a criterion for grouping of viruses.

Occurrence of Cucumber mosaic virus on vanilla

Indian Academy of Sciences (India)

Cucumber mosaic virus (CMV) causing mosaic, leaf distortion and stunting of vanilla (Vanilla planifolia Andrews) in India was characterized on the basis of biological and coat protein (CP) nucleotide sequence properties. In mechanical inoculation tests, the virus was found to infect members of Chenopodiaceae, ...

Introgression of a Tombusvirus Resistance Locus from Nicotiana edwardsonii var. Columbia to N. clevelandii.

Science.gov (United States)

Schoelz, James E; Wiggins, B Elizabeth; Wintermantel, William M; Ross, Kathleen

2006-05-01

ABSTRACT A new variety of Nicotiana, N. edwardsonii var. Columbia, was evaluated for its capacity to serve as a new source for virus resistance genes. Columbia was developed from a hybridization between N. glutinosa and N. clevelandii, the same parents used for the formation of the original N. edwardsonii. However, in contrast to the original N. edwardsonii, crosses between Columbia and either of its parents are fertile. Thus, the inheritance of virus resistance genes present in N. glutinosa could be characterized by using Columbia as a bridge plant in crosses with the susceptible parent, N. clevelandii. To determine how virus resistance genes would segregate in interspecific crosses between Columbia and N. clevelandii, we followed the fate of the N gene, a single dominant gene that specifies resistance to Tobacco mosaic virus (TMV). Our genetic evidence indicated that the entire chromosome containing the N gene was introgressed into N. clevelandii to create an addition line, designated N. clevelandii line 19. Although line 19 was homozygous for resistance to TMV, it remained susceptible to Tomato bushy stunt virus (TBSV) and Cauliflower mosaic virus (CaMV) strain W260, indicating that resistance to these viruses must reside on other N. glutinosa chromosomes. We also developed a second addition line, N. clevelandii line 36, which was homozygous for resistance to TBSV. Line 36 was susceptible to TMV and CaMV strain W260, but was resistant to other tombusviruses, including Cucumber necrosis virus, Cymbidium ringspot virus, Lettuce necrotic stunt virus, and Carnation Italian ringspot virus.

Genetic transformation of sweet orange with the coat protein gene of Citrus psorosis virus and evaluation of resistance against the virus.

Science.gov (United States)

Zanek, María Cecilia; Reyes, Carina Andrea; Cervera, Magdalena; Peña, Eduardo José; Velázquez, Karelia; Costa, Norma; Plata, Maria Inés; Grau, Oscar; Peña, Leandro; García, María Laura

2008-01-01

Citrus psorosis is a serious viral disease affecting citrus trees in many countries. Its causal agent is Citrus psorosis virus (CPsV), the type member of genus Ophiovirus. CPsV infects most important citrus varieties, including oranges, mandarins and grapefruits, as well as hybrids and citrus relatives used as rootstocks. Certification programs have not been sufficient to control the disease and no sources of natural resistance have been found. Pathogen-derived resistance (PDR) can provide an efficient alternative to control viral diseases in their hosts. For this purpose, we have produced 21 independent lines of sweet orange expressing the coat protein gene of CPsV and five of them were challenged with the homologous CPV 4 isolate. Two different viral loads were evaluated to challenge the transgenic plants, but so far, no resistance or tolerance has been found in any line after 1 year of observations. In contrast, after inoculation all lines showed characteristic symptoms of psorosis in the greenhouse. The transgenic lines expressed low and variable amounts of the cp gene and no correlation was found between copy number and transgene expression. One line contained three copies of the cp gene, expressed low amounts of the mRNA and no coat protein. The ORF was cytosine methylated suggesting a PTGS mechanism, although the transformant failed to protect against the viral load used. Possible causes for the failed protection against the CPsV are discussed.

Multiple loci condition seed transmission of soybean mosaic virus (SMV) and SMV-induced seed coat mottling in soybean.

Science.gov (United States)

Domier, Leslie L; Hobbs, Houston A; McCoppin, Nancy K; Bowen, Charles R; Steinlage, Todd A; Chang, Sungyul; Wang, Yi; Hartman, Glen L

2011-06-01

Infection of soybean plants with Soybean mosaic virus (SMV), which is transmitted by aphids and through seed, can cause significant reductions in seed production and quality. Because seedborne infections are the primary sources of inoculum for SMV infections in North America, host-plant resistance to seed transmission can limit the pool of plants that can serve as sources of inoculum. To examine the inheritance of SMV seed transmission in soybean, crosses were made between plant introductions (PIs) with high (PI88799), moderate (PI60279), and low (PI548391) rates of transmission of SMV through seed. In four F(2) populations, SMV seed transmission segregated as if conditioned by two or more genes. Consequently, a recombinant inbred line population was derived from a cross between PIs 88799 and 548391 and evaluated for segregation of SMV seed transmission, seed coat mottling, and simple sequence repeat markers. Chromosomal regions on linkage groups C1 and C2 were significantly associated with both transmission of isolate SMV 413 through seed and SMV-induced seed coat mottling, and explained ≈42.8 and 46.4% of the variability in these two traits, respectively. Chromosomal regions associated with seed transmission and seed coat mottling contained homologues of Arabidopsis genes DCL3 and RDR6, which encode enzymes involved in RNA-mediated transcriptional and posttranscriptional gene silencing.

Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

Science.gov (United States)

Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

2012-06-01

Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

PRODUCTION OF POLYCLONAL ANTIBODY TO THE COAT PROTEIN OF CITRUS TRISTEZA VIRUS IN CHICKEN EGGS

Directory of Open Access Journals (Sweden)

Nurhadi Nurhadi

2016-10-01

Full Text Available Citrus tristeza virus (CTV is one of the most destructive diseases in many citrus growing areas of Indonesia. Effective strategies for controlling CTV depend on diagnostic procedure namely enzyme-linked immunosorbent assay (ELISA. Study aimed to purify the CTV antigen and produced its polyclonal antibody. Virion of the severe CTV isolate designated UPM/ T-002 was concentrated by polyethylene glycol (PEG precipitation combined with low speed centrifugation. Semipurified antigen was further purified by sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDS-PAGE. The specific coat protein (CP band of CTV with molecular weight of 25 kD was excised and eluted using elution buffer containing 0.25 M Tris-HCl pH 6.8 + 0.1% SDS, then used as antigen for injection into 6-month-old female of White Leghorn chicken. Results, showed than the specific polyclonal antibody raised against the 25-kDa CP had a titer of approximately 104, gave low background reaction with healthy plant sap and reacted specifically with CTV isolates. The reaction was equally strong for a severe, a moderate, a mild, and a symptomless isolate, suggesting a broad reaction range of this antibody toward different CTV isolates. Optimal virus titer can be obtained since virus loss during purification could be minimized and the highly purified antigen as an immunogen could be obtained by cutting out the CP band from SDS-PAGE gels. Large amount of highly titer of CTV antibody can be produced in chicken egg. The simplicity of the procedure makes it economically acceptable and technically adoptable because the antibody can be produced in basic laboratory.

Minor Coat and Heat Shock Proteins Are Involved in the Binding of Citrus Tristeza Virus to the Foregut of Its Aphid Vector, Toxoptera citricida.

Science.gov (United States)

Killiny, N; Harper, S J; Alfaress, S; El Mohtar, C; Dawson, W O

2016-11-01

Vector transmission is a critical stage in the viral life cycle, yet for most plant viruses how they interact with their vector is unknown or is explained by analogy with previously described relatives. Here we examined the mechanism underlying the transmission of citrus tristeza virus (CTV) by its aphid vector, Toxoptera citricida, with the objective of identifying what virus-encoded proteins it uses to interact with the vector. Using fluorescently labeled virions, we demonstrated that CTV binds specifically to the lining of the cibarium of the aphid. Through in vitro competitive binding assays between fluorescent virions and free viral proteins, we determined that the minor coat protein is involved in vector interaction. We also found that the presence of two heat shock-like proteins, p61 and p65, reduces virion binding in vitro Additionally, treating the dissected mouthparts with proteases did not affect the binding of CTV virions. In contrast, chitinase treatment reduced CTV binding to the foregut. Finally, competition with glucose, N-acetyl-β-d-glucosamine, chitobiose, and chitotriose reduced the binding. These findings together suggest that CTV binds to the sugar moieties of the cuticular surface of the aphid cibarium, and the binding involves the concerted activity of three virus-encoded proteins. Limited information is known about the specific interactions between citrus tristeza virus and its aphid vectors. These interactions are important for the process of successful transmission. In this study, we localized the CTV retention site as the cibarium of the aphid foregut. Moreover, we demonstrated that the nature of these interactions is protein-carbohydrate binding. The viral proteins, including the minor coat protein and two heat shock proteins, bind to sugar moieties on the surface of the foregut. These findings will help in understanding the transmission mechanism of CTV by the aphid vector and may help in developing control strategies which interfere

Enrichment of Phosphatidylethanolamine in Viral Replication Compartments via Co-opting the Endosomal Rab5 Small GTPase by a Positive-Strand RNA Virus.

Directory of Open Access Journals (Sweden)

Kai Xu

2016-10-01

Full Text Available Positive-strand RNA viruses build extensive membranous replication compartments to support replication and protect the virus from antiviral responses by the host. These viruses require host factors and various lipids to form viral replication complexes (VRCs. The VRCs built by Tomato bushy stunt virus (TBSV are enriched with phosphatidylethanolamine (PE through a previously unknown pathway. To unravel the mechanism of PE enrichment within the TBSV replication compartment, in this paper, the authors demonstrate that TBSV co-opts the guanosine triphosphate (GTP-bound active form of the endosomal Rab5 small GTPase via direct interaction with the viral replication protein. Deletion of Rab5 orthologs in a yeast model host or expression of dominant negative mutants of plant Rab5 greatly decreases TBSV replication and prevents the redistribution of PE to the sites of viral replication. We also show that enrichment of PE in the viral replication compartment is assisted by actin filaments. Interestingly, the closely related Carnation Italian ringspot virus, which replicates on the boundary membrane of mitochondria, uses a similar strategy to the peroxisomal TBSV to hijack the Rab5-positive endosomes into the viral replication compartments. Altogether, usurping the GTP-Rab5-positive endosomes allows TBSV to build a PE-enriched viral replication compartment, which is needed to support peak-level replication. Thus, the Rab family of small GTPases includes critical host factors assisting VRC assembly and genesis of the viral replication compartment.

Stability and infectivity of novel pandemic influenza A (H1N1) virus in blood-derived matrices under different storage conditions.

Science.gov (United States)

Wang, Xue; Zoueva, Olga; Zhao, Jiangqin; Ye, Zhiping; Hewlett, Indira

2011-12-22

Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. We examined the stability of novel pandemic influenza A (H1N1) virus RNA when the virus was stored in phosphate buffered saline (PBS), plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID(50) assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be transmitted by blood or blood derived samples.

Stability and infectivity of novel pandemic influenza A (H1N1 virus in blood-derived matrices under different storage conditions

Directory of Open Access Journals (Sweden)

Wang Xue

2011-12-01

Full Text Available Abstract Background Influenza A virus has been detected in the blood of some infected individuals, and may pose a safety concern for collection, handling and transport of specimens for epidemiological and public health investigations if infectious virus is present in samples. Furthermore the effect of storage on virus stability and infectivity has not been well studied. Methods We examined the stability of novel pandemic influenza A (H1N1 virus RNA when the virus was stored in phosphate buffered saline (PBS, plasma, or buffy coated blood at either room temperature or 4°C using a sensitive Taqman RT-PCR assay. We also investigated virus infectivity using the EID50 assay when virus was stored in PBS, plasma, or buffy coats isolated from blood at 4°C. Results Viral RNA stability was affected by the matrix used for storage. The recovery of viral RNA was highest when virus was stored in PBS with lower amounts being recovered from plasma and buffy coats at either room temperature or 4°C. Incubation time did not appear to be a major factor for viral RNA stability, although there was gradual decline after longer periods post-incubation. Both sample matrix and incubation time affected virus infectivity. The decay in virus infectivity was greatest in PBS followed by buffy coats and plasma. Virus infectivity was abolished in buffy coats at day 20 post-incubation when virus concentrations were low. Conclusion These data indicate that encapsidated viral RNA was stable overall in all three liquid matrices at room temperature or 4°C although it was most stable in PBS; virus infectivity in buffy coats at 4°C decayed in a time dependent manner while it remained unchanged in plasma. These findings have implications for storage, handling and transport of blood derived samples from influenza patients for epidemiological and laboratory investigations. It should be noted that there is little known about influenza viremia, and whether influenza viruses can be

Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

Energy Technology Data Exchange (ETDEWEB)

Xu Ziming; Sun Hongjing; Gao Faming, E-mail: fmgao@ysu.edu.cn; Hou Li; Li Na [Yanshan University, Key Laboratory of Applied Chemistry (China)

2012-12-15

Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe-Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe-Au process.

Synthesis and magnetic property of T4 virus-supported gold-coated iron ternary nanocomposite

Science.gov (United States)

Xu, Ziming; Sun, Hongjing; Gao, Faming; Hou, Li; Li, Na

2012-12-01

Herein, we present a novel method based on the use of the symmetrical T4 bacteriophage capsid as a scaffold for preparing the gold-coated iron ternary core/shell nanostructure. Results showed that the thick gold shell was obtained to effectively protect Fe core from oxidation. Magnetic measurements showed that the nanocomposites were superparamagnetic at room temperature with a blocking temperature of about 35 K. At 3 K, its coercivity of 1142.86 Oe was larger than the existing experimental values. The magnetic property of Au/T4 was also tested, demonstrating the source of the magnetic sample arising from the Fe core only. The absorption spectrum of the Fe@Au/T4 complex was measured and compared with gold/virus. Different thickness gold shells were controlled in the synthesis by tuning the Au salt addition. On the basis of results and discussion, we further speculated the general growing mechanism of the template-supported Fe@Au process.

Detection of sweet potato virus C, sweet potato virus 2 and sweet potato feathery mottle virus in Portugal.

Science.gov (United States)

Varanda, Carla M R; Santos, Susana J; Oliveira, Mônica D M; Clara, Maria Ivone E; Félix, Maria Rosário F

2015-06-01

Field sweet potato plants showing virus-like symptoms, as stunting, leaf distortion, mosaic and chlorosis, were collected in southwest Portugal and tested for the presence of four potyviruses, sweet potato virus C (SPVC), sweet potato virus 2 (SPV2), sweet potato feathery mottle virus (SPFMV), sweet potato virus G (SPVG), and the crinivirus sweet potato chlorotic stunt virus (SPCSV). DsRNA fractions were extracted from symptomatic leaves and used as templates in single and multiplex RT-PCR assays using previously described specific primers for each analyzed virus. The amplified reaction products for SPVC, SPV2 and SPFMV were of expected size, and direct sequencing of PCR products revealed that they correspond to the coat protein gene (CP) and showed 98%, 99% and 99% identity, respectively, to those viruses. Comparison of the CP genomic and amino acid sequences of the Portuguese viral isolates recovered here with those of ten other sequences of isolates obtained in different countries retrieved from the GenBank showed very few differences. The application of the RT-PCR assays revealed for the first time the presence of SPVC and SPFMV in the sweet potato crop in Portugal, the absence of SPVG and SPCSV in tested plants, as well as the occurrence of triple virus infections under field conditions.

Coat protein sequence shows that Cucumber mosaic virus isolate

Indian Academy of Sciences (India)

A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the Institute of Himalayan Bioresource Technology (IHBT), Palampur, exhibiting mild mottling and stunting. The causal virus (Cucumber mosaic virus, CMV) was identified and characterized on the basis of host range, aphid ...

Au nanocrystals grown on a better-defined one-dimensional tobacco mosaic virus coated protein template genetically modified by a hexahistidine tag

International Nuclear Information System (INIS)

Liu Nan; Zhang Wei; Luo Zhaopeng; Zhai Niu; Zhang Hongfei; Li Zhonghao; Jiang Xingyi; Tang Gangling; Hu Qingyuan; Wang Chong; Tian Dandan

2012-01-01

In this paper, tobacco mosaic virus (TMV) coated protein (CP) was genetically modified by introducing a hexahistidine tag into it for a well-defined one-dimensional template, on which Au nanocrystals (NCs) were grown. The results showed that genetic modification could not only ameliorate the one-dimensional structure of the template, but also improve the growth density of Au NCs on the template. This indicated that genetic modification could be an effective method to modulate the structure of the TMVCP template-based nanocomposites allowing for a broader application of them. (paper)

Ultramicroscopic observation of recombinant adenoassociated virus ...

African Journals Online (AJOL)

Ultramicroscopic observation of recombinant adenoassociated virus type 2 on the surface of formvarcarbon coated copper grids under different relative humidity and incubation time using negative stain transmission electron microscopy.

Deep sequencing reveals a novel closterovirus associated with wild rose leaf rosette disease.

Science.gov (United States)

He, Yan; Yang, Zuokun; Hong, Ni; Wang, Guoping; Ning, Guogui; Xu, Wenxing

2015-06-01

A bizarre virus-like symptom of a leaf rosette formed by dense small leaves on branches of wild roses (Rosa multiflora Thunb.), designated as 'wild rose leaf rosette disease' (WRLRD), was observed in China. To investigate the presumed causal virus, a wild rose sample affected by WRLRD was subjected to deep sequencing of small interfering RNAs (siRNAs) for a complete survey of the infecting viruses and viroids. The assembly of siRNAs led to the reconstruction of the complete genomes of three known viruses, namely Apple stem grooving virus (ASGV), Blackberry chlorotic ringspot virus (BCRV) and Prunus necrotic ringspot virus (PNRSV), and of a novel virus provisionally named 'rose leaf rosette-associated virus' (RLRaV). Phylogenetic analysis clearly placed RLRaV alongside members of the genus Closterovirus, family Closteroviridae. Genome organization of RLRaV RNA (17,653 nucleotides) showed 13 open reading frames (ORFs), except ORF1 and the quintuple gene block, most of which showed no significant similarities with known viral proteins, but, instead, had detectable identities to fungal or bacterial proteins. Additional novel molecular features indicated that RLRaV seems to be the most complex virus among the known genus members. To our knowledge, this is the first report of WRLRD and its associated closterovirus, as well as two ilarviruses and one capilovirus, infecting wild roses. Our findings present novel information about the closterovirus and the aetiology of this rose disease which should facilitate its control. More importantly, the novel features of RLRaV help to clarify the molecular and evolutionary features of the closterovirus. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Solanum americanum: reservoir for Potato virus Y and Cucumber mosaic virus in sweet pepper crops

Directory of Open Access Journals (Sweden)

Monika Fecury Moura

2014-03-01

Full Text Available Weeds can act as important reservoirs for viruses. Solanum americanum (Black nightshade is a common weed in Brazil and samples showing mosaic were collected from sweet pepper crops to verify the presence of viruses. One sample showed mixed infection between Cucumber mosaic virus (CMV and Potato virus Y (PVY and one sample showed simple infection by PVY. Both virus species were transmitted by plant extract and caused mosaic in tomato (Solanum lycopersicum cv. Santa Clara, sweet pepper (Capsicum annuum cv. Magda, Nicotiana benthamiana and N. tabaccum TNN, and local lesions on Chenopodium quinoa, C. murale and C. amaranticolor. The coat protein sequences for CMV and PVY found in S. americanum are phylogenetically more related to isolates from tomato. We conclude that S. americanum can act as a reservoir for different viruses during and between sweet pepper crop seasons.

Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

Directory of Open Access Journals (Sweden)

Jinlong Guo

2015-01-01

Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

Incidence of Lettuce mosaic virus in lettuce and its detection by polyclonal antibodies produced against recombinant coat protein expressed in Escherichia coli.

Science.gov (United States)

Sharma, Prachi; Sharma, Susheel; Singh, Jasvir; Saha, Swati; Baranwal, V K

2016-04-01

Lettuce mosaic virus (LMV), a member of the genus Potyvirus of family Potyviridae, causes mosaic disease in lettuce has recently been identified in India. The virus is seed borne and secondary infection occurs through aphids. To ensure virus freedom in seeds it is important to develop diagnostic tools, for serological methods the production of polyclonal antibodies is a prerequisite. The coat protein (CP) gene of LMV was amplified, cloned and expressed using pET-28a vector in Escherichia coli BL21DE3 competent cells. The LMV CP was expressed as a fusion protein containing a fragment of the E. coli His tag. The LMV CP/His protein reacted positively with a commercial antiserum against LMV in an immunoblot assay. Polyclonal antibodies purified from serum of rabbits immunized with the fusion protein gave positive results when LMV infected lettuce (Lactuca sativa) was tested at 1:1000 dilution in PTA-ELISA. These were used for specific detection of LMV in screening lettuce accessions. The efficacy of the raised polyclonal antiserum was high and it can be utilized in quarantine and clean seed production. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of the epitope structure of Plum pox virus coat protein.

Science.gov (United States)

Candresse, Thierry; Saenz, Pilar; García, Juan Antonio; Boscia, Donato; Navratil, Milan; Gorris, Maria Teresa; Cambra, Mariano

2011-05-01

Typing of the particular Plum pox virus (PPV) strain responsible in an outbreak has important practical implications and is frequently performed using strain-specific monoclonal antibodies (MAbs). Analysis in Western blots of the reactivity of 24 MAbs to a 112-amino-acid N-terminal fragment of the PPV coat protein (CP) expressed in Escherichia coli showed that 21 of the 24 MAbs recognized linear or denaturation-insensitive epitopes. A series of eight C-truncated CP fragments allowed the mapping of the epitopes recognized by the MAbs. In all, 14 of them reacted to the N-terminal hypervariable region, defining a minimum of six epitopes, while 7 reacted to the beginning of the core region, defining a minimum of three epitopes. Sequence comparisons allowed the more precise positioning of regions recognized by several MAbs, including those recognized by the 5B-IVIA universal MAb (amino acids 94 to 100) and by the 4DG5 and 4DG11 D serogroup-specific MAbs (amino acids 43 to 64). A similar approach coupled with infectious cDNA clone mutagenesis showed that a V74T mutation in the N-terminus of the CP abolished the binding of the M serogroup-specific AL MAb. Taken together, these results provide a detailed positioning of the epitopes recognized by the most widely used PPV detection and typing MAbs.

Characterization of Brugmansia mosaic virus Isolated from Brugmansia spp. in Korea

Directory of Open Access Journals (Sweden)

Chung Youl Park

2014-12-01

Full Text Available In May 2013, an angel’s trumpet leaves showing mosaic and malformation symptoms were collected from Suwon city, Gyeonggi-do. An analysis of the collected sample by transmission electron microscopy observation showed filamentous rod particles of 720-800 nm in length. On the basis of the these observations, we performed PCR against three reported Potyviruses (Brugmansia mosaic virus, Colombian datura virus and Brugmansia suaveolens mottle virus, and the sample was positive for BruMV. Pathogenicity and host range test of BruMV was determined by mechanical inoculation. Solanaceae (tobacco, tomato and eggplant and Amaranthaceae (ground cherry appeared typical virus symptoms. To determine coat protein of this virus, we designed specific primer pairs, and performed PCR amplification, cloning, and sequencing. Phylogenetic analysis showed that BruMV-SW was most closely related to BruMV isolate SK. Comparison of the BruMV-SW coat protein nucleotide sequences showed 92% to 99% identities to the other BruMV isolates.

Design and self-assembly of simple coat proteins for artificial viruses

NARCIS (Netherlands)

Hernandez-Garcia, Armando; Kraft, Daniela J.; Janssen, Anne F J; Bomans, Paul H H; Sommerdijk, Nico A J M; Thies-Weesie, Dominique M E; Favretto, Marco E.; Brock, Roland; De Wolf, Frits A.; Werten, Marc W T; Van Der Schoot, Paul; Stuart, Martien Cohen; De Vries, Renko

2014-01-01

Viruses are among the simplest biological systems and are highly effective vehicles for the delivery of genetic material into susceptible host cells1. Artificial viruses can be used as model systems for providing insights into natural viruses and can be considered a testing ground for developing

Loss of aphid transmissibility of plum pox virus isolates

NARCIS (Netherlands)

Kamenova, I.; Lohuis, H.; Peters, D.

2002-01-01

The aphid transmissibility of seven Plum pox virus (PPV) isolates and the amino acid sequences of their coat proteins were analysed Two aphid transmissible isolates PPV-A and PPV-P contained the DAG amino triplet, while DAL or NAG replaced this triplet in the coat proteins of non-aphid transmissible

The molecular biology of ilarviruses.

Science.gov (United States)

Pallas, Vicente; Aparicio, Frederic; Herranz, Mari C; Sanchez-Navarro, Jesus A; Scott, Simon W

2013-01-01

Ilarviruses were among the first 16 groups of plant viruses approved by ICTV. Like Alfalfa mosaic virus (AMV), bromoviruses, and cucumoviruses they are isometric viruses and possess a single-stranded, tripartite RNA genome. However, unlike these other three groups, ilarviruses were recognized as being recalcitrant subjects for research (their ready lability is reflected in the sigla used to create the group name) and were renowned as unpromising subjects for the production of antisera. However, it was recognized that they shared properties with AMV when the phenomenon of genome activation, in which the coat protein (CP) of the virus is required to be present to initiate infection, was demonstrated to cross group boundaries. The CP of AMV could activate the genome of an ilarvirus and vice versa. Development of the molecular information for ilarviruses lagged behind the knowledge available for the more extensively studied AMV, bromoviruses, and cucumoviruses. In the past 20 years, genomic data for most known ilarviruses have been developed facilitating their detection and allowing the factors involved in the molecular biology of the genus to be investigated. Much information has been obtained using Prunus necrotic ringspot virus and the more extensively studied AMV. A relationship between some ilarviruses and the cucumoviruses has been defined with the recognition that members of both genera encode a 2b protein involved in RNA silencing and long distance viral movement. Here, we present a review of the current knowledge of both the taxonomy and the molecular biology of this genus of agronomically and horticulturally important viruses. Copyright © 2013 Elsevier Inc. All rights reserved.

Virus-Assembled Flexible Electrode-Electrolyte Interfaces for Enhanced Polymer-Based Battery Applications

Directory of Open Access Journals (Sweden)

Ayan Ghosh

2012-01-01

Full Text Available High-aspect-ratio cobalt-oxide-coated Tobacco mosaic virus (TMV- assembled polytetrafluoroethylene (PTFE nonstick surfaces were integrated with a solvent-free polymer electrolyte to create an anode-electrolyte interface for use in lithium-ion batteries. The virus-assembled PTFE surfaces consisted primarily of cobalt oxide and were readily intercalated with a low-molecular-weight poly (ethylene oxide (PEO based diblock copolymer electrolyte to produce a solid anode-electrolyte system. The resulting polymer-coated virus-based system was then peeled from the PTFE backing to produce a flexible electrode-electrolyte component. Electrochemical studies indicated the virus-structured metal-oxide PEO-based interface was stable and displayed robust charge transfer kinetics. Combined, these studies demonstrate the development of a novel solid-state electrode architecture with a unique peelable and flexible processing attribute.

Comparative analysis among the small RNA populations of source, sink and conductive tissues in two different plant-virus pathosystems.

Science.gov (United States)

Herranz, Mari Carmen; Navarro, Jose Antonio; Sommen, Evelien; Pallas, Vicente

2015-02-22

In plants, RNA silencing plays a fundamental role as defence mechanism against viruses. During last years deep-sequencing technology has allowed to analyze the sRNA profile of a large variety of virus-infected tissues. Nevertheless, the majority of these studies have been restricted to a unique tissue and no comparative analysis between phloem and source/sink tissues has been conducted. In the present work, we compared the sRNA populations of source, sink and conductive (phloem) tissues in two different plant virus pathosystems. We chose two cucurbit species infected with two viruses very different in genome organization and replication strategy; Melon necrotic spot virus (MNSV) and Prunus necrotic ringspot virus (PNRSV). Our findings showed, in both systems, an increase of the 21-nt total sRNAs together with a decrease of those with a size of 24-nt in all the infected tissues, except for the phloem where the ratio of 21/24-nt sRNA species remained constant. Comparing the vsRNAs, both PNRSV- and MNSV-infected plants share the same vsRNA size distribution in all the analyzed tissues. Similar accumulation levels of sense and antisense vsRNAs were observed in both systems except for roots that showed a prevalence of (+) vsRNAs in both pathosystems. Additionally, the presence of overrepresented discrete sites along the viral genome, hot spots, were identified and validated by stem-loop RT-PCR. Despite that in PNRSV-infected plants the presence of vsRNAs was scarce both viruses modulated the host sRNA profile. We compare for the first time the sRNA profile of four different tissues, including source, sink and conductive (phloem) tissues, in two plant-virus pathosystems. Our results indicate that antiviral silencing machinery in melon and cucumber acts mainly through DCL4. Upon infection, the total sRNA pattern in phloem remains unchanged in contrast to the rest of the analyzed tissues indicating a certain tissue-tropism to this polulation. Independently of the

NIR-assisted orchid virus therapy using urchin bimetallic nanomaterials in phalaenopsis

International Nuclear Information System (INIS)

Chen, Shin-Yu; Do, Yi-Yin; Huang, Pung-Ling; Cheng, Liang-Chien; Chen, Chieh-Wei; Lee, Po-Han; Liu, Ru-Shi; Yu, Fengjiao; Zhou, Wuzong

2013-01-01

The use of nanoparticles has drawn special attention, particularly in the treatment of plant diseases. Cymbidium mosaic virus (CymMV) and Odontoglossum ring spot virus (ORSV) are the most prevalent and serious diseases that affect the development of the orchid industry. In this study we treated nanoparticles as a strategy for enhancing the resistance of orchids against CymMV and ORSV. After chitosan-modified gold nanoparticles (Au NPs) were injected into Phalaenopsis leaves, the injected leaves were exposed to 980 nm laser for light–heat conversion. To evaluate virus elimination in the treated Phalaenopsis leaves, the transcripts of coat protein genes and the production of viral proteins were assessed by reverse transcription-Polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of coat protein genes for both CymMV and ORSV was significantly lower in the chitosan-modified Au NP-treated Phalaenopsis leaves than in the control. Similarly, the amount of coat proteins for both viruses in the Phalaenopsis leaves was lower than that in the control (without nanoparticle injection). We propose that the temperature increase in the chitosan-modified Au NP-treated Phalaenopsis tissues after laser exposure reduces the viral population, consequently conferring resistance against CymMV and ORSV. Our findings suggest that the application of chitosan-modified Au NPs is a promising new strategy for orchid virus therapy. (paper)

Detection of viruses and the spatial and temporal spread patterns of viral diseases of cucurbits (Cucurbitaceae spp.) in the coastal savannah zone of Ghana

International Nuclear Information System (INIS)

Gyamena, A. E

2013-07-01

Cucurbits are susceptible to over 35 plant viruses; each of these viruses is capable of causing total crop failure in a poorly managed virus pathosystem. The objectives of this study were to detect the viruses that infect six cucurbit species in the coastal savannah zone of Ghana and to describe the spatial and temporal spread patterns of virus epidemics in zucchini squash (Cucurbita pepo L.) by the use of mathematical and geostatistical models. Cucumber (Cucumis sativus L.), watermelon (Citrullus lanatus Thunb.), zucchini squash (Cucurbita pepo L.), butternut squash (Cucurbita moschata Duchesne), egushi (Citrullus colocynthis L. Schrad.) and melon (Cucumis melo L.) were grown on an experimental field in the coastal savannah zone of Ghana and were monitored for the expression of virus and virus-like symptoms. The observed symptoms were further confirmed by Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay (DAS ELISA) and mechanical inoculation of indicator plants. The temporal spread patterns of virus disease in zucchini squash were analyzed by exponential logistic, monomolecular and gompertz mechanistic models. The spatial patterns of virus disease spread in zucchini squash field were analyzed by semivariograms and inverse distance weighing (IDW) methods. Cucumber, zucchini squash, melon and butternut squash were infected by both Cucumber mosaic virus (CMW) and Papaya ringspot virus (PRSV-W). Egushi was infected by CMW but not PRSV-W. None of the six cucurbit species were infected by Watermelon mosaic virus (WMV) or Zucchini yellow mosaic virus (ZYMV). The temporal pattern of disease incidence in the zucchini squash field followed the gompertz function with an average apparent infection rate of 0.026 per day. The temporal pattern of disease severity was best described by the exponential model with coefficient of determination of 94.38 % and rate of progress disease severity of 0.114 per day. As at 49 days after planting (DAP), disease incidence and

Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

Science.gov (United States)

Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

2016-10-02

The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of Osmotic Pressure on the Stability of Whole Inactivated Influenza Vaccine for Coating on Microneedles.

Directory of Open Access Journals (Sweden)

Hyo-Jick Choi

Full Text Available Enveloped virus vaccines can be damaged by high osmotic strength solutions, such as those used to protect the vaccine antigen during drying, which contain high concentrations of sugars. We therefore studied shrinkage and activity loss of whole inactivated influenza virus in hyperosmotic solutions and used those findings to improve vaccine coating of microneedle patches for influenza vaccination. Using stopped-flow light scattering analysis, we found that the virus underwent an initial shrinkage on the order of 10% by volume within 5 s upon exposure to a hyperosmotic stress difference of 217 milliosmolarity. During this shrinkage, the virus envelope had very low osmotic water permeability (1 - 6×10-4 cm s-1 and high Arrhenius activation energy (Ea = 15.0 kcal mol-1, indicating that the water molecules diffused through the viral lipid membranes. After a quasi-stable state of approximately 20 s to 2 min, depending on the species and hypertonic osmotic strength difference of disaccharides, there was a second phase of viral shrinkage. At the highest osmotic strengths, this led to an undulating light scattering profile that appeared to be related to perturbation of the viral envelope resulting in loss of virus activity, as determined by in vitro hemagglutination measurements and in vivo immunogenicity studies in mice. Addition of carboxymethyl cellulose effectively prevented vaccine activity loss in vitro and in vivo, believed to be due to increasing the viscosity of concentrated sugar solution and thereby reducing osmotic stress during coating of microneedles. These results suggest that hyperosmotic solutions can cause biphasic shrinkage of whole inactivated influenza virus which can damage vaccine activity at high osmotic strength and that addition of a viscosity enhancer to the vaccine coating solution can prevent osmotically driven damage and thereby enable preparation of stable microneedle coating formulations for vaccination.

Evidence for Non-Transmission of Rice Yellow Mottle Virus (RYMV through Rice Seed

Directory of Open Access Journals (Sweden)

Sy, AA.

2004-01-01

Full Text Available An indexing of the organs (radicle and plumule and components (husk, endosperm and embryo of rice seeds using Enzyme Linked Immunosorbent Assay (ELISA was carried out to detect Rice yellow mottle virus (RYMV and establish the exact location of the virus in the rice seed. RYMV was detected only in the husk (seed coat but not in the endosperm, plumule, radicle, nor embryo. None of the seedlings raised from the seeds expressed RYMV symptoms. No virus particle was detected by the ELISA test in the leaves of the screenhouse-reared plants obtained from seeds of infected plants. The results indicate that RYMV is apparently not transmitted through rice seed probably because the virus is seed-borne in the husk (seed coat of mature rice seeds.

Kinetics of cellular uptake of viruses and nanoparticles via clathrin-mediated endocytosis

Science.gov (United States)

Banerjee, Anand; Berezhkovskii, Alexander; Nossal, Ralph

2016-02-01

Several viruses exploit clathrin-mediated endocytosis to gain entry into host cells. This process is also used extensively in biomedical applications to deliver nanoparticles (NPs) to diseased cells. The internalization of these nano-objects is controlled by the assembly of a clathrin-containing protein coat on the cytoplasmic side of the plasma membrane, which drives the invagination of the membrane and the formation of a cargo-containing endocytic vesicle. Current theoretical models of receptor-mediated endocytosis of viruses and NPs do not explicitly take coat assembly into consideration. In this paper we study cellular uptake of viruses and NPs with a focus on coat assembly. We characterize the internalization process by the mean time between the binding of a particle to the membrane and its entry into the cell. Using a coarse-grained model which maps the stochastic dynamics of coat formation onto a one-dimensional random walk, we derive an analytical formula for this quantity. A study of the dependence of the mean internalization time on NP size shows that there is an upper bound above which this time becomes extremely large, and an optimal size at which it attains a minimum. Our estimates of these sizes compare well with experimental data. We also study the sensitivity of the obtained results on coat parameters to identify factors which significantly affect the internalization kinetics.

Caracterização de um vírus baciliforme isolado de Solanum violaefolium transmitido pelos ácaros Brevipalpus phoenicis e Brevipalpus obovatus (Acari: Tenuipalpidae Characterization of a bacilliform virus isolated from Solanum violaefolium transmitted by the tenuipalpid mites Brevipalpus phoenicis and Brevipalpus obovatus

Directory of Open Access Journals (Sweden)

Paulo de Tarso Oliveira Ferreira

2007-09-01

Full Text Available Solano-violeta (Solanum violaefolium é uma planta ornamental rasteira usada para cobrir solos de áreas sombreadas. Um vírus que induz manchas anelares nas folhas desta planta, tentativamente designado Solanum violaefolium ringspot virus - SvRSV, transmitido pelo ácaro Brevipalpus phoenicis (Acari: Tenuipalpidae foi encontrado em Piracicaba, SP. Trata-se de um vírus baciliforme que se assemelha a outros vírus do tipo citoplasmático transmitidos por Brevipalpus sp. Este trabalho teve como objetivo relatar propriedades biológicas e estabelecer uma caracterização molecular parcial do SvRSV. O vírus pode ser transmitido mecanicamente a várias outras espécies botânicas, causando lesões localizadas. Entre as espécies avaliadas, Datura stramonium mostrou-se a melhor hospedeira experimental. Observou-se também a manifestação de sintomas nestas plantas após infestação das mesmas por B. obovatus previamente alimentado em lesões de SvRSV, confirmando esta outra espécie de ácaro como vetor do vírus. Suas propriedades físicas in vitro foram: temperatura de inativação 40-45 ºC; ponto final de diluição 10-3-10-4; longevidade in vitro 12 dias. Em secções ultrafinas, as partículas do SvRSV mostraram-se levemente mais delgadas e mais longas que as de outros vírus do mesmo grupo. A partir do dsRNA do SvRSV foi construída uma biblioteca de cDNA e foram identificadas duas possíveis regiões codificadoras das proteínas de movimento e replicase viral. Baseado nestas regiões foram desenhados "primers" para amplificação do RNA do SvRSV por RT-PCR. Sondas baseadas nas seqüências obtidas hibridizaram com ss- e dsRNA de D. stramonium infectadas pelo vírus. Ensaios preliminares de RT-PCR e hibridização não resultaram em reação com o vírus da leprose dos citros, tipo citoplasmático (CiLV-C.Solanum violaefolium is an ornamental plant, with prostrate, trailing growth habit and is cultivated in shaded areas. A virus that causes

Poinsettia latent virus is not a cryptic virus, but a natural polerovirus-sobemovirus hybrid

International Nuclear Information System (INIS)

Siepen, Marc aus dem; Pohl, Jens O.; Koo, Bong-Jin; Wege, Christina; Jeske, Holger

2005-01-01

The biochemical and genetic features of Poinsettia latent virus (PnLV, formerly named Poinsettia cryptic virus), which is spread worldwide in commercial cultivars of Euphorbia pulcherrima without inducing symptoms, have been determined using virus-purification, immunological techniques, electron microscopy, cloning, and sequencing. PnLV was found to be a chimeric virus with one 4652 bases, plus strand RNA showing a close relationship to poleroviruses within the first three quarters of its genome but to sobemoviruses in the last quarter. Thus, we propose to classify this virus as 'polemovirus'. Similarities of protein and nucleic acid sequences at the 5' and extreme 3' end of its RNA suggest a replication mode like that of poleroviruses, whereas the coat protein sequence is closely related to that of sobemoviruses. Consistent with these results, PnLV forms stable icosahedra of 34 nm in diameter. The consequences for the taxonomy of PnLV and for gardeners' practice are discussed

Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions

Directory of Open Access Journals (Sweden)

Leonardo PARRANO

2013-01-01

Full Text Available Garlic is an important crop cultivated worldwide and several different viruses have been associated with propagative material. Garlic is propagated from bulbs and/or from vegetative topsets of the inflorescences known as bulbils. The effects of the geographic origin and the type of the propagative material on the phylogenetic relationships and genetic variability of the coat protein genes of four allium viruses are presented here. Onion yellow dwarf virus (OYDV, Leek yellow stripe virus (LYSV, Garlic virus X (GVX, and Garlic common latent virus (GCLV were detected in single and mixed infections in plants grown either from bulbils and/or bulbs originating from Italy, China, Argentina, and the U.S.A. OYDV and LYSV fell into five and three well supported clades respectively whereas isolates of GVX and GCLV all clustered into one well-supported clade each. Some of the OYDV and LYSV clades presented evidence of host tissue selection while some phylogenetic structuring based on the geographic origin or host was also observed for some virus clades. Unique haplotypes and novel coat protein amino acid sequence patterns were identified for all viruses. An OYDV coat protein amino acid signature unique to Chenopodium quinoa, an uncommon host of the virus, was of particular interest. The type of propagative material affected the population dynamics of all of the viruses. The virus populations in plants propagated from bulbs were more diverse than in plants propagated from bulbils.

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

Science.gov (United States)

Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

2007-11-01

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

Enzymes and Enzyme Activity Encoded by Nonenveloped Viruses.

Science.gov (United States)

Azad, Kimi; Banerjee, Manidipa; Johnson, John E

2017-09-29

Viruses are obligate intracellular parasites that rely on host cell machineries for their replication and survival. Although viruses tend to make optimal use of the host cell protein repertoire, they need to encode essential enzymatic or effector functions that may not be available or accessible in the host cellular milieu. The enzymes encoded by nonenveloped viruses-a group of viruses that lack any lipid coating or envelope-play vital roles in all the stages of the viral life cycle. This review summarizes the structural, biochemical, and mechanistic information available for several classes of enzymes and autocatalytic activity encoded by nonenveloped viruses. Advances in research and development of antiviral inhibitors targeting specific viral enzymes are also highlighted.

Characterization of petunia flower mottle virus (PetFMV), a new potyvirus infecting Petunia x hybrida.

Science.gov (United States)

Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G

1998-01-01

With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.

Evidence for lysine acetylation in the coat protein of a polerovirus.

Science.gov (United States)

Cilia, Michelle; Johnson, Richard; Sweeney, Michelle; DeBlasio, Stacy L; Bruce, James E; MacCoss, Michael J; Gray, Stewart M

2014-10-01

Virions of the RPV strain of Cereal yellow dwarf virus-RPV were purified from infected oat tissue and analysed by MS. Two conserved residues, K147 and K181, in the virus coat protein, were confidently identified to contain epsilon-N-acetyl groups. While no functional data are available for K147, K181 lies within an interfacial region critical for virion assembly and stability. The signature immonium ion at m/z 126.0919 demonstrated the presence of N-acetyllysine, and the sequence fragment ions enabled an unambiguous assignment of the epsilon-N-acetyl modification on K181. We hypothesize that selection favours acetylation of K181 in a fraction of coat protein monomers to stabilize the capsid by promoting intermonomer salt bridge formation.

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus.

Science.gov (United States)

May, Jared; Johnson, Philip; Saleem, Huma; Simon, Anne E

2017-04-15

To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5' cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5' cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary

Induction of protective immunity in swine by recombinant bamboo mosaic virus expressing foot-and-mouth disease virus epitopes

Directory of Open Access Journals (Sweden)

Lin Na-Sheng

2007-09-01

Full Text Available Abstract Background Plant viruses can be employed as versatile vectors for the production of vaccines by expressing immunogenic epitopes on the surface of chimeric viral particles. Although several viruses, including tobacco mosaic virus, potato virus X and cowpea mosaic virus, have been developed as vectors, we aimed to develop a new viral vaccine delivery system, a bamboo mosaic virus (BaMV, that would carry larger transgene loads, and generate better immunity in the target animals with fewer adverse environmental effects. Methods We engineered the BaMV as a vaccine vector expressing the antigenic epitope(s of the capsid protein VP1 of foot-and-mouth disease virus (FMDV. The recombinant BaMV plasmid (pBVP1 was constructed by replacing DNA encoding the 35 N-terminal amino acid residues of the BaMV coat protein with that encoding 37 amino acid residues (T128-N164 of FMDV VP1. Results The pBVP1 was able to infect host plants and to generate a chimeric virion BVP1 expressing VP1 epitopes in its coat protein. Inoculation of swine with BVP1 virions resulted in the production of anti-FMDV neutralizing antibodies. Real-time PCR analysis of peripheral blood mononuclear cells from the BVP1-immunized swine revealed that they produced VP1-specific IFN-γ. Furthermore, all BVP1-immunized swine were protected against FMDV challenge. Conclusion Chimeric BaMV virions that express partial sequence of FMDV VP1 can effectively induce not only humoral and cell-mediated immune responses but also full protection against FMDV in target animals. This BaMV-based vector technology may be applied to other vaccines that require correct expression of antigens on chimeric viral particles.

Chitosan-coated poly(lactic-co-glycolic acid nanoparticles as an efficient delivery system for Newcastle disease virus DNA vaccine

Directory of Open Access Journals (Sweden)

Zhao K

2014-09-01

Full Text Available Kai Zhao,1,* Yang Zhang,1,2,* Xiaoyan Zhang,1,* Ci Shi,1,2 Xin Wang,1 Xiaohua Wang,1 Zheng Jin,3 Shangjin Cui2 1Laboratory of Microbiology, School of Life Science, Heilongjiang University, 2Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, 3Key Laboratory of Chemical Engineering Process and Technology for High-efficiency Conversion, Heilongjiang University, Harbin, People’s Republic of China *These authors contributed equally to this work Abstract: We determined the efficacy and safety of chitosan (CS-coated poly(lactic-co-glycolic acid (PLGA nanoparticles (NPs as a delivery system for a vaccine to protect chickens against Newcastle disease virus (NDV. The newly constructed vaccine contained DNA (the F gene of NDV. The Newcastle disease virus (NDV F gene deoxyribonucleic acid (DNA plasmid (pFDNA-CS/PLGA-NPs were spherical (diameter =699.1±5.21 nm [mean ± ­standard deviation] and smooth, with an encapsulation efficiency of 98.1% and a Zeta potential of +6.35 mV. An in vitro release assay indicated that CS controlled the burst release of plasmid DNA, such that up to 67.4% of the entire quantity of plasmid DNA was steadily released from the pFDNA-CS/PLGA-NPs. An in vitro expression assay indicated that the expression of nanoparticles (NPs was maintained in the NPs. In an immunization test with specific pathogen-free chickens, the pFDNA-CS/PLGA-NPs induced stronger cellular, humoral, and mucosal immune responses than the plasmid DNA vaccine alone. The pFDNA-CS/PLGA-NPs did not harm 293T cells in an in vitro assay and did not harm chickens in an in vivo assay. Overall, the results indicated that CS-coated PLGA NPs can serve as an efficient and safe mucosal immune delivery system for NDV DNA vaccine.Keywords: mucosal immune delivery system, immune effect

Rootstock-to-scion transfer of transgene-derived small interfering RNAs and their effect on virus resistance in nontransgenic sweet cherry.

Science.gov (United States)

Zhao, Dongyan; Song, Guo-qing

2014-12-01

Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

An isoform of eukaryotic initiation factor 4E from Chrysanthemum morifolium interacts with Chrysanthemum virus B coat protein.

Directory of Open Access Journals (Sweden)

Aiping Song

Full Text Available BACKGROUND: Eukaryotic translation initiation factor 4E (eIF4E plays an important role in plant virus infection as well as the regulation of gene translation. METHODOLOGY/PRINCIPAL FINDINGS: Here, we describe the isolation of a cDNA encoding CmeIF(iso4E (GenBank accession no. JQ904592, an isoform of eIF4E from chrysanthemum, using RACE PCR. We used the CmeIF(iso4E cDNA for expression profiling and to analyze the interaction between CmeIF(iso4E and the Chrysanthemum virus B coat protein (CVBCP. Multiple sequence alignment and phylogenetic tree analysis showed that the sequence similarity of CmeIF(iso4E with other reported plant eIF(iso4E sequences varied between 69.12% and 89.18%, indicating that CmeIF(iso4E belongs to the eIF(iso4E subfamily of the eIF4E family. CmeIF(iso4E was present in all chrysanthemum organs, but was particularly abundant in the roots and flowers. Confocal microscopy showed that a transiently transfected CmeIF(iso4E-GFP fusion protein distributed throughout the whole cell in onion epidermis cells. A yeast two hybrid assay showed CVBCP interacted with CmeIF(iso4E but not with CmeIF4E. BiFC assay further demonstrated the interaction between CmeIF(iso4E and CVBCP. Luminescence assay showed that CVBCP increased the RLU of Luc-CVB, suggesting CVBCP might participate in the translation of viral proteins. CONCLUSIONS/SIGNIFICANCE: These results inferred that CmeIF(iso4E as the cap-binding subunit eIF(iso4F may be involved in Chrysanthemum Virus B infection in chrysanthemum through its interaction with CVBCP in spatial.

Phylogenetic relationships and the occurrence of interspecific recombination between beet chlorosis virus (BChV) and Beet mild yellowing virus (BMYV).

Science.gov (United States)

Kozlowska-Makulska, Anna; Hasiow-Jaroszewska, Beata; Szyndel, Marek S; Herrbach, Etienne; Bouzoubaa, Salah; Lemaire, Olivier; Beuve, Monique

2015-02-01

Samples containing two viruses belonging to the genus Polerovirus, beet chlorosis virus (BChV) and beet mild yellowing virus (BMYV), were collected from French and Polish sugar beet fields. The molecular properties of 24 isolates of BChV and BMYV were investigated, and their genetic diversity was examined in the coat protein (CP)- and P0-encoding genes. For the first time, we have demonstrated that beet polerovirus populations include recombinants between BChV and BMYV containing breakpoints within the CP gene. Moreover, a partial correlation between geographic origin and phylogenetic clustering was observed for BMYV isolates.

'Let the phage do the work': Using the phage P22 coat protein structures as a framework to understand its folding and assembly mutants

International Nuclear Information System (INIS)

Teschke, Carolyn M.; Parent, Kristin N.

2010-01-01

The amino acid sequence of viral capsid proteins contains information about their folding, structure and self-assembly processes. While some viruses assemble from small preformed oligomers of coat proteins, other viruses such as phage P22 and herpesvirus assemble from monomeric proteins (Fuller and King, 1980). The subunit assembly process is strictly controlled through protein:protein interactions such that icosahedral structures are formed with specific symmetries, rather than aberrant structures. dsDNA viruses commonly assemble by first forming a precursor capsid that serves as a DNA packaging machine. DNA packaging is accompanied by a conformational transition of the small precursor procapsid into a larger capsid for isometric viruses. Here we highlight the pseudo-atomic structures of phage P22 coat protein and rationalize several decades of data about P22 coat protein folding, assembly and maturation generated from a combination of genetics and biochemistry.

Detection and Molecular Characterization of Grapevine Virus A in Jordan

Directory of Open Access Journals (Sweden)

G. Anfoka

2004-12-01

Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.

Extraction of total nucleic acid based on silica-coated magnetic particles for RT-qPCR detection of plant RNA virus/viroid.

Science.gov (United States)

Sun, Ning; Deng, Congliang; Zhao, Xiaoli; Zhou, Qi; Ge, Guanglu; Liu, Yi; Yan, Wenlong; Xia, Qiang

2014-02-01

In this study, a nucleic acid extraction method based on silica-coated magnetic particles (SMPs) and RT-qPCR assay was developed to detect Arabis mosaic virus (ArMV), Lily symptomless virus (LSV), Hop stunt viroid (HSVd) and grape yellow speckle viroid 1 (GYSVd-1). The amplification sequences of RT-qPCR were reversely transcribed in vitro as RNA standard templates. The standard curves covered six or seven orders of magnitude with a detection limit of 100 copies per each assay. Extraction efficiency of the SMPs method was evaluated by recovering spiked ssRNAs from plant samples and compared to two commercial kits (TRIzol and RNeasy Plant mini kit). Results showed that the recovery rate of SMPs method was comparable to the commercial kits when spiked ssRNAs were extracted from lily leaves, whereas it was two or three times higher than commercial kits when spiked ssRNAs were extracted from grapevine leaves. SMPs method was also used to extract viral nucleic acid from15 ArMV-positive lily leaf samples and 15 LSV-positive lily leaf samples. SMPs method did not show statistically significant difference from other methods on detecting ArMV, but LSV. The SMPs method has the same level of virus load as the TRIzol, and its mean virus load of was 0.5log10 lower than the RNeasy Plant mini kit. Nucleic acid was extracted from 19 grapevine-leaf samples with SMPs and the two commercial kits and subsequently screened for HSVd and GYSVd-1 by RT-qPCR. Regardless of HSVd or GYSVd-1, SMPs method outperforms other methods on both positive rate and the viroid load. In conclusion, SMPs method was able to efficiently extract the nucleic acid of RNA viruses or viroids, especially grapevine viroids, from lily-leaf or grapevine-leaf samples for RT-qPCR detection. Copyright © 2013 Elsevier B.V. All rights reserved.

Coat protein-mediated resistance against an Indian isolate of the ...

Indian Academy of Sciences (India)

Coat protein (CP)-mediated resistance against an Indian isolate of the Cucumber mosaic virus (CMV) subgroup IB was demonstrated in transgenic lines of Nicotiana benthamiana through Agrobacterium tumefaciens-mediated transformation. Out of the fourteen independently transformed lines developed, two lines were ...

Coat protein of Turnip mosaic virus in oilseed rape (Brassica napus)

African Journals Online (AJOL)

mohammad

2Department of Plant Breeding and Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad, Mashhad,. Iran. Accepted 15 August, 2012 ... led to prevalence of infectious diseases. Turnip mosaic virus (TuMV) is an .... During the sampling of canola plants for the detection of virus, some colonies of aphids were ...

Silica-coated Gd(DOTA)-loaded protein nanoparticles enable magnetic resonance imaging of macrophages

Science.gov (United States)

Bruckman, Michael A.; Randolph, Lauren N.; Gulati, Neetu M.; Stewart, Phoebe L.; Steinmetz, Nicole F.

2015-01-01

The molecular imaging of in vivo targets allows non-invasive disease diagnosis. Nanoparticles offer a promising platform for molecular imaging because they can deliver large payloads of imaging reagents to the site of disease. Magnetic resonance imaging (MRI) is often preferred for clinical diagnosis because it uses non-ionizing radiation and offers both high spatial resolution and excellent penetration. We have explored the use of plant viruses as the basis of for MRI contrast reagents, specifically Tobacco mosaic virus (TMV), which can assemble to form either stiff rods or spheres. We loaded TMV particles with paramagnetic Gd ions, increasing the ionic relaxivity compared to free Gd ions. The loaded TMV particles were then coated with silica maintaining high relaxivities. Interestingly, we found that when Gd(DOTA) was loaded into the interior channel of TMV and the exterior was coated with silica, the T1 relaxivities increased by three-fold from 10.9 mM−1 s−1 to 29.7 mM−1s−1 at 60 MHz compared to uncoated Gd-loaded TMV. To test the performance of the contrast agents in a biological setting, we focused on interactions with macrophages because the active or passive targeting of immune cells is a popular strategy to investigate the cellular components involved in disease progression associated with inflammation. In vitro assays and phantom MRI experiments indicate efficient targeting and imaging of macrophages, enhanced contrast-to-noise ratio was observed by shape-engineering (SNP > TMV) and silica-coating (Si-TMV/SNP > TMV/SNP). Because plant viruses are in the food chain, antibodies may be prevalent in the population. Therefore we investigated whether the silica-coating could prevent antibody recognition; indeed our data indicate that mineralization can be used as a stealth coating option to reduce clearance. Therefore, we conclude that the silica-coated protein-based contrast agent may provide an interesting candidate material for further investigation

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

Hydrogel based QCM aptasensor for detection of avian influenza virus.

Science.gov (United States)

Wang, Ronghui; Li, Yanbin

2013-04-15

The objective of this study was to develop a quartz crystal microbalance (QCM) aptasensor based on ssDNA crosslinked polymeric hydrogel for rapid, sensitive and specific detection of avian influenza virus (AIV) H5N1. A selected aptamer with high affinity and specificity against AIV H5N1 surface protein was used, and hybridization between the aptamer and ssDNA formed the crosslinker in the polymer hydrogel. The aptamer hydrogel was immobilized on the gold surface of QCM sensor using a self-assembled monolayer method. The hydrogel remained in the state of shrink if no H5N1 virus was present in the sample because of the crosslinking between the aptamer and ssDNA in the polymer network. When it exposed to target virus, the binding reaction between the aptamer and H5N1 virus caused the dissolution of the linkage between the aptamer and ssDNA, resulting in the abrupt swelling of the hydrogel. The swollen hydrogel was monitored by the QCM sensor in terms of decreased frequency. Three polymeric hydrogels with different ratio (100:1 hydrogel I, 10:1 hydrogel II, 1:1 hydrogel III) of acrylamide and the aptamer monomer were synthesized, respectively, and then were used as the QCM sensor coating material. The results showed that the developed hydrogel QCM aptasensor was capable of detecting target H5N1 virus, and among the three developed aptamer hydrogels, hydrogel III coated QCM aptasensor achieved the highest sensitivity with the detection limit of 0.0128 HAU (HA unit). The total detection time from sampling to detection was only 30 min. In comparison with the anti-H5 antibody coated QCM immunosensor, the hydrogel QCM aptasensor lowered the detection limit and reduced the detection time. Copyright © 2012 Elsevier B.V. All rights reserved.

Serum albumin 'camouflage' of plant virus based nanoparticles prevents their antibody recognition and enhances pharmacokinetics.

Science.gov (United States)

Pitek, Andrzej S; Jameson, Slater A; Veliz, Frank A; Shukla, Sourabh; Steinmetz, Nicole F

2016-05-01

Plant virus-based nanoparticles (VNPs) are a novel class of nanocarriers with unique potential for biomedical applications. VNPs have many advantageous properties such as ease of manufacture and high degree of quality control. Their biocompatibility and biodegradability make them an attractive alternative to synthetic nanoparticles (NPs). Nevertheless, as with synthetic NPs, to be successful in drug delivery or imaging, the carriers need to overcome several biological barriers including innate immune recognition. Plasma opsonization can tag (V)NPs for clearance by the mononuclear phagocyte system (MPS), resulting in shortened circulation half lives and non-specific sequestration in non-targeted organs. PEG coatings have been traditionally used to 'shield' nanocarriers from immune surveillance. However, due to broad use of PEG in cosmetics and other industries, the prevalence of anti-PEG antibodies has been reported, which may limit the utility of PEGylation in nanomedicine. Alternative strategies are needed to tailor the in vivo properties of (plant virus-based) nanocarriers. We demonstrate the use of serum albumin (SA) as a viable alternative. SA conjugation to tobacco mosaic virus (TMV)-based nanocarriers results in a 'camouflage' effect more effective than PEG coatings. SA-'camouflaged' TMV particles exhibit decreased antibody recognition, as well as enhanced pharmacokinetics in a Balb/C mouse model. Therefore, SA-coatings may provide an alternative and improved coating technique to yield (plant virus-based) NPs with improved in vivo properties enhancing drug delivery and molecular imaging. Copyright © 2016 Elsevier Ltd. All rights reserved.

Initial infection of roots and leaves reveals different resistance phenotypes associated with coat protein gene-mediated resistance to Potato mop-top virus.

Science.gov (United States)

Germundsson, Anna; Sandgren, Maria; Barker, Hugh; Savenkov, Eugene I; Valkonen, Jari P T

2002-05-01

Resistance to the pomovirus Potato mop-top virus (PMTV) was studied in potato (Solanum tuberosum cv. Saturna) and Nicotiana benthamiana transformed with the coat protein (CP) gene of PMTV. The incidence of PMTV infections was reduced in tubers of the CP-transgenic potatoes grown in the field in soil infested with the viruliferous vector, Spongospora subterranea. However, in those tubers that were infected, all three virus RNAs were detected and virus titres were high. The CP-transgenic N. benthamiana plants were inoculated with PMTV using two methods. Following mechanical inoculation of leaves, no RNA 3 (the CP-encoding RNA homologous to the transgene) was detected in leaves, but in some plants low amounts of RNA 3 were detected in roots; RNA 2 was readily detected in leaves and roots of several plants. Inoculation of roots using viruliferous S. subterranea resulted in infection of roots in all plants and the three PMTV RNAs were detected. However, no systemic movement of PMTV from roots to the above-ground parts was observed, indicating a novel expression of resistance. These data indicate that the CP gene-mediated resistance to PMTV specifically restricts accumulation of PMTV RNA 3, and is more effective in leaves than roots. Furthermore, expression of resistance is different depending on whether leaves or roots are inoculated. Data do not exclude the possibility that both a protein-mediated and an RNA-mediated resistance mechanism are involved.

KARAKTERISASICYMBIDIUM MOSAIC VIRUS (CYMMV PADA TANAMAN ANGGREK

Directory of Open Access Journals (Sweden)

KHAMDAN KHALIMI

2012-11-01

Full Text Available Characterization ofCymbidium mosaic virus (CymMV on Orchid Plant Orchids are affected by more virus disease problems than most crops, reducing their commercial values considerably. Orchid viruses are widespread in cultivated orchids, withCymbidium mosaic potexvirus (CymMV being the most prevalent. CymMV high incidence in cultivated orchids has been attributed to the stability and ease of transmission of this virus through cultural practices. CymMV induces floral and foliar necrosis. The virus also reduce plant vigor and lower flower quality, which affect their economic value. The objective of the research is to characterize the virus causing mosaic or chlorotic and necrotic on orchids in West Java. A reverse transcription-polymerase chain reaction (RT- PCR assays using oligonucleotide primers specific to CymMV were also successfully amplified the regions of the coat protein (CP gene of the virus. Analysis by using sodium dodecyl sulphate- polyacrylamide gel electrophoresis (SDS-PAGE revealed that the virus have a major structural protein with an estimated molecular weight of 28 kDa. Aligments of partial nucleotide sequences of the CP gene displayed 86 to 92% homology to CymMV isolates from other countries.

Production of Japanese Encephalitis Virus Antigens in Plants Using Bamboo Mosaic Virus-Based Vector

Directory of Open Access Journals (Sweden)

Tsung-Hsien Chen

2017-05-01

Full Text Available Japanese encephalitis virus (JEV is among the major threats to public health in Asia. For disease control and prevention, the efficient production of safe and effective vaccines against JEV is in urgent need. In this study, we produced a plant-made JEV vaccine candidate using a chimeric virus particle (CVP strategy based on bamboo mosaic virus (BaMV for epitope presentation. The chimeric virus, designated BJ2A, was constructed by fusing JEV envelope protein domain III (EDIII at the N-terminus of BaMV coat protein, with an insertion of the foot-and-mouth disease virus 2A peptide to facilitate the production of both unfused and epitope-presenting for efficient assembly of the CVP vaccine candidate. The strategy allowed stable maintenance of the fusion construct over long-term serial passages in plants. Immuno-electron microscopy examination and immunization assays revealed that BJ2A is able to present the EDIII epitope on the surface of the CVPs, which stimulated effective neutralizing antibodies against JEV infection in mice. This study demonstrates the efficient production of an effective CVP vaccine candidate against JEV in plants by the BaMV-based epitope presentation system.

Specific antibodies to detect Tamarillo leaf malformation virus (TALMV) in Tamarillo

International Nuclear Information System (INIS)

Gallo Garcia, Yuliana; Marin Montoya, Mauricio; Gutierrez, Pablo Andres

2011-01-01

In Colombia, yields of Tamarillo are seriously affected by a complex viral disease known as virosis. This pathology was first reported in 1991 in the north of Antioquia and currently affects all Tamarillo growing regions in the country. Recent works have demonstrated the association of two potyviruses (potyviridae) with this disease: potato virus y (PVY) and Tamarillo leaf malformation virus (TALMV, proposed species). Specific diagnostic tools are required for early asymptomatic detection of these viruses and Tamarillo certification programs. In this study, we report the obtention of TALMV specific antibodies using a 15 residues peptide mimicking the n-terminal coat protein. Specificity and sensitivity of the anti-TALMV antibodies was determined by Elisa and dot-blot using recombinant protein and synthetic peptides as controls. The usefulness of these antibodies was validated from a preliminary trial of TALMV detection in plant samples obtained from Tamarillo crops in eastern Antioquia and results were compared with a TALMV specific coat RT-PCR detection protocol.

Aptasensor development for detection of virus in water

DEFF Research Database (Denmark)

Kirkegaard, Julie

of three types of waterborne viruses: norovirus, rotavirus and hepatitis A virus. The development of the aptasensor involved sample preparation for aptamer selection of rotavirus and hepatitis A virus, an iterative design process of the aptasensor, investigation of the surface immobilisation of aptamers...... and finally an impedimetric electrical characterisation of the sensor. The sample preparation of the rotavirus was based on purification and biotinylation of the virus to meet the requirements of the aptamer selection process. The selection process, performed by an external collaborator, was based...... on streptavidin coated magnetic bead separation, hence the needed biotinylation. It was found that the BPH linker gave the highest yield when the biotinylated rotavirus were immobilised onto the beads. The design of the viral aptasensor was determined by an iterative design process. The final chip design...

Coat protein sequence shows that Cucumber mosaic virus isolate ...

Indian Academy of Sciences (India)

Madhu

A viral disease was identified on geraniums (Pelargonium spp.) grown in a greenhouse at the .... DNA was cloned in p-GEM Teasy vector (Promega, USA) as per the ... M. persicae and A. gossypii transmitted the virus in non persistent manner ...

Sequence determination and analysis of the NSs genes of two tospoviruses.

Science.gov (United States)

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Mutants of alfalfa mosaic virus

International Nuclear Information System (INIS)

Roosien, J.

1983-01-01

In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

Science.gov (United States)

Han, S S; Karasev, A V; Ieki, H; Iwanami, T

2002-11-01

Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

Genomic Variability of Citrus tristeza virus (CTV Isolates Introduced into Morocco

Directory of Open Access Journals (Sweden)

Bouabid Lbida

2004-08-01

Full Text Available Genomic variability of the coat protein gene of Citrus tristeza virus isolates obtained from old Meyer lemon introductions in Morocco and more recent budwood introductions from Spain were studied. The coat protein gene of the virus was amplified directly from infected tissue by immunocapture RT-PCR and analysed by single stranded conformation polymorphism (SSCP and sequencing. Each isolate consisted of several related genomic variants, typical of a quasi-species. Although SSCP analysis has only limited typing ability it could be used in an initial screening to discriminate between isolates of different origin and to analyse the genomic structure of each isolate. Sequence analysis showed that the isolates of Spanish origin were closely related to mild isolates characterised in Florida and in Portugal. The Meyer lemon isolate on the other hand was related to severe strains of Meyer lemon characterised in Florida some years ago and to other severe strains from Brasil. A knowledge of the coat protein gene sequence is useful to trace the origin of the isolates.

An evolutionary analysis of the Secoviridae family of viruses.

Directory of Open Access Journals (Sweden)

Jeremy R Thompson

Full Text Available The plant-infecting Secoviridae family of viruses forms part of the Picornavirales order, an important group of non-enveloped viruses that infect vertebrates, arthropods, plants and algae. The impact of the secovirids on cultivated crops is significant, infecting a wide range of plants from grapevine to rice. The overwhelming majority are transmitted by ecdysozoan vectors such as nematodes, beetles and aphids. In this study, we have applied a variety of computational methods to examine the evolutionary traits of these viruses. Strong purifying selection pressures were calculated for the coat protein (CP sequences of nine species, although for two species evidence of both codon specific and episodic diversifying selection were found. By using Bayesian phylogenetic reconstruction methods CP nucleotide substitution rates for four species were estimated to range from between 9.29×10(-3 to 2.74×10(-3 (subs/site/year, values which are comparable with the short-term estimates of other related plant- and animal-infecting virus species. From these data, we were able to construct a time-measured phylogeny of the subfamily Comovirinae that estimated divergence of ninety-four extant sequences occurred less than 1,000 years ago with present virus species diversifying between 50 and 250 years ago; a period coinciding with the intensification of agricultural practices in industrial societies. Although recombination (modularity was limited to closely related taxa, significant and often unique similarities in the protein domains between secovirid and animal infecting picorna-like viruses, especially for the protease and coat protein, suggested a shared ancestry. We discuss our results in a wider context and find tentative evidence to indicate that some members of the Secoviridae might have their origins in insects, possibly colonizing plants in a number of founding events that have led to speciation. Such a scenario; virus infection between species of

Coat protein sequence shows that Cucumber mosaic virus isolate ...

Indian Academy of Sciences (India)

Madhu

crop is reported to be infecetd by a number of pests and dis- eases (Rao et al 2000) including a ... Plant Virus Lab, Floriculture Division, Institute of Himalayan Bioresource Technology, Palampur 176 061, India. *Corresponding author (Fax ..... ELISA test used in testing the plants (either mechanical- ly inoculated or naturally ...

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Viruses affecting lentil (Lens culinaris Medik. in Greece; incidence and genetic variability of Bean leafroll virus and Pea enation mosaic virus

Directory of Open Access Journals (Sweden)

Elisavet K. CHATZIVASSILIOU

2016-07-01

Full Text Available In Greece, lentil (Lens culinaris Medik. crops are mainly established with non-certified seeds of local landraces, implying high risks for seed transmitted diseases. During April and May of the 2007–2012 growing seasons, surveys were conducted in eight regions of Greece (Attiki, Evros, Fthiotida, Korinthos, Kozani, Larissa, Lefkada and Viotia to monitor virus incidence in lentil fields. A total of 1216 lentil samples, from plants exhibiting symptoms suggestive of virus infection, were analyzed from 2007 to 2009, using tissue-blot immunoassays (TBIA. Pea seed-borne mosaic virus (PSbMV overall incidence was 4.9%, followed by Alfalfa mosaic virus (AMV (2.4% and Bean yellow mosaic virus (BYMV (1.0%. When 274 of the samples were tested for the presence of luteoviruses, 38.8% were infected with Bean leafroll virus (BLRV. Since BLRV was not identified in the majority of the samples collected from 2007 to 2009, representative symptomatic plants (360 samples were collected in further surveys performed from 2010 to 2012 and tested by ELISA. Two viruses prevailed in those samples: BLRV (36.1% was associated with stunting, yellowing, and reddening symptoms and Pea enation mosaic virus-1 (PEMV-1 (35.0% was associated with mosaic and mottling symptoms. PSbMV (2.2%, AMV (2.2%, BYMV (3.9% and CMV (2.8% were also detected. When the molecular variability was analyzed for representative isolates, collected from the main Greek lentil production areas, five BLRV isolates showed 95% identity for the coat protein (CP gene and 99% for the 3’ end region. Three Greek PEMV isolates co-clustered with an isolate from Germany when their CP sequence was compared with isolates with no mutation in the aphid transmission gene. Overall, limited genetic variability was detected among Greek isolates of BLRV and PEMV.

Present status of some virus diseases affecting legume crops in Tunisia, and partial characterization of Chickpea chlorotic stunt virus

Directory of Open Access Journals (Sweden)

Asma NAJAR

2011-09-01

Full Text Available Field surveys were conducted in Tunisia during the 2005‒2006, 2006‒2007 and 2009‒2010 growing seasons to identify viruses which produce yellowing, reddening and/or stunting symptoms of chickpea, faba bean and pea crops. Tissue blot immunoassay (TBIA results showed that Chickpea chlorotic stunt virus (CpCSV was the most common virus, followed by Faba bean necrotic yellows virus, Bean leafroll virus and Beet western yellows virus. The coat protein (CP gene nucleotide sequence of seven CpCSV isolates collected from different regions of Tunisia was compared with sequences of five other isolates in the NCBI database. A homology tree of the CP nucleotide sequences was prepared and CpCSV isolates were grouped into two clusters. The first group contained two Tunisian CpCSV chickpea isolates collected from Bizerte and Kef; sequenced regions showed a high nucleotiode homology (95% to that of the Ethiopian and Sudanese CpCSV isolates. The second group included five Tunisian isolates: two from chickpea, two from pea and one from faba bean, which showed a high homology (96% when compared with the Moroccan, Egyptian and Syrian CpCSV isolates.

Phytosanitary evaluation of olive germplasm in Albania

Directory of Open Access Journals (Sweden)

M. Luigi

2009-09-01

Full Text Available A survey on viruses was carried out in 2008 in the main olive-growing areas of Albania (Kruja, Sauk and Vlora. Fifty samples from 14 local and 2 exotic olive cultivars were collected from 10 commercial orchards and one collection field and inspected for Arabis mosaic virus (ArMV, Cherry leaf roll virus (CLRV, Strawberry latent ringspot virus (SLRV, Olive latent virus 1 (OLV-1, Olive leaf yellowing-associated virus (OLYaV, Cucumber mosaic virus (CMV, Olive latent virus-2 (OLV-2 and Tobacco necrosis virus strain D (TNV-D by a one-step RT-PCR assay using virus-specifi c primers. None of these viruses were found in the source plants except SLRSV and OLYaV, which were detected in a ‘K. M. Berat’ olive tree grown in the collection field. These findings are important because the incidence of olive virus diseases is low in Albania but high in other Mediterranean countries. Thus, all efforts should be to directed to maintaining the Albanian olive germplasm pathogen-free and in the best agronomical and phytosanitary condition possible.

Antimicrobial-Coated Granules for Disinfecting Water

Science.gov (United States)

Akse, James R.; Holtsnider, John T.; Kliestik, Helen

2011-01-01

Methods of preparing antimicrobialcoated granules for disinfecting flowing potable water have been developed. Like the methods reported in the immediately preceding article, these methods involve chemical preparation of substrate surfaces (in this case, the surfaces of granules) to enable attachment of antimicrobial molecules to the surfaces via covalent bonds. A variety of granular materials have been coated with a variety of antimicrobial agents that include antibiotics, bacteriocins, enzymes, bactericides, and fungicides. When employed in packed beds in flowing water, these antimicrobial-coated granules have been proven effective against gram-positive bacteria, gram-negative bacteria, fungi, and viruses. Composite beds, consisting of multiple layers containing different granular antimicrobial media, have proven particularly effective against a broad spectrum of microorganisms. These media have also proven effective in enhancing or potentiating the biocidal effects of in-line iodinated resins and of very low levels of dissolved elemental iodine.

Citrus Tristeza Virus on the Island of Crete

DEFF Research Database (Denmark)

Shegani, M.; Tsikou, D.; Velimirovic, A.

2012-01-01

Over a period of two years, more than 5,000 citrus trees were tested for the presence of Citrus tristeza virus (CTV) on the island of Crete, resulting in thirty eight positives. Comparisons of the relative transcript levels of CTV p23, coat protein (CP), polymerase (POL) and an intergenic (POL/p3...

The molecular basis of the antigenic cross-reactivity between measles and cowpea mosaic viruses

International Nuclear Information System (INIS)

Olszewska, Wieslawa; Steward, Michael W.

2003-01-01

Two nonrelated viruses, cowpea mosaic virus (wtCPMV) and measles virus (MV), were found to induce cross-reactive antibodies. The nature of this cross-reactivity was studied and results are presented here demonstrating that antiserum raised against wtCPMV reacted with peptide from the fusion (F) protein of MV. Furthermore, the F protein of MV was shown to share an identical conformational B cell epitope with the small subunit of CPMV coat protein. Passive transfer of anti-wtCPMV antibodies into BALB/c mice conferred partial protection against measles virus induced encephalitis. The results are discussed in the context of cross-protection

Biological effects of rAAV-caAlk2 coating on structural allograft healing

DEFF Research Database (Denmark)

Koefoed, Mette; Ito, Hiromu; Gromov, Kirill

2005-01-01

Structural bone allografts often fracture due to their lack of osteogenic and remodeling potential. To overcome these limitations, we utilized allografts coated with recombinant adeno-associated virus (rAAV) that mediate in vivo gene transfer. Using beta-galactosidase as a reporter gene, we show...

Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

Directory of Open Access Journals (Sweden)

Hoseong Choi

2013-03-01

Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

Molecular modeling and in-silico engineering of Cardamom mosaic virus coat protein for the presentation of immunogenic epitopes of Leptospira LipL32.

Science.gov (United States)

Kumar, Vikram; Damodharan, S; Pandaranayaka, Eswari P J; Madathiparambil, Madanan G; Tennyson, Jebasingh

2016-01-01

Expression of Cardamom mosaic virus (CdMV) coat protein (CP) in E. coli forms virus-like particles. In this study, the structure of CdMV CP was predicted and used as a platform to display epitopes of the most abundant surface-associated protein, LipL32 of Leptospira at C, N, and both the termini of CdMV CP. In silico, we have mapped sequential and conformational B-cell epitopes from the crystal structure of LipL32 of Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 using IEDB Elipro, ABCpred, BCPRED, and VaxiJen servers. Our results show that the epitopes displayed at the N-terminus of CdMV CP are promising vaccine candidates as compared to those displayed at the C-terminus or at both the termini. LipL32 epitopes, EP2, EP3, EP4, and EP6 are found to be promising B-cell epitopes for vaccine development. Based on the type of amino acids, length, surface accessibility, and docking energy with CdMV CP model, the order of antigenicity of the LipL32 epitopes was found to be EP4 > EP3 > EP2 > EP6.

The structure of melon necrotic spot virus determined at 2.8 Å resolution

International Nuclear Information System (INIS)

Wada, Yasunobu; Tanaka, Hideaki; Yamashita, Eiki; Kubo, Chikako; Ichiki-Uehara, Tamaki; Nakazono-Nagaoka, Eiko; Omura, Toshihiro; Tsukihara, Tomitake

2007-01-01

The structure of melon necrotic spot virus is reported. The structure of melon necrotic spot virus (MNSV) was determined at 2.8 Å resolution. Although MNSV is classified into the genus Carmovirus of the family Tombusviridae, the three-dimensional structure of MNSV showed a higher degree of similarity to tomato bushy stunt virus (TBSV), which belongs to the genus Tombusvirus, than to carnation mottle virus (CMtV), turnip crinkle virus (TCV) or cowpea mottle virus (CPMtV) from the genus Carmovirus. Thus, the classification of the family Tombusviridae at the genus level conflicts with the patterns of similarity among coat-protein structures. MNSV is one of the viruses belonging to the genera Tombusvirus or Carmovirus that are naturally transmitted in the soil by zoospores of fungal vectors. The X-ray structure of MNSV provides us with a representative structure of viruses transmitted by fungi

The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

International Nuclear Information System (INIS)

Lim, Hyoun-Sub; Nam, Jiryun; Seo, Eun-Young; Nam, Moon; Vaira, Anna Maria; Bae, Hanhong; Jang, Chan-Yong; Lee, Cheol Ho; Kim, Hong Gi; Roh, Mark; Hammond, John

2014-01-01

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP SP ) with that from AltMV-Po (CP Po ) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP Po [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP SP but not CP Po interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP SP than CP Po in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein

Tomato bushy stunt virus (TBSV) infecting Lycopersicon esculentum.

Science.gov (United States)

Hafez, El Sayed E; Saber, Ghada A; Fattouh, Faiza A

2010-01-01

Tomato bushy stunt virus (TBSV) was detected in tomato crop (Lycopersicon esculentum) in Egypt with characteristic mosaic leaf deformation, stunting, and bushy growth symptoms. TBSV infection was confirmed serologically by ELISA and calculated incidence was 25.5%. Basic physicochemical properties of a purified TBSV Egh isolate were identical to known properties of tombusviruses of isometric 30-nm diameter particles, 41-kDa coat protein and the genome of approximately 4800 nt. This is the first TBSV isolate reported in Egypt. Cloning and partial sequencing of the isolate showed that it is more closely related to TBSV-P and TBSV-Ch than TBSV-Nf and TBSV-S strains of the virus. However, it is distinct from the above strains and could be a new strain of the virus which further confirms the genetic diversity of tombusviruses.

Polyclonal antibodies against the recombinantly expressed coat protein of the Citrus psorosis virus

Directory of Open Access Journals (Sweden)

Reda Salem

2018-05-01

Full Text Available Psorosis is a damaging disease of citrus that is widespread in many parts of the world. Citrus psorosis virus (CPsV, the type species of the genus Ophiovirus, is the putative causal agent of psorosis. Detection of CPsV by laboratory methods, serology in particular is a primary requirement for large-scale surveys but their production has been impaired by the difficulty of obtaining sufficient clean antigen for immunization. Specific PAbs against coat protein were produced in E. coli using recombinant DNA approach. The full length CP gene fragment was amplified by RT-PCR using total RNA extracted from CPsV infected citrus leaves and CP specific primers. The obtained product (1320bp was cloned, sequenced and sub-cloned into pET-30(+ expression vector. Expression was induced and screened in different bacterial clones by the presence of the expressed protein (48kDa and optimized in one clone. Expressed CP was purified using batch chromatography under denaturing conditions. Specificity of expressed protein was demonstrated by ELISA before used as antigen for raising PAbs in mice. Specificity of the raised PAbs to CPsV was verified by ELISA and western blotting. The raised PAbs were showed highly effectiveness in screening by ELISA comparing with the commercial antibodies purchased from Agritest, Valanzano, Italy.The expression of CPsV CP gene in E. coli, production of PAbs using recombinant protein as an antigen, the suitability of these antibodies for use in immunodiagnostics against the CPsV Egyptian isolate have been accomplished in this work. Keywords: CPsV, CP, PAbs, RT-PCR, ELISA, Western blotting

Surface properties, more than size, limiting convective distribution of virus-sized particles and viruses in the central nervous system.

Science.gov (United States)

Chen, Michael Y; Hoffer, Alan; Morrison, Paul F; Hamilton, John F; Hughes, Jeffrey; Schlageter, Kurt S; Lee, Jeongwu; Kelly, Brandon R; Oldfield, Edward H

2005-08-01

Achieving distribution of gene-carrying vectors is a major barrier to the clinical application of gene therapy. Because of the blood-brain barrier, the distribution of genetic vectors to the central nervous system (CNS) is even more challenging than delivery to other tissues. Direct intraparenchymal microinfusion, a minimally invasive technique, uses bulk flow (convection) to distribute suspensions of macromolecules widely through the extracellular space (convection-enhanced delivery [CED]). Although acute injection into solid tissue is often used for delivery of oligonucleotides, viruses, and liposomes, and there is preliminary evidence that certain of these large particles can spread through the interstitial space of the brain by the use of convection, the use of CED for distribution of viruses in the brain has not been systematically examined. That is the goal of this study. Investigators used a rodent model to examine the influence of size, osmolarity of buffering solutions, and surface coating on the volumetric distribution of virus-sized nanoparticles and viruses (adeno-associated viruses and adenoviruses) in the gray matter of the brain. The results demonstrate that channels in the extracellular space of gray matter in the brain are large enough to accommodate virus-sized particles and that the surface characteristics are critical determinants for distribution of viruses in the brain by convection. These results indicate that convective distribution can be used to distribute therapeutic viral vectors in the CNS.

Polyelectrolyte-modified cowpea mosaic virus for the synthesis of gold nanoparticles.

Science.gov (United States)

Aljabali, Alaa A A; Evans, David J

2014-01-01

Polyelectrolyte surface-modified cowpea mosaic virus (CPMV) can be used for the templated synthesis of narrowly dispersed gold nanoparticles. Cationic polyelectrolyte, poly(allylamine) hydrochloride, is electrostatically bound to the external surface of the virus capsid. The polyelectrolyte-coated CPMV promotes adsorption of aqueous gold hydroxide anionic species, prepared from gold(III) chloride and potassium carbonate, that are easily reduced to form CPMV-templated gold nanoparticles. The process is simple and environmentally benign using only water as solvent at ambient temperature.

Role of Charge Regulation and Size Polydispersity in Nanoparticle Encapsulation by Viral Coat Proteins

NARCIS (Netherlands)

Kusters, Remy; Lin, Hsiang-Ku; Zandi, Roya; Tsvetkova, Irina; Dragnea, Bogdan; van der Schoot, Paul

2015-01-01

Nanoparticles can be encapsulated by virus coat proteins if their surfaces are functionalized to acquire a sufficiently large negative charge. A minimal surface charge is required to overcome (i) repulsive interactions between the positively charged RNA-binding domains on the proteins and (ii) the

Occurrence and Distribution of Citrus tristeza virus (CTV in the Jordan Valley

Directory of Open Access Journals (Sweden)

G. Anfoka

2005-04-01

Full Text Available In a survey conducted in 2002 and 2003, Citrus tristeza virus (CTV was detected in the Jordan Valley. The direct tissue blot immunoassay (DTBIA indicated that 12.7 and 15.2% of samples tested in the central and northern Jordan Valley respectively were infected with CTV. Similar results showed that all citrus species grown in the Jordan Valley were susceptible to CTV. DAS-ELISA analysis of samples from a citrus orchard in the Dir Alla area with severe CTV symptoms indicated that 49% of samples were infected with CTV. Using a CTV specific primer pair (CTV1/CTV10, the coat protein gene of the virus was successfully amplified from leaf extracts obtained from CTVinfected trees by IC-RT-PCR. After cloning and sequencing the coat protein gene, the sequence of the amplified product was deposited in the GenBank.

The Coat Protein and NIa Protease of Two Potyviridae Family Members Independently Confer Superinfection Exclusion

Science.gov (United States)

French, Roy

2016-01-01

ABSTRACT Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement of specific viral determinants, are just beginning to be elucidated. In this study, SIE determinants encoded by two economically important wheat viruses, Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) and Triticum mosaic virus (TriMV; genus Poacevirus, family Potyviridae), were identified in gain-of-function experiments that used heterologous viruses to express individual virus-encoded proteins in wheat. Wheat plants infected with TriMV expressing WSMV P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, or NIb cistrons permitted efficient superinfection by WSMV expressing green fluorescent protein (WSMV-GFP). In contrast, wheat infected with TriMV expressing WSMV NIa-Pro or coat protein (CP) substantially excluded superinfection by WSMV-GFP, suggesting that both of these cistrons are SIE effectors encoded by WSMV. Importantly, SIE is due to functional WSMV NIa-Pro or CP rather than their encoding RNAs, as altering the coded protein products by minimally changing RNA sequences led to abolishment of SIE. Deletion mutagenesis further revealed that elicitation of SIE by NIa-Pro requires the entire protein while CP requires only a 200-amino-acid (aa) middle fragment (aa 101 to 300) of the 349 aa. Strikingly, reciprocal experiments with WSMV-mediated expression of TriMV proteins showed that TriMV CP, and TriMV NIa-Pro to a lesser extent, likewise excluded superinfection by TriMV-GFP. Collectively, these data demonstrate that WSMV- and TriMV-encoded CP and NIa-Pro proteins are effectors of SIE and that these two proteins trigger SIE independently of each other. IMPORTANCE Superinfection exclusion (SIE) is an antagonistic virus-virus interaction that

The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

Energy Technology Data Exchange (ETDEWEB)

Lim, Hyoun-Sub, E-mail: hyounlim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Jiryun, E-mail: jilyoon@naver.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Seo, Eun-Young, E-mail: sey22@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Nam, Moon, E-mail: moonlit51@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Vaira, Anna Maria, E-mail: a.vaira@ivv.cnr.it [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Istituto di Virologia Vegetale, CNR, Strada delle Cacce 73, Torino 10135 (Italy); Bae, Hanhong, E-mail: hanhongbae@ynu.ac.kr [School of Biotechnology, Yeungnam University, Geongsan 712-749 (Korea, Republic of); Jang, Chan-Yong, E-mail: sunbispirit@gmail.com [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Cheol Ho, E-mail: chlee1219@hanmail.net [Department of Chemical and Biological Engineering, Seokyoung University, Seoul 136-704 (Korea, Republic of); Kim, Hong Gi, E-mail: hgkim@cnu.ac.kr [Department of Applied Biology, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Roh, Mark, E-mail: marksroh@gmail.com [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States); Laboratory of Floriculture and Plant Physiology, School of Bio-Resource Science, Dankook University, Cheonan, Chungnam 330-714 (Korea, Republic of); Hammond, John, E-mail: john.hammond@ars.usda.gov [Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS, 10300 Baltimore Avenue B-010A, Beltsville, MD 20705 (United States)

2014-03-15

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP{sub SP}) with that from AltMV-Po (CP{sub Po}) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution of only two residues from CP{sub Po} [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP{sub SP} but not CP{sub Po} interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP{sub SP} than CP{sub Po} in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein.

PREFACE The physics of virus assembly The physics of virus assembly

Science.gov (United States)

Stockley, Peter G.; Twarock, Reidun

2010-12-01

Viruses are pathogens in every kingdom of life and are major causes of human disease and suffering. They are known to encompass a size range that overlaps with that of the smallest bacterial cells, and the largest viruses now seem to be hosts of their own viral pathogens. Recent genomic sequencing efforts show that many organisms have genes that are likely to be descended in evolution from viral progenitors. Even more astonishingly, analysis of the world's oceans has shown that some of the simplest viruses, the tailed dsDNA phages, are the most common biological entities on the planet, with estimates of their numbers ranging up to 1031, with ~ 1021 infection events every second, leading to a turnover of around 20% of the biomass in the sea every few days. These cycles of infection and lysis of oceanic bacteria and algae provide the nutrients for the smallest organisms lying at the bottom of the food chain. Without viruses, therefore, life on Earth would probably not be sustainable. These are remarkable facts for systems that are non-living in the strict sense, and are composed of simple materials—nucleic acids, proteins and lipids. Many viruses consist of little more than a protective protein coat surrounding their genomic nucleic acids, which can be either DNA or RNA. Their simplicity leads to highly symmetrical structures with protein containers based on helical or icosahedral lattices. Many simple viruses self-assemble rapidly and with great fidelity, and many groups are busy trying to exploit these properties to make virus-like particles for a wide range of applications, including targeted drug-delivery, medical imaging and even novel materials. This issue of Physical Biology contains a series of papers describing some of the latest experimental and theoretical research on viruses, their structures and assembly, as well as their regulated disassembly during infection. These range from a dissection of the in vivo assembly mechanism of a filamentous virus

Expression and purification of coat protein of citrus tristeza virus ...

African Journals Online (AJOL)

CTV coat protein gene (CTV-cp) cloned in pQE30 vector and transformed to DH5α containing 666bp long from Thailand MK-50 isolate was amplified with a forward primer CTV-CP1 (5' CAC CGA CGA AAC AAA GAA ATT GAA GAA CA 3') and a reverse primer CTVCP2 (5' TCA ACG TGT GTT AAA TTT CCC AAG C 3') and ...

Extension of the ELISA method to the measurement of the specific radioactivity of viruses in crude cellular extracts

Energy Technology Data Exchange (ETDEWEB)

Konate, G; Fritig, B [Institut de Biologie Moleculaire et Cellulaire, 67-Strasbourg (France). Lab. de Virologie

1983-06-01

The double-antibody sandwich method of ELISA, which allows accurate quantitative determination of plant viruses, was extended to a radiochemical procedure which permits direct measurement of the specific radioactivity of virus labelled in vivo and present in very crude plant homogenates. Evidence is presented showing that 20 to 50% of the virus introduced in the polystyrene wells during the antigen incubation step could be trapped in the sandwich. The percentage of virus bound increased with the concentration of the coating antibody and was almost proportional to the concentration of the antigen and to the incubation time of the antigens. Complete dissociation of the double-antibody sandwich was achieved by incubation with 0.2 M KOH or NaOH (pH 13.3), and the label carried by the virus was measured by scintillation counting of the solubilization fluid. The ratio infected/healthy was much higher for the radiochemical procedure than for the immunosorbent assay itself since binding of the virus to the coating antibody was not accompanied by any nonspecific trapping of radioactive contaminants in the double-antibody sandwich. The procedure was highly sensitive since the background corresponded to the scintillation counting background. The detection of the label carried by tobacco mosaic virus was possible when the tobacco samples contained at least 5 ng of virus carrying a label as low as 40 dpm /sup 3/H or 20 dpm /sup 14/C.

Highly specific salt bridges govern bacteriophage P22 icosahedral capsid assembly: identification of the site in coat protein responsible for interaction with scaffolding protein.

Science.gov (United States)

Cortines, Juliana R; Motwani, Tina; Vyas, Aashay A; Teschke, Carolyn M

2014-05-01

Icosahedral virus assembly requires a series of concerted and highly specific protein-protein interactions to produce a proper capsid. In bacteriophage P22, only coat protein (gp5) and scaffolding protein (gp8) are needed to assemble a procapsid-like particle, both in vivo and in vitro. In scaffolding protein's coat binding domain, residue R293 is required for procapsid assembly, while residue K296 is important but not essential. Here, we investigate the interaction of scaffolding protein with acidic residues in the N-arm of coat protein, since this interaction has been shown to be electrostatic. Through site-directed mutagenesis of genes 5 and 8, we show that changing coat protein N-arm residue 14 from aspartic acid to alanine causes a lethal phenotype. Coat protein residue D14 is shown by cross-linking to interact with scaffolding protein residue R293 and, thus, is intimately involved in proper procapsid assembly. To a lesser extent, coat protein N-arm residue E18 is also implicated in the interaction with scaffolding protein and is involved in capsid size determination, since a cysteine mutation at this site generated petite capsids. The final acidic residue in the N-arm that was tested, E15, is shown to only weakly interact with scaffolding protein's coat binding domain. This work supports growing evidence that surface charge density may be the driving force of virus capsid protein interactions. Bacteriophage P22 infects Salmonella enterica serovar Typhimurium and is a model for icosahedral viral capsid assembly. In this system, coat protein interacts with an internal scaffolding protein, triggering the assembly of an intermediate called a procapsid. Previously, we determined that there is a single amino acid in scaffolding protein required for P22 procapsid assembly, although others modulate affinity. Here, we identify partners in coat protein. We show experimentally that relatively weak interactions between coat and scaffolding proteins are capable of driving

Distribution and molecular detection of apple mosaic virus in apple ...

African Journals Online (AJOL)

... pair for real time polymerase chain reaction (RT-PCR) detection of coat protein gene for Turkish ApMV isolates. Apple mosaic virus isolates were collected in 2007 to 2010 and the presence of the pathogen was detected by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and RT-PCR tests.

Serological and molecular studies of a novel virus isolate causing yellow mosaic of Patchouli [Pogostemon cablin (Blanco) Benth].

Science.gov (United States)

Zaim, Mohammad; Ali, Ashif; Joseph, Jomon; Khan, Feroz

2013-01-01

Here we have identified and characterized a devastating virus capable of inducing yellow mosaic on the leaves of Patchouli [Pogostemon cablin (Blanco) Benth]. The diagnostic tools used were host range, transmission studies, cytopathology, electron microscopy, serology and partial coat protein (CP) gene sequencing. Evidence from biological, serological and sequence data suggested that the causal virus belonged to genus Potyvirus, family Potyviridae. The isolate, designated as Patchouli Yellow Mosaic Virus (PaYMV), was transmitted through grafting, sap and the insect Myzus persicae (Sulz.). Flexuous rod shaped particles with a mean length of 800 nm were consistently observed in leaf-dip preparations from natural as well as alternate hosts, and in purified preparation. Cytoplasmic cylindrical inclusions, pinwheels and laminar aggregates were observed in ultra-thin sections of infected patchouli leaves. The purified capsid protein has a relative mass of 43 kDa. Polyclonal antibodies were raised in rabbits against the coat protein separated on SDS - PAGE; which were used in ELISA and western blotting. Using specific antibodies in ELISA, PaYMV was frequently detected at patchouli plantations at Lucknow and Bengaluru. Potyvirus-specific degenerate primer pair (U335 and D335) had consistently amplified partial CP gene from crude preparations of infected tissues by reverse transcription polymerase chain reaction (RT-PCR). Comparison of the PCR product sequence (290 bp) with the corresponding regions of established potyviruses showed 78-82% and 91-95% sequence similarity at the nucleotide and amino acid levels, respectively. The results clearly established that the virus under study has close homology with watermelon mosaic virus (WMV) in the coat protein region and therefore could share a common ancestor family. Further studies are required to authenticate the identity of PaYMV as a distinct virus or as an isolate of WMV.

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

International Nuclear Information System (INIS)

Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

2008-01-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

Rapid immunohistochemical diagnosis of tobacco mosaic virus disease by microwave-assisted plant sample preparation

Science.gov (United States)

Zellnig, Günther; Möstl, Stefan; Zechmann, Bernd

2013-01-01

Immunoelectron microscopy is a powerful method to diagnose viral diseases and to study the distribution of the viral agent within plant cells and tissues. Nevertheless, current protocols for the immunological detection of viral diseases with transmission electron microscopy (TEM) in plants take between 3 and 6 days and are therefore not suited for rapid diagnosis of virus diseases in plants. In this study, we describe a method that allows rapid cytohistochemical detection of tobacco mosaic virus (TMV) in leaves of tobacco plants. With the help of microwave irradiation, sample preparation of the leaves was reduced to 90 min. After sample sectioning, virus particles were stained on the sections by immunogold labelling of the viral coat protein, which took 100 min. After investigation with the TEM, a clear visualization of TMV in tobacco cells was achieved altogether in about half a day. Comparison of gold particle density by image analysis revealed that samples prepared with the help of microwave irradiation yielded significantly higher gold particle density as samples prepared conventionally at room temperature. This study clearly demonstrates that microwave-assisted plant sample preparation in combination with cytohistochemical localization of viral coat protein is well suited for rapid diagnosis of plant virus diseases in altogether about half a day by TEM. PMID:23580761

Identificação de marcadores moleculares ligados a gene de resistência ao vírus do mosaico (PRSV-W) em melão (Cucumis melo L.).

OpenAIRE

Ana Paula Matoso Teixeira

2004-01-01

A importância da cultura do meloeiro é crescente no Brasil, sobretudo na região Nordeste, tanto pelo volume comercializado como por ser estabelecida geralmente em pequenas propriedades. Diversas enfermidades acometem esta cultura, destacando-se as viroses. Dentre estas, o mosaico, causado pelo Papaya ringspot virus - estirpe melancia (PRSV-W) é das mais importantes. Dentre as estratégias de controle desta doença, o emprego de cultivares resistentes apresenta-se como um método prático e ...

Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

Directory of Open Access Journals (Sweden)

Budzanivska I. G.

2014-03-01

Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

Science.gov (United States)

Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

2013-10-01

Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

tRNA-like structure regulates translation of Brome mosaic virus RNA.

Science.gov (United States)

Barends, Sharief; Rudinger-Thirion, Joëlle; Florentz, Catherine; Giegé, Richard; Pleij, Cornelis W A; Kraal, Barend

2004-04-01

For various groups of plant viruses, the genomic RNAs end with a tRNA-like structure (TLS) instead of the 3' poly(A) tail of common mRNAs. The actual function of these TLSs has long been enigmatic. Recently, however, it became clear that for turnip yellow mosaic virus, a tymovirus, the valylated TLS(TYMV) of the single genomic RNA functions as a bait for host ribosomes and directs them to the internal initiation site of translation (with N-terminal valine) of the second open reading frame for the polyprotein. This discovery prompted us to investigate whether the much larger TLSs of a different genus of viruses have a comparable function in translation. Brome mosaic virus (BMV), a bromovirus, has a tripartite RNA genome with a subgenomic RNA4 for coat protein expression. All four RNAs carry a highly conserved and bulky 3' TLS(BMV) (about 200 nucleotides) with determinants for tyrosylation. We discovered TLS(BMV)-catalyzed self-tyrosylation of the tyrosyl-tRNA synthetase but could not clearly detect tyrosine incorporation into any virus-encoded protein. We established that BMV proteins do not need TLS(BMV) tyrosylation for their initiation. However, disruption of the TLSs strongly reduced the translation of genomic RNA1, RNA2, and less strongly, RNA3, whereas coat protein expression from RNA4 remained unaffected. This aberrant translation could be partially restored by providing the TLS(BMV) in trans. Intriguingly, a subdomain of the TLS(BMV) could even almost fully restore translation to the original pattern. We discuss here a model with a central and dominant role for the TLS(BMV) during the BMV infection cycle.

Thermally joining and/or coating or thermally separating the workpieces having heat-sensitive coating, comprises restoring coating by thermally coating the coating material after thermally joining and/or coating or thermally separating

OpenAIRE

Riedel, Frank; Winkelmann, Ralf; Puschmann, Markus

2011-01-01

The method for thermally joining and/or coating or thermally separating the workpieces (1), which have a heat-sensitive coating (2), comprises restoring the coating by thermally coating a coating material (3) after thermally joining and/or coating or thermally separating the workpieces. A part of the thermal energy introduced in the workpiece for joining and/or coating or separating or in the workpieces is used for thermally coating the coating material. Two workpieces are welded or soldered ...

Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

Directory of Open Access Journals (Sweden)

Milady F. Mendoza

2004-10-01

Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

HIV-1 Nef hijacks clathrin coats by stabilizing AP-1:Arf1 polygons.

Science.gov (United States)

Shen, Qing-Tao; Ren, Xuefeng; Zhang, Rui; Lee, Il-Hyung; Hurley, James H

2015-10-23

The lentiviruses HIV and simian immunodeficiency virus (SIV) subvert intracellular membrane traffic as part of their replication cycle. The lentiviral Nef protein helps viruses evade innate and adaptive immune defenses by hijacking the adaptor protein 1 (AP-1) and AP-2 clathrin adaptors. We found that HIV-1 Nef and the guanosine triphosphatase Arf1 induced trimerization and activation of AP-1. Here we report the cryo-electron microscopy structures of the Nef- and Arf1-bound AP-1 trimer in the active and inactive states. A central nucleus of three Arf1 molecules organizes the trimers. We combined the open trimer with a known dimer structure and thus predicted a hexagonal assembly with inner and outer faces that bind the membranes and clathrin, respectively. Hexagons were directly visualized and the model validated by reconstituting clathrin cage assembly. Arf1 and Nef thus play interconnected roles in allosteric activation, cargo recruitment, and coat assembly, revealing an unexpectedly intricate organization of the inner AP-1 layer of the clathrin coat. Copyright © 2015, American Association for the Advancement of Science.

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Protein synthesis directed by cowpea mosaic virus RNAs

International Nuclear Information System (INIS)

Stuik, E.

1979-01-01

The thesis concerns the proteins synthesized under direction of Cowpea mosaic virus RNAs. Sufficient radioactive labelling of proteins was achieved when 35 S as sulphate was administered to intact Vigna plants, cultivated in Hoagland solution. The large polypeptides synthesized under direction of B- and M-RNA are probably precursor molecules from which the coat proteins are generated by a mechanism of posttranslational cleavage. (Auth.)

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

Sensitive radioimmunoassay for the determination of antibodies to mouse hepatitis virus

Energy Technology Data Exchange (ETDEWEB)

Leibowitz, J L [California Univ., San Diego, La Jolla (USA); Fung, L S; Levy, G A [Toronto Univ., Ontario (Canada)

1983-05-01

A solid-phase radioimmunoassay is described for the detection of antibodies to mouse hepatitis virus. Viruses were purified by velocity and isopycnic gradient centrifugation and 96-well plastic plates were coated with viral antigens. To allow the detection of most serotypes of low titered antisera, a pool of antigens from several viral serotypes were employed. The second antibody, an affinity-purified goat antimouse immunoglobulin, detects IgG, IgM and IgA antibodies. This assay is more sensitive than either the plaque reduction assay or the commercially available enzyme-linked immunosorbant assay and proved to be useful for screening mouse colonies for the presence of mouse hepatitis virus, following seroconversion in experimental animals and in the production of monoclonal antibodies to both structural and nonstructural proteins.

Survey of Viruses Present in Radish Fields in 2014

Directory of Open Access Journals (Sweden)

Jinsoo Chung

2015-09-01

Full Text Available A 2014 nationwide survey in radish fields investigated the distribution of common viruses and possible emerging viruses. Radish leaves with virus-like symptoms were collected and 108 samples assayed by RT-PCR using specific primers for Radish mosaic virus (RaMV, Cucumber mosaic virus (CMV, and Turnip mosaic virus (TuMV; 47 samples were TuMV positive, and RaMV and CMV were detected in 3 and 2 samples, respectively. No samples showed double infection of TuMV/RaMV, or RaMV/CMV, but two double infections of TuMV/CMV were detected. TuMV isolates were sorted by symptom severity, and three isolates (R007-mild; R041 and R065-severe selected for BLAST and phylogenetic analysis, which indicated that the coat protein (CP of these isolates (R007, R041, and R065 have approx. 98-99% homology to a previously reported TuMV isolate. RaMV CP showed approx. 99% homology to a previously reported isolate, and the CMV CP is identical to a previously reported Korean isolate (GenBank : GU327368. Three isolates of TuMV showing different pathogenicity (degree of symptom severity will be valuable to study determinants of pathogenicity.

Frequency and Molecular Characterization of Watermelon Mosaic Virus from Serbia

Directory of Open Access Journals (Sweden)

Ana Vučurović

2010-01-01

Full Text Available Watermelon mosaic virus (WMV is widespread in cucurbit crops, most commonly occuring in temperate and Mediterranean regions. In Serbia WMV has been detected in single and mixed infections with Zucchini yellow mosaic virus and Cucumber mosaic virus in field-grown pumpkin and squash crops. Among pumpkin-affecting viruses WMV is the most frequent one, both by the number of localities and its incidence at each location. During the growing season of 2009, samples from 583 plants of Cucurbita pepo cvs. Olinka, Belgrade zucchini and Tosca (Zucchini group, as well as from C. maxima and C. moschata showing symptoms of virus infection were collected from 12 commercial fields at eight localities and analyzed by DAS-ELISA using polyclonal antisera specific to six most important cucurbit viruses. Interestingly, WMV was detected at fewer sites and had lower ncidence rate than in two previous years. In single infections, WMV was found in 11% of tested plants in three fields; in mixed infections with ZYMV, it was recorded in 9.9% of plants in five fields and with CMV in only 0.2% in one field. The partial coat protein gene and 3’ non-translated region from two representativeisolates of WMV originating from different localities and host plant species were amplified by RT-PCR, sequenced, and compared with the sequences available in GenBank database. The PCR-amplified fragment of predicted size of approximately 1017 bp was obtained. The sequences of isolates 137-08 (Acc. No. GQ259958 and 159-08 (GU144020 proved to be 94-99% identical at the nucleotide level with those from other parts of the world. The sequences of these two isolates differed from each other only at two nucleotide positions, without any amino acid substitution. Phylogenetic analysis of 57 isolates based on 750 bp sequences of the coat protein gene showed no correlation between isolates and their geographic origin, and italso indicated that these isolates fell into three molecular groups of

PENGKLONAN DAN PERUNUTAN NUKLEOTIDA GEN SELUBUNG PROTEIN DAN 3’UTR (untranslated region PEANUT STRIPE VIRUS

Directory of Open Access Journals (Sweden)

Hasriadi Mat Akin

2011-10-01

Full Text Available Cloning and sequencing of coat protein gene and 3’UTR (untranslated region of peanut stripe virus. The cDNA of 3' terminal of peanut stripe virus genomic RNA was cloned and sequenced. The cDNA was ligated with plasmid vector pGEM-T Easy and transformed to competent cells of Escherichia coli. The 3' terminal of PstV genomic RNA contained 1195 nucleotides (nts.  The region included the nucleotide sequences of NIb (nuclear inclusion body (129 nts, CP gene (coat protein gene (861 nts, and 3'UTR (untranslated region (205 nts. The nucleotide sequence of a CP gene contained one long uninterrupted open reading frame (ORF without a start codon, which ended a UAG stop codon. The 287 amino acid residues of PStV coat protein were predicted from the CP gene.  The amino acid was analyzed for the presence of consensus polyprotein cleavage site for maturation of potyvirus polyprotein.  A putative cleavage site was found at position 43 (Q/S following the Valine (V residue at -4 position.  This isolate of PstV can be expected to be aphid transmissible because the coat protein contained a DAG triplet at position 53-55.

pH-Dependent Formation and Disintegration of the Influenza A Virus Protein Scaffold To Provide Tension for Membrane Fusion.

Science.gov (United States)

Batishchev, O V; Shilova, L A; Kachala, M V; Tashkin, V Y; Sokolov, V S; Fedorova, N V; Baratova, L A; Knyazev, D G; Zimmerberg, J; Chizmadzhev, Y A

2016-01-01

Influenza virus is taken up from a pH-neutral extracellular milieu into an endosome, whose contents then acidify, causing changes in the viral matrix protein (M1) that coats the inner monolayer of the viral lipid envelope. At a pH of ~6, M1 interacts with the viral ribonucleoprotein (RNP) in a putative priming stage; at this stage, the interactions of the M1 scaffold coating the lipid envelope are intact. The M1 coat disintegrates as acidification continues to a pH of ~5 to clear a physical path for the viral genome to transit from the viral interior to the cytoplasm. Here we investigated the physicochemical mechanism of M1's pH-dependent disintegration. In neutral media, the adsorption of M1 protein on the lipid bilayer was electrostatic in nature and reversible. The energy of the interaction of M1 molecules with each other in M1 dimers was about 10 times as weak as that of the interaction of M1 molecules with the lipid bilayer. Acidification drives conformational changes in M1 molecules due to changes in the M1 charge, leading to alterations in their electrostatic interactions. Dropping the pH from 7.1 to 6.0 did not disturb the M1 layer; dropping it lower partially desorbed M1 because of increased repulsion between M1 monomers still stuck to the membrane. Lipid vesicles coated with M1 demonstrated pH-dependent rupture of the vesicle membrane, presumably because of the tension generated by this repulsive force. Thus, the disruption of the vesicles coincident with M1 protein scaffold disintegration at pH 5 likely stretches the lipid membrane to the point of rupture, promoting fusion pore widening for RNP release. Influenza remains a top killer of human beings throughout the world, in part because of the influenza virus's rapid binding to cells and its uptake into compartments hidden from the immune system. To attack the influenza virus during this time of hiding, we need to understand the physical forces that allow the internalized virus to infect the cell. In

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

Science.gov (United States)

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Stability and assembly in vitro of bacteriophage PP7 virus-like particles

Directory of Open Access Journals (Sweden)

Peabody David S

2007-11-01

Full Text Available Abstract Background The stability of a virus-like particle (VLP is an important consideration for its use in nanobiotechnology. The icosahedral capsid of the RNA bacteriophage PP7 is cross-linked by disulfide bonds between coat protein dimers at its 5-fold and quasi-6-fold symmetry axes. This work determined the effects of these disulfides on the VLP's thermal stability. Results Measurements of the thermal denaturation behavior of PP7 VLPs in the presence and absence of a reducing agent show that disulfide cross-links substantially stabilize them against thermal denaturation. Although dimers in the capsid are linked to one another by disulfides, the two subunits of dimers themselves are held together only by non-covalent interactions. In an effort to confer even greater stability a new cross-link was introduced by genetically fusing two coat protein monomers, thus producing a "single-chain dimer" that assembles normally into a completely cross-linked VLP. However, subunit fusion failed to increase the thermal stability of the particles, even though it stabilized the isolated dimer. As a step toward gaining control of the internal composition of the capsid, conditions that promote the assembly of PP7 coat protein dimers into virus-like particles in vitro were established. Conclusion The presence of inter-dimer disulfide bonds greatly stabilizes the PP7 virus-like particle against thermal denaturation. Covalently cross-linking the subunits of the dimers themselves by genetically fusing them through a dipeptide linker sequence, offers no further stabilization of the VLP, although it does stabilize the dimer. PP7 capsids readily assemble in vitro in a reaction that requires RNA.

The influence of the N- and C- terminal modifications of Potato virus X coat protein on virus properties

Czech Academy of Sciences Publication Activity Database

Hoffmeisterová, Hana; Moravec, Tomáš; Plchová, Helena; Folwarczna, Jitka; Čeřovská, Noemi

2012-01-01

Roč. 56, č. 4 (2012), s. 775-779 ISSN 0006-3134 R&D Projects: GA ČR GA521/09/1525 Institutional research plan: CEZ:AV0Z50380511 Keywords : chimeric coat protein * expression of recombinant protein * Nicotiana benthamiana Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.692, year: 2012

Coated microneedle arrays for transcutaneous delivery of live virus vaccines

OpenAIRE

Vrdoljak, Anto; McGrath, Marie G.; Carey, John B.; Draper, Simon J.; Hill, Adrian V.S.; O’Mahony, Conor; Crean, Abina M.; Moore, Anne C.

2011-01-01

Vaccines are sensitive biologics that require continuous refrigerated storage to maintain their viability. The vast majority of vaccines are also administered using needles and syringes. The need for cold chain storage and the significant logistics surrounding needle-and-syringe vaccination is constraining the success of immunization programs. Recombinant live viral vectors are a promising platform for the development of vaccines against a number of infectious diseases, however these viruses ...

Role of alfalfa mosaic virus coat protein gene in symptom formation

NARCIS (Netherlands)

Neeleman, L.; van der Kuyl, A. C.; Bol, J. F.

1991-01-01

On Samsun NN tobacco plants strains 425 and YSMV of alfalfa mosaic virus (AIMV) cause mild chlorosis and local necrotic lesions, respectively. DNA copies of RNA3 of both strains were transcribed in vitro into infectious RNA molecules. When the 425 and YSMV transcripts were inoculated to tobacco

Maize rayado fino virus capsid proteins assemble into virus-like particles in Escherichia coli.

Science.gov (United States)

Hammond, Rosemarie W; Hammond, John

2010-02-01

Maize rayado fino virus (MRFV; genus Marafivirus; family Tymoviridae) is an isometric plant virus of 30 nm containing two components: empty shells and complete virus particles (encapsidating the 6.3 kb genomic RNA). Both particles are composed of two serologically related, carboxy co-terminal, coat proteins (CP) of apparent molecular mass 21-22 kDa (CP2) and 24-28 kDa (CP1) in a molar ratio of 3:1, respectively; CP1 contains a 37 amino acid amino terminal extension of CP2. In our study, expression of CP1 or CP2 in Escherichia coli resulted in assembly of each capsid protein into virus-like particles (VLPs), appearing in electron microscopy as stain-permeable (CP2) or stain-impermeable particles (CP1). CP1 VLPs encapsidated bacterial 16S ribosomal RNA, but not CP mRNA, while CP2 VLPs encapsidated neither CP mRNA nor 16S ribosomal RNA. Expression of CP1 and CP2 in E. coli using a co-expression vector resulted in the assembly of VLPs which were stain-impermeable and encapsidated CP mRNA. These results suggest that the N-terminal 37 amino acid residues of CP1, although not required for particle formation, may be involved in the assembly of complete virions and that the presence of both CP1 and CP2 in the particle is required for specific encapsidation of MRFV CP mRNA. (c) 2009 Elsevier B.V. All rights reserved.

RNASEK Is a V-ATPase-Associated Factor Required for Endocytosis and the Replication of Rhinovirus, Influenza A Virus, and Dengue Virus

Directory of Open Access Journals (Sweden)

Jill M. Perreira

2015-08-01

Full Text Available Human rhinovirus (HRV causes upper respiratory infections and asthma exacerbations. We screened multiple orthologous RNAi reagents and identified host proteins that modulate HRV replication. Here, we show that RNASEK, a transmembrane protein, was needed for the replication of HRV, influenza A virus, and dengue virus. RNASEK localizes to the cell surface and endosomal pathway and closely associates with the vacuolar ATPase (V-ATPase proton pump. RNASEK is required for endocytosis, and its depletion produces enlarged clathrin-coated pits (CCPs at the cell surface. These enlarged CCPs contain endocytic cargo and are bound by the scissioning GTPase, DNM2. Loss of RNASEK alters the localization of multiple V-ATPase subunits and lowers the levels of the ATP6AP1 subunit. Together, our results show that RNASEK closely associates with the V-ATPase and is required for its function; its loss prevents the early events of endocytosis and the replication of multiple pathogenic viruses.

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

Science.gov (United States)

de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

2014-02-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

A sensitive radioimmunoassay for the determination of antibodies to mouse hepatitis virus

International Nuclear Information System (INIS)

Leibowitz, J.L.; Fung, L.S.; Levy, G.A.

1983-01-01

A solid-phase radioimmunoassay is described for the detection of antibodies to mouse hepatitis virus. Viruses were purified by velocity and isopycnic gradient centrifugation and 96-well plastic plates were coated with viral antigens. To allow the detection of most serotypes of low titered antisera, a pool of antigens from several viral serotypes were employed. The second antibody, an affinity-purified goat antimouse immunoglobulin, detects IgG, IgM and IgA antibodies. This assay is more sensitive than either the plaque reduction assay or the commercially available enzyme-linked immunosorbant assay and proved to be useful for screening mouse colonies for the presence of mouse hepatitis virus, following seroconversion in experimental animals and in the production of monoclonal antibodies to both structural and nonstructural proteins. (Auth.)

Allergenicity assessment of genetically modified cucumber mosaic virus (CMV) resistant tomato (Solanum lycopersicon).

Science.gov (United States)

Lin, Chih-Hui; Sheu, Fuu; Lin, Hsin-Tang; Pan, Tzu-Ming

2010-02-24

Cucumber mosaic virus (CMV) has been identified as the causal agent of several disease epidemics in most countries of the world. Insect-mediated virus diseases, such as those caused by CMV, caused remarkable loss of tomato (Solanum lycopersicon) production in Taiwan. With expression of the CMV coat protein gene (Cmvcp) in a local popular tomato cultivar L4783, transgenic tomato line R8 has showed consistent CMV resistance through T(0) to T(8). In this report, the allergenicity of the CMV coat protein (CMV cp) expressed in transgenic tomato R8 was assessed by investigation of the expression of the transgene source of protein, sequence similarity with known allergens, and resistance to pepsin hydrolysis. There is no known account for either the CMV or its coat protein being an allergen. The result of a bioinformatic search also showed no significant homology between CMV cp and any known allergen. The pepsin-susceptible property of recombinant CMV cp was revealed by a simulated gastric fluid (SGF) assay. Following the most recent FAO/WHO decision tree, all results have indicated that CMV cp was a protein with low possibility to be an allergen and the transgenic tomato R8 should be considered as safe as its host.

RNA virus interference via CRISPR/Cas13a system in plants

KAUST Repository

Aman, Rashid

2017-11-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

European coatings conference - Marine coatings. Proceedings

Energy Technology Data Exchange (ETDEWEB)

NONE

2008-07-01

This volume contains 13 lectures (manuscripts or powerpoint foils) with the following topics: 1. Impact of containerization on polyurethane and polyurea in marine and protective coatings (Malte Homann); 2. The application of combinatorial/high-throughput methods to the development of marine coatings (Bret Chisholm); 3. Progress and perspectives in the AMBIO (advanced nanostructured surfaces for the control of biofouling) Project (James Callow); 4. Release behaviour due to shear and pull-off of silicone coatings with a thickness gradient (James G. Kohl); 5. New liquid rheology additives for high build marine coatings (Andreas Freytag); 6. Effective corrosion protection with polyaniline, polpyrrole and polythiophene as anticorrosice additives for marine paints (Carlos Aleman); 7. Potential applications of sol gel technology for marine applications (Robert Akid); 8: Performance of biocide-free Antifouling Coatings for leisure boats (Bernd Daehne); 9. Novel biocidefree nanostructured antifouling coatings - can nano do the job? (Corne Rentrop); 10. One component high solids, VOC compliant high durability finish technology (Adrian Andrews); 11. High solid coatings - the hybrid solution (Luca Prezzi); 12. Unique organofunctional silicone resins for environmentally friendly high-performance coatings (Dieter Heldmann); 13. Silicone-alkyd paints for marine applications: from battleship-grey to green (Thomas Easton).

Coated Glass Slides TACAS Are Applicable to Heat-Assisted Immunostaining and In Situ Hybridization at the Electron Microscopy Level

International Nuclear Information System (INIS)

Matsui, Takahiro; Onouchi, Takanori; Shiogama, Kazuya; Mizutani, Yasuyoshi; Inada, Ken-ichi; Yu, Fuxun; Hayasaka, Daisuke; Morita, Koichi; Ogawa, Hirohisa; Mahara, Fumihiko; Tsutsumi, Yutaka

2015-01-01

We performed pre-embedding electron microscopic study for visualizing the antigen and genome of severe fever with thrombocytopenia syndrome (SFTS) virus in the cytoplasm of macrophages of the human splenic red pulp, both requesting preheating treatment of sections. To pursue this, coated glass slides with unique characteristics are needed. Namely, during staining they must prevent detaching off sections, but after staining the sections must be transferred to epoxy resin. Aminopropyltriexoxysilane-coated glass slides, widely used for immunostaining, were resistant to transfer to epoxy resin. In contrast, coated glass slides designated as Thinlayer Advanced Cytology Assay System (TACAS) were suitable for this purpose. The technique is also applicable to the coated glass slide-requiring cytology practice, in which immunocytochemical evaluation is needed after cell transfer to another glass slide

Binding constants of Southern rice black-streaked dwarf virus Coat Protein with ferulic acid derivatives

Directory of Open Access Journals (Sweden)

Longlu Ran

2018-04-01

Full Text Available The data present binding constants between ferulic acid derivatives and the Coat Protein (P10 by fluorescence titration in this article, which is hosted in the research article entitled “Interaction Research on an Antiviral Molecule that Targets the Coat Protein of Southern rice black-streaked dwarf virus’’ (Ran et al., 2017 [1]. The data include fluorescence quenching spectrum, Stern–Volmer quenching constants, and binding parameters. In this article, a more comprehensive data interpretation and analysis is explained.

Previously unknown and highly divergent ssDNA viruses populate the oceans.

Science.gov (United States)

Labonté, Jessica M; Suttle, Curtis A

2013-11-01

Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.

Wheat streak mosaic virus coat protein is a host-specific long-distance transport determinant in oat

Science.gov (United States)

Viral determinants involved in systemic infection of hosts by monocot-infecting plant viruses are poorly understood. Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) exclusively infects monocotyledonous crops such as wheat, oat, barley, maize, triticale, and rye. Previously, ...

First report of Cilevirus associated with green ringspot on senescent hibiscus leaves in Tampa, Florida

Science.gov (United States)

The genus Cilevirus includes plant and mite associated viruses with single stranded and positive sense bipartite genomes. The type member of the genus is Citrus leprosis virus, which causes an important disease of citrus in South America, but is not known to occur in Florida. Symptoms of the disea...

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

Science.gov (United States)

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Nanoparticle/Polymer Nanocomposite Bond Coat or Coating

Science.gov (United States)

Miller, Sandi G.

2011-01-01

This innovation addresses the problem of coatings (meant to reduce gas permeation) applied to polymer matrix composites spalling off in service due to incompatibility with the polymer matrix. A bond coat/coating has been created that uses chemically functionalized nanoparticles (either clay or graphene) to create a barrier film that bonds well to the matrix resin, and provides an outstanding barrier to gas permeation. There is interest in applying clay nanoparticles as a coating/bond coat to a polymer matrix composite. Often, nanoclays are chemically functionalized with an organic compound intended to facilitate dispersion of the clay in a matrix. That organic modifier generally degrades at the processing temperature of many high-temperature polymers, rendering the clay useless as a nano-additive to high-temperature polymers. However, this innovation includes the use of organic compounds compatible with hightemperature polymer matrix, and is suitable for nanoclay functionalization, the preparation of that clay into a coating/bondcoat for high-temperature polymers, the use of the clay as a coating for composites that do not have a hightemperature requirement, and a comparable approach to the preparation of graphene coatings/bond coats for polymer matrix composites.

Wipes coated with a singlet-oxygen-producing photosensitizer are effective against human influenza virus but not against norovirus

NARCIS (Netherlands)

Verhaelen, Katharina; Bouwknegt, Martijn; Rutjes, Saskia; de Roda Husman, Ana Maria; Duizer, Erwin

2014-01-01

Transmission of enteric and respiratory viruses, including human norovirus (hNoV) and human influenza virus, may involve surfaces. In food preparation and health care settings, surfaces are cleaned with wipes; however, wiping may not efficiently reduce contamination or may even spread viruses,

New species of RNA formed during tobacco mosaic virus infection

Energy Technology Data Exchange (ETDEWEB)

Siegel, A.; Hari, V.; Montgomery, I.; Kolacz, K.

1976-01-01

Previous investigations have demonstrated that extracts of TMV infected leaf tissue contain several unique virus related RNA species, including viral RNA, RF, RI and a low-molecular-weight component (LMC) of approximately 2.5 x 10/sup 5/ daltons. We have found that LMC becomes heavily labelled when infected tissue is incubated in the dark in the presence of actinomycin D and /sup 3/H-uridine. This component was isolated by sucrose-density gradient centrifugation and polyacrylamide gel electrophoresis and was used as a messenger in a wheat-germ derived cell-free protein synthesizing system. Analysis of the products produced by SDS-gel electrophoresis revealed a protein the same size as TMV coat protein. It was confirmed as coat protein by its reaction with specific antiserum in a gel-diffusion test. We conclude that LMC acts as a messenger for coat protein in the in vitro system and deduce that it probably does so in vivo. During the course of isolating LMC, we have observed several previously unreported new RNA species, probably unique to infected tissue. Among these are a component of approximately 1.1 x 10/sup 6/ daltons and another of a size similar to that of, but distinct from, viral RNA. There are indications that other unique RNA species may also be present and evidence for these will be presented. Our evidence to date points to the likelihood that TMV RNA may be processed into smaller pieces for translation rather than, as in the case of poliovirus, being translated into a polyprotein. It is possible that other groups of non-split genome plant viruses may behave in manner similar to that of TMV in this regard. We have observed that tobacco etch virus (a member of the Pot Y group) infected tissue also contains a component similar to that of LMC but larger (ca. 350,000 daltons). A peculiar feature of this system is that it appears to be sensitive to actinomycin D.

A Molecular Staple: D-Loops in the I Domain of Bacteriophage P22 Coat Protein Make Important Intercapsomer Contacts Required for Procapsid Assembly

Science.gov (United States)

D'Lima, Nadia G.

2015-01-01

ABSTRACT Bacteriophage P22, a double-stranded DNA (dsDNA) virus, has a nonconserved 124-amino-acid accessory domain inserted into its coat protein, which has the canonical HK97 protein fold. This I domain is involved in virus capsid size determination and stability, as well as protein folding. The nuclear magnetic resonance (NMR) solution structure of the I domain revealed the presence of a D-loop, which was hypothesized to make important intersubunit contacts between coat proteins in adjacent capsomers. Here we show that amino acid substitutions of residues near the tip of the D-loop result in aberrant assembly products, including tubes and broken particles, highlighting the significance of the D-loops in proper procapsid assembly. Using disulfide cross-linking, we showed that the tips of the D-loops are positioned directly across from each other both in the procapsid and the mature virion, suggesting their importance in both states. Our results indicate that D-loop interactions act as “molecular staples” at the icosahedral 2-fold symmetry axis and significantly contribute to stabilizing the P22 capsid for DNA packaging. IMPORTANCE Many dsDNA viruses have morphogenic pathways utilizing an intermediate capsid, known as a procapsid. These procapsids are assembled from a coat protein having the HK97 fold in a reaction driven by scaffolding proteins or delta domains. Maturation of the capsid occurs during DNA packaging. Bacteriophage HK97 uniquely stabilizes its capsid during maturation by intercapsomer cross-linking, but most virus capsids are stabilized by alternate means. Here we show that the I domain that is inserted into the coat protein of bacteriophage P22 is important in the process of proper procapsid assembly. Specifically, the I domain allows for stabilizing interactions across the capsid 2-fold axis of symmetry via a D-loop. When amino acid residues at the tip of the D-loop are mutated, aberrant assembly products, including tubes, are formed instead

Structure and behaviour of proteins, nucleic acids and viruses from vibrational Raman optical activity

DEFF Research Database (Denmark)

Barron, L.D.; Blanch, E.W.; McColl, I.H.

2003-01-01

stacking arrangement and the mutual orientation of the sugar and base rings around the C-N glycosidic link. The ROA spectra of intact viruses provide information on the folds of the coat proteins and the nucleic acid structure. The large number of structure-sensitive bands in protein ROA spectra...... is especially favourable for fold determination using pattern recognition techniques. This article gives a brief account of the ROA technique and presents the ROA spectra of a selection of proteins, nucleic acids and viruses that illustrate the applications of ROA spectroscopy in biomolecular research....

Preliminary coating design and coating developments for ATHENA

DEFF Research Database (Denmark)

Jakobsen, Anders Clemen; Ferreira, Desiree Della Monica; Christensen, Finn Erland

2011-01-01

We present initial novel coating design for ATHENA. We make use of both simple bilayer coatings of Ir and B4C and more complex constant period multilayer coatings to enhance the effective area and cover the energy range from 0.1 to 10 keV. We also present the coating technology used...... for these designs and present test results from coatings....

Clonagem e purificação de fragmento da proteína capsidial de Banana streak OL virus Cloning and purification of Banana streak OL virus coat protein fragment

Directory of Open Access Journals (Sweden)

Ricardo Lombardi

2010-08-01

Full Text Available O objetivo deste trabalho foi clonar e induzir a expressão de fragmento da proteína capsidial de Banana streak OL virus (BSOLV-CP em Escherichia coli, bem como purificar a proteína recombinante obtida. Empregou-se um par de iniciadores específicos para amplificar, em PCR, um fragmento de aproximadamente 390 pb, da região codificadora da porção central da BSOLV-CP. O fragmento obtido foi clonado em vetor pGEM-T Easy, subclonado em vetor pQE-30 e transformado em células de E. coli M15 (pREP4 por choque térmico. A expressão da proteína foi induzida por tiogalactopiranosídeo de isopropila (IPTG, e a proteína recombinante BSOLV-rcCP de 14 kDa foi detectada em Western blot e Dot blot. A expressão da proteína BSOLV-rcCP abre novas possibilidades para a obtenção de antígenos para a produção de antissoros contra o BSOLV.The objective of this work was to clone and to induce the expression of a fragment of Banana streak OL virus coat protein (BSOLV-CP in Escherichia coli, as well as to purify the obtained recombinant protein. Two specific primers were used for the PCR-amplification of approximately 390-bp fragment of the codifying region of the BSOLV-CP central portion. The obtained fragment was cloned in pGEM-T Easy vector, subcloned in pQE-30 expression vector and transformed into competent E. coli M15 (pREP4 cells by heat shock. The protein expression was induced by isopropyl thiogalactopyranoside (IPTG and the 14-kDa BSOLV-rcCP recombinant protein was detected in Western and Dot blotting. The expression of the BSOLV-rcCP protein enables new approaches to the obtention of antigens for the antisera production against BSOLV.

Electrocurtain coating process for coating solar mirrors

Science.gov (United States)

Kabagambe, Benjamin; Boyd, Donald W.; Buchanan, Michael J.; Kelly, Patrick; Kutilek, Luke A.; McCamy, James W.; McPheron, Douglas A.; Orosz, Gary R.; Limbacher, Raymond D.

2013-10-15

An electrically conductive protective coating or film is provided over the surface of a reflective coating of a solar mirror by flowing or directing a cation containing liquid and an anion containing liquid onto the conductive surface. The cation and the anion containing liquids are spaced from, and preferably out of contact with one another on the surface of the reflective coating as an electric current is moved through the anion containing liquid, the conductive surface between the liquids and the cation containing liquid to coat the conductive surface with the electrically conductive coating.

Evaluación de barreras vegetales en el manejo integrado de la mancha anular del papayo (PRSV-P en Michoacán, México Evaluation of plant barriers in an integrated management of papayo ringspot in Michoacan, Mexico

Directory of Open Access Journals (Sweden)

Patricia Rivas-Valencia

2008-12-01

Full Text Available El efecto de barreras vegetales como componente de un programa de manejo integrado (MI, se validó y adaptó en 1999 en Michoacán, México, para controlar la Mancha Anular del Papayo, enfermedad causada por el Papaya ringspot potyvirus type-P (PRSV-P. Se estableció un experimento en parcelas divididas con dos factores experimentales: barreras vegetales (Hibiscus sabdariffa, y componentes de MI: MI sin aspersión de citrolina (1.5% (MI-A, MI sin eliminación de plantas con síntomas iniciales de virosis antes de floración (MI-D y MI. Las barreras vegetales sembradas 20 días antes del trasplante del papayo y el desplante retrasaron en 19 días el inicio del progreso de epidemias en el MI lo que resultó en una mayor producción (14.2% que el resto de tratamientos, aunque fue superado por MI-A en vigor (4% en diámetro de tallo. La citrolina fue fitotóxica, disminuyó el vigor de plantas (5.3% y no limitó significativamente el desarrollo de la enfermedad ya que la intensidad de las epidemias (X0 = 47días, Yf = 84% y ABCPE = 3220% días fue similar al testigo. El uso de barreras vegetales por si sola aparentemente no es suficiente para la reducción de la incidencia y dispersión de la enfermedad. Los áfidos más abundantes, con reconocida capacidad transmisora del PRSV-P, fueron Aphis gossypii, A. nerii, A. spiraecola y Macrosiphum euphorbiae, los cuales representaron aproximadamente el 13% del total de áfidos capturados.The effect of plant barriers as a component of an integrated management program (IM was validated and adapted in 1999, in Michoacan, Mexico, to control papaya ringspot, caused by papaya ringspot potyvirus type-P (PRSV-P. A split-plot design was established with two experimental factors: plant barriers and components of IM: IM without oil sprinkling (IM-O, IM without plant rouging (IM-R, and complete IM. Plant barriers (Hibiscus sabdariffa, sowed 20 days before papaya transplanting, and plant rouging delayed the epidemics

An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

International Nuclear Information System (INIS)

Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

2007-01-01

Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

Analysis of the solvent accessibility of cysteine residues on Maize rayado fino virus virus-like particles produced in Nicotiana benthamiana plants and cross-linking of peptides to VLPs.

Science.gov (United States)

Natilla, Angela; Hammond, Rosemarie W

2013-02-14

Mimicking and exploiting virus properties and physicochemical and physical characteristics holds promise to provide solutions to some of the world's most pressing challenges. The sheer range and types of viruses coupled with their intriguing properties potentially give endless opportunities for applications in virus-based technologies. Viruses have the ability to self- assemble into particles with discrete shape and size, specificity of symmetry, polyvalence, and stable properties under a wide range of temperature and pH conditions. Not surprisingly, with such a remarkable range of properties, viruses are proposed for use in biomaterials, vaccines, electronic materials, chemical tools, and molecular electronic containers. In order to utilize viruses in nanotechnology, they must be modified from their natural forms to impart new functions. This challenging process can be performed through several mechanisms including genetic modification of the viral genome and chemically attaching foreign or desired molecules to the virus particle reactive groups. The ability to modify a virus primarily depends upon the physiochemical and physical properties of the virus. In addition, the genetic or physiochemical modifications need to be performed without adversely affecting the virus native structure and virus function. Maize rayado fino virus (MRFV) coat proteins self-assemble in Escherichia coli producing stable and empty VLPs that are stabilized by protein-protein interactions and that can be used in virus-based technologies applications. VLPs produced in tobacco plants were examined as a scaffold on which a variety of peptides can be covalently displayed. Here, we describe the steps to 1) determine which of the solvent-accessible cysteines in a virus capsid are available for modification, and 2) bioconjugate peptides to the modified capsids. By using native or mutationally-inserted amino acid residues and standard coupling technologies, a wide variety of materials have been

Production of Polyclonal Antibodies to Potato virus X Using Recombinant Coat Protein

Czech Academy of Sciences Publication Activity Database

Čeřovská, Noemi; Moravec, Tomáš; Plchová, Helena; Hoffmeisterová, Hana; Kmoníčková, Jitka; Dědič, P.

2010-01-01

Roč. 158, č. 1 (2010), s. 66-68 ISSN 0931-1785 R&D Projects: GA MŠk 1M06030 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato virus X * recombinant viral antigen * antibodies Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.937, year: 2010

Active coatings technologies for tailorable military coating systems

Science.gov (United States)

Zunino, J. L., III

2007-04-01

The main objective of the U.S. Army's Active Coatings Technologies Program is to develop technologies that can be used in combination to tailor coatings for utilization on Army Materiel. The Active Coatings Technologies Program, ACT, is divided into several thrusts, including the Smart Coatings Materiel Program, Munitions Coatings Technologies, Active Sensor packages, Systems Health Monitoring, Novel Technology Development, as well as other advanced technologies. The goal of the ACT Program is to conduct research leading to the development of multiple coatings systems for use on various military platforms, incorporating unique properties such as self repair, selective removal, corrosion resistance, sensing, ability to modify coatings' physical properties, colorizing, and alerting logistics staff when tanks or weaponry require more extensive repair. A partnership between the U.S. Army Corrosion Office at Picatinny Arsenal, NJ along with researchers at the New Jersey Institute of Technology, NJ, Clemson University, SC, University of New Hampshire, NH, and University of Massachusetts (Lowell), MA, are developing the next generation of Smart Coatings Materiel via novel technologies such as nanotechnology, Micro-electromechanical Systems (MEMS), meta-materials, flexible electronics, electrochromics, electroluminescence, etc. This paper will provide the reader with an overview of the Active Coatings Technologies Program, including an update of the on-going Smart Coatings Materiel Program, its progress thus far, description of the prototype Smart Coatings Systems and research tasks as well as future nanotechnology concepts, and applications for the Department of Defense.

RNA virus interference via CRISPR/Cas13a system in plants

KAUST Repository

Aman, Rashid

2018-01-04

CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

Flow coating apparatus and method of coating

Science.gov (United States)

Hanumanthu, Ramasubrahmaniam; Neyman, Patrick; MacDonald, Niles; Brophy, Brenor; Kopczynski, Kevin; Nair, Wood

2014-03-11

Disclosed is a flow coating apparatus, comprising a slot that can dispense a coating material in an approximately uniform manner along a distribution blade that increases uniformity by means of surface tension and transfers the uniform flow of coating material onto an inclined substrate such as for example glass, solar panels, windows or part of an electronic display. Also disclosed is a method of flow coating a substrate using the apparatus such that the substrate is positioned correctly relative to the distribution blade, a pre-wetting step is completed where both the blade and substrate are completed wetted with a pre-wet solution prior to dispensing of the coating material onto the distribution blade from the slot and hence onto the substrate. Thereafter the substrate is removed from the distribution blade and allowed to dry, thereby forming a coating.

E-selectin is a viable route of infection for polymer-coated adenovirus retargeting in TNF-.alpha.-activated human umbilical vein endothelial cells

Czech Academy of Sciences Publication Activity Database

Bachtarzi, H.; Stevenson, M.; Šubr, Vladimír; Seymour, L. W.; Fisher, K. D.

2011-01-01

Roč. 19, č. 8 (2011), s. 690-700 ISSN 1061-186X Institutional research plan: CEZ:AV0Z40500505 Keywords : polymer-coated virus * vascular targeting * inflammation Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.696, year: 2011

Promising MS2 mediated virus-like particle vaccine against foot-and-mouth disease.

Science.gov (United States)

Dong, Yan-mei; Zhang, Guo-guang; Huang, Xiao-jun; Chen, Liang; Chen, Hao-tai

2015-05-01

Foot-and-mouth disease (FMD) has caused severe economic losses to millions of farmers worldwide. In this work, the coding genes of 141-160 epitope peptide (EP141-160) of VP1 were inserted into the coat protein (CP) genes of MS2 in prokaryotic expression vector, and the recombinant protein self-assembled into virus-like particles (VLP). Results showed that the CP-EP141-160 VLP had a strong immunoreaction with the FMD virus (FMDV) antigen in vitro, and also had an effective immune response in mice. Further virus challenge tests were carried out on guinea pigs and swine, high-titer neutralizing antibodies were produced and the CP-EP141-160 VLP vaccine could protect most of the animals against FMDV. Copyright © 2015. Published by Elsevier B.V.

Sequence similarity between the viral cp gene and the transgene in transgenic papayas Similaridade de seqüência entre o gene cp do vírus e do transgene presente em mamoeiros transgênicos

Directory of Open Access Journals (Sweden)

Manoel Teixeira Souza Júnior

2005-05-01

Full Text Available The Papaya ringspot virus (PRSV coat protein transgene present in 'Rainbow' and 'SunUp' papayas disclose high sequence similarity (>89% to the cp gene from PRSV BR and TH. Despite this, both isolates are able to break down the resistance in 'Rainbow', while only the latter is able to do so in 'SunUp'. The objective of this work was to evaluate the degree of sequence similarity between the cp gene in the challenge isolate and the cp transgene in transgenic papayas resistant to PRSV. The production of a hybrid virus containing the genome backbone of PRSV HA up to the Apa I site in the NIb gene, and downstream from there, the sequence of PRSV TH was undertaken. This hybrid virus, PRSV HA/TH, was obtained and used to challenge 'Rainbow', 'SunUp', and an R2 population derived from line 63-1, all resistant to PRSV HA. PRSV HA/TH broke down the resistance in both papaya varieties and in the 63-1 population, demonstrating that sequence similarity is a major factor in the mechanism of resistance used by transgenic papayas expressing the cp gene. A comparative analysis of the cp gene present in line 55-1 and 63-1-derived transgenic plants and in PRSV HA, BR, and TH was also performed.O gene da capa protéica (cp do vírus da mancha anelar do mamoeiro (Papaya ringspot virus, PRSV, presente nos mamoeiros 'Rainbow' e 'SunUp', tem alta similaridade de seqüência (>89% com o gene cp dos isolados PRSV BR e TH. Apesar deste alto grau de similaridade, ambos isolados são capazes de quebrar a resistência observada em 'Rainbow', ao passo que TH quebra a resistência em 'SunUp'. O objetivo deste trabalho foi avaliar o grau de similaridade de seqüência entre o gene cp do vírus desafiante e do transgene em mamoeiros transgênicos resistentes a PRSV. Produziu-se um vírus híbrido contendo o genoma do isolado PRSV HA até o sítio de restrição Apa I no gene NIb, e, a partir deste ponto, este vírus continha o genoma do isolado PRSV TH. PRSV HA/TH foi utilizado

The Impact of "Coat Protein-Mediated Virus Resistance" in Applied Plant Pathology and Basic Research.

Science.gov (United States)

Lindbo, John A; Falk, Bryce W

2017-06-01

Worldwide, plant viruses cause serious reductions in marketable crop yield and in some cases even plant death. In most cases, the most effective way to control virus diseases is through genetically controlled resistance. However, developing virus-resistant (VR) crops through traditional breeding can take many years, and in some cases is not even possible. Because of this, the demonstration of the first VR transgenic plants in 1985 generated much attention. This seminal report served as an inflection point for research in both basic and applied plant pathology, the results of which have dramatically changed both basic research and in a few cases, commercial crop production. The typical review article on this topic has focused on only basic or only applied research results stemming from this seminal discovery. This can make it difficult for the reader to appreciate the full impact of research on transgenic virus resistance, and the contributions from fundamental research that led to translational applications of this technology. In this review, we take a global view of this topic highlighting the significant changes to both basic and applied plant pathology research and commercial food production that have accumulated in the last 30 plus years. We present these milestones in the historical context of some of the scientific, economic, and environmental drivers for developing specific VR crops. The intent of this review is to provide a single document that adequately records the significant accomplishments of researchers in both basic and applied plant pathology research on this topic and how they relate to each other. We hope this review therefore serves as both an instructional tool for students new to the topic, as well as a source of conversation and discussion for how the technology of engineered virus resistance could be applied in the future.

HCMV spread and cell tropism are determined by distinct virus populations.

Directory of Open Access Journals (Sweden)

Laura Scrivano

Full Text Available Human cytomegalovirus (HCMV can infect many different cell types in vivo. Two gH/gL complexes are used for entry into cells. gH/gL/pUL(128,130,131A shows no selectivity for its host cell, whereas formation of a gH/gL/gO complex only restricts the tropism mainly to fibroblasts. Here, we describe that depending on the cell type in which virus replication takes place, virus carrying the gH/gL/pUL(128,130,131A complex is either released or retained cell-associated. We observed that virus spread in fibroblast cultures was predominantly supernatant-driven, whereas spread in endothelial cell (EC cultures was predominantly focal. This was due to properties of virus released from fibroblasts and EC. Fibroblasts released virus which could infect both fibroblasts and EC. In contrast, EC released virus which readily infected fibroblasts, but was barely able to infect EC. The EC infection capacities of virus released from fibroblasts or EC correlated with respectively high or low amounts of gH/gL/pUL(128,130,131A in virus particles. Moreover, we found that focal spread in EC cultures could be attributed to EC-tropic virus tightly associated with EC and not released into the supernatant. Preincubation of fibroblast-derived virus progeny with EC or beads coated with pUL131A-specific antibodies depleted the fraction that could infect EC, and left a fraction that could predominantly infect fibroblasts. These data strongly suggest that HCMV progeny is composed of distinct virus populations. EC specifically retain the EC-tropic population, whereas fibroblasts release EC-tropic and non EC-tropic virus. Our findings offer completely new views on how HCMV spread may be controlled by its host cells.

Enumeration and biomass estimation of planktonic bacteria and viruses by transmission electron microscopy

International Nuclear Information System (INIS)

Borsheim, K.Y.; Bratbak, G.; Heldal, M.

1990-01-01

Bacteria and virus particles were harvested from water samples by ultracentrifugation directly onto Formvar-coated electron microscopy grids and counted in a transmission electron microscope. With this technique, we have counted and sized bacteria and viruses in marine water samples and during laboratory incubations. By X-ray microanalysis, we could determine the elemental composition and dry-matter content of individual bacteria. The dry weight/volume ratio for the bacteria was 600 fg of dry weight microns-3. The potassium content of the bacteria was normal compared with previous estimates from other bacterial assemblages; thus, this harvesting procedure did not disrupt the bacterial cells. Virus particles were, by an order of magnitude, more abundant than bacteria in marine coastal waters. During the first 5 to 7 days of incubation, the total number of viruses increased exponentially at a rate of 0.4 day-1 and thereafter declined. The high proliferation rate suggests that viral parasitism may affect mortality of bacteria in aquatic environments

A stable RNA virus-based vector for citrus trees

International Nuclear Information System (INIS)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe; Dawson, William O.

2007-01-01

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter. These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees

Analysis of potato virus Y coat protein epitopes recognized by three commercial monoclonal antibodies.

Science.gov (United States)

Tian, Yan-Ping; Hepojoki, Jussi; Ranki, Harri; Lankinen, Hilkka; Valkonen, Jari P T

2014-01-01

Potato virus Y (PVY, genus Potyvirus) causes substantial economic losses in solanaceous plants. Routine screening for PVY is an essential part of seed potato certification, and serological assays are often used. The commercial, commonly used monoclonal antibodies, MAb1128, MAb1129, and MAb1130, recognize the viral coat protein (CP) of PVY and distinguish PVYN strains from PVYO and PVYC strains, or detect all PVY strains, respectively. However, the minimal epitopes recognized by these antibodies have not been identified. SPOT peptide array was used to map the epitopes in CP recognized by MAb1128, MAb1129, and MAb1130. Then alanine replacement as well as N- and C-terminal deletion analysis of the identified peptide epitopes was done to determine critical amino acids for antibody recognition and the respective minimal epitopes. The epitopes of all antibodies were located within the 30 N-terminal-most residues. The minimal epitope of MAb1128 was 25NLNKEK30. Replacement of 25N or 27N with alanine weakened the recognition by MAb1128, and replacement of 26L, 29E, or 30K nearly precluded recognition. The minimal epitope for MAb1129 was 16RPEQGSIQSNP26 and the most critical residues for recognition were 22I and 23Q. The epitope of MAb1130 was defined by residues 5IDAGGS10. Mutation of residue 6D abrogated and mutation of 9G strongly reduced recognition of the peptide by MAb1130. Amino acid sequence alignment demonstrated that these epitopes are relatively conserved among PVY strains. Finally, recombinant CPs were produced to demonstrate that mutations in the variable positions of the epitope regions can affect detection with the MAbs. The epitope data acquired can be compared with data on PVY CP-encoding sequences produced by laboratories worldwide and utilized to monitor how widely the new variants of PVY can be detected with current seed potato certification schemes or during the inspection of imported seed potatoes as conducted with these MAbs.

Lotus Dust Mitigation Coating and Molecular Adsorber Coating

Science.gov (United States)

O'Connor, Kenneth M.; Abraham, Nithin S.

2015-01-01

NASA Goddard Space Flight Center has developed two unique coating formulations that will keep surfaces clean and sanitary and contain contaminants.The Lotus Dust Mitigation Coating, modeled after the self-cleaning, water-repellant lotus leaf, disallows buildup of dust, dirt, water, and more on surfaces. This coating, has been successfully tested on painted, aluminum, glass, silica, and some composite surfaces, could aid in keeping medical assets clean.The Molecular Adsorber Coating is a zeolite-based, sprayable molecular adsorber coating, designed to prevent outgassing in materials in vacuums. The coating works well to adsorb volatiles and contaminates in manufacturing and processing, such as in pharmaceutical production. The addition of a biocide would also aid in controlling bacteria levels.

Combustion chemical vapor desposited coatings for thermal barrier coating systems

Energy Technology Data Exchange (ETDEWEB)

Hampikian, J.M.; Carter, W.B. [Georgia Institute of Technology, Atlanta, GA (United States)

1995-10-01

The new deposition process, combustion chemical vapor deposition, shows a great deal of promise in the area of thermal barrier coating systems. This technique produces dense, adherent coatings, and does not require a reaction chamber. Coatings can therefore be applied in the open atmosphere. The process is potentially suitable for producing high quality CVD coatings for use as interlayers between the bond coat and thermal barrier coating, and/or as overlayers, on top of thermal barrier coatings.

A versatile SERS-based immunoassay for immunoglobulin detection using antigen-coated gold nanoparticles and malachite green-conjugated protein A/G

Science.gov (United States)

A surface enhanced Raman scattering (SERS) immunoassay for antibody detection in serum is described in the present work. The developed assay is conducted in solution and utilizes Au nanoparticles coated with the envelope (E) protein of West Nile Virus (WNV) as the SERS-active substrate and malachite...

Potato leafroll virus structural proteins manipulate overlapping, yet distinct protein interaction networks during infection.

Science.gov (United States)

DeBlasio, Stacy L; Johnson, Richard; Sweeney, Michelle M; Karasev, Alexander; Gray, Stewart M; MacCoss, Michael J; Cilia, Michelle

2015-06-01

Potato leafroll virus (PLRV) produces a readthrough protein (RTP) via translational readthrough of the coat protein amber stop codon. The RTP functions as a structural component of the virion and as a nonincorporated protein in concert with numerous insect and plant proteins to regulate virus movement/transmission and tissue tropism. Affinity purification coupled to quantitative MS was used to generate protein interaction networks for a PLRV mutant that is unable to produce the read through domain (RTD) and compared to the known wild-type PLRV protein interaction network. By quantifying differences in the protein interaction networks, we identified four distinct classes of PLRV-plant interactions: those plant and nonstructural viral proteins interacting with assembled coat protein (category I); plant proteins in complex with both coat protein and RTD (category II); plant proteins in complex with the RTD (category III); and plant proteins that had higher affinity for virions lacking the RTD (category IV). Proteins identified as interacting with the RTD are potential candidates for regulating viral processes that are mediated by the RTP such as phloem retention and systemic movement and can potentially be useful targets for the development of strategies to prevent infection and/or viral transmission of Luteoviridae species that infect important crop species. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tablet coating by injection molding technology - Optimization of coating formulation attributes and coating process parameters.

Science.gov (United States)

Desai, Parind M; Puri, Vibha; Brancazio, David; Halkude, Bhakti S; Hartman, Jeremy E; Wahane, Aniket V; Martinez, Alexander R; Jensen, Keith D; Harinath, Eranda; Braatz, Richard D; Chun, Jung-Hoon; Trout, Bernhardt L

2018-01-01

We developed and evaluated a solvent-free injection molding (IM) coating technology that could be suitable for continuous manufacturing via incorporation with IM tableting. Coating formulations (coating polymers and plasticizers) were prepared using hot-melt extrusion and screened via stress-strain analysis employing a universal testing machine. Selected coating formulations were studied for their melt flow characteristics. Tablets were coated using a vertical injection molding unit. Process parameters like softening temperature, injection pressure, and cooling temperature played a very important role in IM coating processing. IM coating employing polyethylene oxide (PEO) based formulations required sufficient room humidity (>30% RH) to avoid immediate cracks, whereas other formulations were insensitive to the room humidity. Tested formulations based on Eudrajit E PO and Kollicoat IR had unsuitable mechanical properties. Three coating formulations based on hydroxypropyl pea starch, PEO 1,000,000 and Opadry had favorable mechanical (35% elongation, >95×10 4 J/m 3 toughness) and melt flow (>0.4g/min) characteristics, that rendered acceptable IM coats. These three formulations increased the dissolution time by 10, 15 and 35min, respectively (75% drug release), compared to the uncoated tablets (15min). Coated tablets stored in several environmental conditions remained stable to cracking for the evaluated 8-week time period. Copyright © 2017 Elsevier B.V. All rights reserved.

IDENTIFICATION AND CHARACTERIZATION OF CARMOVIRUS ON CARNATION (Dianthus caryophyllus L. IN WEST JAVA, INDONESIA

Directory of Open Access Journals (Sweden)

Erniawati Diningsih

2015-06-01

Full Text Available Carnation has a highly economic demand of cut flower in Indonesia. Field observations in West Java Indonesia was conducted in order to find the typical mottle symptoms that was a suspect caused by a virus disease. Identification of the virus was respectively conducted by performing ELISA test with four anti sera and characterizations held by bioassay, observing of virion particles, detecting of nucleic acid by RT-PCR and nucleotide sequencing. Total of 403 samples were collected from plants with or no virus-like symptoms. Among those all tested, 83% were found to be infected by Carnation mottle virus (CarMV, but negatively against Carnation ringspot virus (CRSV, Carnation laten virus (CLV, and Carnation vein mottle virus (CVMV antisera. By mechanical inoculation, the virus was able to infect systemically Cenopodium quinoa and locally infect on others. However on Phalaenopsis sp and Gomprena globosa, there was symptompless found. The isometric CarMV particles size was approximately 30 nm. RT-PCR using specific primers of CP gene of CarMV successfully amplified a DNA sized 1000 bp. CarMV West Java Indonesian (Idn-WJ isolates possessed the highest nucleotide and amino acid homology with CarMV from Spain and was in the same cluster with CarMV from China, Taiwan and Israel.

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Directory of Open Access Journals (Sweden)

Z. Gholampour

2016-02-01

phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990. The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT and DetR (GGTCCAGTTTAATTGCCATCCA specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen, then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5 Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously

Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato

KAUST Repository

Mahfouz, Magdy M.

2017-12-22

CRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

Radioactive probes as diagnostic tools for rice tungro viruses

International Nuclear Information System (INIS)

Azzam, O.; Arboleda, M.; Reyes. J. de los

1996-01-01

Rice tungro bacilliform (RTBV) and rice tungro spherical viruses (RTSV) are the two viral components responsible for rice tungro disease which has seriously affected the irrigated rice ecosystem in Southeast Asia for the last 30 years. RTBV has an 8 Kb double-stranded DNA circular genome, and it is primarily responsible for induction of symptoms in infected plants. RTSV has a 12 kb single-stranded RNA genome. It does not induce any apparent symptoms in the infected plant, and it is transmitted by greenleafhopper. RTBV depends upon RTSV for its own transmission. The two viruses are limited to the vascular tissue of the rice plant and are present at a low titer. Most of the detection methods used for the identification of these viruses have relied on the virus protein properties and therefore, early detection of the virus activity was not possible. We were interested in evaluating tissue printing, dot blot, and southern techniques for early detection of virus nucleic acids in rice plant using radioactive and non radioactive probes. 32 P-labeled T7 or SP6 RNA polymerase transcripts complementary to the RTBV genome and RTSV coat protein genes were used as probes of the positive stand of both viruses. For nonradioactive probes, RTBV DNA genome was labeled using the ECL detection kit (Amersham). Preliminary results show that viral nucleic acids of RTBV and RTSV could be detected using both labelling systems. Non radioactive probes were comparable in their sensitivity to the radioactive probes. Less than 100 pg of viral DNA was detected in the dot-blot assays. More data will be presented to compare the efficiency and reliability of these two techniques in detecting early virus activity in the rice plant. (author)

Barley yellow dwarf virus: Luteoviridae or Tombusviridae?

Science.gov (United States)

Miller, W Allen; Liu, Sijun; Beckett, Randy

2002-07-01

Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.

Synthetic scaffold coating with adeno-associated virus encoding BMP2 to promote endogenous bone repair.

Science.gov (United States)

Dupont, Kenneth M; Boerckel, Joel D; Stevens, Hazel Y; Diab, Tamim; Kolambkar, Yash M; Takahata, Masahiko; Schwarz, Edward M; Guldberg, Robert E

2012-03-01

Biomaterial scaffolds functionalized to stimulate endogenous repair mechanisms via the incorporation of osteogenic cues offer a potential alternative to bone grafting for the treatment of large bone defects. We first quantified the ability of a self-complementary adeno-associated viral vector encoding bone morphogenetic protein 2 (scAAV2.5-BMP2) to enhance human stem cell osteogenic differentiation in vitro. In two-dimensional culture, scAAV2.5-BMP2-transduced human mesenchymal stem cells (hMSCs) displayed significant increases in BMP2 production and alkaline phosphatase activity compared with controls. hMSCs and human amniotic-fluid-derived stem cells (hAFS cells) seeded on scAAV2.5-BMP2-coated three-dimensional porous polymer Poly(ε-caprolactone) (PCL) scaffolds also displayed significant increases in BMP2 production compared with controls during 12 weeks of culture, although only hMSC-seeded scaffolds displayed significantly increased mineral formation. PCL scaffolds coated with scAAV2.5-BMP2 were implanted into critically sized immunocompromised rat femoral defects, both with or without pre-seeding of hMSCs, representing ex vivo and in vivo gene therapy treatments, respectively. After 12 weeks, defects treated with acellular scAAV2.5-BMP2-coated scaffolds displayed increased bony bridging and had significantly higher bone ingrowth and mechanical properties compared with controls, whereas defects treated with scAAV2.5-BMP2 scaffolds pre-seeded with hMSCs failed to display significant differences relative to controls. When pooled, defect treatment with scAAV2.5-BMP2-coated scaffolds, both with or without inclusion of pre-seeded hMSCs, led to significant increases in defect mineral formation at all time points and increased mechanical properties compared with controls. This study thus presents a novel acellular bone-graft-free endogenous repair therapy for orthotopic tissue-engineered bone regeneration.

Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV Evidence of different phylogenetic origins of two mexican Sugarcane mosaic virus (SCMV isolates

Directory of Open Access Journals (Sweden)

Giovanni Chaves-Bedoya

2012-01-01

Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein

Advances in alfalfa mosaic virus-mediated expression of anthrax antigen in planta

International Nuclear Information System (INIS)

Brodzik, R.; Bandurska, K.; Deka, D.; Golovkin, M.; Koprowski, H.

2005-01-01

Plant viruses show great potential for production of pharmaceuticals in plants. Such viruses can harbor a small antigenic peptide(s) as a part of their coat proteins (CP) and elicit an antigen-specific immune response. Here, we report the high yield and consistency in production of recombinant alfalfa mosaic virus (AlMV) particles for specific presentation of the small loop 15 amino acid epitope from domain-4 of the Bacillus anthracis protective antigen (PA-D4s). The epitope was inserted immediately after the first 25 N-terminal amino acids of AlMV CP to retain genome activation and binding of CP to viral RNAs. Recombinant AlMV particles were efficiently produced in tobacco, easily purified for immunological analysis, and exhibited extended stability and systemic proliferation in planta. Intraperitional injections of mice with recombinant plant virus particles harboring the PA-D4s epitope elicited a distinct immune response. Western blotting and ELISA analysis showed that sera from immunized mice recognized both native PA antigen and the AlMV CP

Molecular characterization of a novel cryptic virus infecting pigeonpea plants.

Directory of Open Access Journals (Sweden)

Surender Kumar

Full Text Available A new member of the genus Deltapartitivirus was identified containing three dsRNAs with an estimated size of 1.71, 1.49 and 1.43 kb. The dsRNAs were extracted from symptomless pigeonpea [Cajanus cajan (L. Millspaugh] plants cv. Erra Kandulu. This new virus with 4.64 kb genome was tentatively named Arhar cryptic virus-1 (ArCV-1. The genomic RNAs were amplified and characterized by sequence independent single primer amplification. The dsRNAs shared a highly conserved 16 nt 5' non-coding region (5'-GATAATGATCCAAGGA-3'. The largest dsRNA (dsRNA-1 was identified as the viral RNA dependent RNA polymerase (replicase, predicted to encode a putative 55.34 kDa protein (P1. The two other smaller dsRNAs (dsRNA-2 and dsRNA-3 predicted to encode for putative capsid proteins of 38.50kDa (P2 and 38.51kDa (P3, respectively. Phylogenetic analysis indicated that ArCV-1 formed a clade together with Fragaria chiloensis cryptic virus, Rosa multiflora cryptic virus and Rose cryptic virus-1, indicating that ArCV-1 could be a new member of the genus Deltapartitivirus. ArCV-1 3Dpol structure revealed several interesting features. The 3Dpol in its full-length shares structural similarities with members of the family Caliciviridaeand family Picornaviridae. In addition, fourth dsRNA molecule (dsRNA-2A, not related to ArCV-1 genome, was found in the same plant tissue. The dsRNA-2A (1.6 kb encodes a protein (P4, with a predicted size of 44.5 kDa. P4 shares similarity with coat protein genes of several cryptic viruses, in particular the bipartite cryptic viruses including Raphanus sativus cryptic virus-3. This is the first report of occurrence of a cryptic virus in pigeonpea plants.

Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.

Science.gov (United States)

Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P

2011-11-01

The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.

Combining ability of summer-squash lines with different degrees of parthenocarpy and PRSV-W resistance

OpenAIRE

Nogueira, Douglas Willian; Maluf, Wilson Roberto; Figueira, Antonia dos Reis; Maciel, Gabriel Mascarenhas; Gomes, Luiz Antonio Augusto; Benavente, Cesar Augusto Ticona

2011-01-01

The aim was to assess heterosis in a set of 16 summer-squash hybrids, and evaluate the combining capacity of the respective parental lines, which differed as to the degree of parthenocarpy and resistance to PRSV-W (Papaya Ringspot Virus-Watermelon strain). The hybrids were obtained using a partial diallel cross design (4 ? 4). The lines of parental group I were 1 = ABX-037G-77-03-05-01-01-bulk, 2 = ABX-037G-77-03-05-03-10-bulk, 3 = ABX-037G-77-03-05-01-04-bulk and 4 = ABX-037G-77-03-05-05-01-...

Occurrence of Squash yellow mild mottle virus and Pepper golden mosaic virus in Potential New Hosts in Costa Rica.

Science.gov (United States)

Castro, Ruth M; Moreira, Lisela; Rojas, María R; Gilbertson, Robert L; Hernández, Eduardo; Mora, Floribeth; Ramírez, Pilar

2013-09-01

Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1) was obtained from a chayote (S. edule) leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV) and Pepper golden mosaic virus (PepGMV) were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV) infecting chayote in the Western Hemisphere.

Occurrence of Squash yellow mild mottle virus and Pepper golden mosaic virus in Potential New Hosts in Costa Rica

Directory of Open Access Journals (Sweden)

Ruth M. Castro

2013-09-01

Full Text Available Leaf samples of Solanum lycopersicum, Capsicum annuum, Cucurbita moschata, Cucurbita pepo, Sechium edule and Erythrina spp. were collected. All samples were positive for begomoviruses using polymerase chain reaction and degenerate primers. A sequence of ∼1,100 bp was obtained from the genomic component DNA-A of 14 samples. In addition, one sequence of ∼580 bp corresponding to the coat protein (AV1 was obtained from a chayote (S. edule leaf sample. The presence of Squash yellow mild mottle virus (SYMMoV and Pepper golden mosaic virus (PepGMV were confirmed. The host range reported for SYMMoV includes species of the Cucurbitaceae, Caricaceae and Fabaceae families. This report extends the host range of SYMMoV to include the Solanaceae family, and extends the host range of PepGMV to include C. moschata, C. pepo and the Fabaceae Erythrina spp. This is the first report of a begomovirus (PepGMV infecting chayote in the Western Hemisphere.

Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

Science.gov (United States)

Abraham, A D; Menzel, W; Lesemann, D-E; Varrelmann, M; Vetten, H J

2006-05-01

ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

Biological and molecular characterization of Brazilian isolates of Zucchini yellow mosaic virus

Directory of Open Access Journals (Sweden)

David Marques de Almeida Spadotti

2015-02-01

Full Text Available Zucchini yellow mosaic virus (ZYMV causes substantial economic losses in cucurbit crops. Although ZYMV has been present in Brazil for more than 20 years, there is little information about the biological and molecular characteristics of the isolates found in the country. This study aimed to characterize the experimental hosts, pathotypes and genetic diversity of a collection of eleven Brazilian ZYMV isolates within the coat protein gene. For biological analysis, plant species from Amaranthaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae, Solanaceae, and Pedaliaceae were mechanically inoculated and pathotypes were identified based on the reaction of a resistant Cucumis melo, accession PI414723. All of the cucurbit species/varieties and Sesamum indicum were systemically infected with all isolates. The nucleotide sequence variability of the coat protein gene ranged from 82 % to 99 % compared to the corresponding sequences of ZYMV isolates from different geographical locations. No recombination event was detected in the coat protein gene of the isolates.

Pixelated coatings and advanced IR coatings

Science.gov (United States)

Pradal, Fabien; Portier, Benjamin; Oussalah, Meihdi; Leplan, Hervé

2017-09-01

Reosc developed pixelated infrared coatings on detector. Reosc manufactured thick pixelated multilayer stacks on IR-focal plane arrays for bi-spectral imaging systems, demonstrating high filter performance, low crosstalk, and no deterioration of the device sensitivities. More recently, a 5-pixel filter matrix was designed and fabricated. Recent developments in pixelated coatings, shows that high performance infrared filters can be coated directly on detector for multispectral imaging. Next generation space instrument can benefit from this technology to reduce their weight and consumptions.

A novel single-stranded RNA virus isolated from a phytopathogenic filamentous fungus, Rosellinia necatrix, with similarity to hypo-like viruses

Directory of Open Access Journals (Sweden)

Rui eZhang

2014-07-01

Full Text Available Here we report a biological and molecular characterization of a novel positive-sense RNA virus isolated from a field isolate (NW10 of a filamentous phytopathogenic fungus, the white root rot fungus that is designated as Rosellinia necatrix fusarivirus 1 (RnFV1. A recently developed technology using zinc ions allowed us to transfer RnFV1 to two mycelially incompatible Rosellinia necatrix strains. A biological comparison of the virus-free and -recipient isogenic fungal strains suggested that RnFV1 infects latently and thus has no potential as a virocontrol agent. The virus has an undivided positive-sense RNA genome of 6286 nucleotides excluding a poly (A tail. The genome possesses two non-overlapping open reading frames (ORFs: a large ORF1 that encodes polypeptides with RNA replication functions and a smaller ORF2 that encodes polypeptides of unknown function. A lack of coat protein genes was suggested by the failure of virus particles from infected mycelia. No evidence was obtained by Northern analysis or classical 5'-RACE for the presence of subgenomic RNA for the downstream ORF. Sequence similarities were found in amino-acid sequence between RnFV1 putative proteins and counterparts of a previously reported mycovirus, Fusarium graminearum virus 1 (FgV1. Interestingly, several related sequences were detected by BLAST searches of independent transcriptome assembly databases one of which probably represents an entire virus genome. Phylogenetic analysis based on the conserved RNA-dependent RNA polymerase showed that RnFV1, FgV1, and these similar sequences are grouped in a cluster distinct from distantly related hypoviruses. It is proposed that a new taxonomic family termed Fusariviridae be created to include RnFV1and FgV1.

Induction of RNA-mediated resistance to papaya ringspot virus type W

Czech Academy of Sciences Publication Activity Database

Krubphachaya, P.; Juříček, Miloslav; Kertbundit, Sunee

2007-01-01

Roč. 40, č. 3 (2007), s. 404-411 ISSN 1225-8687 Grant - others:BIOTEC, NSTDA(TH) BT-B-06-PG-14-4503 Institutional research plan: CEZ:AV0Z50380511 Source of funding: V - iné verejné zdroje Keywords : inverted-repeat * in vitro inoculation * PRSV type W Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.141, year: 2007 http://www.jbmb.or.kr/view_article.php3?cont=jbmb&kid=182&mid=13& pid =13

Ebola Virus and Marburg Virus

Science.gov (United States)

Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance.

Science.gov (United States)

Niu, Qi-Wen; Lin, Shih-Shun; Reyes, Jose Luis; Chen, Kuan-Chun; Wu, Hui-Wen; Yeh, Shyi-Dong; Chua, Nam-Hai

2006-11-01

Plant microRNAs (miRNAs) regulate the abundance of target mRNAs by guiding their cleavage at the sequence complementary region. We have modified an Arabidopsis thaliana miR159 precursor to express artificial miRNAs (amiRNAs) targeting viral mRNA sequences encoding two gene silencing suppressors, P69 of turnip yellow mosaic virus (TYMV) and HC-Pro of turnip mosaic virus (TuMV). Production of these amiRNAs requires A. thaliana DICER-like protein 1. Transgenic A. thaliana plants expressing amiR-P69(159) and amiR-HC-Pro(159) are specifically resistant to TYMV and TuMV, respectively. Expression of amiR-TuCP(159) targeting TuMV coat protein sequences also confers specific TuMV resistance. However, transgenic plants that express both amiR-P69(159) and amiR-HC-Pro(159) from a dimeric pre-amiR-P69(159)/amiR-HC-Pro(159) transgene are resistant to both viruses. The virus resistance trait is displayed at the cell level and is hereditable. More important, the resistance trait is maintained at 15 degrees C, a temperature that compromises small interfering RNA-mediated gene silencing. The amiRNA-mediated approach should have broad applicability for engineering multiple virus resistance in crop plants.

The coat protein of Alfalfa mosaic virus interacts and interferes with the transcriptional activity of the bHLH transcription factor ILR3 promoting salicylic acid-dependent defence signalling response.

Science.gov (United States)

Aparicio, Frederic; Pallás, Vicente

2017-02-01

During virus infection, specific viral component-host factor interaction elicits the transcriptional reprogramming of diverse cellular pathways. Alfalfa mosaic virus (AMV) can establish a compatible interaction in tobacco and Arabidopsis hosts. We show that the coat protein (CP) of AMV interacts directly with transcription factor (TF) ILR3 of both species. ILR3 is a basic helix-loop-helix (bHLH) family member of TFs, previously proposed to participate in diverse metabolic pathways. ILR3 has been shown to regulate NEET in Arabidopsis, a critical protein in plant development, senescence, iron metabolism and reactive oxygen species (ROS) homeostasis. We show that the AMV CP-ILR3 interaction causes a fraction of this TF to relocate from the nucleus to the nucleolus. ROS, pathogenesis-related protein 1 (PR1) mRNAs, salicylic acid (SA) and jasmonic acid (JA) contents are increased in healthy Arabidopsis loss-of-function ILR3 mutant (ilr3.2) plants, which implicates ILR3 in the regulation of plant defence responses. In AMV-infected wild-type (wt) plants, NEET expression is reduced slightly, but is induced significantly in ilr3.2 mutant plants. Furthermore, the accumulation of SA and JA is induced in Arabidopsis wt-infected plants. AMV infection in ilr3.2 plants increases JA by over 10-fold, and SA is reduced significantly, indicating an antagonist crosstalk effect. The accumulation levels of viral RNAs are decreased significantly in ilr3.2 mutants, but the virus can still systemically invade the plant. The AMV CP-ILR3 interaction may down-regulate a host factor, NEET, leading to the activation of plant hormone responses to obtain a hormonal equilibrium state, where infection remains at a level that does not affect plant viability. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

Science.gov (United States)

Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

2018-01-15

Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

Evidence from lateral mobility studies for dynamic interactions of a mutant influenza hemagglutinin with coated pits.

Science.gov (United States)

Fire, E; Zwart, D E; Roth, M G; Henis, Y I

1991-12-01

Replacement of cysteine at position 543 by tyrosine in the influenza virus hemagglutinin (HA) protein enables the endocytosis of the mutant protein (Tyr 543) through coated pits (Lazarovits, J., and M. G. Roth. 1988. Cell. 53:743-752). To investigate the interactions between Tyr 543 and the clathrin coats in the plasma membrane of live cells, we performed fluorescence photobleaching recovery measurements comparing the lateral mobilities of Tyr 543 (which enters coated pits) and wild-type HA (HA wt, which is excluded from coated pits), following their expression in CV-1 cells by SV-40 vectors. While both proteins exhibited the same high mobile fractions, the lateral diffusion rate of Tyr 543 was significantly slower than that of HA wt. Incubation of the cells in a sucrose-containing hypertonic medium, a treatment that disperses the membrane-associated coated pits, resulted in similar lateral mobilities for Tyr 543 and HA wt. These findings indicate that the lateral motion of Tyr 543 (but not of HA wt) is inhibited by transient interactions with coated pits (which are essentially immobile on the time scale of the lateral mobility measurements). Acidification of the cytoplasm by prepulsing the cells with NH4Cl (a treatment that arrests the pinching-off of coated vesicles from the plasma membrane and alters the clathrin lattice morphology) led to immobilization of a significant part of the Tyr 543 molecules, presumably due to their entrapment in coated pits for the entire duration of the lateral mobility measurement. Furthermore, in both untreated and cytosol-acidified cells, the restrictions on Tyr 543 mobility were less pronounced in the cold, suggesting that the mobility-restricting interactions are temperature dependent and become weaker at low temperatures. From these studies we conclude the following. (a) Lateral mobility measurements are capable of detecting interactions of transmembrane proteins with coated pits in intact cells. (b) The interactions of Tyr 543

Characterization of rice black-streaked dwarf virus- and rice stripe virus-derived siRNAs in singly and doubly infected insect vector Laodelphax striatellus.

Directory of Open Access Journals (Sweden)

Junmin Li

Full Text Available Replication of RNA viruses in insect cells triggers an antiviral defense that is mediated by RNA interference (RNAi which generates viral-derived small interfering RNAs (siRNAs. However, it is not known whether an antiviral RNAi response is also induced in insects by reoviruses, whose double-stranded RNA genome replication is thought to occur within core particles. Deep sequencing of small RNAs showed that when the small brown planthopper (Laodelphax striatellus was infected by Rice black-streaked dwarf virus (RBSDV (Reoviridae; Fijivirus, more viral-derived siRNAs accumulated than when the vector insect was infected by Rice stripe virus (RSV, a negative single-stranded RNA virus. RBSDV siRNAs were predominantly 21 and 22 nucleotides long and there were almost equal numbers of positive and negative sense. RBSDV siRNAs were frequently generated from hotspots in the 5'- and 3'-terminal regions of viral genome segments but these hotspots were not associated with any predicted RNA secondary structures. Under laboratory condition, L. striatellus can be infected simultaneously with RBSDV and RSV. Double infection enhanced the accumulation of particular genome segments but not viral coat protein of RBSDV and correlated with an increase in the abundance of siRNAs derived from RBSDV. The results of this study suggest that reovirus replication in its insect vector potentially induces an RNAi-mediated antiviral response.

Coated Aerogel Beads

Science.gov (United States)

Littman, Howard (Inventor); Plawsky, Joel L. (Inventor); Paccione, John D. (Inventor)

2014-01-01

Methods and apparatus for coating particulate material are provided. The apparatus includes a vessel having a top and a bottom, a vertically extending conduit having an inlet in the vessel and an outlet outside of the vessel, a first fluid inlet in the bottom of the vessel for introducing a transfer fluid, a second fluid inlet in the bottom of the vessel for introducing a coating fluid, and a fluid outlet from the vessel. The method includes steps of agitating a material, contacting the material with a coating material, and drying the coating material to produce a coated material. The invention may be adapted to coat aerogel beads, among other materials. A coated aerogel bead and an aerogel-based insulation material are also disclosed.

Discovery and small RNA profile of Pecan mosaic-associated virus, a novel potyvirus of pecan trees.

Science.gov (United States)

Su, Xiu; Fu, Shuai; Qian, Yajuan; Zhang, Liqin; Xu, Yi; Zhou, Xueping

2016-05-26

A novel potyvirus was discovered in pecan (Carya illinoensis) showing leaf mosaic symptom through the use of deep sequencing of small RNAs. The complete genome of this virus was determined to comprise of 9,310 nucleotides (nt), and shared 24.0% to 58.9% nucleotide similarities with that of other Potyviridae viruses. The genome was deduced to encode a single open reading frame (polyprotein) on the plus strand. Phylogenetic analysis based on the whole genome sequence and coat protein amino acid sequence showed that this virus is most closely related to Lettuce mosaic virus. Using electron microscopy, the typical Potyvirus filamentous particles were identified in infected pecan leaves with mosaic symptoms. Our results clearly show that this virus is a new member of the genus Potyvirus in the family Potyviridae. The virus is tentatively named Pecan mosaic-associated virus (PMaV). Additionally, profiling of the PMaV-derived small RNA (PMaV-sRNA) showed that the most abundant PMaV-sRNAs were 21-nt in length. There are several hotspots for small RNA production along the PMaV genome; two 21-nt PMaV-sRNAs starting at 811 nt and 610 nt of the minus-strand genome were highly repeated.

Properties of a virus causing mosaic and leaf curl disease of Celosia argentea L. in Nigeria.

Science.gov (United States)

Owolabi, T A; Taiwo, M A; Thottappilly, G A; Shoyinka, S A; Proll, E; Rabenstein, F

1998-06-01

A sap transmissible virus, causing mosaic and leaf curl disease of Celosia argentea, was isolated at vegetable farms in Amuwo Odofin, Tejuoso, and Abule Ado, Lagos, Nigeria. The virus had a restricted host range confined to a few species of the Amaranthaceae, Chenopodiaceae and Solanaceae families. It failed to infect several other species of the Aizoaceae, Brassicaceae, Cucurbitaceae, Fabaceae, Lamiaceae, Malvaceae, Poaceae and Tiliaceae families. The virus was transmitted in a non-persistent manner by Aphis spiraecola and Toxoptera citricidus but not by eight other aphid species tested. There was no evidence of transmission by seeds of C. argentae varieties. The viral coat protein had a relative molecular mass (M(r)) of about 30.2 K. Electron microscopy of purified virus preparations revealed flexuous rod shaped particles of about 750 nm in length. Serological studies were performed using the enzyme-linked immunosorbent assay (ELISA), immunosorbent electron microscopy (ISEM) and Western blot analysis. The virus reacted positively with an universal potyvirus group monoclonal antibody (MoAb) and MoAb P-3-3H8 raised against peanut stripe potyvirus. It also reacted with polyclonal antibodies raised against several potyviruses including asparagus virus-1 (AV-1), turnip mosaic virus (TuMV), maize dwarf mosaic virus (MDMV), watermelon mosaic virus (WMV-2), plum pox virus (PPV), soybean mosaic virus (SoyMV), lettuce mosaic virus (LMV), bean common mosaic virus (BCMV) and beet mosaic virus (BMV) in at least one of the serological assays used. On the basis of host range, mode of transmission, and available literature data, the celosia virus seems to be different from potyviruses previously reported to infect vegetables in Nigeria. The name celosia mosaic virus (CIMV) has been proposed for this virus.

Chayote mosaic virus, a New Tymovirus Infecting Cucurbitaceae.

Science.gov (United States)

Bernal, J J; Jiménez, I; Moreno, M; Hord, M; Rivera, C; Koenig, R; Rodríguez-Cerezo, E

2000-10-01

ABSTRACT Chayote mosaic virus (ChMV) is a putative tymovirus isolated from chayote crops in Costa Rica. ChMV was characterized at the host range, serological, and molecular levels. ChMV was transmitted mechanically and induced disease symptoms mainly in Cucurbitaceae hosts. Asymptomatic infections were detected in other host families. Serologically, ChMV is related to the Andean potato latent virus (APLV) and the Eggplant mosaic virus (EMV), both members of the genus Tymovirus infecting solanaceous hosts in the Caribbean Basin and South America. The sequence of the genomic RNA of ChMV was determined and its genetic organization was typical of tymoviruses. Comparisons with other tymoviral sequences showed that ChMV was a new member of the genus Tymovirus. The phylogenetic analyses of the coat protein gene were consistent with serological comparisons and positioned ChMV within a cluster of tymoviruses infecting mainly cucurbit or solanaceous hosts, including APLV and EMV. Phylogenetic analyses of the replicase protein gene confirmed the close relationship of ChMV and EMV. Our results suggest that ChMV is related to two tymoviruses (APLV and EMV) of proximal geographical provenance but with different natural host ranges. ChMV is the first cucurbit-infecting tymovirus to be fully characterized at the genomic level.

Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

Directory of Open Access Journals (Sweden)

Michael Andrew Meyer

2013-07-01

Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

Effect of coating parameters on the microstructure of cerium oxide conversion coatings

Energy Technology Data Exchange (ETDEWEB)

Johnson, Benedict Y.; Edington, Joe; O' Keefe, Matthew J

2003-11-25

The microstructure and morphology of cerium oxide conversion coatings prepared under different deposition conditions were characterized by transmission electron microscopy (TEM). The coatings were formed by a spontaneous reaction between a water-based solution containing CeCl{sub 3} and aluminum alloy 7075-T6 substrates. Microstructural characterization was performed to determine the crystallinity of the coatings and to obtain a better understanding of the deposition parameters on coating microstructure. The results of TEM imaging and electron diffraction analysis indicated that the as-deposited coating was composed of nanocrystalline particles of a previously unreported cerium compound. The particles of the coatings produced using glycerol as an additive were found to be much finer than those of the coatings prepared in the absence of glycerol. This indicates that glycerol may act as a grain refiner and/or growth inhibitor during coating deposition. After deposition, the coated panels were treated for 5 min in a phosphate sealing solution. The sealing treatment converted the as-deposited coating into hydrated cerium phosphate. Panels coated from solutions containing no glycerol followed by phosphate sealing performed poorly in salt fog tests. With glycerol addition, the corrosion resistance of the coatings that were phosphate sealed improved considerably, achieving an average passing rate of 85%.

Analysis of Capillary Coating Die Flow in an Optical Fiber Coating Applicator

OpenAIRE

Kyoungjin Kim

2011-01-01

Viscous heating becomes significant in the high speed resin coating process of glass fibers for optical fiber manufacturing. This study focuses on the coating resin flows inside the capillary coating die of optical fiber coating applicator and they are numerically simulated to examine the effects of viscous heating and subsequent temperature increase in coating resin. Resin flows are driven by fast moving glass fiber and the pressurization at the coating die inlet, while ...

Methods and means for coating paper by film coating

NARCIS (Netherlands)

van der Maarel, Marc; Ter Veer, Arend Berend Cornelis; Vrieling-Smit, Annet; Delnoye, Pierre

2015-01-01

This invention relates to the field of paper coating, more in particular to means and methods for providing paper with at least one layer of pigment using film coating to obtain a well printable surface. Provided is a method for preparing coated paper comprising the steps of: a) providing a

Cryo-electron tomography investigation of serum albumin-camouflaged tobacco mosaic virus nanoparticles.

Science.gov (United States)

Gulati, Neetu M; Pitek, Andrzej S; Steinmetz, Nicole F; Stewart, Phoebe L

2017-03-09

Nanoparticles offer great potential in drug delivery and imaging, but shielding strategies are necessary to increase circulation time and performance. Structure-function studies are required to define the design rules to achieve effective shielding. With several formulations reaching clinical testing and approval, the ability to assess and detail nanoparticle formulations at the single particle level is becoming increasingly important. To address this need, we use cryo-electron tomography (cryo-ET) to investigate stealth-coated nanoparticles. As a model system, we studied the soft matter nanotubes formed by tobacco mosaic virus (TMV) coated with human serum albumin (SA) stealth proteins. Cryo-ET and subtomogram averaging allow for visualization of individual SA molecules and determination of their orientations relative to the TMV surface, and also for measurement of the surface coverage provided by added stealth proteins. This information fills a critical gap in the understanding of the structural morphology of stealth-coated nanoparticles, and therefore cryo-ET may play an important role in guiding the development of future nanoparticle-based therapeutics.

Vesicular stomatitis virus expressing a chimeric Sindbis glycoprotein containing an Fc antibody binding domain targets to Her2/neu overexpressing breast cancer cells

International Nuclear Information System (INIS)

Bergman, Ira; Whitaker-Dowling, Patricia; Gao Yanhua; Griffin, Judith A.; Watkins, Simon C.

2003-01-01

Vesicular stomatitis virus (VSV) is a candidate for development for cancer therapy. It is an oncolytic virus that is safe in humans. Recombinant virus can be made directly from plasmid components. We attempted to create a virus that targeted specifically to breast cancer cells. Nonreplicating and replicating pseudotype VSV were created whose only surface glycoprotein (gp) was a Sindbis gp, called Sindbis-ZZ, modified to severely reduce its native binding function and to contain the Fc-binding domain of Staphylococcus aureus protein A. When titered on Her2/neu overexpressing SKBR3 human breast cancer cells, pseudotype VSV coated with Sindbis-ZZ had 5 /ml. This work demonstrates the ability to easily create, directly from plasmid components, an oncolytic replicating VSV with a restricted host cell range

Stent Coating Integrity of Durable and Biodegradable Coated Drug Eluting Stents.

Science.gov (United States)

Yazdani, Saami K; Sheehy, Alexander; Pacetti, Stephen; Rittlemeyer, Brandon; Kolodgie, Frank D; Virmani, Renu

2016-10-01

Coatings consisting of a polymer and drug are widely used in drug-eluting stents (DES) and are essential in providing programmable drug release kinetics. Among other factors, stent coating technologies can influence blood compatibility, affect acute and sub-acute healing, and potentially trigger a chronic inflammatory response. The aim of this study was to investigate the short-term (7 and 28 days) and long-term (90 and 180 days) coating integrity of the Xience Prime Everolimus-Eluting Stent (EES), Resolute Zotarolimus-Eluting Stent (ZES), Taxus Paclitaxel-Eluting Stent (PES), and Nobori Biolimus A9-Eluting Stent (BES) in a rabbit ilio-femoral stent model. Stented arteries (n = 48) were harvested and the tissue surrounding the implanted stents digested away with an enzymatic solution. Results demonstrated that the majority of struts of EES were without any coating defects with a few struts showing minor defects. Similarly, for the ZES, most of the struts were without coating defects at all time points except at 180 days. The majority of PES demonstrated mostly webbing and uneven coating. In the BES group, the majority of strut coating showed polymer cracking. Overall, the EES and ZES had fewer coating defects than the PES and BES. Coating defects, however increase over time for the ZES, whereas the percent of coating irregularities remained constant for the EES. These results provide, for the first time, a comparison of the long-term durability of these drug-eluting stent coatings in vivo. © 2016, Wiley Periodicals, Inc.

Development and electrochemical characterization of Ni‐P coated tungsten incorporated electroless nickel coatings

Energy Technology Data Exchange (ETDEWEB)

Shibli, S.M.A., E-mail: smashibli@yahoo.com; Chinchu, K.S.

2016-08-01

Ni‐P-W alloy and composite coatings were prepared by incorporation of sodium tungstate/tungsten and Ni‐P coated tungsten into electroless nickel bath respectively. Good inter-particle interactions among the depositing elements i.e. Ni and P with the incorporating tungsten particles were achieved by means of pre-coated tungsten particle by electroless nickel covering prior to its addition into the electroless bath. The pre-coated tungsten particles got incorporated uniformly into the Ni-P matrix of the coating. The particles and the coatings were characterized at different stages by different techniques including X-ray diffraction (XRD), scanning electron microscopy (SEM) and energy dispersive spectrometry (EDS). The electroless Ni-P coating incorporated with pre-coated tungsten exhibited considerably high hardness, thickness and deposition rate. The performance and corrosion resistance characteristics of the composite coating incorporated with the nickel coated tungsten were found to be superior over other conventional Ni-P-W ternary alloy coatings currently reported. - Highlights: • An amorphous Ni-P coating was effectively formed on tungsten particles. • Electroless ternary Ni-P-W composite coatings were successfully prepared. • Enhancement in the inter-particle interaction in the Ni-P composite matrix was achieved. • Efficient and uniform incorporation of the composite in the internal layer was evident. • The tungsten incorporated coating possessed effective barrier protection.

Inactivation of microbial infectiousness by silver nanoparticles-coated condom: a new approach to inhibit HIV- and HSV-transmitted infection

Directory of Open Access Journals (Sweden)

Mohammed Fayaz A

2012-09-01

Full Text Available A Mohammed Fayaz,1,* Zhujun Ao,1,3,* Morkattu Girilal,2 Liyu Chen,3,4 Xianzhong Xiao,4 PT Kalaichelvan,2 Xiaojian Yao1,31Laboratory of Molecular Human Retrovirology, Department of Medical Microbiology, Faculty of Medicine, University of Manitoba, Winnipeg, MB, Canada; 2CAS in Botany, University of Madras, Guindy Campus, Chennai, Tamil Nadu, India; 3Department of Microbiology, 4School of Basic Medical Sciences, Central South University, Changsha, Hunan, People’s Republic of China*Both authors contributed equally to this workAbstract: Recent research suggests that today’s condoms are only 85% effective in preventing human immunodeficiency virus (HIV and other sexually transmitted diseases. In response, there has been a push to develop more effective ways of decreasing the spread of the disease. The new nanotechnology-based condom holds the promise of being more potent than the first-generation products. The preliminary goal of this study was to develop a silver nanoparticles (Ag-NPs-coated polyurethane condom (PUC and to investigate its antimicrobial potential including the inactivation of HIV and herpes simplex virus (HSV infectiousness. The Ag-NPs-coated PUC was characterized by using ultraviolet-visible spectrophotometry, Fourier transform-infrared spectroscopy, high-resolution scanning electron microscopy, and energy-dispersive analysis of X-ray spectroscopy. Nanoparticles were stable on the PUC and not washed away by water. Morphology of the PUC was retained after coating. The NP binding is due to its interaction with the nitrogen atom of the PUC. No significant toxic effects was observed when human HeLa cells, 293T and C8166 T cells were contacted to Ag-NPs-coated PUC for three hours. Interestingly, our results demonstrated that the contact of the Ag-NPs-coated PUC with HIV-1 and HSV-1/2 was able to efficiently inactivate their infectiousness. In an attempt to elucidate the antiviral action of the Ag-NPs, we have demonstrated that the

Enveloped viruses disable innate immune responses in dendritic cells by direct activation of TAM receptors.

Science.gov (United States)

Bhattacharyya, Suchita; Zagórska, Anna; Lew, Erin D; Shrestha, Bimmi; Rothlin, Carla V; Naughton, John; Diamond, Michael S; Lemke, Greg; Young, John A T

2013-08-14

Upon activation by the ligands Gas6 and Protein S, Tyro3/Axl/Mer (TAM) receptor tyrosine kinases promote phagocytic clearance of apoptotic cells and downregulate immune responses initiated by Toll-like receptors and type I interferons (IFNs). Many enveloped viruses display the phospholipid phosphatidylserine on their membranes, through which they bind Gas6 and Protein S and engage TAM receptors. We find that ligand-coated viruses activate TAM receptors on dendritic cells (DCs), dampen type I IFN signaling, and thereby evade host immunity and promote infection. Upon virus challenge, TAM-deficient DCs display type I IFN responses that are elevated in comparison to wild-type cells. As a consequence, TAM-deficient DCs are relatively resistant to infection by flaviviruses and pseudotyped retroviruses, but infection can be restored with neutralizing type I IFN antibodies. Correspondingly, a TAM kinase inhibitor antagonizes the infection of wild-type DCs. Thus, TAM receptors are engaged by viruses in order to attenuate type I IFN signaling and represent potential therapeutic targets. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of the novel coating formulations for skin vaccination using stainless steel microneedle.

Science.gov (United States)

Kim, Seong-Jin; Shin, Ju-Hyung; Noh, Jin-Yong; Song, Chang-Seon; Kim, Yeu-Chun

2016-10-01

This study focused on the development of novel coating formulations for stainless steel microneedles against influenza A virus. With in vitro studies, various viscosity enhancers and stabilizers were screened based on the hemagglutination activity of the vaccine, which was coated and dried onto a stainless steel chip at room temperature for 1 day. Following the long-term storage test, the hemagglutination activity and particle size of the vaccine, which was formulated with conventional or methylcellulose or hydroxyethyl cellulose and dried onto the microneedle, were monitored. Next, to evaluate the in vivo immunogenicity and protection effect of each dried vaccine formulation, mice were immunized by the antigen-coated microneedle, which had either the conventional or the proposed formulation. Two novel formulations were chosen in the preliminary screening, and in further evaluations, they exhibited a 20 % higher HA activity during storage for 3 months, and no aggregation was observed during storage after drying. In a mouse model, the microneedle with the novel formulation elicited a higher level of IgG and IgG2a was more prevalent in the IgG isotype profile. In addition, mice immunized with the HEC-coated microneedle survived with small weight loss (>90 %) against lethal challenge infection. Overall, the novel formulation hydroxyethyl cellulose preserved significantly higher HA activity during the production and storage of the microneedle as well as improved the in vivo immunogenicity of the vaccine.

Virus-Vectored Influenza Virus Vaccines

Science.gov (United States)

Tripp, Ralph A.; Tompkins, S. Mark

2014-01-01

Despite the availability of an inactivated vaccine that has been licensed for >50 years, the influenza virus continues to cause morbidity and mortality worldwide. Constant evolution of circulating influenza virus strains and the emergence of new strains diminishes the effectiveness of annual vaccines that rely on a match with circulating influenza strains. Thus, there is a continued need for new, efficacious vaccines conferring cross-clade protection to avoid the need for biannual reformulation of seasonal influenza vaccines. Recombinant virus-vectored vaccines are an appealing alternative to classical inactivated vaccines because virus vectors enable native expression of influenza antigens, even from virulent influenza viruses, while expressed in the context of the vector that can improve immunogenicity. In addition, a vectored vaccine often enables delivery of the vaccine to sites of inductive immunity such as the respiratory tract enabling protection from influenza virus infection. Moreover, the ability to readily manipulate virus vectors to produce novel influenza vaccines may provide the quickest path toward a universal vaccine protecting against all influenza viruses. This review will discuss experimental virus-vectored vaccines for use in humans, comparing them to licensed vaccines and the hurdles faced for licensure of these next-generation influenza virus vaccines. PMID:25105278

c-DNA of HIV-1 detection on spot of Buffy-Coat of leukocytes (DBCS)

OpenAIRE

Marco Rossi de Gasperis; Maria Daniela Caione; Carlo Concato; Ersilia Fiscarelli; Nicola Di Pietro; Vittorio Salotti; Lorenza Putignani; Donato Menichella; Francesco Callea

2010-01-01

Introduction:The elective way for the diagnosis of HIV-1-infection in the window period and in children under the age of 16-18 months is to search virus integrated in leukocytes. Aim of the study was to assess the sensitivity and specificity of extraction from Buffy-Dried Coat Spot (DBCS) in leukocyte to detect c-DNA with nested-PCR in HIV-1-infected individuals compared to Dried Blood Spot (DBS) both extracted by automated instrument EZ1 (QIAGEN, Hilden, Germany). Both DBCS and both DBS were...

Crystal structure of the bacteriophage Qβ coat protein in complex with the RNA operator of the replicase gene.

Science.gov (United States)

Rumnieks, Janis; Tars, Kaspars

2014-03-06

The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein-RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA. © 2013.

The presence of cucumber mosaic virus in pot marigold (Calendula officinalis L. in Serbia

Directory of Open Access Journals (Sweden)

Milošević Dragana

2015-01-01

Full Text Available During 2014 a total of 67 pot marigold samples from five different localities in the Province in Vojvodina were collected and analysed for the presence of Cucumber mosaic virus (CMV and Impatiens necrotic spot virus (INSV using commercial double-antibody sandwich (DAS-ELISA kits. CMV was detected serologically in all inspected localities in 67.16% collected samples. None of the analysed samples was positive for INSV. The virus was successfully mechanically transmitted to test plants including Chenopodium amaranticolor, C. quinoa, Datura stramonium, Nicotiana tabacum 'Samsun' and N. glutinosa, as well as pot marigold seedlings, confirming the infectious nature of the disease. The presence of CMV in pot marigold plants was further verified by RT-PCR and sequencing, using the specific primers CMV CPfwd/CMVCPrev that amplify coat protein (CP gene. Phylogenetic analysis based on the CP gene sequences showed clustering of the selected isolates into three subgroups, IA, IB and II, and Serbian CMV isolates from pot marigold belong to subgroup II.

Presence and characterization of Zucchini yellow mosaic virus in watermelon in Serbia

Directory of Open Access Journals (Sweden)

Vučurović Ana

2012-01-01

Full Text Available The presence of Zucchini yellow mosaic virus (ZYMV in two out of seven watermelon production localities in Serbia during 2011 was investigated by analyzing leaves sampled from symptomatic and asymptomatic watermelon plants and utilizing DAS-ELISA test. In the locality of Gornji Tavankut, ZYMV was detected in 23.08% of tested plants in single infections, and in the locality of Silbas it was detected in 35.29% of tested plants in mixed infections with Cucumber mosaic virus and Alfalfa mosaic virus. ZYMV was successfully mechanically transmitted from naturally infected watermelon plants to Cucurbita pepo 'Ezra F1'. Molecular detection was performed by RT-PCR and amplification of part of the gene for nuclear inclusions, gene of coat protein and part of 3' non-coding region, which confirmed the identification of the ZYMV isolates. Phylogenetic analysis revealed grouping of the isolate originating from watermelon with other isolates from Serbia and Central Europe within A-I subgroup. Analysis of amino acid sequences of the N terminal end of the CP gene revealed that isolate 550-11 belongs to the Central European branch.

Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

International Nuclear Information System (INIS)

Pardun, Karoline; Treccani, Laura; Volkmann, Eike; Streckbein, Philipp; Heiss, Christian; Destri, Giovanni Li; Marletta, Giovanni; Rezwan, Kurosch

2015-01-01

Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic

Mixed zirconia calcium phosphate coatings for dental implants: Tailoring coating stability and bioactivity potential

Energy Technology Data Exchange (ETDEWEB)

Pardun, Karoline [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Treccani, Laura, E-mail: treccani@uni-bremen.de [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Volkmann, Eike [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany); Streckbein, Philipp [University Hospital, Justus-Liebig-University Giessen, Department of Cranio-Maxillo-Facial Surgery, Klinikstrasse 33, 35385 Giessen (Germany); Heiss, Christian [University Hospital of Giessen-Marburg, Department of Trauma Surgery, Rudolf-Buchheim-Strasse 7, 35385 Giessen, Germany, (Germany); Laboratory of Experimental Surgery, Kerkraderstrasse 9, 35392 Giessen (Germany); Destri, Giovanni Li; Marletta, Giovanni [Laboratory for Molecular Surfaces and Nanotechnology (LAMSUN), Department of Chemistry, University of Catania and CSGI, Viale A. Doria 6, 95125 Catania (Italy); Rezwan, Kurosch [University of Bremen, Advanced Ceramics, Am Biologischen Garten 2, 28359 Bremen (Germany)

2015-03-01

Enhanced coating stability and adhesion are essential for long-term success of orthopedic and dental implants. In this study, the effect of coating composition on mechanical, physico-chemical and biological properties of coated zirconia specimens is investigated. Zirconia discs and dental screw implants are coated using the wet powder spraying (WPS) technique. The coatings are obtained by mixing yttria-stabilized zirconia (TZ) and hydroxyapatite (HA) in various ratios while a pure HA coating served as reference material. Scanning electron microscopy (SEM) and optical profilometer analysis confirm a similar coating morphology and roughness for all studied coatings, whereas the coating stability can be tailored with composition and is probed by insertion and dissections experiments in bovine bone with coated zirconia screw implants. An increasing content of calcium phosphate (CP) resulted in a decrease of mechanical and chemical stability, while the bioactivity increased in simulated body fluid (SBF). In vitro experiments with human osteoblast cells (HOB) revealed that the cells grew well on all samples but are affected by dissolution behavior of the studied coatings. This work demonstrates the overall good mechanical strength, the excellent interfacial bonding and the bioactivity potential of coatings with higher TZ contents, which provide a highly interesting coating for dental implants. - Highlights: • Different ratios of zirconia (TZ) and calcium phosphate (CP) were deposited on zirconia substrates. • Enhancement of TZ content in mixed coatings increased coating stability. • Enhancement of CP content in mixed coatings increased bioactivity. • All tested coating compositions were non-toxic.

[Establishment of chemiluminescent enzyme immunoassay for detecting antibodies against foot-and-mouth disease virus serotype O in swine].

Science.gov (United States)

Cui, Chen; Huang, Ligang; Li, Jing; Zou, Xingqi; Zhu, Yuanyuan; Xie, Lei; Zhao, Qizu; Yang, Limin; Liu, Wenjun

2016-11-25

Recombinant structural protein VP1 of foot-and-mouth disease virus serotype O was expressed in Escherichia coli and then purified using Nickel affinity chromatography. A chemiluminescent enzyme immunoassay (CLEIA) method was established using the purified recombinant protein as coating antigen to detect antibody of foot-and-mouth disease virus serotype O in swine. The specificity of VP1-CLEIA method is 100%. The coefficients of variation in the plate and between plates are 1.10%-6.70% and 0.66%-4.80%, respectively. Comparing with the commercial indirect ELISA kit or liquid phase block ELISA kit, the calculated coincidence rate is 93.50% or 94.00%. The high specificity and stability suggested this detection method can be used to monitor the antibody level of foot-and-mouth disease virus serotype O in swine.

Antibacterial polymer coatings.

Energy Technology Data Exchange (ETDEWEB)

Wilson, Mollye C.; Allen, Ashley N.; Barnhart, Meghan; Tucker, Mark David; Hibbs, Michael R.

2009-09-01

A series of poly(sulfone)s with quaternary ammonium groups and another series with aldehyde groups are synthesized and tested for biocidal activity against vegetative bacteria and spores, respectively. The polymers are sprayed onto substrates as coatings which are then exposed to aqueous suspensions of organisms. The coatings are inherently biocidal and do not release any agents into the environment. The coatings adhere well to both glass and CARC-coated coupons and they exhibit significant biotoxicity. The most effective quaternary ammonium polymers kills 99.9% of both gram negative and gram positive bacteria and the best aldehyde coating kills 81% of the spores on its surface.

Characterization of a pepper collection (Capsicum frutescens L.) from Brazil.

Science.gov (United States)

Lima, M F; Carvalho, S I C; Ragassi, C F; Bianchetti, L B; Faleiro, F G; Reifschneider, F J B

2017-08-31

Germplasm banks are essential as sources of genetic variability for plant breeding programs. To characterize a Brazilian Capsicum frutescens collection, 21 malagueta and 5 Tabasco hot pepper accessions were evaluated under field and greenhouse conditions regarding morphological and molecular traits, as well as resistance to viruses. Morphological characterization was performed using 53 IPGRI (International Plant Genetic Resources Institute) descriptors, 15 vegetative, 13 inflorescence, 22 fruit, and 3 seed. Molecular characterization was carried out with 60 polymorphic markers from 29 RAPD primers. The incidence of major viruses infecting Capsicum spp, Tomato spotted wilt virus (TSWV), Groundnut ringspot virus (GRSV), Potato virus Y (PVY), Pepper yellow mosaic virus (PepYMV), Pepper mild mottle virus (PMMoV), and Cucumber mosaic virus (CMV) was evaluated by ELISA. Based on the average genetic distance among genotypes, six groups were defined for the 53 IPGRI descriptors. When considering only 11 quantitative traits (five vegetative and six fruit), six groups were also determined, and the traits plant canopy width (56.05%) and days to fruiting (25.07%) most explained the genetic diversity among genotypes. Molecular analysis defined five groups of accessions with partial correspondence to the morphological characterization data. The incidence of viruses in field-grown plants varied among genotypes and according to virus species, from 5.6% (GRSV; CNPH 3286) to 100% (PMMoV; CNPH2871), and indicated some accessions as potential sources of virus resistance. These results demonstrate the genetic variability within the group of 26 hot pepper accessions, as well as virus-resistant genotypes that can be used in breeding programs.

Comparison of TiC coating and TD coating in actual application

International Nuclear Information System (INIS)

Kim, S.K.; Yoo, J.K.

1995-01-01

Large blocks of SKD-11 were treated by CVD-TiC coating process, TD coating process, TD coating process after vacuum heat treating, and vacuum heat treating. Amount of deformation was measured and compared to find the process which gives the least deformation. Wear tests were carried out for specimens treated by each process. Application of CVD-TiC and TD coating to the automotive press mold was studied

Recombination every day: abundant recombination in a virus during a single multi-cellular host infection.

Directory of Open Access Journals (Sweden)

Remy Froissart

2005-03-01

Full Text Available Viral recombination can dramatically impact evolution and epidemiology. In viruses, the recombination rate depends on the frequency of genetic exchange between different viral genomes within an infected host cell and on the frequency at which such co-infections occur. While the recombination rate has been recently evaluated in experimentally co-infected cell cultures for several viruses, direct quantification at the most biologically significant level, that of a host infection, is still lacking. This study fills this gap using the cauliflower mosaic virus as a model. We distributed four neutral markers along the viral genome, and co-inoculated host plants with marker-containing and wild-type viruses. The frequency of recombinant genomes was evaluated 21 d post-inoculation. On average, over 50% of viral genomes recovered after a single host infection were recombinants, clearly indicating that recombination is very frequent in this virus. Estimates of the recombination rate show that all regions of the genome are equally affected by this process. Assuming that ten viral replication cycles occurred during our experiment-based on data on the timing of coat protein detection-the per base and replication cycle recombination rate was on the order of 2 x 10(-5 to 4 x 10(-5. This first determination of a virus recombination rate during a single multi-cellular host infection indicates that recombination is very frequent in the everyday life of this virus.

The Use of Recombinant Hemagglutinine Protein of Rinderpest Virus in Enzyme Immunoassay

OpenAIRE

BULUT, Hakan; BOLAT, Yusuf

2003-01-01

In this study, Rinderpest virus (RPV) recombinant hemagglutinine protein (rH) fused with protein A region of Staphylococcus aureus was expressed in Escherichia coli and purified by IgG affinity chromatography. rH protein was also used to establish enzyme immunoassay. Therefore, to prevent IgG binding to the protein A the wells coated with the rH proteins were blocked by human serum. Afterwards, RPV antigens were added to the wells to evaluate this assay. To this end, serum from mice immunized...

Variability of geographically distinct isolates of maize rayado fino virus in Latin America.

Science.gov (United States)

Hammond, R W; Kogel, R; Ramirez, P

1997-12-01

We have examined the molecular epidemiology of the leafhopper-borne maize rayado fino virus (MRFV) in Latin America. The coat protein gene and 3' non-translated region of 14 isolates of MRFV collected from Latin America and the United States were sequenced and phylogenetic relationships examined. The nucleotide sequence revealed remarkable conservation, with a sequence similarity of 88-99%. Phylogenetic analysis of sequence data obtained from a 633 bp fragment showed that MRFV has diverged into three main clusters, i.e. the geographically distinct northern and southern isolates and the Colombian isolates. Significant differences between the isolates collected from Colombia, previously named maize rayado colombiana virus, based upon differences in symptomatology and serological relationships to MRFV, and the other MRFV isolates, provides additional evidence supporting its designation as a unique strain of MRFV.

Effects of Bond Coating on NiCrBSi-Mo Composite Functional Coating Properties in Plasma Spraying NiCrBSi-Mo/Ni Coating

OpenAIRE

DU Ji-yu; LI Fang-yi; LU Hai-yang; SHANG Jian-tong; LI Zhen

2017-01-01

Nickel-based bond coating and composite functional coating were sprayed on leaf blade steel material FV520B successively by using air plasma spraying system. NiCrBSi-Mo powder deposition rate, coating porosity, bonding strength and surface hardness were tested. The results indicate that, for the NiCrBSi-Mo/Ni coating, bond coating with 180-220μm thickness can improve NiCrBSi-Mo powder deposition rate while the surface coating with lower porosity, higher bonding strength and high hardness is p...

O-GlcNAc modification of the coat protein of the potyvirus Plum pox virus enhances viral infection.

Science.gov (United States)

Pérez, José de Jesús; Udeshi, Namrata D; Shabanowitz, Jeffrey; Ciordia, Sergio; Juárez, Silvia; Scott, Cheryl L; Olszewski, Neil E; Hunt, Donald F; García, Juan Antonio

2013-08-01

O-GlcNAcylation is a dynamic protein modification which has been studied mainly in metazoans. We reported previously that an Arabidopsis thaliana O-GlcNAc transferase modifies at least two threonine residues of the Plum pox virus (PPV) capsid protein (CP). Now, six additional residues were shown to be involved in O-GlcNAc modification of PPV CP. CP O-GlcNAcylation was abolished in the PPV CP7-T/A mutant, in which seven threonines were mutated. PPV CP7-T/A infected Nicotiana clevelandii, Nicotiana benthamiana, and Prunus persica without noticeable defects. However, defects in infection of A. thaliana were readily apparent. In mixed infections of wild-type arabidopsis, the CP7-T/A mutant was outcompeted by wild-type virus. These results indicate that CP O-GlcNAcylation has a major role in the infection process. O-GlcNAc modification may have a role in virion assembly and/or stability as the CP of PPV CP7-T/A was more sensitive to protease digestion than that of the wild-type virus. Copyright © 2013 Elsevier Inc. All rights reserved.

In-situ phosphatizing coatings for aerospace, OEM and coil coating applications

Science.gov (United States)

Neuder, Heather Aurelia

The current metal coating process is a multi-step process. The surface is cleaned, primered, dried and then painted. The process is labor intensive and time consuming. The wash primer is a conversion coating, which prepares metal surface for better paint adhesion. The wash primers currently used often contain hexavalent chromium (Cr6+), which seals the pores in the conversion coating. The presence of hexavalent chromium, a known carcinogen, and volatile organic compounds (VOCs) make waste disposal expensive and pose dangers to workers. The novel technique of in-situ phosphatizing coating (ISPC) is a single-step, chrome-free alternative to the present coating practice. Formulation of an ISPC involves predispersal of an in-situ phosphatizing reagent (ISPR) into the paint system to form a stable formulation. The ISPR reacts with the metal surface and bonds with the paint film simultaneously, which eliminates the need for a conversion coating. In acid catalyzed paint systems, such as polyester-melamine paints, the ISPR also catalyzes cross-linking reactions between the melamine and the polyester polyols. ISPCs are formulated using commercially available coating systems including: polyester-melamine, two-component epoxy, polyurethane and high-hydroxy content polyester-melamine coil coating. The ISPCs are applied to metal substrates and their performances are evaluated using electrochemical, thermal and standard American Society for Testing and Materials (ASTM) testing methods. In addition, ISPCs were designed and formulated based on: (1) phosphate chemistry, (2) polymer chemistry, (3) sol-gel chemistry, and (4) the ion-exchange principle. Organo-functionalized silanes, which serve as excellent coupling and dispersion agents, are incorporated into the optimized ISPC formula and evaluated using standard ASTM testing methods and electrochemical spectroscopy. Also, an ion-exchange pigment, which leads to better adhesion by forming a mixed metal silicate surface, is

Thin coatings for heavy industry: Advanced coatings for pipes and valves

Science.gov (United States)

Vernhes, Luc

Pipes and valves are pressure vessels that regulate the flow of materials (liquids, gases, and slurries) by controlling the passageways. To optimize processes, reduce costs, and comply with government regulations, original equipment manufacturers (OEMs) must maintain their products in state-of-the-art condition. The first valves were invented over 3,000 years ago to supply water to farms and cities. They were made with bronze alloys, providing good corrosion resistance and acceptable tribological performance. The industrial revolution drove manufacturers to develop new and improved tribological materials. In the 20th century, innovative alloys such as Monel copper-nickel and Stellite cobalt-chrome as well as hard chrome plating were introduced to better control tribological properties and maximize in-service life. Since then, new materials have been regularly introduced to extend the range of applications for valves. For example, Teflon fluoropolymers are used in corrosive chemical and petrochemical processes, the nickel-based superalloys Hastelloy and Inconel for petrochemical applications, and creep-resistant chromium-rich F91 steel for supercritical power plants. Recently, the valve industry has embraced the use of hard thermal sprayed coatings for the most demanding applications, and is investing heavily in research to develop the most suitable coatings for specific uses. There is increasing evidence that the optimal solution to erosive, corrosive, and fretting wear problems lies in the design and manufacture of multi-layer, graded, and/or nanostructured coatings and coating systems that combine controlled hardness with high elastic modulus, high toughness, and good adhesion. The overall objectives of this thesis were 1) to report on advances in the development of structurally controlled hard protective coatings with tailored mechanical, elastoplastic, and thermal properties; and 2) to describe enhanced wear-, erosion-, and corrosion-resistance and other

Experimental exposure of pregnant mares to the asinine-94 strain of equine arteritis virus

Directory of Open Access Journals (Sweden)

J.T. Paweska

1997-07-01

Full Text Available Clinical, virological and serological responses were evaluated in 10 pregnant mares after different challenge exposures to the asinine-94 strain of equine arteritis virus (EAV. The outcome of maternal infection on the progeny was also investigated. Mares were inoculated intranasally (n = 4, intramuscularly (n = 2, intravenously (n = 1, or contact-exposed (n = 3. All inoculated mares developed pyrexia, 5 showed mild clinical signs related to EAV infection and 2 remained asymptomatic. Viraemia was detected in all the inoculated animals and shedding of virus from the respiratory tract occurred in 6. Five mares were re-challenged intranasally 7 and 15 weeks after inoculation. Clinical signs of the disease in these mares were limited to mild conjunctivitis. After re-challenge, virus was recovered from buffy coat cultures of 2 mares 2-6 days after re-infection. EAV was not recovered from colostrum and milk samples during the 1st week post partum. All inoculated mares seroconverted to EAV 8-12 days post inoculation and also seroconverted after re-challenge. No clinical signs of EAV infection were observed in the 3 mares kept in close contact during the post-inoculation and re-challenge periods. Serum neutralising antibody to the virus was detected in 1 in-contact mare only, while a detectable concentration of specific IgG was found by ELISA in the colostrum of 1 of the other in-contact mares. Eight of the mares gave birth to clinically normal foals, although 1 was born prematurely. Shortly after birth, 7 foals developed fever and variable clinical signs; 5 foals became septicaemic and 3 of them died 2-5 days after birth, while the remaining 2 were euthanased at 1 month of age. EAV was not recovered from the placenta, from buffy coat fractions of blood collected from foals immediately after birth and 1-3 days later, or from a range of tissues taken from the 3 foals that died and 2 that were euthanased. Virus was not isolated from tissues collected from

Inhibition of HIV Virus by Neutralizing Vhh Attached to Dual Functional Liposomes Encapsulating Dapivirine.

Science.gov (United States)

Wang, Scarlet Xiaoyan; Michiels, Johan; Ariën, Kevin K; New, Roger; Vanham, Guido; Roitt, Ivan

2016-12-01

Although highly active antiretroviral therapy (HAART) has greatly improved the life expectancy of HIV/AIDS patients, the treatment is not curative. It is a global challenge which fosters an urgent need to develop an effective drug or neutralizing antibody delivery approach for the prevention and treatment of this disease. Due to the low density of envelope spikes with restricted mobility present on the surface of HIV virus, which limit the antibody potency and allow virus mutation and escape from the immune system, it is important for a neutralizing antibody to form bivalent or multivalent bonds with the virus. Liposome constructs could fulfil this need due to the flexible mobility of the membrane with its attached antibodies and the capacity for drug encapsulation. In this study, we evaluated the neutralization activity of a range of liposome formulations in different sizes coated with anti-gp120 llama antibody fragments (Vhhs) conjugated via either non-covalent metal chelation or a covalent linkage. The non-covalent construct demonstrated identical binding affinity to HIV-1 envelope glycoprotein gp120 and neutralizing ability for HIV virus as free Vhh. Although covalently linked Vhh showed significant binding affinity to gp120, it unexpectedly had a lower neutralization potency. This may be due to the comparability in size of the viral and liposome particles restricting the number which can be bound to the liposome surface so involving only a fraction of the antibodies, whereas non-covalently attached antibodies dissociate from the surface after acting with gp120 and free the remainder to bind further viruses. Covalently conjugated Vhh might also trigger the cellular uptake of a liposome-virion complex. To explore the possible ability of the antibody-coated liposomes to have a further function, we encapsulated the hydrophobic antiviral drug dapivirine into both of the non-covalently and covalently conjugated liposome formulations, both of which revealed high

Inhibition of HIV Virus by Neutralizing Vhh Attached to Dual Functional Liposomes Encapsulating Dapivirine

Science.gov (United States)

Wang, Scarlet Xiaoyan; Michiels, Johan; Ariën, Kevin K.; New, Roger; Vanham, Guido; Roitt, Ivan

2016-07-01

Although highly active antiretroviral therapy (HAART) has greatly improved the life expectancy of HIV/AIDS patients, the treatment is not curative. It is a global challenge which fosters an urgent need to develop an effective drug or neutralizing antibody delivery approach for the prevention and treatment of this disease. Due to the low density of envelope spikes with restricted mobility present on the surface of HIV virus, which limit the antibody potency and allow virus mutation and escape from the immune system, it is important for a neutralizing antibody to form bivalent or multivalent bonds with the virus. Liposome constructs could fulfil this need due to the flexible mobility of the membrane with its attached antibodies and the capacity for drug encapsulation. In this study, we evaluated the neutralization activity of a range of liposome formulations in different sizes coated with anti-gp120 llama antibody fragments (Vhhs) conjugated via either non-covalent metal chelation or a covalent linkage. The non-covalent construct demonstrated identical binding affinity to HIV-1 envelope glycoprotein gp120 and neutralizing ability for HIV virus as free Vhh. Although covalently linked Vhh showed significant binding affinity to gp120, it unexpectedly had a lower neutralization potency. This may be due to the comparability in size of the viral and liposome particles restricting the number which can be bound to the liposome surface so involving only a fraction of the antibodies, whereas non-covalently attached antibodies dissociate from the surface after acting with gp120 and free the remainder to bind further viruses. Covalently conjugated Vhh might also trigger the cellular uptake of a liposome-virion complex. To explore the possible ability of the antibody-coated liposomes to have a further function, we encapsulated the hydrophobic antiviral drug dapivirine into both of the non-covalently and covalently conjugated liposome formulations, both of which revealed high

Cold-Sprayed AZ91D Coating and SiC/AZ91D Composite Coatings

Directory of Open Access Journals (Sweden)

Yingying Wang

2018-03-01

Full Text Available As an emerging coating building technique, cold spraying has many advantages to elaborate Mg alloy workpieces. In this study, AZ91D coatings and AZ91D-based composite coatings were deposited using cold spraying. Coatings were prepared using different gas temperatures to obtain the available main gas temperature. Compressed air was used as the accelerating gas, and although magnesium alloy is oxidation-sensitive, AZ91D coatings with good performance were obtained. The results show that dense coatings can be fabricated until the gas temperature is higher than 500 °C. The deposition efficiency increases greatly with the gas temperature, but it is lower than 10% for all coating specimens. To analyze the effects of compressed air on AZ91D powder particles and the effects of gas temperature on coatings, the phase composition, porosity, cross-sectional microstructure, and microhardness of coatings were characterized. X-ray diffraction and oxygen content analysis clarified that no phase transformation or oxidation occurred on AZ91D powder particles during cold spraying processes with compressed air. The porosity of AZ91D coatings remained between 3.6% and 3.9%. Impact melting was found on deformed AZ91D particles when the gas temperature increased to 550 °C. As-sprayed coatings exhibit much higher microhardness than as-casted bulk magnesium, demonstrating the dense structure of cold-sprayed coatings. To study the effects of ceramic particles on cold-sprayed AZ91D coatings, 15 vol % SiC powder particles were added into the feedstock powder. Lower SiC content in the coating than in the feedstock powder means that the deposition efficiency of the SiC powder particles is lower than the deposition efficiency of AZ91D particles. The addition of SiC particles reduces the porosity and increases the microhardness of cold-sprayed AZ91D coatings. The corrosion behavior of AZ91D coating and SiC reinforced AZ91D composite coating were examined. The Si

Hard coatings

International Nuclear Information System (INIS)

Dan, J.P.; Boving, H.J.; Hintermann, H.E.

1993-01-01

Hard, wear resistant and low friction coatings are presently produced on a world-wide basis, by different processes such as electrochemical or electroless methods, spray technologies, thermochemical, CVD and PVD. Some of the most advanced processes, especially those dedicated to thin film depositions, basically belong to CVD or PVD technologies, and will be looked at in more detail. The hard coatings mainly consist of oxides, nitrides, carbides, borides or carbon. Over the years, many processes have been developed which are variations and/or combinations of the basic CVD and PVD methods. The main difference between these two families of deposition techniques is that the CVD is an elevated temperature process (≥ 700 C), while the PVD on the contrary, is rather a low temperature process (≤ 500 C); this of course influences the choice of substrates and properties of the coating/substrate systems. Fundamental aspects of the vapor phase deposition techniques and some of their influences on coating properties will be discussed, as well as the very important interactions between deposit and substrate: diffusions, internal stress, etc. Advantages and limitations of CVD and PVD respectively will briefly be reviewed and examples of applications of the layers will be given. Parallel to the development and permanent updating of surface modification technologies, an effort was made to create novel characterisation methods. A close look will be given to the coating adherence control by means of the scratch test, at the coating hardness measurement by means of nanoindentation, at the coating wear resistance by means of a pin-on-disc tribometer, and at the surface quality evaluation by Atomic Force Microscopy (AFM). Finally, main important trends will be highlighted. (orig.)

Unraveling the Role of the C-terminal Helix Turn Helix of the Coat-binding Domain of Bacteriophage P22 Scaffolding Protein*

Science.gov (United States)

Padilla-Meier, G. Pauline; Gilcrease, Eddie B.; Weigele, Peter R.; Cortines, Juliana R.; Siegel, Molly; Leavitt, Justin C.; Teschke, Carolyn M.; Casjens, Sherwood R.

2012-01-01

Many viruses encode scaffolding and coat proteins that co-assemble to form procapsids, which are transient precursor structures leading to progeny virions. In bacteriophage P22, the association of scaffolding and coat proteins is mediated mainly by ionic interactions. The coat protein-binding domain of scaffolding protein is a helix turn helix structure near the C terminus with a high number of charged surface residues. Residues Arg-293 and Lys-296 are particularly important for coat protein binding. The two helices contact each other through hydrophobic side chains. In this study, substitution of the residues of the interface between the helices, and the residues in the β-turn, by aspartic acid was used examine the importance of the conformation of the domain in coat binding. These replacements strongly affected the ability of the scaffolding protein to interact with coat protein. The severity of the defect in the association of scaffolding protein to coat protein was dependent on location, with substitutions at residues in the turn and helix 2 causing the most significant effects. Substituting aspartic acid for hydrophobic interface residues dramatically perturbs the stability of the structure, but similar substitutions in the turn had much less effect on the integrity of this domain, as determined by circular dichroism. We propose that the binding of scaffolding protein to coat protein is dependent on angle of the β-turn and the orientation of the charged surface on helix 2. Surprisingly, formation of the highly complex procapsid structure depends on a relatively simple interaction. PMID:22879595

How baculovirus polyhedra fit square pegs into round holes to robustly package viruses.

Science.gov (United States)

Ji, Xiaoyun; Sutton, Geoff; Evans, Gwyndaf; Axford, Danny; Owen, Robin; Stuart, David I

2010-01-20

Natural protein crystals (polyhedra) armour certain viruses, allowing them to survive for years under hostile conditions. We have determined the structure of polyhedra of the baculovirus Autographa californica multiple nucleopolyhedrovirus (AcMNPV), revealing a highly symmetrical covalently cross-braced robust lattice, the subunits of which possess a flexible adaptor enabling this supra-molecular assembly to specifically entrap massive baculoviruses. Inter-subunit chemical switches modulate the controlled release of virus particles in the unusual high pH environment of the target insect's gut. Surprisingly, the polyhedrin subunits are more similar to picornavirus coat proteins than to the polyhedrin of cytoplasmic polyhedrosis virus (CPV). It is, therefore, remarkable that both AcMNPV and CPV polyhedra possess identical crystal lattices and crystal symmetry. This crystalline arrangement must be particularly well suited to the functional requirements of the polyhedra and has been either preserved or re-selected during evolution. The use of flexible adaptors to generate a powerful system for packaging irregular particles is characteristic of the AcMNPV polyhedrin and may provide a vehicle to sequester a wide range of objects such as biological nano-particles.

Anticorrosive coatings: a review

DEFF Research Database (Denmark)

Sørensen, Per Aggerholm; Kiil, Søren; Dam-Johansen, Kim

2009-01-01

of volatile organic compounds (VOCs) have caused significant changes in the anticorrosive coating industry. The requirement for new VOC-compliant coating technologies means that coating manufacturers can no longer rely on the extensive track record of their time-served products to convince consumers...... of their suitability for use. An important aspect in the development of new VOC-compliant, high-performance anticorrosive coating systems is a thorough knowledge of the components in anticorrosive coatings, their interactions, their advantages and limitations, as well as a detailed knowledge on the failure modes......, and inhibitive coatings are outlined. In the past decades, several alternatives to organic solvent-borne coatings have reached the commercial market. This review also presents some of these technologies and discusses some of their advantages and limitations. Finally, some of the mechanisms leading to degradation...

Charged-particle coating

International Nuclear Information System (INIS)

Johnson, W.L.; Crane, J.K.; Hendricks, C.D.

1980-01-01

Advanced target designs require thicker (approx. 300 μm) coatings and better surface finishes that can be produced with current coating techniques. An advanced coating technique is proposed to provide maximum control of the coating flux and optimum manipulation of the shell during processing. In this scheme a small beam of ions or particles of known incident energy are collided with a levitated spherical mandrel. Precise control of the incident energy and angle of the deposition flux optimizes the control of the coating morphology while controlled rotation and noncontact support of the shell minimizes the possibility of particulate or damage generated defects. Almost infinite variability of the incident energy and material in this process provides increased flexibility of the target designs which can be physically realized

Comparison of additive amount used in spin-coated and roll-coated organic solar cells

DEFF Research Database (Denmark)

Cheng, Pei; Lin, Yuze; Zawacka, Natalia Klaudia

2014-01-01

All-polymer and polymer/fullerene inverted solar cells were fabricated by spin-coating and roll-coating processes. The spin-coated small-area (0.04 cm(2)) devices were fabricated on indium tin oxide (ITO) coated glass substrates in nitrogen. The roll-coated large-area (1.0 cm(2)) devices were...

Chick embryo lethal orphan virus can be polymer-coated and retargeted to infect mammalian cells

Czech Academy of Sciences Publication Activity Database

Stevenson, M.; Boos, E.; Herbert, C. W.; Hale, A. B.; Green, N.; Lyons, M.; Chandler, L.; Ulbrich, Karel; van Rooijen, N.; Mautner, V.; Fisher, K.; Seymour, L.

2006-01-01

Roč. 13, č. 4 (2006), s. 356-368 ISSN 0969-7128 EU Projects: European Commission(XE) 512087 - GIANT Institutional research plan: CEZ:AV0Z40500505 Keywords : CELO virus * N-(2-hydroxypropyl)methacrylamide * retargeting Subject RIV: CE - Biochemistry Impact factor: 4.782, year: 2006

Blueberry red ringspot virus Eliminated from Highbush Blueberry by Shoot Tip Culture

Czech Academy of Sciences Publication Activity Database

Špak, Josef; Pavingerová, Daniela; Přibylová, Jaroslava; Špaková, Vlastimila; Paprštein, F.; Sedlák, J.

2014-01-01

Roč. 50, č. 4 (2014), s. 174-178 ISSN 1212-2580 Institutional support: RVO:60077344 Keywords : BRRV * in vitro * Vaccinium corymbosum L. Subject RIV: EE - Microbiology, Virology Impact factor: 0.597, year: 2014

Coated particle waste form development

International Nuclear Information System (INIS)

Oma, K.H.; Buckwalter, C.Q.; Chick, L.A.

1981-12-01

Coated particle waste forms have been developed as part of the multibarrier concept at Pacific Northwest Laboratory under the Alternative Waste Forms Program for the Department of Energy. Primary efforts were to coat simulated nuclear waste glass marbles and ceramic pellets with low-temperature pyrolytic carbon (LT-PyC) coatings via the process of chemical vapor deposition (CVD). Fluidized bed (FB) coaters, screw agitated coaters (SAC), and rotating tube coaters were used. Coating temperatures were reduced by using catalysts and plasma activation. In general, the LT-PyC coatings did not provide the expected high leach resistance as previously measured for carbon alone. The coatings were friable and often spalled off the substrate. A totally different concept, thermal spray coating, was investigated at PNL as an alternative to CVD coating. Flame spray, wire gun, and plasma gun systems were evaluated using glass, ceramic, and metallic coating materials. Metal plasma spray coatings (Al, Sn, Zn, Pb) provided a two to three orders-of-magnitude increase in chemical durability. Because the aluminum coatings were porous, the superior leach resistance must be due to either a chemical interaction or to a pH buffer effect. Because they are complex, coated waste form processes rank low in process feasibility. Of all the possible coated particle processes, plasma sprayed marbles have the best rating. Carbon coating of pellets by CVD ranked ninth when compared with ten other processes. The plasma-spray-coated marble process ranked sixth out of eleven processes

Friction surfaced Stellite6 coatings

International Nuclear Information System (INIS)

Rao, K. Prasad; Damodaram, R.; Rafi, H. Khalid; Ram, G.D. Janaki; Reddy, G. Madhusudhan; Nagalakshmi, R.

2012-01-01

Solid state Stellite6 coatings were deposited on steel substrate by friction surfacing and compared with Stellite6 cast rod and coatings deposited by gas tungsten arc and plasma transferred arc welding processes. Friction surfaced coatings exhibited finer and uniformly distributed carbides and were characterized by the absence of solidification structure and compositional homogeneity compared to cast rod, gas tungsten arc and plasma transferred coatings. Friction surfaced coating showed relatively higher hardness. X-ray diffraction of samples showed only face centered cubic Co peaks while cold worked coating showed hexagonally close packed Co also. - Highlights: ► Stellite6 used as coating material for friction surfacing. ► Friction surfaced (FS) coatings compared with casting, GTA and PTA processes. ► Finer and uniformly distributed carbides in friction surfaced coatings. ► Absence of melting results compositional homogeneity in FS Stellite6 coatings.

The Influence of Nano-Fibrillated Cellulose as a Coating Component in Paper Coating

Directory of Open Access Journals (Sweden)

Yaxi Xu

2016-03-01

Full Text Available This work investigates nano-fibrillated cellulose (NFC as a component in mineral pigment paper coating. In this work, bleached Eucalyptus pulp was pretreated by TEMPO (2,2,6,6-tetramethyl-1-piperdinyloxy-mediated oxidation. The oxidized pulp was then isolated to obtain NFC by sonication. Aqueous coating colors consisting of calcium carbonate, clay, carboxylated butadiene-styrene latex, additives, and NFC were prepared. The rheology of the coating colors and the surface properties of paper coated with NFC containing coating colors were determined. The rheological properties allowed NFC to be used in small amounts under laboratory conditions. Nano-fibrillated cellulose was found to improve the surface strength and smoothness of the coated paper. The water resistance of coated paper, on the other hand, decreased because of the hydrophilicity of NFC.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease

Directory of Open Access Journals (Sweden)

Silvie P

2008-10-01

Full Text Available Abstract Background Cotton blue disease (CBD, an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV was shown to be associated with CBD. Results To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004–2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp, and intergenic region genomic sequences. Conclusion The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease.

Science.gov (United States)

Silva, T F; Corrêa, R L; Castilho, Y; Silvie, P; Bélot, J-L; Vaslin, M F S

2008-10-20

Cotton blue disease (CBD), an important global cotton crop pathology responsible for major economic losses, is prevalent in the major cotton-producing states of Brazil. Typical CBD symptoms include stunting due to internodal shortening, leaf rolling, intense green foliage, and yellowing veins. Atypical CBD symptoms, including reddish and withered leaves, were also observed in Brazilian cotton fields in 2007. Recently, a Polerovirus named Cotton leafroll dwarf virus (CLRDV) was shown to be associated with CBD. To understand the distribution and genetic diversity of CLRDV in Brazil, we analyzed 23 CBD-symptomatic plants from susceptible cotton varieties originating from five of the six most important cotton-growing states, from 2004-2007. Here, we report on CLRDV diversity in plants with typical or atypical CBD symptoms by comparing viral coat protein, RNA polymerase (RdRp), and intergenic region genomic sequences. The virus had a widespread distribution with a low genetic diversity; however, three divergent isolates were associated with atypical CBD symptoms. These divergent isolates had a CLRDV-related coat protein but a distinct RdRp sequence, and probably arose from recombination events. Based on the taxonomic rules for the family Luteoviridae, we propose that these three isolates represent isolates of a new species in the genus Polerovirus.

Thermal Stability of RNA Phage Virus-Like Particles Displaying Foreign Peptides

Directory of Open Access Journals (Sweden)

Peabody David S

2011-05-01

Full Text Available Abstract Background To be useful for genetic display of foreign peptides a viral coat protein must tolerate peptide insertions without major disruption of subunit folding and capsid assembly. The folding of the coat protein of RNA phage MS2 does not normally tolerate insertions in its AB-loop, but an engineered single-chain dimer readily accepts them as long as they are restricted to one of its two halves. Results Here we characterize the effects of peptide insertions on the thermal stabilities of MS2 virus-like particles (VLPs displaying a variety of different peptides in one AB-loop of the coat protein single-chain dimer. These particles typically denature at temperatures around 5-10°C lower than unmodified VLPs. Even so, they are generally stable up to about 50°C. VLPs of the related RNA phage PP7 are cross-linked with intersubunit disulfide bonds and are therefore significantly more stable. An AB-loop insertion also reduces the stability of PP7 VLPs, but they only begin to denature above about 70°C. Conclusions VLPs assembled from MS2 single-chain dimer coat proteins with peptide insertions in one of their AB-loops are somewhat less stable than the wild-type particle, but still resist heating up to about 50°C. Because they possess disulfide cross-links, PP7-derived VLPs provide an alternate platform with even higher stability.

Thermal stability of double-ceramic-layer thermal barrier coatings with various coating thickness

International Nuclear Information System (INIS)

Dai Hui; Zhong Xinghua; Li Jiayan; Zhang Yanfei; Meng Jian; Cao Xueqiang

2006-01-01

Double-ceramic-layer (DCL) coatings with various thickness ratios composed of YSZ (6-8 wt.% Y 2 O 3 + ZrO 2 ) and lanthanum zirconate (LZ, La 2 Zr 2 O 7 ) were produced by the atmospheric plasma spraying. Chemical stability of LZ in contact with YSZ in DCL coatings was investigated by calcining powder blends at different temperatures. No obvious reaction was observed when the calcination temperature was lower than 1250 deg. C, implying that LZ and YSZ had good chemical applicability for producing DCL coating. The thermal cycling test indicate that the cycling lives of the DCL coatings are strongly dependent on the thickness ratio of LZ and YSZ, and the coatings with YSZ thickness between 150 and 200 μm have even longer lives than the single-layer YSZ coating. When the YSZ layer is thinner than 100 μm, the DCL coatings failed in the LZ layer close to the interface of YSZ layer and LZ layer. For the coatings with the YSZ thickness above 150 μm, the failure mainly occurs at the interface of the YSZ layer and the bond coat

The C terminus of the polerovirus p5 readthrough domain limits virus infection to the phloem.

Science.gov (United States)

Peter, Kari A; Gildow, Frederick; Palukaitis, Peter; Gray, Stewart M

2009-06-01

Poleroviruses are restricted to vascular phloem tissues from which they are transmitted by their aphid vectors and are not transmissible mechanically. Phloem limitation has been attributed to the absence of virus proteins either facilitating movement or counteracting plant defense. The polerovirus capsid is composed of two forms of coat protein, the major P3 protein and the minor P3/P5 protein, a translational readthrough of P3. P3/P5 is required for insect transmission and acts in trans to facilitate long-distance virus movement in phloem tissue. Specific potato leafroll virus mutants lacking part or all of the P5 domain moved into and infected nonvascular mesophyll tissue when the source-sink relationship of the plant (Solanum sarrachoides) was altered by pruning, with the progeny virus now being transmissible mechanically. However, in a period of months, a phloem-specific distribution of the virus was reestablished in the absence of aphid transmission. Virus from the new phloem-limited infection showed compensatory mutations that would be expected to restore the production of full-length P3/P5 as well as the loss of mechanical transmissibility. The data support our hypothesis that phloem limitation in poleroviruses presumably does not result from a deficiency in the repertoire of virus genes but rather results from P3/P5 accumulation under selection in the infected plant, with the colateral effect of facilitating transmission by phloem-feeding aphid vectors.

The C Terminus of the Polerovirus P5 Readthrough Domain Limits Virus Infection to the Phloem▿

Science.gov (United States)

Peter, Kari A.; Gildow, Frederick; Palukaitis, Peter; Gray, Stewart M.

2009-01-01

Poleroviruses are restricted to vascular phloem tissues from which they are transmitted by their aphid vectors and are not transmissible mechanically. Phloem limitation has been attributed to the absence of virus proteins either facilitating movement or counteracting plant defense. The polerovirus capsid is composed of two forms of coat protein, the major P3 protein and the minor P3/P5 protein, a translational readthrough of P3. P3/P5 is required for insect transmission and acts in trans to facilitate long-distance virus movement in phloem tissue. Specific potato leafroll virus mutants lacking part or all of the P5 domain moved into and infected nonvascular mesophyll tissue when the source-sink relationship of the plant (Solanum sarrachoides) was altered by pruning, with the progeny virus now being transmissible mechanically. However, in a period of months, a phloem-specific distribution of the virus was reestablished in the absence of aphid transmission. Virus from the new phloem-limited infection showed compensatory mutations that would be expected to restore the production of full-length P3/P5 as well as the loss of mechanical transmissibility. The data support our hypothesis that phloem limitation in poleroviruses presumably does not result from a deficiency in the repertoire of virus genes but rather results from P3/P5 accumulation under selection in the infected plant, with the colateral effect of facilitating transmission by phloem-feeding aphid vectors. PMID:19297484

Plant viruses as scaffolds for the presentation of vaccine epitopes

Czech Academy of Sciences Publication Activity Database

Plchová, Helena; Čeřovská, Noemi; Vaculík, Petr; Moravec, Tomáš

2017-01-01

Roč. 61, č. 1 (2017), s. 1-12 ISSN 0006-3134 R&D Projects: GA ČR(CZ) GA15-10768S; GA ČR(CZ) GAP501/12/1761 Grant - others:European Regional Development Fund(XE) CZ.2.16/3.1.00/24014 Institutional support: RVO:61389030 Keywords : tobacco-mosaic-virus * x coat protein * human-papillomavirus type-16 * green fluorescent protein * n-terminal segment * triple gene block * cell-to-cell * transient expression * nicotiana-benthamiana * viral vector * transient expression * plant viral expression vectors Subject RIV: GE - Plant Breeding OBOR OECD: Virology Impact factor: 1.551, year: 2016

Quality of Coated Particles : Physical - Mechanical Characterization of Polymeric Film Coatings

NARCIS (Netherlands)

Perfetti, G.

2012-01-01

All coated particle producers, when applying the coating layer(s) would like to know precisely what is the best coating system to use in order to answer customer’s requests. It is, therefore, of very high relevance for many industries, to have a clear understanding of what are the parameters I need

Flow accelerated organic coating degradation

Science.gov (United States)

Zhou, Qixin

Applying organic coatings is a common and the most cost effective way to protect metallic objects and structures from corrosion. Water entry into coating-metal interface is usually the main cause for the deterioration of organic coatings, which leads to coating delamination and underfilm corrosion. Recently, flowing fluids over sample surface have received attention due to their capability to accelerate material degradation. A plethora of works has focused on the flow induced metal corrosion, while few studies have investigated the flow accelerated organic coating degradation. Flowing fluids above coating surface affect corrosion by enhancing the water transport and abrading the surface due to fluid shear. Hence, it is of great importance to understand the influence of flowing fluids on the degradation of corrosion protective organic coatings. In this study, a pigmented marine coating and several clear coatings were exposed to the laminar flow and stationary immersion. The laminar flow was pressure driven and confined in a flow channel. A 3.5 wt% sodium chloride solution and pure water was employed as the working fluid with a variety of flow rates. The corrosion protective properties of organic coatings were monitored inline by Electrochemical Impedance Spectroscopy (EIS) measurement. Equivalent circuit models were employed to interpret the EIS spectra. The time evolution of coating resistance and capacitance obtained from the model was studied to demonstrate the coating degradation. Thickness, gloss, and other topography characterizations were conducted to facilitate the assessment of the corrosion. The working fluids were characterized by Fourier Transform Infrared Spectrometer (FTIR) and conductivity measurement. The influence of flow rate, fluid shear, fluid composition, and other effects in the coating degradation were investigated. We conclude that flowing fluid on the coating surface accelerates the transport of water, oxygen, and ions into the coating, as

Experimental evaluation of coating delamination in vinyl coated metal forming

International Nuclear Information System (INIS)

Son, Young Ki; Lee, Chan Joo; Kim, Byung Min; Lee, Jung Min; Byoen, Sang Doek; Lee, Soen Bong

2012-01-01

In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications

Experimental evaluation of coating delamination in vinyl coated metal forming

Energy Technology Data Exchange (ETDEWEB)

Son, Young Ki; Lee, Chan Joo; Kim, Byung Min [Pusan National Univ., Busan (Korea, Republic of); Lee, Jung Min [Korea Institute of Industrial Technology, Busan (Korea, Republic of); Byoen, Sang Doek [HA Digital Engineering Gr., Seongsan Gu (Korea, Republic of); Lee, Soen Bong [Keimyung Univ., Daegu (Korea, Republic of)

2012-10-15

In this paper, a new evaluation and prediction method for coating delamination during sheet metal forming is presented. On the basis of the forming limit diagram (FLD), the current study evaluates the delamination of PET coating by using a cross cut specimen, dome test, and rectangular cup drawing test. Dome test specimens were subjected to biaxial, plane strain, and uniaxial deformation modes. Rectangular cup drawing test specimens were subjected to the deep drawing deformation mode, and compression deformation mode. A vinyl coated metal (VCM) sheet consists of three layers of polymer on the sheet metals: a protective film, a PET layer and a PVC layer. The areas with coating delamination were identified, and the results of the evaluation were plotted according to major and minor strain values, depicting coating delamination. The constructed delamination limit diagram (DLD) can be used to determine the forming limit of VCM during the complex press forming process. ARGUS (GOM) was employed to identify the strain value and deformation mode of the delaminated surface after the press forming. After identifying the areas of delamination, the DLD of the PET coating can be constructed in a format similar to that of the FLD. The forming limit of the VCM sheet can be evaluated using the superimposition of the delamination limit strain of the coating onto the FLD of VCM sheet. The experimental results showed that the proposed test method will support the sheet metal forming process design for VCM sheets. The assessment method presented in this study can be used to determine the delamination limit strain under plastic deformation of other polymer coated metals. The experimental results suggested that the proposed testing method is effective in evaluating delamination for specific applications.

Genetic structure and evidence of putative Darwinian diversifying selection in the Potato yellow vein virus (PYVV

Directory of Open Access Journals (Sweden)

Giovanni Chaves-Bedoya

2013-08-01

Full Text Available The population structure and genetic variation of Potato yellow vein virus (PYVV were estimated by analysis of the nucleotide and deduced amino acid sequence of the coat protein of 69 isolates, reported in GenBank, from Solanum tuberosum (ST and Solanum phureja (SP hosts from different regions; predominantly Cundinamarca, Antioquia and Nariño, located in central and southwestern Colombia. Bioinformatics analysis revealed that despite the wide geographic distribution of different hosts and different collecting years, PYVV maintains a genetic similarity between 97.1 to 100.0%, indicating high spatial and temporal genetic stability of the major coat protein. No recombination events were found, but evidence was seen for the first time that this protein could be undergoing Darwinian diversifying selection

ATHENA optimized coating design

DEFF Research Database (Denmark)

Ferreira, Desiree Della Monica; Christensen, Finn Erland; Jakobsen, Anders Clemen

2012-01-01

The optimization of coating design for the ATHENA mission si described and the possibility of increasing the telescope effective area in the range between 0.1 and 10 keV is investigated. An independent computation of the on-axis effective area based on the mirror design of ATHENA is performed...... in order to review the current coating baseline. The performance of several material combinations, considering a simple bi-layer, simple multilayer and linear graded multilayer coatings are tested and simulation of the mirror performance considering both the optimized coating design and the coating...

Preparation of sustained release capsules by electrostatic dry powder coating, using traditional dip coating as reference.

Science.gov (United States)

Yang, Yan; Shen, Lian; Yuan, Feng; Fu, Hui; Shan, Weiguang

2018-05-30

Lately, a great deal of attention is being paid to capsule coating, since the coat protects active pharmaceutical ingredients (APIs) from damage, as is in the case of tablet and pellet. However, moisture and heat sensitivity of gelatin shells make it challenging to coat capsules using the conventional aqueous coating techniques. In an effort to overcome this challenge, the present study aims to coat capsules using two different coating techniques: electrostatic dry powder coating (EDPC) and dip coating (DC). Both capsule coatings and free films were prepared by these two coating techniques, and the effects of coating formulations and processing conditions on the film quality were investigated. The corresponding drug in vitro release and mechanisms were characterized and compared. The results of dissolution tests demonstrated that the drug release behavior of both EDPC and DC coated capsules could be optimized to a sustained release of 24 h, following the Fick's diffusion law. The results of this study suggest that EDPC method is better than DC method for coating capsules, with respect to the higher production efficiency and better stability, indicating that this dry coating technology has promised in gelatin capsule coating applications. Copyright © 2018 Elsevier B.V. All rights reserved.